RU2246315C2 - NEW GROWTH/DIFFERENTIATION FACTOR OF TGF-β-FAMILY AND PHARMACEUTICAL COMPOSITION - Google Patents

Abstract

FIELD: medicine, pharmacology, pharmacy.

SUBSTANCE: invention relates to a new growth/differentiation factor of TGF-β-family representing the amino acid sequence SEQ ID NO.2 or, if necessary, its functionally active moieties and to pharmaceutical composition based on thereof that can be used for inducing angiogenesis. Invention provides the enhancement of biological activity of preparation.

EFFECT: valuable biological properties of factor.

4 cl, 3 tbl, 4 dwg, 3 ex

Description

The present invention relates to a new growth / differentiation factor for the TGF-β family and to a pharmaceutical composition based thereon.

(1990), 419-472), особенно пригодно для медицинских методов лечения и применений. Эти факторы пригодны для заживления ран и регенерации тканей. Далее, некоторые члены TGF-β-семейства индуцируют рост тканей и поэтому играют центральную роль при индуцировании развития хрящей и костей.TGF-β family of growth factors, which include related BMP, TGF and inhibin proteins (Roberts and Spon, Handbook Experimental Pharmacology,

(1990), 419-472), particularly suitable for medical treatments and applications. These factors are suitable for wound healing and tissue regeneration. Further, some members of the TGF-β family induce tissue growth and therefore play a central role in inducing the development of cartilage and bone.

, (1989), 267-280 и Vale и др. (Handbook of Experimental Pharmacology,

(1990), 211-248)) описывают различные факторы роста, как например таковые, которые являются родственными группе BMP (костно-морфогенетические протеины) и группе ингибина. Представители этих групп обладают значительным структурным сходством. Предшественник протеина состоит из амино-концевой сигнальной последовательности, пропептид- и карбокси-концевой последовательности примерно из 110 аминокислот, которая отщепляется от предшественника и представляет собой зрелый протеин. Далее, ее представители определяются путем гомологии аминокислотных последовательностей. Зрелый протеин содержит высококонсервативные последовательности, в особенности семь цистеиновых остатков, которые консервативны у членов семейства. TGF-β-образные протеины представляют собой многофункциональные, гормонально активные факторы роста. Они обладают также родственными биологическими активностями, как например хемотактическое притяжение клеток, способствование дифференциации клеток и индуцирующую активность в отношении ткани, как например хрящи и кости. Многие типы клеток в состоянии синтезировать TGF-β-образные протеины, и практически все клетки содержат TGF-β-рецепторы.Wozney (Progress in Growth Fact or Research,

, (1989), 267-280 and Vale et al. (Handbook of Experimental Pharmacology,

(1990), 211-248)) describe various growth factors, such as those that are related to the BMP group (bone-morphogenetic proteins) and the inhibin group. Representatives of these groups have significant structural similarities. A protein precursor consists of an amino-terminal signal sequence, a propeptide and carboxy-terminal sequence of approximately 110 amino acids, which is cleaved from the precursor and is a mature protein. Further, its representatives are determined by the homology of amino acid sequences. The mature protein contains highly conserved sequences, especially seven cysteine residues, which are conserved in family members. TGF-β-shaped proteins are multifunctional, hormone-active growth factors. They also have related biological activities, such as chemotactic attraction of cells, promoting cell differentiation and inducing activity against tissue, such as cartilage and bones. Many types of cells are able to synthesize TGF-β-like proteins, and almost all cells contain TGF-β-receptors.

In general, these proteins differ in their structure, which leads to significant variations in their exact biological function. Further, they are in a wide area of various types of tissues and stages of development. Therefore, they may have differences with respect to their exact function, for example, the necessary cellular physiological environment, their lifespan, their location, their need for auxiliary factors and their resistance to destruction. Numerous proteins that have an inductive potential for tissues, their natural tasks in the body, and, more importantly, their medical applicability, still need to be investigated in detail. It is very likely that there are still unknown members of the TGF-β family, which are important for osteogenesis or for differentiation / induction of other tissue types. The great difficulty in isolating these new TGF-β-shaped proteins is that their functions cannot yet be accurately described for the development of biological analysis in order to recognize them. On the other hand, the expected homology of nucleotide sequences for known members of the family is too small to allow screening using classical nucleic acid hybridization methods. However, the further isolation and characterization of new TGF-β-shaped proteins is necessary in order to obtain other differentiation and induction proteins that satisfy all the desired medical requirements. These factors can find application in medicine in the treatment (healing) of injuries and in the treatment of degenerative diseases of bones and / or other types of tissues, such as kidneys or liver.

PCT / EP 93/00350 discloses the nucleotide and amino acid sequence for TGF-β protein MP-52, the sequence corresponding to the mature peptide and the majority of the sequence corresponding to the propeptide MP-52. The complete sequence of the MP-52 propeptide is not disclosed.

An object of the present invention is to provide a protein of the TGF-β family containing the indicated amino acid sequence of SEQ ID NO.2 or, if necessary, its functionally active parts and having biological properties, such as inductive in angiogenesis and in relation to tissue, in particular osteoinductive, and / or mitogenic activity that may be suitable for therapeutic use. The above protein features may vary depending on the formation of homodimers or heterodimers. Such structures may also be suitable for clinical applications, especially for indications of angiogenesis, as inducing and / or improving the formation of blood vessels.

(1985), 2267-2271; или Sampath и Reddi, PNAS,

(1981), 7599-7603.The biological properties of the proteins according to the invention, in particular the mitogenic and osteoinductive potential, can be determined, for example, by testing according to Seyedin et al., PNAS,

(1985), 2267-2271; or Sampath and Reddi, PNAS,

(1981), 7599-7603.

The TGF-β family protein of the invention is encoded by a DNA sequence comprising

(a) a part encoding a mature protein and, if necessary, other functional parts of the specified nucleotide sequence of SEQ ID NO.1;

(b) the nucleotide sequence corresponding to the sequence of paragraph (a) due to the degeneracy of the genetic code;

(c) an allelic derivative of a nucleotide sequence corresponding to the sequences of (a) and (b);

or

(d) a sequence hybridizing with one of the sequences (a), (b) or (c);

provided that the DNA molecule according to paragraph (d) encodes at least fully a portion of the mature protein of the TGF-β family. The sequence protocols and drawings are briefly described below.

SEQ ID NO.1 (see end of description) provides the complete nucleotide sequence of DNA encoding TGF-β protein MP-52. ATG - start codon begins with nucleotide 640. The "start" of a mature protein begins after nucleotide 1782.

SEQ ID NO.2 (see end of description) provides the complete amino acid sequence of TGF-β protein MP-52, which is derived from the specified nucleotide sequence of SEQ ID NO.1.

