RU2551764C2 - METHOD FOR DETECTING TUBERCULOUSIS MYCOBACTERIA OF GENETIC CLUSTER Beijing B0/W148 - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, namely to a method for identifying tuberculosis mycobacteria of cluster Beijing B0/W148. A polymerase chain reaction is conducted for amplification of M. tuberculosis DNA fragments with selected primers P1, P2 and P3, sequences of which are presented by SEQ ID NO 1, 2, 3, respectively in the amplification mode of 98°C - 10 minutes, 30 cycles: 98°C - 30 sec, 64°C - 30 sec, 72°C - 50 sec, 72°C - 10 min, 4°C. The amplification products are separated by electrophoresis in 2% agarose gel. If the fragment of 1,021 base pairs is produced, the strain of tuberculosis mycobacteria of cluster Beijing B0/W148 is detected.

EFFECT: presented invention enables fast and high-specificity identification of tuberculosis mycobacteria of cluster Beijing B0/W148.

3 dwg

Description

FIELD OF THE INVENTION

The present invention relates to molecular biology, medicine, including phthisiology, and can be used for laboratory determination of Mycobacterium tuberculosis belonging to the Beijing B0 / W148 cluster.

State of the art

Among the genetic families isolated within the species Mycobacterium tuberculosis, representatives of the Beijing genotype, found in more than half of tuberculosis patients, are of particular importance for Russia. This family was first described in 1992-1994 in the Beijing region of China. In turn, the B0 / W148 cluster is the most common variant of the Beijing genotype in Russia [Mokrousov I. et al. Mycobacterium tuberculosis population in northwestern Russia: an update from Russian-EU / Latvian border region // PLoS One. 2012; 7 (7): e41318]. Representatives of this cluster prevail in patients with severe forms of tuberculosis, demonstrate high virulence [B. Vishnevsky. et al. Virulence of Mycobacterium tuberculosis // Problems of Tuberculosis. - 2002a. - No. 10. - S. 33-36] and transmissivity [Mokrousov I et al. Mycobacterium tuberculosis Beijing genotype in Russia: in search of informative variable-number tandem-repeat loci // J Clin Microbiol. 2008 Nov; 46 (11): 3576-84], association with drug resistance [Toungoussova O. et al. Spread of drug-resistant Mycobacterium tuberculosis strains of the Beijing genotype in the Archangel Oblast, Russia // J. Clin. Microbiol. - 2002. - Vol. 40. - P. 1930-1937]. The current tuberculosis epidemic in Russia is largely associated with the active spread of resistant strains of the B0 / W148 family in the population immunized with BCG. Thus, the timely detection of strains of this cluster is an important component in the diagnosis of tuberculosis and is essential for the selection of an adequate treatment.

To date, about a dozen different technologies have been developed for molecular genetic typing of mycobacteria, but three are most widely used: spoligotyping, analysis of the number of tandem repeats at different loci of the genome (from the English Variable Number of Tandem Repeats, VNTR) and analysis of length polymorphism restriction fragments IS6110 (from the English Restriction Fragment Length Polymorphisms IS6110, IS6110-RFLP).

The spoligotyping method (spacer Oligonucleotide Typing) consists in determining the structure of the M. tuberculosis genetic region (DR region), which consists of several tens of repeating sequences and gaps (spacers) unique in their nucleotide composition [Kamerbeek J. et al. Simultaneous detection and strain differentiation of Mycobacterium tuberculosis for diagnosis and epidemiology // J Clin Microbiol. 1997 Apr; 35 (4): 907-14]. The method requires polymerase chain reaction (PCR) and subsequent DNA hybridization with unique spacer sequences deposited on the membrane in a special device (mini-blotter) and detection of chemiluminescence signals on a photosensitive film. This method allows us to determine the Beijing genotype, however, it does not allow us to establish belonging to the B0 / W148 cluster.

