RU2157406C2 - NEW GROWTH/DIFFERENTIATION FACTOR OF TGF-β-FAMILY - Google Patents

Abstract

FIELD: molecular biology. SUBSTANCE: invention relates to the novel growth/differentiation factor of TGF-β-family and coding its DNA sequences. Invention involves mature protein site and if necessary other functional regions of nucleotide sequence indicated in SEQ ID NO,1, vector containing copy of DNA molecule by p. 1, cell-host transformed by DNA by p. 1, protein expressed by other cells, method of its preparing, pharmaceutical compositions including this protein and polyclonal antibodies raised to this protein. Invention ensures to obtain DNA sequences that encode the novel members of proteins of TGF-β-family showing osteogenic properties. EFFECT: new factor indicated above, improved method of preparing, valuable medicinal properties. 9 cl, 3 tbl, 2 dwg

Description

 The present invention relates to a new growth / differentiation factor for the TGF-β family and its DNA sequences coding for it.

 TGF-β family of growth factors, which include related BMP, TGF and inhibin proteins / Poberts and Sporn, Handbook of Experimental Pharmacology, 95 (1990), 419-472 /, is particularly relevant for a wide range of medical treatment methods and applications. These factors are useful in methods that relate to wound healing and tissue regeneration. Further, some members of the TGF-β family induce tissue growth, especially bone growth, and therefore play a central role in inducing the development of cartilage and bone.

 Wozney / Progress in Growth Fact or Research, 1, (1989), 267-280 and Vale et al. / Handbook of Experimental Pharmacology 95 (1990), 211-248 / describe various growth factors, such as, for example, are related to the BMP group (bone-morphogenetic proteins) and the inhibin group. Members of these groups have significant structural similarities. A protein precursor consists of an amino-terminal signal sequence, a propeptide and carboxy-terminal sequence of approximately 110 amino acids, which is cleaved from the precursor and is a mature protein. Further, its members are determined by the homology of amino acid sequences. The mature protein contains highly conserved sequences, especially seven cysteine residues, which are conserved in family members. TGF-β-like proteins are multifunctional, hormone-active growth factors. They also have related biological activities, such as chemotactic attraction of cells, promoting cell differentiation and tissue-inducing abilities, such as cartilage and bone-inducing abilities. US Pat. No. 5,013,649 discloses DNA sequences that encode osteoinductive proteins designated as BMP-2, and BMP proteins BMP-1 and BMP-3 are known from US patent applications N 179101 and N 170197. Further, many types of cells are able to synthesize TGF-β-like proteins, and almost all cells contain TGF-β-receptors.

 In general, these proteins differ in their structure, which leads to significant variations in their exact biological function. Further, they are in a wide area of various types of tissues and stages of development. Therefore, they may have differences with respect to their exact function, for example, the necessary cellular physiological environment (environment), their life expectancy, their location, their need for auxiliary factors and their resistance to destruction. So, although numerous proteins are described that have tissue inductive potential, especially osteoinductive potential, their natural tasks in the body and - more importantly - their medical applicability still need to be investigated in detail. It is very likely that there are still unknown members of the TGF-β family that are important for osteogenesis or for differentiation / induction of other tissue types. The great difficulty in isolating these new TGF-β-like proteins, however, lies in the fact that their functions cannot yet be accurately described for the development of biological analysis in order to recognize them. On the other hand, the expected homology of nucleotide sequences for known members of the family is too small to allow screening using classical nucleic acid hybridization methods. However, the further isolation and characterization of new TGF-β-like proteins is necessary in order to obtain other differentiation and induction proteins that satisfy all the desired medical requirements. These factors can find application in medicine in the treatment (healing) of injuries and in the treatment of degenerative diseases of bones and / or other types of tissues, such as the kidney or liver.

 PCT / EP 93/00350 discloses the nucleotide and amino acid sequences for the TGF-β-protein of MP-52, the sequence corresponding to the mature peptide and the majority of the sequence corresponding to the propeptide MP-52. The complete sequence of the MP-52 propeptide is not disclosed.

 The object of the present invention is to obtain DNA sequences that encode new members of the TGF-β-protein family with mitogenic and / or differentiatively inductive, for example, osteoinductive, potential. In particular, the object of the present invention is to obtain the complete DNA and amino acid sequence of the MPG 52 TGF protein.

This problem is solved thanks to a DNA molecule that encodes a protein of the TGF-β family and includes:
(a) a portion (region) encoding a mature protein and, if necessary, other functional parts of the nucleotide sequence indicated in SEQ ID NO 1;
(b) the corresponding sequence from paragraph (a) within the framework of the degeneration of the genetic code, the nucleotide sequence;
(c) an allelic derivative corresponding to the sequences of (a) and (b) a nucleotide sequence; or
(d) hybridizing with one of the sequences (a), (b) or (c) a sequence;
under the assumption that the DNA molecule according to paragraph (d) contains at least one part encoding a mature protein of the TGF-β family.

 Other embodiments of the present invention relate to the subject of claims 2-10. Further features and advantages of the invention follow from the description of preferred embodiments and drawings. The protocols (diagrams) of sequences and drawings are briefly described below.

 SEQ ID NO 1 shows the complete nucleotide sequence of a DNA encoding the TGF-β-protein MP-52. ATG - The start codon begins with nucleotide 640. The "start" of a mature protein begins after nucleotide 1782.

 SEQ ID NO 2 shows the complete amino acid sequence of the TGF-β-protein MP-52, which is derived from the nucleotide sequence specified in SEQ ID NO 1. The sequences of SEQ ID NO1 and SEQ ID NO2 are shown in the graphic part.

In FIG. 1 shows a comparison of the amino acid sequence of MP-52 with some members of the BMP protein family with the start of the first of the seven remaining cysteine residues. The ^* sign indicates that the amino acid is the same in all compared proteins; the + sign indicates that the amino acid coincides in at least one of the proteins compared to MP-52.

 In FIG. 2 shows the nucleotide sequences of oligonucleotide primers that are used in the present invention, and a comparison of these sequences with known members of the TGF-β family. M is A or C; S is C or G; R is A or G; and K is G or T, "2a" is the OD primer sequence; "2b" denotes the sequence of the OID primer.

 The present invention encompasses at least the coding for the mature protein part and, if necessary, the functional part of the nucleotide sequence indicated in SEQ ID NO 1, as well as the sequences that correspond to this sequence within the framework of the degeneracy of the genetic code, and allelic derivatives of such sequences. Further, the present invention also encompasses sequences that hybridize to such sequences, under the assumption that such a DNA molecule contains a portion encoding a mature protein of the TGF-β family.

 The term "functional part" in the sense of the present invention refers to a part of a protein which is able to act, such as, for example, a part of a signal peptide, propeptide or mature protein, i.e. perform at least one of the biological functions of the natural parts of the MP-52 protein.