Figure 1 presents a comparison of the amino acid sequence of MP-52 with some members of the BMP protein family with the start of the first of the seven remaining cysteine residues. The * sign indicates that the amino acid is the same in all compared proteins; the + sign indicates that the amino acid coincides in at least one of the proteins compared to MP-52.

Figure 2 presents the nucleotide sequences of the oligonucleotide primers that are used in the present invention, and a comparison of these sequences with known members of the TGF-β family. M is A or C; S is C or G; R is A or G; and K is G or T. "2a" is the OD primer sequence; "2b" denotes the sequence of the OID primer.

Figure 3 presents western blotting, showing that only in the case of recombinant viruses, however, not in the case of wild-type viruses (without integrated foreign DNA), MP-52 specific bands appear. M denotes a pre-stained protein molecular weight marker with the indicated apparent molecular weights (Gibco BRL # 26041-020), 1 denotes a cell culture supernatant (100 μl) after infection with recombinant viruses (with inserted MP52 cDNA) when restoring (1 % β-mercaptoethanol) conditions; 2 denotes a supernatant of cell culture (100 μl) after infection with wild-type viruses (without inserted foreign DNA) under reducing (1% β-mercaptoethanol) conditions; 3 denotes a supernatant ultury cells (500 .mu.l) after infection by recombinant viruses (with inserted MP52 cDNA) under non-reducing conditions, 4 is the supernatant liquid of the cell culture (500 .mu.l) after infection with wild-type viruses (without the inserted foreign DNA) under nonreducing conditions.

Figure 4 presents the plasmid pABWN.

The term "functional part" within the scope of the present invention refers to a part of a protein that is able to act, such as a part of a signal peptide, propeptide, or mature protein, i.e. perform at least one of the biological functions of the natural parts of the MP-52 protein.

The region encoding the mature portion of the protein extends from nucleotide 1783 to 2142 in the sequence indicated by SEQ ID NO.1. If necessary, the DNA molecule may also contain functional parts of the indicated SEQ ID NO.1 sequence, namely the nucleotide sequences encoding the signal and / or propeptide part. Particularly preferably, the DNA molecule contains the sequence of the signal and propeptide part and part of the mature protein, i.e. nucleotides 640-2142 of the sequence indicated in SEQ ID NO.1. On the other hand, the DNA molecule, along with the part encoding the mature protein, may also contain functional signal and / or propeptide parts of other proteins, in particular other proteins of the TGF-β family.

The DNA molecule may additionally contain between the nucleotides 1270 and 1271 in the specified SEQ ID NO.1 sequence a non-coding intro sequence. This intron sequence is contained in the plasmid SKL 52 (H 3) MH 12 deposited in DSM, which has the genomic nucleic acid sequence MP-52.

The MP-52 protein sequence encoded by the phage λ15.1 cDNA begins with nucleotide 321 of the indicated SEQ ID NO.1 sequence.

Although allelic, degenerate and hybridizing sequences have structural differences due to minor changes in the nucleotide and / or amino acid sequence, the proteins encoded by these types of sequences have essentially the same useful properties, which makes it possible to use them for the same purposes in medicine.

According to the present invention, the designation "hybridization" represents the usual hybridization conditions, preferably conditions with a salt concentration of 5 × SSC at 62-66 ° C, followed by washing with 0.6 × SSC, 0.1% SDS for 1 hour , at 62-66 ° C. Particularly preferred is the designation "hybridization" refers to stringent hybridization conditions with a salt concentration of 4 × SSC at 62-66 ° C, followed by washing for 1 hour with 0.1 × SSC, 0.1% SDS, at 62- 66 ° C.

The DNA sequences indicated above are obtained from vertebrates, preferably mammals, such as pigs, cows, and rodents, such as rats or mice, and in particular from primates, such as humans.

(1988), 1528-1534. Соответствующие последовательности BMP 5, BMP 6 и BMP 7 описаны Celeste и др., Proc.Natl.Acad.Sci. USA, 87, (1990), 9843-9847.Particularly preferred is the sequence indicated in SEQ ID NO.1 and designated as MP-52. MP-52 transcripts are obtained from embryonic tissue and encode a protein that exhibits significant amino acid homology with respect to the mature portion of BMP-like proteins (see FIG. 1). The BMP2 protein sequences (= BMP 2A) and BMP 4 (= BMP 2B) are described by Wozney et al., Sience,

(1988), 1528-1534. The corresponding sequences of BMP 5, BMP 6 and BMP 7 are described by Celeste et al., Proc.Natl.Acad.Sci. USA, 87, (1990), 9843-9847.

Another subject of the present invention is a pharmaceutical composition which comprises a pharmaceutically effective amount of the TGF-β protein of the invention as a biologically active substance. If necessary, such a composition includes a pharmaceutically acceptable carrier, excipients, diluent or excipient. Such a pharmaceutical composition can be used in indications of angiogenesis to improve and / or induce the formation of blood vessels, either individually or in combination with other biologically active substances, for example with other proteins of the TGF-β family or growth factors, such as EGF (epidermal growth factor ) or PDGF (platelet derived growth factor). In addition, such a pharmaceutical composition can be used to prevent diseases associated with angiogenesis. The pharmaceutical composition according to the invention can also be used for prophylaxis or in cosmetic surgery. Further, the use of the composition is not limited to humans, but it can also be used in the case of animals, especially domestic animals.

The invention is further illustrated by the following examples.

EXAMPLE 1

Isolation of MP-52

(1979), 5294-5299. Поли(А+)-РНК отделяют от полной РНК путем олиго(dT)-хроматографии согласно инструкциям изготовителя (Stratagene Poly (A) Quick-колонки).1.1. Complete RNA was isolated from human embryonic tissue (aged 8-9 weeks) according to the method of Chirgwin et al., Biochemistry,

(1979), 5294-5299. Poly (A +) - RNA is separated from total RNA by oligo (dT) chromatography according to the manufacturer's instructions (Stratagene Poly (A) Quick Column).

1.2. For the reverse transcription reaction, 1-2.5 μg of poly (A +) - RNA is heated at 65 ° C for 5 minutes and quickly cooled with ice. The reaction mixture contains 27 u PHK-Guarol (Pharmacia), 2.5 μg oligo (dT) 12-18 (Pharmacia) 5xbuffer (250 mmol / L TRIS / Hcl, pH = 8.5; 50 mmol / L MgCl ₂ ; 50 mmol / L DTT ( dithiothreitol); 5 mmol / L of any dNTP (deoxynucleoside triphosphate); 600 mmol / L KCl) and 20 units. AM reverse transcriptase (Boehringer Mannheim) per 1 μg poly (A +) - RNA. The reaction mixture (25 μl) was incubated for 2 hours at 42 ° C.

