RU2737775C1 - Method for identifying yersinia pestis and yersinia pseudotuberculosis and simultaneous differentiation of yersinia pestis of main and central asian subspecies by multiplex pcr - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of biotechnology. Invention is a method for identifying strains of Y. pestis and Y. pseudotuberculosis and simultaneous differentiation of Y. pestis strains by their affiliation to main or Central Asian subspecies by polymerase chain reaction with electrophoretic or hybridization-fluorescence counting of results in real time, which involves multiplex PCR with primers and probes on DNA targets Pestis-Pseudo, 45 and CA-509, having sequence SEQ ID NO: 1–7, identification of Y. pestis and Y. pseudotuberculosis strains and differentiation of Y. pestis strains of the main and Central Asian subspecies by presence/absence and size of formed PCR fragments or presence/absence of fluorescence signals with said primers in accordance with the table.

EFFECT: invention provides effective and reliable identification of Yersinia pestis and Yersinia pseudotuberculosis strains and simultaneous differentiation of Yersinia pestis strains of the main and Central Asian subspecies.

2 cl, 1 tbl, 6 ex

Description

The invention relates to medical microbiology, in particular, to the identification of Yersinia pestis and Yersinia pseudotuberculosis, molecular typing and subspecies differentiation of Yersinia pestis and can be used in research and practical institutions of Rospotrebnadzor.

The bacterium Y. pestis is the causative agent of a particularly dangerous infection - the plague, which can lead to emergencies in the field of public health [International Health Regulations, WHO, 2005]. Y. pestis is one of the evolutionary branches of the bacterium Y. pseudotuberculosis, widespread in soil, which can cause acute intestinal infections. The identity of the nucleotide sequence of genes-homologues of both bacteria Y. pestis and Y. pseudotuberculosis is 97-99%, and the 16S rRNA gene is 100%. Despite the high degree of similarity, these pathogens cause diseases that differ in the pathways of infection, pathogenesis and clinical manifestations. Plague is a systemic disease and is transmitted primarily through a transmissible route, while pseudotuberculosis is clinically manifested as various gastroenteritis and is transmitted by the fecal-oral route. At the same time, Y. pestis and Y. pseudotuberculosis are similar in phenotypic and genetic properties.

The species Y. pestis includes the main subspecies Y. pestis subspecies pestis, which is characterized by high virulence and epidemiological significance, and a number of minor subspecies, which are epidemically insignificant. Minor subspecies strains are selectively virulent against small rodents and lagomorphs, however, most of them are capable of causing cases of plague in humans. An exception is the strains of the Central Asian subspecies Y. pestis subspecies central asiatica, for which cases of plague in humans have not been registered. The Central Asian subspecies is divided into four biovars - Altai, Gissar, Talas and microtus, which are common in the Central Asian zone of natural plague foci. Strains of the Central Asian subspecies circulate in Gorny Altai in Russia and Mongolia (Altai biovar), in Tajikistan (Hissar biovar), in Kyrgyzstan (Talas biovar), in Mongolia and China (microtus biovar). In the same geographic regions, Y. pestis strains of the main subspecies, highly virulent to humans, are widespread, and enteropathogenic Y. pseudotuberculosis strains are also found. These pathogenic Yersinia cause diseases of various degrees of danger to humans, therefore, the differentiation of Y. pestis and Y. pseudotuberculosis and the differentiation of the main and Central Asian subspecies of the plague pathogen is an urgent task. Establishing the belonging of the isolated Y. pestis strain to the main or Central Asian subspecies will make it possible to assess its virulent and epidemiological potential, determine its origin and establish the source of infection. An extremely urgent task is the development of highly effective and sensitive methods for the rapid identification and differentiation of pathogenic Yersinia strains that cause diseases of various severity in humans.