 The region encoding the mature portion of the protein extends from nucleotides 1783-2142 of the sequence indicated in SEQ ID NO 1. If necessary, the DNA molecule may also contain functional parts of the sequence indicated in SEQ ID NO 1, namely, the nucleotide sequences encoding the signal and / or propeptide part. Particularly preferably, the DNA molecule contains a sequence of the signal and propeptide part and part of the mature protein, i.e., nucleotides 640-2142 of the sequence indicated in SEQ ID NO 1. On the other hand, the DNA molecule, along with the mature protein coding part, may also contain functional signal and / or propeptide parts of other proteins, in particular other proteins of the TGF-β family, for example, the aforementioned BMP proteins. The corresponding nucleotide sequences can be represented from the above references, the disclosure of which is referred to here.

 Further, the present invention also includes a DNA molecule, such as the one indicated above, which further comprises a non-coding intronon sequence between nucleotides 1270 and 1271 of the sequence indicated in SEQ ID NO 1. This intron sequence is contained in the plasmid SKL 52 (H3) MP 12 deposited in DSM, which has the genomic nucleic acid sequence MP-52.

 The invention also encompasses phage encoded λ15. 1 cDNA sequence of MP-52 protein. This sequence begins with nucleotide 321 specified in SEQ ID NO 1 sequence.

 Although the allelic, degenerate and hybridizing sequences that are included in the present invention have structural differences based on minor changes in the nucleotide and / or amino acid sequence, the proteins encoded by these sequences have essentially the same useful properties that make them possible to use in principle for the same medical applications.

According to the present invention, the designation "hybridization" represents the usual hybridization conditions, preferably conditions with a salt concentration of 6 x SSC at 62-66 ^o C, followed by 1 hour washing with 0.6 x SSC, 0.1 % SDS, at 62-66 ^° C. The term “hybridization” is particularly preferred for stringent hybridization conditions with a salt concentration of 4 x SSC at 62-66 ^° C., followed by 1 hour washing with 0.1 x SSC, 0.1% SDS, at 62-66 ^° C.

 Preferred embodiments of the present invention are DNA sequences, as described above, which are obtained from vertebrates, preferably mammals, such as pigs, cows and rodents, such as rats or mice, and especially primates, such as people.

 A particularly preferred embodiment of the present invention is that indicated in SEQ ID NO 1 and designated as MP-52 sequence. MP-52 transcripts are derived from embryonic tissue and encode a protein that exhibits significant amino acid homology with respect to the mature portion of BMP-like proteins (see FIG. 1). The protein sequences BMP 2 (= BMP 2A) and BMP 4 (= BMP 2B) are described by Wozney et al., Science, 242 (1988), 1528-1534. The corresponding sequences of BMP 5, BMP 6 and BMP 7 are described by Celeste et al., Proc. Natl. Acad Sci. USA, 87, (1990), 9843-9847. Some typical sequence homology that is specific for known BMP sequences are also found in the propeptide portion of MP-52, while other portions of the MP-52 precursor have significant differences with BMP precursors.

 The next subject of the present invention is a vector that contains at least one copy of the proposed according to the invention DNA molecule. In such a vector, the DNA sequence of the invention is preferably operably linked to an expression control sequence. Such vectors are suitable for producing TGF-β-like proteins in stably or temporarily transformed cells. Various systems of animals, plants, fungi and bacteria can be used for transformation and subsequent cultivation. The vectors of the invention preferably contain the sequences necessary for replication in the host cell and are autonomously replicable. Further, it is preferable to use vectors that contain selectable marker genes, whereby transformation of the host cell can be proved.

 Another subject of the invention is a host cell that has been transformed with the DNA of the invention or of the vector of the invention. Examples of suitable host cells include various eukaryotic and prokaryotic cells, such as, for example, E. coli, insect cells, plant cells, mammalian cells and fungi, such as yeast.

 A further subject of the invention is a protein of the TGF-β family, which is encoded by the DNA sequence of claim 1. The protein according to the invention preferably contains the amino acid sequence indicated in SEQ ID NO 2 or, if necessary, its functional parts and has biological properties, such as tissue inductive, especially osteoinductive, and / or mitogenic abilities, which may be suitable for therapeutic use. The above protein features may vary depending on the formation of homodimers or heterodimers. Such structures may also be suitable for clinical applications.

 The biological properties of the proteins according to the invention, in particular the mitogenic and osteoinductive potential, can be determined, for example, by testing according to Seyedin et al., PNAS, 82 (1985), 2267-2271; or Sampath and Reddi, PNAS, 78 (1981), 7599-7603.

 Another subject of the present invention is a method for producing a protein of the TGF-β family, which is characterized in that the host cell transformed with the DNA according to the invention or the vector according to the invention is cultured and the TGF-β protein is obtained from the cell and / or supernatant after cultivation. Such a method involves culturing the transformed host cell in a suitable nutrient medium and purifying the resulting TGF-β-like protein. Thus, the method allows to obtain a sufficient amount of the desired protein for use in medical treatment or in those applications where methods using cell culture are used in which growth factors are necessary. The host cell may be a bacterium, such as, for example, Bacillus or E. coli; mushroom, usually yeast; a plant cell, such as tobacco, potato or Arabidopsis; or an animal cell, in particular a vertebrate cell line, such as, for example, an MO, COS or CHO cell line; or insect cell line.

 Another further subject of the present invention is the preparation of pharmaceutical compositions which comprise a pharmaceutically effective amount of the TGF-β-protein of the invention as a biologically active substance. If necessary, such a composition includes a pharmaceutically acceptable carrier, excipient, diluent or excipient. Such a pharmaceutical composition can be used in wound healing and tissue regeneration, as well as in the treatment of damage to bones, cartilage, connective tissues, skin, mucous membrane, epithelium or teeth and in the case of dental implants, either individually or in combination with other biologically active substances, for example, with other proteins of the TGF-β family or growth factors, such as EGF (epidermal growth factor) or PDGF (platelet-derived growth factor). Further, such a pharmaceutical composition can be used to prevent disease, such as, for example, to prevent osteoporosis and arthrosis.

 Another possible clinical application of the TGF-β-protein according to the invention is the use of an immune response as a suppressor to avoid organ transplant rejection or use in connection with antigenesis. The pharmaceutical composition according to the invention can also be used for prophylaxis or in cosmetic surgery. Further, the use of the composition is not limited to humans, but it can also be used in the case of animals, especially domestic animals.

Finally, a further subject of the invention is an antibody that can specifically bind to the proteins of the invention, or an antibody fragment of this kind (for example, Fab or Fab ¹ ). Methods for producing such a specific antibody or antibody fragment are within the general specialist knowledge of a person skilled in the art. Preferably, such an antibody is a monoclonal antibody. Such antibodies or antibody fragments may also be suitable for diagnostic methods.