1.3. The deoxynucleotide primers OD and OID indicated in FIG. 2 are obtained on an automatic DNA synthesizer (Biosearch). The purification is carried out by denaturing polyacrylamide gel electrophoresis and isolating the main strip from the gel by isotachophoresis. By comparing the nucleic acid sequences of known members of the TGF-β family and selecting regions with the highest conservation, oligonucleotides are designed. A comparison of these areas is presented in figure 2. To facilitate cloning, both nucleotides contain EcoRI restriction sites and the OD additionally contains an NcoI restriction site at its 5 ′ end.

1.4. In the case of the polymerase chain reaction (PCR reaction), 20 ng of the corresponding poly (A +) - RNA cDNA from the starting material is used. The reaction is carried out in a volume of 50 μl, and it contains 1xPCR buffer (16.6 mmol / L (NH ₄ ) ₂ SO ₄ ; 67 mmol / L TRIS / HCl, pH = 8.8; 2 mmol / L MgCl ₂ ; 6 7 μmol / L EDTA, 10 mmol / L β-mercapto-ethanol; 170 μg / ml bovine serum albumin (Gibco); 200 μmol / L any dNTP (Pharmacia); 30 pmol each oligonucleotide (OD and OID) and 1.5 units Taq polymerase (Ampli Taq, Perkin Elmer Cetus). The reaction mixture is coated with paraffin and 40 cycles of polymerase chain reaction are carried out. Products of the polymerase chain (PCR) reaction are purified by extraction with phenol and chloroform and concentrated by ethanol precipitation.

1.5. The polymerase chain reaction product is digested with restriction enzymes SphI (Pharmacia) and AIWNI (Biolabs) according to the manufacturer's instructions.

1.6. Restriction cleavage products are fractionated by agarose gel electrophoresis. After staining with ethidium bromide, undigested amplification products are excised from the gel and isolated by phenol extraction. The resulting DNA is then purified by double extraction with phenol with chloroform.

1.7. After ethanol precipitation, one-fourth or one-fifth of the extracted DNA is re-amplified, and the same conditions as for primary amplification are used, except that the number of cycles is reduced to 13. The products of re-amplification (re-amplification) are purified, cut using the same enzymes, as indicated above, and uncut products, as explained above for amplification products, are isolated from agarose gels. Stage re-amplification (re-amplification) is repeated twice.

1.8. After the last isolation from the gel, the amplification products are cleaved thanks to 4 units. EcoRI (Pharmacia) under manufacturer's recommended conditions. One fourth of the mixture after restriction is ligated with the EcoRI digested pBluescript II SK + vector (Stratagene). After ligation, 24 clones are further analyzed by sequencing. Cleaved using ALWNI and SphI, the sample gives a new sequence, which is referred to as MP-52. Other clones contain predominant BMP 6 sequences and one clone contains a BMP 7 sequence.

The clone at the 3'-end is complemented with cDNA according to the method described in detail by Frohmann (amplification, published by Perkin-Elmer Corp., Issue 5 (1990), pp. 11-15). The same embryonic mRNA that was used to isolate the first fragment of MP-52 is subjected to reverse transcription, as described above. Amplification is carried out using an adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CTTGAGTACGAGGCTTTCCACTG) of the MP-52 sequence. Amplification products are re-amplified (re-amplified) using an overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and an overlapping internal primer (GGAGCCCACGAATCATGCAGTCA) MP-52 sequence. The reamplification products, after restriction digestion with NcoI, are cloned into the same vector [pUC 19 (Pharmacia No. 27-4951-01) with one modified multiplen cloning site that contains a single NcoI restriction site] and sequenced. Clones are characterized by overlapping their sequence with the 3'-end of the known MP-52 sequence. One of them is used as a probe for screening the human genomic gene bank (Stratagene No. 946203) according to the detailed method described by Ausubel et al. (Current Protocols in Molecular Biology, published by Greene Publishing Associates und Wiley-Intersience / 1989 /). A phage (λ 2.7.4) is isolated from 8 · 10 ⁵ λ-phages, which contains an insert of approximately 20 kb and is deposited in DSM under the number 7387. This clone, along with the sequence isolated from mRNA by the described amplification methods, contains other sequence information (Sequenzinformationen) at the 5'-end.

For analysis by sequencing, a HindIII fragment of approximately 7.5 kb is subcloned into a vector cut in the same manner (Bluescript SK, Stratagene No. 212206). This, designated SKL 52 (H 3) MP 12, the plasmid is also stored in DSM under the number 7353. The information-carrying sequence presented in SEQ ID NO.1 is derived from phage λ 2.7.4. The ATG at position 640 is the first ATG in the reading frame (a stop codon appears at position 403). Based on this sequence, we must assume that this is a starting codon for translation.

Genomic DNA contains an intron of approximately 2 kb between base pairs 1270 and 1271 of SEQ ID NO.1. The sequence of the intron is not shown. The correct splicing site is confirmed by sequencing the amplification product, which is derived from cDNA containing this region. These information-carrying sequences are obtained using a slightly modified method, which is described in detail by Frohman (amplifications, published by Perkin-Elmer-Corporation, Issue 5, (1990), pp. 11-15). The same embryonic RNA that was used to isolate the 3 ′ end of MP-52 is reverse transcribed using the internal 5 ′ directional primer of the MP-52 sequence (ACAGCAGGTGGGTGGTCTGGACT). The poly-A end (tail) is attached to the 5’ end of the first cDNA strand using terminal transferase. Two-stage amplification is carried out, first by using the primer (AGAATTCGCATGCCATGGTCGACGAAGC) T16 consisting of oligo-dT and the adapter sequence, and secondly, by using the adapter primer (AGAATTCGCATGCCATGGTCGACG) and the internal primer (CCAGCAGSTCCCTS). The amplification products are re-amplified (re-amplified) using the same adapter primer and overlapping (overlapping) internal primer (TCCAGGGCACTAATGTCAAACACG) of the MP-52 sequence. Then, the reamplification products are re-amplified using an overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and an overlapping internal primer (ACTAATGTCAAACACGTACCTCTG) MP-52-sequentially. The products of re-amplification using smooth ends are cloned into a vector (Bluescript, SK, Stratagene No. 2120206), which is digested with EcoRV. Clones are characterized by overlapping their sequence using DNA phage λ 2.7.4.

Next, a cDNA bank obtained from RNA of human fibroblasts and cloned in phage λ gt 10 is subjected to screening. In this case, 2 × 106 phages are examined, and a fragment of the genomic MP-52 DNA is used as a radioactive probe (exon 2 up to the Hind III restriction site in the unexposed translation of the 3’ region). 17 spots (hemolysis zones) of the mixture were isolated, which were further examined by PCR using primers from the 5’-3’ region of the MP-52 sequence. After that, 8 sterile spots were selected and separated, cDNA was isolated from the phage by partial digestion with EcoRI and cloned in an EcoRI digest Bluescript vector.