Another typing method based on amplification technologies is the analysis of the number of tandem repeats. This method is based on estimating the length of the PCR reaction product (minisatellite analysis, English Variable Number of Tandem Repeats Typing, VNTR-typing). The most typical pattern for the B0 / W148 cluster according to 24 locus typing (s154, s580, s960, s1644, s2059, s2531, s2687, s2996, s3007, s3192, s4348, s802, s2165, s2461, s577, s2163, s4052, s452 , s1955, s2347, s2401, s3171, s3690) is presented as 244233352644425173353723, where the numbers indicate the number of repeats at a certain locus [Mokrousov I. Insights into the Origin, Emergence, and Current Spread of a Successful Russian Clone of Mycobacterium tuberculosis // Clin. Microbiol. Rev 2013 Apr; 26 (2): 342-360]. However, there is already evidence that this pattern can be modified, and thus this method for determining the representatives of the B0 / W148 cluster is of little use [Mokrousov I. Insights into the Origin, Emergence, and Current Spread of a Successful Russian Clone of Mycobacterium tuberculosis // Clin. Microbiol. Rev 2013 Apr; 26 (2): 342-360].

Currently, to detect strains of the B0 / W148 family, the IS6110-RFLP typing method (from the Restriction Fragment Length Polymorphisms IS6110) is used, based on a hybridization analysis of length polymorphism of restriction DNA fragments containing the insertion element IS6110. This method is an analogue of the proposed invention. An approach was proposed in 1993 by van Embden and colleagues [Van Embden J. et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology // J. Clin. Microbiol. -1993. -Vol. 31. -P. 406-409]. The method is based on the determination of the number and localization in the M. tuberculosis genome of a small (about 1350 bp) mobile genetic element — the insertion sequence IS6110 with the PvuII restriction site [Thierry D. et al. IS6110, an IS-like element of Mycobacterium tuberculosis complex // NAR. -1990. -Vol. 18 (1). -P. 188]. Fragments of IS6110 are distributed randomly in the ring chromosome of M. tuberculosis, and their number can vary from 0 to 26 copies per genome. During PvuII restriction enzyme treatment, the genomic DNA of M. tuberculosis breaks up into several fragments, the number and length of which depends on the number of IS6110 elements and their localization in the MTB genome. Fragments are separated by gel electrophoresis and visualized by Southern blot hybridization with labeled probes complementary to the IS6110 sequence. Thus, for each strain, a unique hybridization pattern is obtained. The pattern characteristic of representatives of the B0 / W148 cluster is shown in Figure 1. However, the method has a number of serious drawbacks that impede its widespread use in laboratory practice. A number of problems are associated with the complexity of the technique itself, the need to use a large amount of bacterial mass, and the duration of the analysis procedure (up to 40 days). Like many other gel electrophoretic analysis techniques, IS6110-RFLP typing is characterized by the complexity of processing the results.

The objective of the invention is to develop a method for the rapid and unambiguous detection of M. tuberculosis genotype Beijing B0 / W148.

Disclosure of invention

The task of identifying mycobacterium tuberculosis of the Beijing B0 / W148 cluster is achieved through the use of a polymerase chain reaction for amplification of M. tuberculosis DNA fragments with primers P1 5'-GTGTTGTACATTGGGCATCG-3 ', P2 5'-GGTGTACATATCGAAGCTCG-3' and P3 5'GTGATCGA-CTGATCGA-CTGATCGA-CTGATCGA-TCGATCGA-TCGATCGA-CTCG-3 ' the sequences of which are represented by SEQ ID NO: 1, 2, 3, respectively, in the amplification mode 98 ° C for 10 min, 30 cycles: 98 ° C for 30 s, 64 ° C for 30 s, 72 ° C for 50 s, 72 ° C for 10 min, 4 ° C, by separation of amplification products by electrophoresis in a 2% agarose gel to obtain a fragment of 1021 bp for Beijing B0 / W148 strains or 320 bp for strains tammov not related to this family.