The modern level of molecular genetic research methods makes it possible to develop fast and effective methods for the indication and differentiation of Y. pestis and other infectious agents based on polymerase chain reaction (PCR), which are highly efficient, sensitive and reliable. For these purposes, PCR with electrophoretic and hybridization-fluorescent recording of results in real time is used. Currently, several methods have been developed for identifying and differentiating strains of the plague pathogen using PCR.

The "GenPest" test system for detecting Yersinia pestis DNA by PCR was registered. This system is based on the use of DNA targets - regions of the cafl and pla genes located on the pFra and pPst plasmids of the plague pathogen, respectively. However, this test system is not intended for intraspecific differentiation and identification of strains of the Central Asian subspecies and Y. pseudotuberculosis strains.

A known method of express diagnostics of bacteria of the genus Yersinia, which is based on the method of multiplex PCR with subsequent analysis of the lengths of amplified fragments of the gene porin - OmpF (patent RU 2385941, publ. 10.04.2010). The method allows simultaneous detection and differential diagnosis of pathogenic and non-pathogenic Yersinia species, as well as species identification of species pathogenic for humans: Y. pestis, Y. pseudotuberculosis and Y. enterocolitica. However, this method is not intended for carrying out subspecies differentiation of Y. pestis strains.

Intraspecific differentiation of strains of the plague pathogen is described in the patent (RU No. 2425891, published on 08/10/2011). Using this method, it is possible to separate the Y. pestis and Y. pseudotuberculosis strains with further differentiation of the Y. pestis strains according to their belonging to the main and minor subspecies. At the same time, this method does not provide for the identification of Y. pestis strains of the Central Asian subspecies.

A known method of differentiation of biovars and genovariants of Y. pestis strains of the main subspecies using the polymerase chain reaction (patent RU No. 2565554, published on 20.10.2015). The method provides for the separation of antique, medieval biovars of the main subspecies of the plague pathogen, as well as phylogenetic lines 1.ANT / 1.ORI and 2.ANT / 2.MED of the main subspecies. However, the method is not suitable for establishing the belonging of Y. pestis strains to the Central Asian subspecies and for identifying Y. pseudotuberculosis strains.

A method for subspecies differentiation of strains of the plague pathogen by the method of polymerase chain reaction with hybridization-fluorescent recording of results in real time has been published (Patent RU No. 2621869, published on 07.06.2017). The method provides separation of the main, Caucasian, Altai, Gissar and Ulegei subspecies, but does not solve the problem of identifying Y. pestis strains and Y. pseudotuberculosis strains.

The known method of subspecies differentiation of strains of the causative agent of plague by the method of polymerase chain reaction (Patent RU No. 2552611, published 10.06.2015). The method provides for DNA isolation, PCR using designed primers for amplification of fragments of intergenic regions wzyE-dapF and YPDF_0064-YPDSF_0065 of the strain under study. Differentiation is carried out by comparing the sizes of the obtained amplicons of the studied strain with the sizes of similar fragments characteristic of the strains of the main (151 bp and 374 bp), Caucasian (185 bp and 434 bp), Altai and Hissar strains. (202 bp and 374 bp), as well as the Ulegey (185 bp and 374 bp) subspecies. EFFECT: invention makes it possible to effectively carry out subspecies differentiation of Y. pestis strains and significantly reduce the analysis time. However, the method is not suitable for determining the belonging of strains to Y. pseudotuberculosis or Y. pestis, and to the Central Asian subspecies of Y. pestis.

There is a known method of differentiation of Yersinia pestis strains of the main and non-main subspecies by real-time PCR (RU 2642273, publ. 01.24.2018). The method provides for the isolation of chromosomal DNA from the test material, setting up PCR with specific primers and allele-specific probes and taking into account the results obtained. The method provides separation of Y. pestis of the main and non-main subspecies, but does not solve the problem of differentiation of strains of Y. pestis of the Central Asian subspecies and strains of Y. pseudotuberculosis

There is a method of subspecies differentiation of strains of the plague pathogen by sequencing (RU 2404256, publ. 20.11.2010), which provides for the amplification of fragments of the rhaS and araC genes, as well as the determination of their nucleotide sequences. The genotype of the investigated strain is established by the nucleotides located in positions 482, 494, 671 of the rhaS gene and 773 of the araC gene. The subspecies belonging of the strain is determined by comparing its genotype with the known genotypes of Y. pestis strains. However, this method does not allow differentiation of strains of the main and Central Asian subspecies of Y. pestis and identification of the species Y. pseudotuberculosis.