Sequencing of one of the resulting plasmids SK 52 L 15. IMP25 shows that the longest phage (15.1) begins with nucleotide No. 321 of SEQ ID K NO.1. Further, by sequencing, the splicing site is confirmed (nucleotide 1270).

Plasmid SKL 52 (H 3) MP 12 has been stored under number 7353 at DSM (German Collection of Microorganisms and Cell Culture, Mascheroder Weg Ib, 38124, Brounschweig) from December 10, 1992.

Phage λ 2.7.4 has been stored under number 7387 in the DSM since January 13, 1993.

Plasmid SK52L15. IMP25 has been stored under number 8421 in the DSM since July 16, 1993.

EXAMPLE 2

Expression MP-52

Various systems are tested for the expression of MP-52. The use of vaccinia viruses as an expression system is described in detail and as a guide for a specialist in Current Protocols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wilay-Interscience, Wiley and Sans), hereinafter abbreviated CP, in chapter 16, part 16.15-16.18. The system is based on the fact that foreign DNA, when using certain vectors by homologous recombination, can be integrated into the genome of the vaccinia virus. For this purpose, the vector used contains the TC (thymidine kinase) gene from the vaccinia genome. In order to enable selection for recombinant viruses, the vector further comprises E. coli - xanthine-guanine-phosphoribosyl-transferase-gene (gpt) / Falkner et al., J. Virol 62 (1988), 1849-1854 /. In this vector, cDNA is cloned with the entire coding region of MP-52. cDNA is derived from plasmid SK52L15. IMP25 (DSM, number 8421), which, to remove a large portion of the undeveloped 5’ region, however, is first deleted and intermediate cloned. For this, plasmid SK52L15. IMP25 is linearized using SaLI and the 5'-end is subsequently deleted by using the Exo III / Mung Bean kit (Stratagene # 200 330) according to the manufacturer's instructions. After restriction with BamHI, the MP-52 cDNAs that were deletion on the agarozogel to different degrees were separated from the residual vector, isolated and, according to standard methods (Sambrook et al., Molecular Cloning, 2nd edition, Cold Spring Harbor Laboratory Press, 1989) intermediate clone subjected to restriction using EcoRV and BamHI pBluescript II SK-vector (Stratagene # 212206 / p.SK52S /. All restriction is carried out according to the manufacturer's instructions. Additional sequencing using sequenase (USB / Amersham # 70770) gives, among other things, a clone, which starts with nucleotide 576 in SEQ ID NO.1 (64 base pairs ud cDNA insert and cloned in the same split vector for recombination in smallpox vaccine. The resulting plasmid (pBPIMP52S) was stored in DSM (no. 9217) from May 24, 1994 g and is used to produce recombinant vaccinia viruses.For this, up to 80% of confluent 14 3B cells (HuTk, ATCC CRL 8303) in culture plates with a diameter of 35 mm are infected with wild-type vaccinia virus in 2 ml of PBS (phosphate-buffered saline in for 30 minutes at room temperature and with shakes on occasion (1 virus per 10 cells). After suction of the supernatant and the addition, 2 ml of culture medium (MEM, Gibco BRL # 041-01095) were incubated for 2 hours at 37 ° C. The medium is then removed and transformations of these cells are achieved with 100 ng pBPIMP52S, 2 μg DNA carrier (calf thymus, Boehringer Mannheim # 104175) and 10 μl of lipofectin (Gibco BRL # 18292-011) in 1 ml of MEM for 15 hours at 37 ° C. After the addition of 1 ml of MEM with 20% FCS (Gibco BRL # 011-06290), they were incubated for the next 24 hours at 37 ° C and the lysed cells were then frozen.

gpt selection for xanthine-guanine phosphoribosyl transferase and isolation and amplification of individual recombinant viruses are carried out essentially as described in section 16.17 of the CP, with the difference that PK-13 cells are used (ATCC CCL 37).

The integration of MP-52 cDNA into the viral genome is confirmed by analysis using Southern blotting and dot blotting (SR, part 16.18). Recombinant virus is used for expression assays in the 143 B cell line (HuTk, ATCC CRL, 8303, human). Confluent cells are infected using the appropriate cell number of viruses for 45 minutes at 37 ° C and then appropriate culture medium (MEM, Gibco BRL # 041-01095) with 10% FCS and penicillin / streptomycin (1: 500, Gibco BRL #) are added. 043-0514 OH). After 6 hours at 37 ° C, the medium is removed, the cells are washed twice with, for example, HBSS (Gibco BRL # 042-0418 OM) and culture medium (e.g., MEM) without FCS is added. After production for 20-22 hours, the cell culture supernatant is collected. Expression analysis is carried out by Western blotting according to standard methods (CP, part 10.8). For this, proteins are precipitated from 100-500 μl of the cell culture supernatant by adding an equivalent volume of acetone and incubating for at least 1 hour on ice and separated by centrifugation. After resuspension of the precipitate in a predetermined buffer (7 M urea, 1% SDS, 7 mmol sodium dihydrogen phosphate, 0.01% bromophenol blue and, if necessary, 1% β-mercaptoethanol), separation is carried out on a 15% polyacrylamide gel. As marker proteins, a pre-stained standard for molecular weight protein (Gibco BRL # 26041-020) is used. Transfer to a PVDF membrane (Immobilon # IPVHOOO10) and blocking of the membrane is carried out by standard methods.

, 1321-1325, 1988/). С помощью обоих антител можно обнаруживать специфически экспрессию МР-52, причем димерный МР-52 менее эффективно распознается, чем мономерный. Для вестерн-блоттинга, согласно фиг.3, применяют куриные антитела, которые специфически очищены путем ПЭГ-преципитации /Thalley и др., В 10/Technology,

, 934-938 (1990)/ и через связанный с мембраной антиген (зрелый МР-52 с 6 гистидинами) (18, 17; Sambrook и др., Molecular Cloning, 2-е издание, Cold Spring Harbor Laboratory Press, 1989). В качестве второго антитела используют антикуриный IgG с присоединенной щелочной фосфатазой (Sigma A 9171). Обнаружение осуществляют с помощью набора для определения протеина Tropix Western-Light (Serva # WL 10 RC), согласно указаниям изготовителя.To detect MP-52 on the membrane, polyclonal antibodies against MP-52 are obtained both in the case of chickens and also in the case of rabbits. For this, the mature portion of MP-52 with 6 histidines at the N-terminus is expressed in E. coli and purified, as described for example by Hochuli et al. (B 10 / Technology,

, 1321-1325, 1988 /). Using both antibodies, specific expression of MP-52 can be detected, with dimeric MP-52 being less efficiently recognized than monomeric. For western blotting, according to figure 3, apply chicken antibodies that are specifically purified by PEG precipitation / Thalley et al., B 10 / Technology,

, 934-938 (1990) / and through a membrane-bound antigen (mature MP-52 with 6 histidines) (18, 17; Sambrook et al., Molecular Cloning, 2nd edition, Cold Spring Harbor Laboratory Press, 1989). As the second antibody, anti-chicken IgG with attached alkaline phosphatase (Sigma A 9171) is used. Detection is performed using the Tropix Western-Light Protein Detection Kit (Serva # WL 10 RC), as directed by the manufacturer.