 Further, the invention should be more apparent due to the following example.

Example 1
Isolation of MP-52
1.1. Complete RNA was isolated from human embryonic tissue (aged 8–9 weeks) by the method of Chirgwin et al., Biochemistry, 18 (1979), 5294-5299. Poly (A +) - RNA is separated from total RNA by oligo (dT) chromatography according to the manufacturer's instructions (Stratagene Poly (A) Quick Column).

1.2. For the reverse transcription reaction, 1-2.5 μg of poly (A +) - RNA is heated at 65 ^° C for 5 minutes and quickly cooled with ice. The reaction mixture contains 27 u RNA - Guard (Pharmacia), 2.5 μg oligo (dT) 12-18 (Pharmacia), 5 x buffer (250 mmol / L TRIS / HCl, pH 8.5; 50 mmol / L MgCl ₂ ; 50 mmol / L DTT (dithiothreitol); 5 mmol / L of any dNTP (deoxynucleoside triphosphate); 600 mmol / L KCl) and 20 units. AMV reverse transcriptase (Boehringer Mannheim) per 1 μg poly (A +) - RNA. The reaction mixture (25 μl) was incubated for 2 hours at 42 ^o C.

 1.3. Referring to FIG. 2 deoxynucleotide primers OD and OID are obtained on an automatic DNA synthesizer (Biosearch). The purification is carried out by denaturing polyacrylamide gel electrophoresis and isolating the main strip from the gel by isotachophoresis. By comparing the nucleic acid sequences of known members of the TGF-β family and selecting regions with the highest conservation, oligonucleotides are designed. A comparison of these areas is shown in FIG. 2. To facilitate cloning, both nucleotides contain EcoRI restriction sites and the OD additionally contains an NcoI restriction site at its 5'-end.

1.4. In the case of the polymerase chain reaction (PCR reaction), 20 ng of the corresponding poly (A +) - RNA cDNA from the starting material is used. The reaction is carried out in a volume of 50 μl, and it contains 1 x PCR buffer (16.6 mmol / L (NH ₄ ) ₂ SO ₄ ; 67 mmol / L TRIS / HCl, pH 8.8; 2 mmol / L MgCl ₂ ; 6.7 μmol / L EDTA, 10 mmol / L β-mercapto-ethanol; 170 μg / ml bovine serum albumin (Gibco); 200 μmol / L any dNTP (Pharmacia); 30 pmol each oligonucleotide (OD and OID) and 1.5 units of Taq polymerase (AmpliTaq, Perkin Elmer Cetus). The reaction mixture is coated with paraffin and 40 cycles of polymerase chain reaction are carried out. Products of the polymerase chain (PCR) reaction are purified by extraction with phenol and chloroform and concentrated by ethanol REPRESENTATIONS.

 1.5. The polymerase chain reaction product is digested with restriction enzymes SphI (Pharmacia) and ALWNI (Biolabs) according to the manufacturer's instructions.

 1.6. Restriction cleavage products are fractionated by agarose gel electrophoresis. After staining with ethidium bromide, undigested amplification products are excised from the gel and isolated by phenol extraction. The resulting DNA is then purified by double extraction with phenol and chloroform.

 1.7. After ethanol precipitation, one fourth or one fifth of the extracted DNA is re-amplified, and the same conditions as for primary amplification are used, except that the number of cycles is reduced to 13. The products of re-amplification (re-amplification) are purified, cut using the same enzymes, as described above, and uncut products, as explained above for amplification products, are isolated from agarose gels. Stage reamplification (re-amplification) is repeated twice.

1.8. After the last isolation from the gel, the amplification products are cleaved thanks to 4 units. EcoRI (Pharmacia) under manufacturer's recommended conditions. One fourth of the mixture after restriction is ligated with the EcoRI digested pBLuescriptII SK + vector (Stratagene). After ligation, 24 clones are further analyzed by sequencing. Cleaved using ALWNI and SpHI, the sample gives a new sequence, which is designated as MP-52. Other clones contain predominant BMP 6 sequences and one clone contains a BMP 7 sequence. The clone at the 3'-end is complemented with cDNA according to the method described in detail by Frohmann (Amplifications, published by Perkin-Elmer Corp., Issue 5 (1990), pp. 11-15). The same embryonic mRNA that was used to isolate the first fragment of MP-52 is subjected to reverse transcription as described above. Amplification is carried out using an adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CTTGAGTACGAGGCTTTCCACTG) of the MP-52 sequence. The amplification products are re-amplified (re-amplified) using an overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and an overlapping internal primer (GGAGCCCACGAATCATGCAGTCA) MP-52 sequence. The reamplification products, after restriction digestion with NcoI, are cloned into the same vector [pUC 19 (Pharmacia N 27-4951-01) with one modified multiplen cloning site that contains a single NcoI restriction site] and sequenced. Clones are characterized by overlapping their sequence with the 3'-end of the known MP-52 sequence. One of them is used as a probe for screening the human genomic gene bank (Stratagene No. 946203) according to the detailed method described by Ausubel et al. (Current Protocolsin Molecular Biology, published by Greene Publishing Associates und Wiley-Intersience / 1989 /). A phage (λ 2.7.4) is isolated from 8 • 10 ⁵ λ phages, which contains an insert of about 20 kb and is deposited in DSM under the number 7387. This clone, along with the sequence isolated from mRNA by the described amplification methods, contains other sequence information / Sequenzinformationen / at the 5'-end.

 For analysis by sequencing, a HindIII fragment of approximately 7.5 kb is subcloned into a vector cut in the same manner (Bluescript SK, Stratogenene N 212206). This plasmid, also designated as SKL 52 (H3) MP12, is also stored in DSM under the number 7353. The information-carrying sequence shown in SEQ ID NO 1 is derived from phage λ 2.7.4. The ATG at position 640 is the first ATG in the reading frame (a stop codon appears at position 403). Based on this sequence, we must assume that this is a starting codon for translation.