Also known is a method of subspecies differentiation of Y. pestis strains by the method of multilocus sequence typing (RU 2415948, publ. 04/10/2011), providing for the determination of nucleotide sequences of a number of life support genes (rhaS, araC, metB, aspA, thiH) using sequencing technologies. The genotype of the investigated strain is established by the nucleotides located at positions 482, 494, 671 of the rhaS gene, at position 773 of the araC gene, at positions 988 and 989 of the metB gene, at positions 1087-1089 of the aspA gene and 552 of the thiH gene. By the alleles of the genes rhaS, agaC, metB, aspA and thiH, the sequence type (ST) of the Y. pestis strain is determined with its subsequent subspecies differentiation by comparing with the sequence types of the main and non-main subspecies. These methods with the use of sequencing technology make it possible to determine the subspecies belonging of strains of the plague pathogen, however, they are laborious, expensive, and also require appropriate technical equipment and special training of researchers.

In the scientific and special literature there are no other data on the methods of identification of Y. pestis and Y. pseudotuberculosis, and the differentiation of strains of Y. pestis of the Central Asian and main subspecies from other subspecies and biovars of the plague pathogen by the method of multiplex PCR with electrophoretic or hybridization-fluorescence recording of results in real time.

The technical result of the invention is to provide highly efficient and reliable identification of Y. pestis and Y. pseudotuberculosis strains, with simultaneous differentiation of Y. pestis strains of the main and Central Asian subspecies by multiplex PCR with electrophoretic or hybridization-fluorescent recording of results in real time.

The technical result is achieved by the method of identifying strains of Y. pestis and Y. pseudotuberculosis, and the simultaneous differentiation of strains of Y. pestis of the main and Central Asian subspecies by the method of multiplex polymerase chain reaction, which provides for multiplex PCR in one stage in one reaction mixture with primers and electrophoretic accounting of the results ( PCR-EF) or primers and probes in the TaqMan format with hybridization-fluorescent registration of results in real time (PCR-RT) on the target: "Pestis-Pseudo" for Y. pestis and Y. pseudotuberculosis strains, "45" for Y strains pestis of the main subspecies, "CA-509" for Y. pestis strains of the Central Asian subspecies, having the sequence: SEQ ID NO: 1-7 with identification of Y. pestis and Y. pseudotuberculosis strains and differentiation of Y. pestis strains of the main and Central Asian subspecies by size formed by PCR fragments and by the presence and absence of signals with the indicated primers in accordance and with a table.

The DNA targets used are located in the following regions of the Y. pestis genome: "Pestis-Pseudo" at position 3025402-3025654 intergenic space between the AK38_2746 gene encoding carbohydrate kinase and the AK38_2747 gene encoding a hypothetical transcription regulator protein, "45" at position 2579997-2580134 ilvB-ilvN genes encoding acetolactate synthase, "CA-509" in position 2351984-2351475 of the YPO2071 gene, which presumably encodes DEAD box-helicase. The names of genes and genomic regions, their coordinates are given for the genome of the Y. pestis CO92 strain, accession number in NCBI GenBank NC_003143.1.

The identification of Y. pestis and Y. pseudotuberculosis by PCR-EF with primers on the Pestis-Pseudo target is based on the presence of a 110 bp marker insertion. in the chromosomal locus of plague strains. Pseudotuberculosis strains lack this insertion.