Western blotting in FIG. 3 shows that only in the case of recombinant viruses, however, not in the case of wild-type viruses (without integrated foreign DNA), MP-52 specific bands appear. The expression of MP-52 leads to a secreted protein with a molecular weight of approximately 25 kDa that appears in the gel under non-reducing conditions. Under reducing conditions, a protein with 14-15 kDa penetrates the gel. These results indicate that MP-52 is expressed as a dimeric mature protein. In the case of weak bands appearing during Western blot analysis, in the region above 60 kDa, we are probably talking about the residues of uncut precursor proteins. The behavior with respect to penetration also confirms the theoretical molecular weights obtained from SEQ ID NO.2, according to which the mature monomeric MP-52 has a value of 13.6 kDa.

The expression of MP-52 and the cleavage of the precursor protein to mature MP-52 can be detected in various cell lines. Cells C 127 (ATCC CRL 1616, mouse), BHK 21 (ATCC CCL 10, hamster), MRC-5 (ATCC CCL 171, human) and 3T6 Swiss albino (ATCC CCL 96, mouse) were tested.

Expression and cleavage to mature MP-52 is also shown in another eukaryotic expression system. For this, MP-52 cDNA (starting at nucleotide 576) is cloned into the pSG5 expression plasmid (Stratagene # 216201). The plasmid pSK52S is subjected to restriction with CIa I and Xba I, and the protruding ends of the MP-5 2 insert are blunted by treatment with T4 polymerase. Cloning in subjected to restriction and also with blunt ends due to processing using T4 polymerase pSG5 vector is carried out by standard methods. All enzymatic reactions are carried out according to the manufacturer's instructions. The correct orientation of the MP-52 insert is provided by restriction analysis and additional sequencing using a T7 primer (Stratagene # 300 302). The resulting plasmid pSG52S (stored since May 17, 1994 in DSM under the number 9204) can be co-transformed using a vector that encodes a selectable marker, such as the G418 resistance gene, to obtain stable cell lines. For this purpose, pSG52S is co-transformed with plasmid p3616 (stored in DSM under 9203 from 05.17.1994) into L 929 cells (ATCC CCL, I, mouse) using lipofectin (Gibco BRL # 18292-011), as directed manufacturer. G418 selection is carried out according to methods known to the person skilled in the art (CP, part 9.5) and comes to a cell line that produces detectable mature MP-52 in Western blotting.

Another expression vector for MP-52 is obtained using pABWN plasmid (Niwa et al., Gene, 108, (1991), 193-200; and FIG. 4), which is made available to Dr. Miyazaki.

For this, the Hind III fragment from the plasmid pSK52S, which begins with nucleotide 576 in SEQ ID NO.1, is isolated and the protruding ends are blunted by treatment with a Klenov fragment. Not I restriction site is introduced by ligation of the adapter at both ends of the fragment. Adapter: AGCGGCCGCT

TCGCCGGCGA

The pABWN vector is subjected to restriction with Xho I, is also treated with a Klenov fragment and dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim). This phosphorylated adapter is additionally ligated so that it is now possible to insert an MP-52 fragment after restriction with Not I to the Not I generated site of the vector cut. The resulting expression vector is hereinafter referred to as Hind III-MP-52 / pABWN. All ongoing cloning reactions are carried out according to standard methods (for example, CP, part 3.16). The structure of the Hind III-MP-52 / pABWN expression vector is confirmed by sequencing and obtaining a restriction map. Hind III-MP-52 / pABWN contains an MP-52 sequence starting at nucleotide 576 and ending at nucleotide 2278 in SEQ ID NO.1.

Hind III-MP-52 / pABWN is transfected into L cells (murine fibroblasts) and stable transformants are obtained from there. For this, depending on the circumstances, 4 μg of the plasmid (Hind III-MP-52 / pABWN or pABWN) is transfected into 5 × 10 ⁵ L-cells located in 6 cm diameter culture dishes using 20 μl Lipofect AMINE reagent (Gibco BRL # 18324-012). For this purpose, solution A (4 μg of the corresponding DNA plasmid in 200 μl of OPTI-MEM I / Gibco BRL # 31985) is carefully mixed with solution B (20 μl of Lipofect AMINE reagent in 200 μl of OPTI-MEM I) and at room temperature for 45 minutes incubated to form a complex of DNA liposomes. During this procedure, the cells are washed once with 2 ml of OPTI-MEM I. For each transfection, 1.6 ml of OPTI-MEM I is injected into the vessel with the DNA liposome complex. The solution is gently mixed and the washed cells are thus interlaced. Cells are incubated with the diluted complex for 5 hours at 37 ° C in a CO ₂ -containing incubator. After incubation, add 2 ml of DMEM (Gibco BRL, modified Dulbecco Eagle medium) with 20% FCS. 24 hours after transfection, the medium is replaced with fresh DMEM with 10% FCS. 48 hours after the start of transfection, the cells are transferred to 10 cm diameter culture dishes. 72 hours after the start of transfection, a concentration of 800 μg / ml begins G418 selection. Stable clones appear after 1-2 weeks.

5 ml of conditioned DMEM with or without FCS was obtained from confluent transformants that grew for 3 days in a 10 cm diameter culture dish. Cells transfected with two different supernatants (Hind III-MP52 / pABWN and pABWN) and cell lysates examined by western blotting. Moreover, mature MP-52 was found in the conditioned medium, as well as in the lysates of cells transfected with Hind III-MP52 / pABWN. Clones are cloned further and producing MP-52 cells, depending on the circumstances, selected according to Western blot analysis. Estimates from Western blot analyzes show MP-52 production up to 1 mg / L.

EXAMPLE 3

Biological activity of MP-52

In order to detect the biological activity of MP-52 and prove the usefulness of the present invention for medical applications in order to avoid and / or treat bone diseases, various in vitro and in vivo experiments are performed.

1. In vitro test

1.1.