 Genomic DNA contains an intron of approximately 2 kb in length between base pairs 1270 and 1271 of SEQ ID NO 1. The sequence of the intron is not shown. The correct splicing site is confirmed by sequencing the amplification product, which is derived from cDNA containing this region. These information-carrying sequences are obtained using a slightly modified method, which is described in detail by Frohman (Amplifications, published by Perkin-Elmer-Corporation, Issue 5, (1990), pp. 11-15). The same embryonic RNA that was used to isolate the 3 ′ end of MP-52 is reverse transcribed using the internal 5′-directional primer of the MP-52 sequence (ACAGCAGGTGGGTGGTGTGGACT). The poly-A end (tail) is attached to the 5'-end of the first cDNA strand using terminal transferase. Two-stage amplification is carried out, first by applying an oligo-dT primer and an adapter sequence of primer (AGAATTCGCATGCCATGGTCGACGAAGC / T 16 /) and, secondly, by using an adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CCAGTAG-52CCCCTCCCCCTCCCCCTCCCCCCTCTCCC. Amplification products are re-amplified (re-amplified) using the same adapter primer and overlapping (overlapping) internal primer (TCCAGGGCACTAATGTCAAACACG) of the MP-52 sequence. Then, the re-amplification products are re-amplified using an overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and an overlapping internal primer (ACTAATGTCAAACACGTACCTCTG) MP-52 sequence. Smooth-end re-amplification products are cloned into a vector (Bluescript, SK, Stratagene No. 212206), which is digested with EcoRV. Clones are characterized by overlapping their sequence using DNA phage λ 2.7.4.

 Next, a cDNA bank obtained from RNA of human fibroblasts and cloned in phage λ qt 10 is subjected to screening. At the same time, 2 x 106 phages are examined, and a fragment of the genomic MP-52 DNA is used as a radioactive probe (second exon up to the HindIII restriction site in the unexposed translation of the 3'-region). Allocate 17 spots (hemolysis zones) of the mixture, which are further investigated using PCR using primers from the 5'-3'-region of the MP-52 sequence. After that, 8 sterile spots are selected and separated. cDNA was isolated from the phage by partial digestion with EcoRI and cloned in an EcoRI digest Bluescript vector.

 Sequencing of one of the resulting plasmids SK 52 L 15. IMP25 shows that the longest phage (15.1) begins with nucleotide N 321 SEQ ID K N 1. Next, the splicing site is confirmed by sequencing (nucleotide 1270).

 Plasmid SKL 52 (H3) MP 12 has been stored under number 7353 at DSM (German collection of microorganisms and cell cultures, Mascheroder Weg 1b, 38124, Braunschweig) from December 10, 1992.

 Phage λ 2.7.4. stored at 7387 at DSM from January 13, 1993

 Plasmid SK 52 L15. IMP25 has been stored under number 8421 in the DSM since July 16, 1993.

Example 2
Expression MP-52
Various systems are tested for the expression of MP-52. The use of vaccine vaccine viruses as an expression system is described in detail and as a guide for a specialist in Curren Protocols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wilay-Interscience, Wiley and Sans), hereinafter abbreviated as CP, in chapter 16, part 16.15 - 16.18. The system is based on the fact that foreign DNA, when using certain vectors by homologous recombination, can be integrated into the genome of the vaccinia virus. For this purpose, the vector used contains the TK (thymidine kinase) gene from the smallpox vaccine genome. In order to enable selection for recombinant viruses, the vector further comprises E. coli-xanthine-guanine-phosphoribosyl-transferase-gene (gpt) / Falkner et al., J. Virol. 62 (1988), 1849-18544 /. In this vector, cDNA is cloned with the entire coding region of MP-52. cDNA is derived from plasmid SK 52L15. IMP25 (DSM, number 8421), which, to remove a large portion of the undeveloped 5'-region, however, is first deleted and intermediate cloned. For this, plasmid SK 52L15. IMP25 is linearized using SalI and the 5'-end is subsequently deleted by using the ExoIII / Mung Bean kit (Stratagene # 200 330) according to the manufacturer's instructions. After restriction by BamHI, the MP-52 cDNAs that were deletion on the agarozogel to different degrees were separated from the residual vector, isolated and, according to standard methods (Sambrook et al., Molecular Cloning, 2nd edition, Colg Spring Harbor Laboratory Press, 1989) intermediate restriction cloned using EcoRV and BamHI pBLuescriptII SK vector (Stratagene # 212206) /p.SK52S/. All restriction is carried out according to the manufacturer's instructions. Additional sequencing using sequenase (USB / Amersham # 70770) yields, among other things, a clone that starts with nucleotide 576 in SEQ ID NO 1 (64 base pairs away from the start codon). From it, by restriction with SalI and SacI, the cDNA insert is isolated and cloned in the same split vector for recombination in vaccinia. The resulting plasmid (pBPIM52S) was stored in DSM (numbered 9217) from May 24, 1994 and used to produce recombinant vaccinia viruses. For this, up to 80% of confluent 14 3B cells (HuTk-, ATCC CRL 8303) in culture dishes with a diameter of 35 mm are infected with the wild-type vaccinia virus in 2 ml of PBS (phosphate buffered saline) for 30 minutes at room temperature and at shaking on occasion (1 virus per 10 cells). After suction of the supernatant and the addition, 2 ml of culture medium (MEM, Gibco BRL # 041-01095) were incubated for 2 hours at 37 ^° C. The medium was then removed and these cells were transformed with 100 ng pBPIMP52S, 2 μg DNA carrier ( calf thymus, Boehringer Mannheim # 104175) and 10 μl of lipofectin (Gibco BRL # 18292-011) in 1 ml of MEM for 15 hours at 37 ^o C. After adding 1 ml of MEM with 20% FCS (Gibco BRL # 011-06290 ) incubated for the next 24 hours at 37 ^o C and lysed cells are then frozen. gpt-Selection for xanthine-guanine-phosphoribosyl-transferase and isolation and amplification of individual recombinant viruses is carried out essentially as described in section 16.17 CP, with the difference that PK-13 cells are used (ATCC CCL 37).

The integration of MP-52 cDNA into the viral genome is confirmed by analysis using Southern blotting and dot blotting (CP, part 16.18). Recombinant virus is used for expression assays in the 143 B cell line (HuTk-, ATCC CRL, 8303, human). Confluent cells are infected using the appropriate cell number of viruses for 45 minutes at 37 ^° C and then appropriate culture medium (MEM, Gibco BRL # 041-01095) with 10% FCS and penicillin / streptomycin (1: 500, Gibco BRL #) are added. 043-0514 OH). After 6 hours at 37 ^° C., the medium is removed, the cells are washed twice with, for example, HBSS (Gibco BRL # 042-0418 OM) and culture medium (eg, MEM) without FCS is added. After production for 20-22 hours, the cell culture supernatant is collected. Expression analysis is carried out by Western blotting according to standard methods (CP, part 10.8). For this, proteins are precipitated from 100-500 μl of cell culture non-supernatant by adding an equivalent volume of acetone and incubating for at least 1 hour on ice and separated by centrifugation. After resuspension of the precipitate in a predetermined buffer (7 M urea, 1% SDS, 7 mmol sodium dihydrogen phosphate, 0.01% bromophenol blue and, if necessary, 1% β-mercaptoethanol), separation is carried out on a 15% polyacrylamide gel. As marker proteins, a pre-stained standard for molecular weight protein is used (Gibco BRL # 26041-020). Transfer to the PVDF membrane (Immobilon # IPVH00010) and blocking of the membrane is carried out by standard methods.