The identification of Y. pestis and Y. pseudotuberculosis by RT-PCR with primers and probes on the Pestis-Pseudo target is based on the presence of a marker SNP, for which two variants of the probe containing the LNA link are designed: one variant is specific for the nucleotide characteristic of Y. pestis and the other for Y. pseudotuberculosis.

Target "45" - provides identification of strains of the main subspecies by the presence of a marker deletion in the chromosomal locus of 45 bp. The CA-509 target allows identification of the Central Asian subspecies by the presence of a 509 bp deletion in the chromosomal locus.

The inventive method is carried out as follows.

Multiplex polymerase chain reaction is carried out using the proposed primers and probes on the target "Pestis-Pseudo", "45", "CA-509". Oligonucleotide primers used for amplification in PCR with electrophoretic recording of results, as well as oligonucleotide primers and probes used for amplification in PCR with hybridization-fluorescent recording of results in real time, on the target "Pestis-Pseudo", "45", "CA -509 "are calculated based on the nucleotide sequences of these regions in the strains Y. pestis CO92, KIM, Antiqua, Nepal516, 91001, Y. pseudotuberculosis IP32953, the nucleotide sequences of which are presented in the NCBI GenBank database. Using these primers in PCR-EF, these regions are amplified in one step in one reaction mixture. To carry out multiplex PCR-RT in one stage in one reaction mixture, probes in the TaqMan format are used and the following reaction conditions (common for PCR-EF and PCR-RT) are used: 1 cycle 95 ° C 2 min; 35 cycles 95 ° C 10 s, 59 ° C 50 s.

The belonging of the isolated DNA to the species Y. pestis or Y. pseudotuberculosis, as well as the simultaneous differentiation of Y. pestis of the main or Central Asian subspecies, is established by the result of the multiplex reaction carried out in accordance with the table.

When carrying out PCR with electrophoretic accounting of the results with primers on the DNA target "Pestis-Pseudo" in the species Y. pestis, an amplicon of 253 bp is found. (due to the presence of a 110 bp insertion in this target DNA in Y. pestis). In the species Y. pseudotuberculosis and other species, an amplicon with a size of 253 bp in electrophoretic recording of the results on the DNA of the target "Pestis-Pseudo" is not formed. When electrophoretic accounting of the results with primers on the Pestis-Pseudo target DNA in the species Y. pseudotuberculosis, an amplicon of 143 bp is formed, in other species such an amplicon is not formed due to the absence of homologous genome regions for hybridization of oligonucleotide primers to the Pestis target DNA -Pseudo ". Electrophoretic recording of the results with primers for target DNA "45" in strains of the species Y. pestis (except for the main subspecies Y. pestis), Y. pseudotuberculosis, an amplicon of 183 bp was found. In the main subspecies Y. pestis, the size of amplicons with primers on the target "45" is 138 bp in electrophoretic recording of the results. In the species Y. pestis of the Central Asian subspecies with primers for DNA, the target “CA-509” does not have amplicons upon electrophoretic recording of the results; in the species of Y. pestis (except for the Central Asian subspecies Y. pestis) and Y. pseudotuberculosis there are amplicons of 157 bp.

When performing PCR with hybridization-fluorescent accounting of results in real time, there is a fluorescence signal for the Pestis-Pseudo target with the Pestis-P probe in the species Y. pestis. During hybridization-fluorescence accounting of the results in the species Y. pseudotuberculosis, a fluorescence signal is detected by the Pestis-Pseudo target with the Pseudo-P probe. In other species, due to the lack of specific nucleotide sequences for hybridization of oligonucleotide primers and probes to the Pestis-Pseudo target, the fluorescence signal is not detected.

In the strains of the main subspecies Y. pestis, there is no fluorescence signal for the target "45", since the DNA probe designed for this target is complementary to the site of the 45 bp deletion, which is a marker for the strains of the main subspecies. In the species Y. pestis (except for the main subspecies Y. pestis) and Y. pseudotuberculosis, a fluorescent signal is detected at the target "45". The Central Asian subspecies Y. pestis lacks a fluorescence signal for the CA-509 target, since the primers and probe designed for this DNA target are complementary to the 509 bp deletion site, which is a marker for the Central Asian subspecies. In the species Y. pseudotuberculosis, a fluorescent signal is detected at the CA-509 target.