(1988), 91-99), исследуют, оказывает ли также МР-52 это влияние. При применении надосадочных жидкостей культур клеток (DMEM с 10% FCS, продуцирующих МР 52 трансформантов L-клеток (трансфекция с помощью Hind III-MP52/pABWN), изучают хондрогенную активность МР-52 в первичных культурах из зародышевых конечностей крыс.Since enhancing the synthesis of glycosaminoglycan (GAG) in chondrocytes after TGF-β stimulation is described (Hiraki et al., Biochimica et Biophysica Acta,

(1988), 91-99) investigate whether MP-52 also has this effect. Using supernatants of cell cultures (DMEM with 10% FCS producing MP 52 L-cell transformants (transfection with Hind III-MP52 / pABWN), the chondrogenic activity of MP-52 was studied in primary cultures from rat germinal limbs.

, (1988), 91-99).For this purpose, use 4 limbs of rat fetuses at the age of 16 days. After trypsinization, the obtained cells in F-12 medium (Ham's F-12 nutrient mixture, Gibco BRL # 21700) with 10% FCS were placed on type 1 collagen-coated plates with 24 wells in the amount of 3 × 10 ⁵ cells and cultured for about 2 days up to confluence. To 500 μl of culture medium (F-12 medium with 10% FCS), depending on the circumstances, add 56 μl of conditioned medium (KM) of transfectants due to Hind III-MP 52 / pABWN L-cells, transfectants due to pABWN-L- cells or medium only (DMEM with 10% FCS). After a period of 0, 3, 6, and 9 days, an F-12 medium with 10% FCS is used, as well as appropriate additives. All three days carry out a change of environment with the corresponding additives. Then, for the next 2 days, the culture was cultured in F-12 medium without FCS in the presence of appropriate additives (conditioned medium, respectively, control medium), and then ³⁵ S-sulfate was added over 6 hours. Incorporated into polysaccharides ³⁵ S is determined after pronase-E digestion and precipitation, as described by Hiraki et al. (Biochimica et Biophisica Acta,

, (1988), 91-99).

Table 1 Radioactivity (cpm / well) Number of stages DMEM (10% FCS) control L cells KM L-cell transfectants due to pABWN KM of L-cell transfectants due to Hind III-MP 52 / pABWN 2 3720 ± 114 3865 ± 120 4879 ± 422 5 4188 ± 135 4154 ± 29 8223 ± 275 * 8 3546 ± 160 3310 ± 115 9890 ± 1260 * eleven 3679 ± 218 3633 ± 167 7520 ± 160 * The value refers to ± SEM for 3 or 4 culture mixtures.
*) p <0.01 vs DMEM and CM of L-cell transfectants obtained using pABWN (multiple Scheffe t-test).

As can be seen from table 1, the supernatant of cultures of cells producing MP 52 transfectants significantly stimulate GAG synthesis compared to pure nutrient medium (DMEM with 10% FCS) or supernatant of the culture of L cells transfected with pABWN. This shows that MP-52 can stimulate the differentiation of chondrocytes.

1.2.

The described effect of some members of the BMP family is an increase in the activity of alkaline phosphatase (ALP activity) in osteoblasts. Clonal cell lines of rats ROB-C 26 (C-26) are classified as osteoblasts of a relatively early stage of maturation (Yamaguchi et al., Calcif. Tissue Int. 49 (1991), 221-225).

For osteoinductive proteins, such as BMP-2, the ability to enhance ALP activity has been described: Yamaguchi et al., J. Cell. Biol. 113 (1991), 681-687.

The effect of MR 52 on C26 cells is investigated as follows. With 26 cells in an amount of 3 × 10 ⁴ cells per well, they are plated on a 24-well plate and cultured in α-MEM medium (Gibco BRL) with 10% FCS until confluence. 56 μl of culture supernatant producing MP 52 producing L-cell transfectants (Hind III-MP52 / pABWN), respectively, supernatant of L-cell transfectants obtained using pABWN, or only culture supernatant (DMEM with 10% FCS), is added to the well L cells to 500 μl of C-26 cell culture medium. Replace the medium with the appropriate additives for all three days. ALP activity in cell extracts is determined after 0, 3, 6, 9, and 12 days using standard methods based on p-nitrophenyl phosphate as a substrate, as described for example by Takuwa et al. (Am.J. Physiol., 257/1989 /, E797-E803).

table 2 ALP activity (nmol / min) per well The number of stages of incubation DMEM (10% FCS) control L cells KM L-cell transfectants due to pABWN KM of L-cell transfectants due to Hind III-MP-52 / pABWN 0 41.8 ± 2.8 41.8 ± 2.8 41.8 ± 2.8 3 136.3 ± 3.7 125.8 ± 2.3 181.3 ± 14.2 * 6 129.0 ± 7.8 119.3 ± 6.4 258.0 ± 8.3 * nine 118.4 ± 3.7 110.1 ± 2.8 258.4 ± 10.6 * 12 121.2 ± 3.2 125.3 ± 6.0 237.8 ± 11.0 * Values refer to ± SD for 4 culture mixtures.
* p <0.01 vs DMEM and CM of L-cell transfectants obtained by pABWN (multiple Scheffe t-test).

As follows from table 2, ALP activity is significantly enhanced by the addition of MP 52 compared with pure DMEM medium with 10% FCS and the medium infected with pABWN L-cells.

This result shows that MR 52 can contribute not only to differentiation of chondrocytes, but also to differentiation and maturation of osteoblasts.

(1991), 96-101), путем обработки BMP-2 показывает увеличение ALP-активности, после инкубации с кондиционированной средой продуцирующих МР 52-трансфектантов L-клеток (Hind III-MP52/pABWN) или со средой после продуцирования МР 52 за счет инфекции рекомбинантными вирусами осповакцины не показывает никакого изменения ALP-активности. Это указывает на то, что МР 52 обладает отчасти специфичностью клетки, отклоняющейся от BMP-2. Различные функции, обусловленные разными целевыми участками отдельных членов TGF-β-семейства, могут иметь большую пригодность в медицине.Another osteoblast cell line (MC3T3-EI, mouse), which, as described by Takuwa et al. (Biochem. Hiophys. Res. Com.,

(1991), 96-101), by treatment with BMP-2, shows an increase in ALP activity after incubation with conditioned medium producing MP 52 L-cell transfectants (Hind III-MP52 / pABWN) or with medium after producing MP 52 due to infection with recombinant vaccinia viruses does not show any change in ALP activity. This indicates that MP 52 has partly cell specificity that deviates from BMP-2. Various functions due to different target sites of individual members of the TGF-β family can be of great medical utility.

2. In vivo experiments

2.1.