 In order to detect MP-52 on the membrane, polyclonal antibodies against MP-52 are obtained both in the case of chickens and also in the case of rabbits. For this, the mature portion of MP-52 with 6 histidines at the N-terminus is expressed in E. coli and purified, as, for example, described by Hochuli et al. (B 10 / Technology, 6, 1321-1325 / 1988 /). Using both antibodies, specific expression of MP-52 can be detected, with dimeric MP-52 being less efficiently recognized than monomeric. For western blotting, as shown in FIG. 3, chicken antibodies are used that are specifically purified by PEG precipitation / Thalley et al. B 10 / Technology, 8, 934-938 (1990) / and through a membrane-associated antigen (mature MP-52 with 6 histidines) (18, 17; Sambrook et al., Molecular Cloning, 2nd Edition, Cold Spring Harbor Laboratory Press, 1989). As the second antibody, anti-chicken IgG with attached alkaline phosphatose (Sigma A 9171) is used.

 Detection is performed using the Tropix Western-Light Protein Detection Kit (Serva # WL10 RC), as directed by the manufacturer.

 Western blotting in FIG. 3 shows that only in the case of recombinant viruses, but not in the case of wild-type viruses (without integrated foreign DNA), MP-52 specific bands appear. The expression of MP-52 results in a secreted protein with a molecular weight of approximately 25 kDa that appears in the gel under non-reducing conditions. Under reducing conditions, a protein with 14-15 kDa penetrates the gel. These results indicate that MP-52 is expressed as a dimeric mature protein. In the case of weak bands appearing during western blotting analysis in the region above 60 kDa, we are probably talking about the residues of uncut precursor proteins. The penetration behavior also confirms the theoretical molecular weights obtained from SEQ ID NO 2, according to which the mature monomeric MP-52 has a value of 13.6 kDa.

 The expression of MP-52 and the cleavage of the precursor protein to mature MP-52 can be detected in various cell lines. Cells C 127 (ATCC CRL, 1616, mouse), BHK 21 (ATCC CCL, 10, hamster), MRC-5 (ATCC CCL, 171, humans) and 3TG Swiss albino (ATCC CCL, 96, mouse) were tested.

 Expression and cleavage to mature MP-52 are also shown in another eukaryotic expression system. For this, MP-52 cDNA (starting at nucleotide 576) is cloned into the pSG5 expression plasmid (Stratagene # 216201). The plasmid pSK52s is subjected to restriction with ClaI and XbaI and the protruding ends of the MP-52 insert are blunted by treatment with T4 polymerase. Cloning, subjected to restriction and also with blunt ends, by processing with the T4 polymerase p.SG5 vector is carried out by standard methods. All enzymatic reactions are carried out according to the manufacturer's instructions. The correct orientation of the MP-52 insert is provided by restriction analysis and additional sequencing using a 17 primer (Stratagene # 300302). The resulting plasmid pSG52s (stored since May 17, 1994 in DSM under the number 9204) can be counter-formed using a vector that encodes a selectable marker, such as, for example, the G418 resistance gene to obtain stable cell lines. For this purpose, pSG52s are transformed with plasmid p3616 (stored in DSM under 9203 from 05.17.1994) into L929 cells (ATCC CCL, 1, mouse) using lipofectin (Cibco BRL # 18292-011), according to the manufacturer's instructions . G418 selection is carried out according to methods known to the person skilled in the art (CP, part 9.5) and reaches a cell line that produces detectable mature MP-52 in Western blotting.

 Another expression vector for MP-52 is obtained using the plasmid pABWN (Niwa et al., Gene, 108 (1991), 193-200; and Fig. 4), which is made available to Dr. Miyazaki.

For this, the HindIII fragment from the plasmid p.SK52s, which begins with nucleotide 576 in SEQ ID NO 1, is isolated and the protruding ends are blunted by treatment with a Klenov fragment. By ligation of the adapter, a NotI restriction site is introduced at both ends of the fragment. Adapter:
AGCGGCCGCT
TCGCCGGCGA
The pABWN vector is subjected to restriction with XhoI, is also treated with a Klenov fragment and dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim). This phosphorylated adapter is additionally ligated so that it is now possible to insert the MP-52 fragment after restriction with NotI into the NotI generated site of the vector cut. The resulting expression vector is hereinafter referred to as HindIII-MP-52 / pABWN. All cloning reactions carried out are carried out according to standard methods (for example, CP, part 3.16). The structure of the HindIII-MP-52 / pABWN expression vector is confirmed by sequencing and obtaining a restriction map. HindIII-MP-52 / pABWN contains an MP-52 sequence starting at nucleotide 576 and ending at nucleotide 2278 in SEQ ID NO 1.

HindIII-MP-52 / pABWN is transfected into L cells (murine fibroblasts), and stable transformants are obtained from there. To do this, depending on the circumstances, 4 μg of the plasmid (HindIII-MP-52 / pABWN or pABWN) will be transfected into 5 • 10 ⁵ L-cells located in 6 cm diameter culture dishes using 20 μl Lipofect AMINE reagent (Gibco BRL # 18324-012). For this purpose, solution A (4 μg of the corresponding DNA plasmid in 200 μl of OPTI-MEM I / Gibco BRL # 31985 /) is carefully mixed with solution B (20 μl of Lipofect AMINE reagent in 200 μl of OPTI-MEM I) and at room temperature for 45 minutes incubated to form a complex of DNA liposomes. During this procedure, the cells are washed once with 2 ml of OPTI-MEM I. For each transfection, 1.6 ml of OPTI-MEM I is injected into the vessel with the DNA liposome complex. The solution is gently mixed and the washed cells are thus interlaced. Cells are incubated with the diluted complex for 5 hours at 37 ^° C. in a CO ₂ -containing incubator. After incubation, add 2 ml of DMEM (Gibco BRL, modified Dulbecco Eagle-medium) with 20% FCS. 24 hours after transfection, the medium is replaced with fresh DMEM with 10% FCS. 48 hours after the start of transfection, the cells are transferred to 10 cm diameter culture plates. After 72 hours after the start of transfection, a concentration of G 418 begins at a concentration of 800 μg / ml. Stable clones appear after 1-2 weeks.

 5 ml of conditioned DMEM with or without FCS is obtained from confluent transformants that grew for 3 days in a 10 cm diameter culture dish. Cells transfected with two different supernatant fluids (HindIII-MP-52 / pAWWN and pABWN) as well as lysates cells are examined by western blotting. Moreover, mature MP-52 was found in the conditioned medium, as well as in the lysates of cells transfected with HindIII-MP-52 / pABWN. The clones are further cloned and MP-52 producing cells, depending on the circumstances, are selected according to Western blot analysis. Estimates from Western blot analyzes show MP-52 production up to 1 mg / L.