The essence of the invention is confirmed by the following examples.

Example 1. Identification of Y. pestis and differentiation of the main subspecies by the method of multiplex PCR with electrophoretic consideration of the results (model experiment).

Isolation of the DNA of the test sample is carried out using commercial kits for DNA isolation. Multiplex PCR is carried out with primers designed for the target DNA "Pestis-Pseudo", "45", "CA-509". The following results are obtained. An amplicon of 253 bp is present in electrophoretic recording of the results. on the Pestis-Pseudo target, an amplicon of 138 bp is formed. on target "45" and an amplicon of 157 bp. on the target "CA-509". Therefore, the investigated strain belongs to the Y. pestis species, the main subspecies.

Example 2. Identification of Y. pestis and differentiation of the Central Asian subspecies by multiplex PCR with electrophoretic recording of the results.

The study of the isolated DNA is carried out analogously to example No. 1. Multiplex PCR is carried out with primers designed for the target DNA "Pestis-Pseudo", "45", "CA-509". The following results are obtained. An amplicon of 253 bp is detected during electrophoretic recording of the results. on the "Pestis-Pseudo" target, there is an amplicon of 183 bp. on target "45" and there is no 157 bp amplicon. on the target "CA-509". Therefore, the investigated strain belongs to the species Y. pestis, a Central Asian subspecies.

Example 3. Identification of Y. pseudotuberculosis by multiplex PCR with electrophoretic recording of the results.

The study of the isolated DNA is carried out analogously to example No. 1. Multiplex PCR is carried out with primers designed for the target DNA "Pestis-Pseudo", "45", "CA-509". The following results are obtained. An amplicon of 143 bp is present in electrophoretic recording of results. on the "Pestis-Pseudo" target, there is an amplicon of 183 bp. target "45" and there is a 157 bp amplicon. on the target "CA-509". Therefore, the investigated strain belongs to the species Y. pseudotuberculosis.

Example 4. Identification of Y. pestis and differentiation of the main subspecies by multiplex PCR with hybridization-fluorescent registration of results in real time.

The study of the isolated DNA is carried out analogously to example No. 1. Multiplex PCR is carried out with primers and probes designed for the target DNA "Pestis-Pseudo", "45", "CA-509". The following results are obtained. With hybridization-fluorescent registration of results in real time, there is a fluorescence signal for the Pestis-Pseudo target with a Pestis-P probe, there is no fluorescence signal for the 45 target and there is a signal for the CA-509 target. Therefore, the investigated strain belongs to the Y. pestis species, the main subspecies.

Example 5. Identification of Y. pestis and differentiation of the Central Asian subspecies by multiplex PCR with hybridization-fluorescent registration of results in real mode.

The study of the isolated DNA is carried out analogously to example No. 1. Multiplex PCR is carried out with primers and probes designed for the target DNA "Pestis-Pseudo", "45", "CA-509". The following results are obtained. With hybridization-fluorescent registration of results in real time, a fluorescence signal appears for the Pestis-Pseudo target with a Pestis-P probe, there is a fluorescence signal for the 45 targets and there is no signal for the CA-509 target. Therefore, the investigated strain belongs to the species Y. pestis, a Central Asian subspecies.

Example 6. Identification of Y. pseudotuberculosis by multiplex PCR with hybridization-fluorescence recording of results in real time.

The study of the isolated DNA is carried out analogously to example No. 1. Multiplex PCR is carried out with primers and probes designed for the target DNA "Pestis-Pseudo", "45", "CA-509". The following results are obtained. When hybridization-fluorescent registration of results in real time, there are signals on the target "Pestis-Pseudo" with the probe Pseudo-P, "45" and "CA-509". Therefore, the investigated strain belongs to the species Y. pseudotuberculosis.