The most clearly expressed opportunity to study bone development is based on ectopic bone formation in vivo. It can be induced, for example, by implantation of a demineralized bone matrix (Urist, Science, 150 (1965), 893-899). By combining an inactive matrix with bone-inducing proteins, the same process can be induced as described, for example, by Sampath et al. (PNAS stands for Proc.Natl.Acad.Sci., USA), 78 (1981, 7599-7603). This process of bone formation is similar to that of embryonic enchondral bone formation and treatment of bones in the adult state. Thus, this method makes it possible to study proteins for their ability to induce bone in vivo.

For such an experiment, the MP 52 protein, which is obtained by expression of the vaccinia system (see Example 2), is partially purified and implanted.

For this purpose, 143B cells (HuTk-, ATCC CRL 8303) are grown in culture dishes and microtiter containers until confluence and, as described in Example 2 for expression analysis, are infected with recombinant viruses, washed and allowed to accumulate for approximately 20 hours MP 52 in MEM (Gibco BRL, approximately 1 ml per 10 ⁶ cells). As a control, the same preparation is carried out by infection with wild-type viruses. The cell culture supernatant (conditioned medium) of each preparation (mixture) was collected and centrifuged (40,000 × g for 30 minutes at 4 ° C). To remove viruses, the supernatant is filtered through inorganic filters (pore size 0.1 μm, Whatman, Anotop 25). During characterization, MP-52 was able to detect that this protein binds to heparin-sepharose. This behavior is used for partial cleaning. For this purpose, the filtered and centrifuged, conditioned medium is adjusted to a final concentration of 50 mmol TRIS, pH = 7.0; 100 mmol NaCl and 6 mol urea and loaded onto a heparin column (HiTrop ^TM , Pharmacia # 17-0407-01), which is equilibrated with buffer A (50 mmol TRIS, pH = 7.0, 100 mmol NaCl and 6 mol urea). The loaded column is washed with buffer A and, using a linear gradient, up to 100% buffer B (50 mmol TRIS, pH = 7.0 600 mmol NaCl and 6 mol urea) at a flow rate of 0.5 ml / min, elute for 50 minutes (2, 5 ml per fraction). Urea is optional. By Western blot analysis (see Example 2), it can further be verified that MP 52 elutes reproducibly in mainly 2 fractions at a NaCl concentration of about 250-400 mmol. Aliquots of these fractions are also, according to the manufacturer's instructions, checked using silver stained 15% polyacrylamide gels (Silver Stain-II, Daiichi # SE 140000) and combined. Comparable fractions, after purification from the conditioned medium after infection with wild-type viruses, are also combined after analysis in silver stained gels.

), колонки с ионообменниками, аффинные колонки, колонки с хелатами металлов или колонки, базирующиеся на гидрофобных взаимодействиях.From further studies regarding MP 52, it follows that MP 52 also binds to hydroxyapatite. Therefore, in principle, it is possible to achieve additional purification using a column with hydroxyapatite, and accordingly replace the column with heparin (for example, BIO-RAD, Econo-ras NTR). For further purifications, other methods known to the person skilled in the art, such as, for example, gel sieve columns (

), columns with ion exchangers, affinity columns, columns with metal chelates or columns based on hydrophobic interactions.

) уравновешивают с помощью 10% буфера В (буфер А: 0,1% трифторуксусной кислоты; буфер В: 90% ацетонитрила, 0,1% трифторуксусной кислоты). После загрузки колонки объединенными, содержащими МР 52 фракциями гепариновую колонку промывают в большом количестве 10% буфером В. Связанный протеин элюируют с помощью следующих градиентов: 10-50% буфера В в течение 20 минут и 50-100% буфера В в течение 50 минут. Фракции по 500 мкл собирают и анализируют как путем вестерн-блоттинг-анализа, так и также в окрашенных серебром гелях. МР 52-протеин при выбранных условиях элюируется примерно в области 55-65% ацетонитрила. Фракции с МР 52 объединяют. То же самое осуществляют с соответствующими фракциями из контрольной очистки надосадочной жидкости инфицированных вирусами дикого типа клеток.Pre-purified by chromatography on heparin-sepharose MP 52-protein, respectively, respectively contaminating proteins, which are also in wild type infected supernatant cell culture liquids, are further purified using reverse phase HPLC (high performance liquid chromatography). For this purpose, a C8 column (Aquapore RP 300, Applied Biosystems, particle size: 7 μm; pore size: 300

) balance with 10% buffer B (buffer A: 0.1% trifluoroacetic acid; buffer B: 90% acetonitrile, 0.1% trifluoroacetic acid). After loading the column with pooled MP 52 fractions, the heparin column was washed in a large amount with 10% buffer B. The bound protein was eluted using the following gradients: 10-50% buffer B for 20 minutes and 50-100% buffer B for 50 minutes. Fractions of 500 μl were collected and analyzed both by Western blot analysis and also in silver stained gels. MP 52 protein under selected conditions elutes in the region of 55-65% acetonitrile. Fractions with MP 52 are combined. The same is done with the appropriate fractions from the control purification of the supernatant of wild-type infected virus cells.

Also partially purified MP 52 protein in a concentration determined by Western blot analysis of 50 ng / ml shows a distinct increase in ALP activity on ROB-C26 cells after three stages of incubation.

Partially purified MP 52 protein, respectively a control protein from respectively partially purified supernatant of cell cultures after infection with wild-type viruses, is reconstructed with a matrix and implanted in rats to prove the ability to cartilage and bone formation.

(1983), 6591-6595). Крысиные кости (бедро и большеберцовая кость) деминерализуют в течение 24 часов в 0,6 М НСl и затем удаляют еще имеющийся костный мозг. После промывки с помощью воды и обезжиривания в течение 3 часов в смеси хлороформа с метанолом (1:1) кости высушивают на воздухе, замороженными при низкой температуре пульверизуют (распыляют) в мельнице и отделяют путем просеивания частицы размером 400-1000 мкм. После этого матрицу в течение 7 дней при комнатной температуре экстрагируют в 4 М гуанидиний-НСl в присутствии ингибиторов протеазы. После экстенсивных (обильных) промывок водой матрицу лиофилизируют и хранят при 4°С. Таким образом обработанные матрицы не проявляют, ни одна из них, никакой индуктирующей кости активности.In principle, various matrix materials known to those skilled in the art should be applicable, i.e. natural (also modified) and synthetically prepared matrices, preferably, however, biocompatible, biologically degradable in vivo porous materials. In these experiments, a rat bone matrix is used, which is essentially prepared similar to that described by Sampath et al. (PNAS,

(1983), 6591-6595). Rat bones (thigh and tibia) are demineralized for 24 hours in 0.6 M Hcl and then the existing bone marrow is removed. After washing with water and degreasing for 3 hours in a mixture of chloroform with methanol (1: 1), the bones are dried in air, frozen at a low temperature, pulverized (sprayed) in a mill and particles 400–1000 μm in size are separated by sieving. After that, the matrix was extracted at room temperature for 7 days in 4 M guanidinium-Hcl in the presence of protease inhibitors. After extensive (plentiful) washes with water, the matrix is lyophilized and stored at 4 ° C. Thus processed matrices do not show, none of them, any inducing bone activity.