Example 3
Biological Activity MP-52
In order to detect the biological activity of MP-52 and prove the usefulness of the present invention for medical applications in order to avoid and / or treat bone diseases, various in vitro and in vivo experiments are carried out.

1. In vitro test
1.1.

 Since enhancing the synthesis of glycosaminoglycan (GAG) in chondrocytes after TGF-β stimulation has been described (Hiraki et al., Biochimica et Biophysica Acta, 969 (1988), 91-99), it is investigated whether MP-52 also has this effect. Using supernatants of cell cultures (DMEM with 10% FCS) producing MP-52 L-cell transformants (transfection with HindIII-MP-52 / pABWN), the chondrogenic activity of MP-52 was studied in primary cultures from rat germinal limbs.

For this purpose, use 44 limbs of rat fetuses at the age of 16 days. After trypsinization, the obtained cells in F-12 medium (Ham's F-12 nutrient mixture, Gibco BRL # 21700) with 10% FCS are placed on collagen type 1 plates with 24 recesses in an amount of 3 • 10 ⁵ cells and cultured for about 2 days up to confluence. To 500 μl of culture medium (F-12 medium with 10% FCS), as appropriate, add 56 μl of conditioned medium (KM) of transfectants due to HindIII-MP-52 / pABWN L-cells, transfectants due to pABWN-L- cells or medium alone (DMEM with 10% FCS). After a period of 0, 3, 6, and 9 days, an F-12 medium with 10% FCS is used, as well as appropriate additives. All three days carry out a change of environment with the corresponding additives. Then, for the next 2 days, the culture was cultured in F-12 medium without FCS in the presence of appropriate additives (conditioned medium, respectively, control medium), and then ³⁵ S-sulfate was added over 6 hours. Incorporated into polysaccharides ³⁵ S is determined after pronase-E digestion and precipitation as described by Hiraki et al. (Biochimica et Biophisica Acta, 969 (1988), 91-99).

 As can be seen from the table, 1 supernatant of cell cultures producing MP-52 transfectants significantly stimulate GAG synthesis compared to pure nutrient medium (DMEM with 10% FCS) or supernatant of L-cell culture transfected with pABWN. This shows that MP-52 can stimulate chondrocyte differentiation.

 1.2.

 The described effect of some members of the BMP family is an increase in the activity of alkaline phosphatase (ALP activity) in osteoblasts. Clonal cell lines of rats ROB - C-26 (C-26) are classified as osteoblasts of a relatively early stage of maturation (Yamaguchi et al., Calcif. Tissue Int. 49 (1991), 221-225).

 For osteoinductive proteins, such as BMP-2, the ability to enhance ALP activity has been described: Yamaguchi et al., J. Cell. Biol. 113 (1991), 681-687.

The effect of MP-52 on C-26 cells is investigated as follows. C-26-cells in the amount of 3 × 10 ⁴ cells per well are seeded on a 24-well plate and cultured in α-MEM (Gibco BRL) medium with 10% FCS until confluence. 56 μl of culture supernatant of producing MP-52 L-cell transfectants (HindIII-MP-52 / pABWN), respectively, of supernatant of L-cell transfectants obtained with pABWN, or only culture supernatant (DMEM with 10% FCS) L cells to 500 μl of C-26 cell culture medium. Replace the medium with the appropriate additives for all three days. ALP activity in cell extracts is determined after 0, 3, 6, 9, and 12 days using standard methods based on p-nitrophenyl phosphate as a substrate, as described, for example, by Takuwa et al. (Am. J. Physiol. 257 / 1989 /, E797-E803).

 As follows from table 2, ALF activity is significantly enhanced by the addition of MP-52 compared with pure DMEM medium with 10% FCS and the medium infected with pABWN L-cells.

 This result shows that MP-52 can contribute not only to differentiation of chondrocytes, but also to differentiation and maturation of osteoblasts.

 Another osteoblast cell line (MC3T3-EI, mouse), which, as described by Takuwa et al. (Biochem. Biophys. Res. Com., 174 (1991), 96-101), by treatment with BMP-2 shows an increase in ALP activity after incubation with conditioned medium producing MP-52 L-cell transfectants (HindIII-MP-52 / pABWN) or with medium after producing MP-52 due to infection with recombinant vaccinia viruses, there is no change in ALP activity. This indicates that MP-52 has partly cell specificity that deviates from BMP-2. Different functions due to different target areas of individual members of the TGF-β family can be of great medical utility.

2. In vivo experiments
2.1.

 The most clearly expressed opportunity to study bone development is based on ectopic bone formation in vivo. It can be induced, for example, by implantation of a demineralized bone matrix (Urist, Science, 150 (1965), 893-899). By combining an inactive matrix with bone-inducing proteins, the same process as described, for example, by Sampath et al. (PNAS (Proc. Natl. Acad. Sci., USA), 78 (1981), 7599-7603) can be induced. This process of bone formation is similar to that of embryonic enchondral bone formation and treatment of bones in adulthood. Thus, this method makes it possible to study proteins for their ability to induce bone in vivo.

 For such an experiment, the MP-52 protein, which is obtained by expression in the smallpox vaccine system (see Example 2), is partially purified and implanted.

For this purpose, 143B cells (HuTk-, ATCC CRL 8303) are grown in culture dishes and microtiter containers until confluence and, as described in Example 2 for expression analysis, are infected with recombinant viruses, washed and allowed to accumulate for approximately 20 hours MP-52 in MEM (Gibco BRL, approximately 1 ml per 10 ⁶ cells). As a control, the same preparation is carried out by infection with wild-type viruses. The cell culture supernatant (conditioned medium) of each preparation (mixture) was collected and centrifuged (40,000 x g for 30 minutes at 4 ^° C). To remove viruses, the supernatant is filtered through inorganic filters (pore size 0.1 μm, Whatman, Anotop 25). During characterization, MP-52 was able to detect that this protein binds to heparin-sepharose. This behavior is used for partial cleaning. For this purpose, the filtered and centrifuged, conditioned medium is adjusted to a final concentration of 50 mmol TRIS, pH 7.0; 100 mmol NaCl and 6 mol urea and loaded onto a heparin column (HiTrop ^TM , Pharmacia # 17-0407-01), which is equilibrated with buffer A (50 mmol TRIS, pH 7.0, 100 mmol NaCl and 6 mol urea). The loaded column is washed with buffer A and, using a linear gradient, up to 100% buffer B (50 mmol TRIS, pH 7.0, 600 mmol NaCl and 6 mol urea) are eluted at a flow rate of 0.5 ml / min for 50 min (2, 5 ml per fraction). Urea is optional. By Western blot analysis (see Example 2), it can further be verified that MP-52 elutes reproducibly in mainly 2 fractions at a NaCl concentration of about 250-400 mmol. Aliquots of these fractions are also, according to the manufacturer's instructions, checked using silver stained 15% polyacrylamide gels (Silver Stain-II, Daiichi # SE 140000) and combined. Comparable fractions, after purification from the conditioned medium after infection with wild-type viruses, are also combined after analysis in silver stained gels.