For the amplification reaction, primers are used, selected during the analysis of the results of the whole genome sequencing of 40 strains of various genetic families endemic to Russia (GenBank No. SRA061654). Amplification is carried out in a single tube using primers P1, P2 and P3, the sequences of which are represented by SEQ ID NO: 1, 2, 3, respectively. The invention is illustrated by drawings.

Brief Description of the Drawings

Figure 1. Characteristic profile of IS6110-RFLP strains belonging to the Beijing B0 / W148 cluster. The restriction profile of laboratory strain 14323 was selected as a marker.

Figure 2. Scheme of PCR and the location of the primers P1, P2 and P3. Blocks indicate genome regions. The arrows indicate the position of the primers. Blocks II and IV of the representatives of the Beijing B0 / W148 cluster are inverted and rearranged.

Figure 3. Examples of electrophoresis of amplification products of strains of Mycobacterium tuberculosis cluster Beijing B0 / W148, Beijing and other genetic families. M, molecular weight marker "100 bp DNA ladder".

The implementation of the invention

1) Isolation of genomic DNA

Isolation of the total genomic DNA of M. tuberculosis is carried out according to the method of van Embden et al. [Van Embden J. et al. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology // J Clin Microbiol., 1993.31 (2): p. 406-9.]. The M. tuberculosis cells obtained during cultivation on Lowenstein-Jensen nutrient medium are collected by microbiological loops into 1.5 ml tubes (Eppendorf type) containing 500 μl TE buffer. Thermal inactivation of cells is carried out at 90 ° C for 30 minutes. The resulting suspension was centrifuged at 6000 g for 3 minutes, followed by removal of the supernatant. 100 μl of 20 mg / ml lysozyme was added to the precipitate, followed by incubation for 1 hour at 37 ° C. Then 150 μl of a solution containing 10% dodecyl sulfate sodium (SDS)) (140 μl) and proteinase K (10 mg / ml) (10 μl) are added. Shake with stirring and incubate at 65 ° C for one hour. Next, 100 μl of 5M NaCl is added to the tube. Subsequently, 1 volume of phenol / chdoroform (1: 1 ratio) was added, mixed vigorously and centrifuged for 10 min at 14,900 g. The upper phase is transferred to a clean tube without affecting the lower phase and interphase. 1.5 volumes of 96% ethyl alcohol (-20 ° C) are added to the aqueous phase and gently mixed. Incubated overnight at -20 ° C or 1 hour at -70 ° C. Subsequently, DNA is precipitated by centrifugation for 15 min at 14,900 g. 400 μl of 70% ethyl alcohol (-20 ° C) was added to the precipitate. Centrifuge for 5 minutes at 14,900 g. The supernatant is removed and the resulting DNA is dissolved in 30 μl of TE buffer. Further storage of chromosomal DNA samples is carried out at -20º C. The obtained DNA is used for PCR.

2) Amplification of fragments of the M. tuberculosis genome

The amplification material is pure DNA. Amplification of DNA fragments is carried out by PCR using three primers: P1 GTGTTGTACATTGGGCATCG, P2 GGTGTACATATCGAAGCTCG and P3 GCTCGACGAAGTGAGATTGC. As a control, the DNA of a typical Beijing B0 / W148 strain is used. Purified DNA (0.5 μl) was added to the PCR mixture (final volume 25 μl) containing 66 mM Tris-HCl (pH = 9.0); 16.6 mM (NH4) 2SO4; 2.5 mM MgCl2, 250 μM each of deoxyribonucleoside triphosphates (dNTPs), 1 U Taq polymerase (LITEH, Russia) and 20 pmol of primers P1, P2 and P3. The reaction is carried out in a DNA Engine Tetrad 2 thermocycler (MJ Research, USA) under conditions adapted for the maximum yield of PCR product: 98 ° C for 10 min, 30 cycles: 98 ° C for 30 s, 64 ° C for 30 s, 72 ° С - 50 s, 72 ° С - 10 min, 4 ° С - storage. PCR products (5 μl) were separated by electrophoresis on a 1.5% agarose gel and visualized on a UV transilluminator.