Thus, the claimed method for the identification of Y. pestis and Y. pseudotuberculosis strains and the simultaneous differentiation of Y. pestis strains of the main and Central Asian subspecies using multiplex PCR with electrophoretic or hybridization-fluorescent accounting of the results using targets "Pestis-Pseudo", "45" "CA-509" allows you to quickly and efficiently identify strains belonging to the species Y. pestis and Y. pseudotuberculosis, and differentiate strains of the plague pathogen of the main and Central Asian subspecies.

Sequences of primers and probes

SEQ ID NO: 1

Pestis-Pseudo-S - GTCTTTGCCGCCGATATTAT

Pestis-Pseudo-As - CTGGCGGAATTAGACGTG

SEQ ID NO: 2

Pestis-P - Cy5-GGTTTATTTAA ( C-LNA ) ( T-LNA ) ( G-LNA ) TTCT-RTQ2

SEQ ID NO: 3

Pseudo-P-ROX-GGCTTATTTAA ( C-LNA ) ( G-LNA ) ( G-LNA ) TTCT-RTQ2;

SEQ ID NO: 4

45-S - GTGGATGAGAAAGTTTACCC

45-As - ATCACACCTGGATGGTTAC

SEQ ID NO: 5

45-P R6G-ACTCAGCAAGCATCTGCTCAACATG-RTQ1;

SEQ ID NO: 6

CA-509-S - CGGACTGGGTAATAACAAG

CA-509-As - CCCGTTGTCTGTTTCTGA

SEQ ID NO: 7

CA-509-P - FAM-TAGCCCTAAGCGCAACGTGAA-RTQ1

Claims (2)

1. Method for identification of Yersinia pestis and Yersinia pseudotuberculosis and simultaneous differentiation of Yersinia pestis strains of the main and Central Asian subspecies by multiplex PCR method, involving PCR with electrophoretic recording of the results in one stage, using primers SEQ ID NO: 1, 4, 6 in one reaction mixture on target DNA “Pestis-Pseudo”, “45”, “CA-509” with subsequent identification of Y. pestis and Y. pseudotuberculosis species and differentiation of main and Central Asian subspecies of Y. pestis by amplicon size: on DNA target “Pestis-Pseudo »The presence of the amplicon 143 bp. characteristic of the species Y. pseudotuberculosis, and the presence of an amplicon of 253 bp. typical for the species Y. pestis; the presence of an amplicon of 138 bp. the DNA target "45" is typical for the main subspecies Y. pestis; the Central Asian subspecies Y. pestis is characterized by the absence of an amplicon on the CA-509 DNA target. 2. Method for identification of Yersinia pestis and Yersinia pseudotuberculosis and simultaneous differentiation of Yersinia pestis strains of the main and Central Asian subspecies by multiplex PCR method, which involves PCR with hybridization-fluorescent registration of results in real time in one stage with primers and probes SEQ ID NO: 1 in one reaction mixture on the target DNA "Pestis-Pseudo", "45", "CA-509" with subsequent identification of Y. pestis and Y. pseudotuberculosis species and differentiation of the main and Central Asian subspecies of Y. pestis by the presence and absence of a fluorescence signal: for species Y. pestis is characterized by the presence of a signal on the target "Pestis-Pseudo" with primers SEQ ID NO: 1 and probe SEQ ID NO: 2; for the main subspecies Y. pestis is characterized by the absence of a signal on the target "45" with primers SEQ ID NO: 4 and probe SEQ ID NO: 5; the Central Asian subspecies Y. pestis is characterized by the absence of a signal on the target "CA-509" with primers SEQ ID NO: 6 and probe SEQ ID NO: 7; Y. pseudotuberculosis is characterized by a signal on the target "Pestis-Pseudo" with primers SEQ ID NO: 1 and probe SEQ ID NO: 3.

Images