 From further studies regarding MP-52, it follows that MP-52 also binds to hydroxyapatite. Therefore, in principle, additional purification can be achieved by using a column with hydroxyapatite, respectively replacing the column with heparin (for example, B10-RAD, Econo-pac HTP). For further purifications, other methods known to the person skilled in the art are also possible, such as, for example, columns with gel sieves (Gelsiebsoulen), columns with ion exchangers, affinity columns, columns with metal chelates or columns based on hydrophobic interactions.

) уравновешивают с помощью 10% буфера B (буфер A : 0,1% трифторуксусной кислоты; буфер B : 90% ацетонитрила, 0,1% трифторуксусной кислоты). После загрузки колонки объединенными, содержащими MP-52 фракциями гепариновую колонку промывают в большом количестве 10% буфером B. Связанный протеин элюируют с помощью следующих градиентов: 10-50% буфера B в течение 20 минут и 50-100% буфера B в течение 50 минут. Фракции по 500 мкл собирают и анализируют как путем вестерн-блоттинг-анализа, так и также в окрашенных серебром гелях. MP-52-Протеин при выбранных условиях элюируется примерно в области 55-65% ацетонитрила. Фракции с MP-52 объединяют. То же самое осуществляют с соответствующими фракциями из контрольной очистки надосадочной жидкости инфицированных вирусами дикого типа клеток.The MP-52 protein preliminarily purified by chromatography on heparin sepharose, respectively, also contaminating proteins, which are also found in wild-type infected supernatant cell culture liquids, are further purified by reverse phase HPLC (high performance liquid chromatography). For this purpose, a C8 column (Aquapore RP 300, Applied Biosystems, particle size: 7 μm; pore size: 300

) is equilibrated with 10% buffer B (buffer A: 0.1% trifluoroacetic acid; buffer B: 90% acetonitrile, 0.1% trifluoroacetic acid). After loading the column with pooled MP-52 fractions, the heparin column was washed in large quantities with 10% buffer B. The bound protein was eluted with the following gradients: 10-50% buffer B for 20 minutes and 50-100% buffer B for 50 minutes . Fractions of 500 μl were collected and analyzed both by Western blot analysis and also in silver stained gels. MP-52-Protein under selected conditions elutes in the region of 55-65% acetonitrile. Fractions with MP-52 are combined. The same is done with the appropriate fractions from the control purification of the supernatant of wild-type infected cells infected with viruses.

 Also partially purified MP-52 protein in a concentration determined by Western blot analysis of 50 ng / ml shows a distinct increase in ALP activity on ROB-C-26 cells after three stages of incubation.

 Partially purified MP-52 protein, respectively a control protein from respectively partially purified supernatant of cell cultures after infection with wild-type viruses, is reconstructed with a matrix and implanted into rats to prove the ability to cartilage and bone formation.

In principle, various matrix materials known to those skilled in the art, i.e., natural (also modified), and synthetically prepared matrices, preferably, however, biocompatible, biologically degradable, in vivo porous materials, should be applicable. In these experiments, a bone matrix of rats is used, which is essentially prepared in the same way as described by Sampath et al. (PNAS, 80 (1983), 6591-6595). Rat bones (thigh and tibia) are demineralized for 24 hours in 0.6 M HCl and then the existing bone marrow is removed. After washing with water and degreasing for 3 hours in a mixture of chloroform with methanol (1: 1), the bones are dried in air, frozen at a low temperature, they are pulverized (sprayed) in a mill and particles 400–1000 μm in size are separated by sieving. After that, the matrix was extracted at room temperature for 7 days in 4 M guanidinium-HCl in the presence of protease inhibitors. After extensive (abundant) washes with water, the matrix is lyophilized and stored at 4 ^° C. Thus, the treated matrices do not show, none of them, any bone inducing activity.

 Protein can be combined with a well-extracted bone matrix using various methods known to the person skilled in the art.

 MP-52-Protein, respectively, is a control protein, which was purified using both heparin-sepharose and also reverse phase HPLC in a solution of acetonitrile with trifluoroacetic acid, after elution, combined in an amount of 25 mg. matrices on the implant, mix well, freeze at low temperatures and lyophilize.

 Approximately 3 months old rats (Wistar) are used to implant the MP-52 matrix. They are anesthetized by intramuscular injection of an anesthetic (0.2 ml Rompun (Bayer) mixed with 0.5 ml Ketanest 50 (Parke Davis) )) in the amount of 0.14 ml per 100 g of body weight. For implants, pockets in the abdominal muscles are prepared on both sides (below the chest, starting about 0.5 cm below the lowest costal arch). Associated with the MP-52 matrix (approximately 2-4 μg as determined by Western blot analysis), as well as the associated control proteins, are moistened with a 0.9% sodium chloride solution (Delta Pharma) and transferred to muscle pockets. The muscle pockets as well as the necessary skin incisions are then sutured. Rats are immunosuppressed with cyclosporin A (Sandimmun).

 After 18, respectively, 26 days, the implants are removed from rats and fixed for histological examination. Since the implant with MP-52 after 26 days already suggests macroscopic bone formation, it is placed (embedded) in methyl methacrylate to prepare thin films; other implants are embedded in paraffin. Mineralized cartilage and bone tissue are blackened (made black) by the Von Kossa staining method (Romeis B., Mikroskopische Technik, ed. Bock P .; Urban and Schwarzenberg; Munchen, Baltimore, Wien / 1989 /). When stained with trichrome dyes (Trichromfarbung) according to Masson-Goldner (Romeis B .; Mikroskopishe Technik, publ. Bock P .; Urban and Schwarzenberg; Munchen, Baltimore, Wien / 1989 /), mineralized bone tissue and collagen are stained slightly green, the osteoid is red, and the cytoplasm has a reddish-brown color. Both staining methods are used for implants from both rats. Using both staining methods in the case of both experimental animals, it is possible to prove a clear cartilage and bone formation in implants that contain MP-52. Corresponding implants with a control protein show no cartilage and bone formation. The proportion of the appearance of cartilage with chondrocytes and cartilage regions with the beginning of the formation of the extracellular matrix and its mineralization in concentric circles in the implant with MP-52 after 18 days is higher than in that after 26 days. However, also in the implant after 18 days mature bone tissues with vectorial formation of osteoid, as well as individual osteocytes in the bone, are already detected. Further, closed bones (Ossikel) with starting bone marrow formation are recognizable. In the case of the implant, after 26 days, cartilaginous regions with the onset of matrix formation and calcification are also found, the proportion of green-colored mineralized bone tissue with osteocytes and osteoid edges, however, is clearly increased. Also in this implant is the formation of bone marrow with isolated (individual) cases of fat cells. For clarity, in FIG. Figure 5 shows the staining detection (von Kossa) of bone material from the entire implant after 26 days. In FIG. 6 shows a small cutout from the same implant after Masson-Goldner staining. Active bones with a rim (edge) from cubodial osteoblasts are visible and in separate "walled" osteoblasts osteoids are recognized. Further, individual osteocytes are visible in the mineralized bone tissue (in the original preparation it is colored green). Bone marrow formation is also detected.