Protein, when using various methods known to the person skilled in the art, can be combined with an extracted bone matrix.

MR 52-protein, respectively, a control protein, which was purified using both heparin-sepharose and also reverse phase HPLC, in a solution of acetonitrile with trifluoroacetic acid, after elution, are combined in an amount of 25 mg of the matrix per implant, mixed well, frozen when low temperatures and lyophilize.

Approximately 3 months old rats (Wistar) are used for implantation of the MP 52 matrix. They are anesthetized by intramuscular injection of an anesthetic (0.2 ml Rompun (Bayer) mixed with 0.5 ml Ketanest 50 (Parke Davis) ) in an amount of 0.14 ml per 100 g of body weight. For implants, pockets in the abdominal muscles are prepared on both sides (below the chest, starting about 0.5 cm below the lowest costal arch). Associated with the MP 52 matrix (approximately 2-4 μg as determined by Western blot analysis), as well as the control proteins associated with the matrix, are moistened with a 0.9% sodium chloride solution (Delta Pharma) and transferred to muscle pockets . The muscle pockets as well as the necessary skin incisions are then sutured. Rats are immunosuppressed with cyclosporin A (Sandimmun).

P.; Urban и Schwarzenberg;

, Baltimore, Wien/1989/). При окрашивании с помощью трихромкрасителей (

) согласно Masson-Coldner (Romeis В.; Mikroskopische Technik, изд.,

P.; Urban и Schwarzenberg;

, Baltimore, Wien /1989/) минерализованная костная ткань и коллаген окрашиваются слегка зеленым, остеоид является красным, а цитоплазма имеет красновато-коричневую окраску. К имплантатам из обеих крыс применяют оба способа окрашивания. С помощью обоих способов окрашивания в случаях обоих подопытных животных можно доказать отчетливое хряще- и костеобразование в имплантатах, которые содержат МР 52. Соответствующие имплантаты с контрольным протеином не показывают никакого хряще- и костеобразования. Доля предстадий хряща с хондроцитами и хрящевыми областями с начинающимся образованием внеклеточной матрицы и ее минерализация в концентрических кругах в имплантате с МР 52 спустя 18 дней выше, чем в таковом спустя 26 дней. Однако также в имплантате спустя 18 дней уже обнаруживаются зрелые костные ткани с векториальным образованием остеоида, а также отдельные остеоциты в кости. Далее, распознаваемы замкнутые косточки (Ossikel) с начинающимся образованием костного мозга. В случае имплантата спустя 26 дней также еще обнаруживаются хрящевые области с начинающимся образованием матрицы и кальцинозом, доля окрашенной в зеленый цвет минерализованной костной ткани с остеоцитами и остеоидными краями, однако, отчетливо увеличена. Также в этом имплантате обнаруживается образование костного мозга с единичными (отдельными) случаями жировых клеток.After 18 or 26 days, the implants are removed from the rats and fixed for histological examination. Since the implant with MP 52 after 26 days already suggests macroscopic bone formation, it is placed (embedded) in methyl methacrylate to prepare thin films; other implants are embedded in paraffin. Mineralized cartilage and bone tissue blacken (make black) thanks to the method of staining Von Kossa (Romeis B., Mikroskopische Technik, ed.

P .; Urban and Schwarzenberg;

, Baltimore, Wien / 1989 /). When stained with trichrome dyes (

) according to Masson-Coldner (Romeis B .; Mikroskopische Technik, ed.,

P .; Urban and Schwarzenberg;

, Baltimore, Wien / 1989 /) mineralized bone tissue and collagen are stained slightly green, the osteoid is red, and the cytoplasm has a reddish-brown color. Both staining methods are used for implants from both rats. Using both staining methods in the cases of both experimental animals, it is possible to prove distinct cartilage and bone formation in implants that contain MP 52. The corresponding implants with the control protein show no cartilage and bone formation. The proportion of the appearance of cartilage with chondrocytes and cartilage regions with the beginning of the formation of an extracellular matrix and its mineralization in concentric circles in an implant with MP 52 after 18 days is higher than in that after 26 days. However, also in the implant after 18 days mature bone tissues with vectorial formation of the osteoid, as well as individual osteocytes in the bone, are already detected. Further, closed bones (Ossikel) with starting bone marrow formation are recognizable. In the case of an implant, after 26 days, cartilaginous regions with a beginning matrix formation and calcification are also found, the proportion of green-colored mineralized bone tissue with osteocytes and osteoid edges, however, is clearly increased. Also in this implant, bone marrow formation with isolated cases of fat cells is detected.

Experience shows that the recombinantly obtained MP-52, alone, in combination with a matrix, is able to induce endochondral bone formation.

2.2.

To confirm the results, another test of ectopic bone formation is carried out with the use of transformants due to MR 52 L-cells. Producing MP 52 (transfected with Hind III-MP52 / pABWN) and non-producing MP 52 (transfected with pABWN) L cells (1 × 10 ⁶ cells) are injected from both sides of the thigh muscles taken from three male nude mice. After 3 weeks, all animals are sacrificed, the thigh muscles are separated and examined using both low-energy X-rays and histopathologically as well.

As presented in table 3, analysis by x-ray radiation shows a dense material at the injection sites in the muscle tissue of all producing MP 52 L-cells. Using histological studies, simple cartilage formation and calcification of cartilage in mice can be established. Also, these results confirm that MR 52 can induce endochondral bone formation.

Table 3 MP-producing 52 cells (Hind III-MP52 / pABWN) Control Cells (pABWN) Dense material in the case of x-ray analysis 3/3 0/3 Chondrocytes in the case of histology 3/3 0/3 Calcification 3/3 0/3 Cartilage in the case of histology

For the cell lines and plasmids indicated in the description, materials confirming the data are attached.

Claims (5)

1. A protein of the TGF-β family containing the amino acid sequence of SEQ ID NO2 or a portion of the mature protein of the TGF-β family shown in FIG. 1, having the property of inducing angiogenesis. 2. A pharmaceutical composition having the property of inducing angiogenesis, characterized in that it contains the protein of claim 1 as an active substance in an effective amount, if necessary, together with pharmaceutically acceptable carriers, excipients, diluents or excipients. 3. The pharmaceutical composition according to claim 2, characterized in that the active substance is applied to and / or integrated into a natural or synthetic matrix material. 4. The pharmaceutical composition according to one of claims 2 and 3, characterized in that the matrix material is a biocompatible, biodegradable in vivo porous material. Priority on points: 08/10/1993 on all counts.

Images