The indicated primers were selected based on the results of genome sequencing of 40 M. tuberculosis strains endemic for Russia (GenBank No. SRA061654). The method is arranged in such a way that when a sample with the Beijing B0 / W148 genotype is present in the reaction mixture, primers P1 and P2 are activated. In this case, the P3 primer is not involved in amplification. In turn, if there are representatives of other genotypes in the system, amplification proceeds from primers P1 and P3 (Figure 2).

To assess the specificity of the selected primers, a comparative analysis of the nucleotide sequences was carried out with the GenBank database using the BLAST program. It was found that there are no cross-reactions when using these primers with DNA from other types of microorganisms and humans.

3) Evaluation of the results

If a Beijing B0 / W148 strain is present in the sample, the PCR product is a bright band represented by an amplified DNA fragment of 1021 bp; in the case of any other genotype, a 320 bp fragment is obtained (Figure 3). Fragment lengths are determined by comparison with a molecular weight marker (e.g., 100bp ladder) or directly by comparison with the profile of amplified fragments of the control strain of the Beijing B0 / W148 genotype.

The proposed method for detecting M. tuberculosis strains belonging to the Beijing B0 / W148 cluster was tested on a collection of 60 samples of genomic DNA of M. tuberculosis strains isolated at the St. Petersburg Research Institute of Epidemiology and Microbiology named after Pasteur and the Moscow City Scientific and Practical Center for the Fight against Tuberculosis. For the presented collection, spoligotyping, IS6110-RFLP typing and typing by the described method were carried out. According to spoligotyping, 35 samples belonged to the Beijing genotype. Of these, 18 samples, according to IS6110-RFLP typing, were identified as Beijing B0 / W148. For the same 18 samples tested using the proposed method, a band in the region of 1021 bp of the marker was identified during PCR, which corresponds to the identification of the Beijing B0 / W148 cluster. A band of 320 bp was identified for 42 DNA samples, which is consistent with the results obtained using classical typing methods. This method has a number of significant advantages, such as speed of execution and the possibility of simultaneous analysis of a large collection of samples, unambiguous interpretation of the results, simple equipment for standard PCR and gel electrophoresis. The developed method is quite affordable in a specialized laboratory and takes less than a day, which is significantly faster compared to the IS6110-RFLP method. Thus, the proposed method provides high sensitivity and specificity for determining strains of mycobacterium tuberculosis of the Beijing B0 / W148 genotype.

Sequence listing

     SEQUENCE LISTING

<110> Federal State Budgetary Institution of Science

       "Research Institute of Physical and Chemical Medicine

       Federal Biomedical Agency "

<120> A method for detecting mycobacterium tuberculosis genetic

       cluster Beijing B0 / W148

<130>

<140>

<141> 2013-07-03

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer P1 for ampliification of Mycobacterium tuberculosis genome fragment

<400> 1

gtgttgtaca ttgggcatcg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer P2 for ampliification of Mycobacterium tuberculosis genome fragment

<400> 2

ggtgtacata tcgaagctcg 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer P3 for ampliification of Mycobacterium tuberculosis genome fragment

<400> 3

gctcgacgaa gtgagattgc 20

Claims (1)

A method for identifying mycobacterium tuberculosis of the Beijing B0 / W148 cluster, characterized in that a polymerase chain reaction is used to amplify M. tuberculosis DNA fragments with selected primers P1, P2 and P3, the sequences of which are represented by SEQ ID NO 1, 2, 3, respectively, in the mode amplification 98 ° C - 10 min, 30 cycles: 98 ° C - 30 s, 64 ° C - 30 s, 72 ° C - 50 s, 72 ° C - 10 min, 4 ° C, separation of amplification products is carried out by electrophoresis in 2 % agarose gel, in the case of obtaining a fragment of 1021 bp, the strain of Mycobacterium tuberculosis cluster Beijing B0 / W148 is determined.

Images