 Experience shows that recombinantly obtained MP-52, alone, in combination with a matrix, is able to induce endochondral bone formation.

 2.2.

To confirm the results, another test of ectopic bone formation is carried out with the use of transformants due to MP-52 L-cells. Producing MP-52 (transfected with HindIII-MP-52 / pABWN) and non-producing MP-52 (transfected with pABWN) L cells (1 x 10 ⁶ cells) are injected on both sides of the thigh muscles taken from three male naked mice. After 3 weeks, all animals are sacrificed, the thigh muscles are separated and examined using both low-energy X-rays and histopathologically.

 As shown in table 3, analysis by x-ray radiation shows a dense material at the injection sites in the muscle tissue of all producing MP-52 L-cells. Using histological studies, simple cartilage formation and calcification of cartilage in mice can be established. Also, these results confirm that MP-52 can induce endochondral bone formation.

 The experiments carried out confirm that MP-52 protein stimulates the formation of cartilage from undifferentiated mesenchymal cells, as well as the differentiation and maturation of osteoblasts. This leads to enchondral bone formation, which is equal to the induction cascade during embryonic bone formation and healing (fusion) of bones in fractures.

 The conditions indicated in the experiments should be considered as an illustration of MP-52 activity, and not as a limitation. The invention can also be considered and characterized in another form.

 For the cell lines and plasmids indicated in the application, materials are given as an application, from which the supporting data are obvious.

Description of drawings
In FIG. 1 shows a comparison of the amino acid sequence of MP-52 with some members of the BMP protein family with the start of the first of the seven remaining cysteine residues. The ^* sign indicates that the amino acid is the same in all compared proteins; the + sign indicates that the amino acid coincides in at least one of the proteins compared to MP-52.

 In FIG. 2 shows the nucleotide sequences of oligonucleotide primers that are used in the present invention, and a comparison of these sequences with known members of the TGF-β family. M is A or C; S is C or G; R is A or G; K is G or T, "2a" is the OD primer sequence, "2b" is the OID primer sequence.

 In FIG. Figure 3 presents western blotting, showing that only in the case of recombinant viruses, however, not in the case of wild-type viruses (without integrated foreign DNA), MP-52 specific bands appear. M denotes a pre-stained protein molecular weight marker with the indicated apparent molecular weights (Cibco BRL # 26041-020), 1 denotes a cell culture supernatant (100 μl) after infection with recombinant viruses (with MP-52 cDNA inserted) during reconstituting (1% β-mercaptoethanol) conditions; 2 denotes a cell culture supernatant (100 μl) after infection with wild-type viruses (without inserted foreign DNA) under reducing (1% β-mercaptoethanol) conditions; 3 denotes a supernatant ultury cells (500 .mu.l) after infection by recombinant viruses (with inserted MP-52 cDNA) under non-reducing conditions, 4 is the supernatant liquid of the cell culture (500 .mu.l) after infection with wild-type viruses (without the inserted foreign DNA) under nonreducing conditions.

 In FIG. 4 shows the plasmid pABWN.

 In FIG. 5 shows a section of the entire implant (after implantation for 26 days), stained according to Von Kossa. Mineralized tissue stands out clearly - black - compared to the surrounding muscle tissue.

 In FIG. Figure 6 shows an implant cutout (after implantation for 26 days) stained according to Mass on Goldner. 1 denotes the osteoblast edge (pink in the original), 2 denotes an osteoid (red in the original), 3 denotes mineralized bone tissue (green in the original) with osteocytes (pink in the original), 4 denotes bone marrow (in the original light pink to orange).

Claims (9)

1. A DNA molecule encoding a protein of the TGF-β family and containing: (a) a part encoding a mature protein and, if necessary, other functional parts, of the nucleotide sequence of SEQ 1DNO.1, shown in the graphic part,
(b) the nucleotide sequence corresponding to the sequence of paragraph (a) due to the degeneracy of the genetic code, the corresponding nucleotide sequence that encodes a protein according to the 1DNO.2 sequence or the functional parts thereof, shown in the graphic part,
(c) a nucleotide sequence hybridizing with one of the sequences from p. (a, (b) provided that the DNA molecule according to (c) encodes at least completely a portion of the mature protein of the TGF-β family, shown in the graphic part.  2. Vector HindIII-MP52 / pABWN, characterized in that it contains at least an MP52 sequence starting with nucleotide 576 and ending with nucleotide 2278 in the sequence SEQ 1DN1 according to claim 1 (a).  3. L-cells, which are murine fibroblasts, transformed with the vector according to claim 2.  4. The protein of the TGF-β family, which is encoded by the DNA sequence according to claim 1, characterized in that it contains the amino acid sequence indicated in SEQ 1DNO.2 or, if necessary, its functionally active parts.  5. A method of obtaining a protein of the TGF-β-family, which encodes a DNA molecule according to claim 1, characterized in that such DNA is introduced into a vector with which the host cell is transformed to form a host cell containing the vector, cultured in a cell - the host in conditions that allow protein expression and receive (secrete) TGF-β protein from the cell and / or culture supernatant (supernatant).  6. A pharmaceutical composition, characterized in that it contains at least one protein according to claim 4 as an active substance in an effective amount, if necessary, together with pharmaceutically acceptable carriers, excipients, diluents or excipients, for forming bone connective tissue and / or cartilage, including the strengthening of dental implants.  7. The pharmaceutical composition according to claim 6, characterized in that the active substance is applied to and / or integrated into a natural or synthetic matrix material.  8. The pharmaceutical composition according to one of claims 6 and 7, characterized in that the matrix material is a biocompatible, biodegradable in vivo porous material.  9. Monoclonal antibodies or antibody fragments, characterized in that they bind the MP-52 protein according to claim 4. Priority on points:
08/10/93 according to claims 1, 4, 6 - 8, 9;
06/09/94 according to claims 2 - 4, 5.

Images