MXPA94006061A - New growth/differentiation factor of the tgf- beta family - Google Patents

Abstract

The invention concerns a protein of the TGF- beta family, the DNA coding therefor and a pharmaceutical composition containing the protein.

Description

HUEUO FACTOR DE CRECÍ MI ENTO- IFEREHCI ATION OF THE T6F-BET FAMILY OWNER: B i OP has rm 'that ll = -c ha f t zu r hiotechnologischer In twi ckl un-3 yon Ph rma ka mbH German nationality company with address at: Czerny-Ring 22 D-69115 Heidel ber-3., GERMANY INUENTOR (ES) are not indicated ABSTRACT The invention relates to a protein of the TGF-beta family? to the DNAs -who code for it? and to a pharmaceutical composition containing the protein.

DESCRIPTION OF THE INVENTION The present invention relates to a n u f f e r of c re c i m e n t / d i f r e n c i a n t i n g f i i a TGF-beta? and the sequences of DHA - =? that code for it.

The TGF-beta family of growth factors? to which the BMP proteins belong? T8F? and related to the inhi í na Roberts and Sporn? Handbook of Experimental Pharmacology 95 < 1 98.- «? 419 - 472. ':' is especially relevant to a wide range of treatment methods and me nual applications. These factors are appropriate in processes that are related to wound healing and tissue re-establishment. Adiionally.-. Several members of the TSF-bta family induce the creation of tissues? in particular the growth of bones? and FOG therefore plays a major role in the induction of cartilage and bone development.

Wozney < Prosress in Sro? Th Factor Research 1 < 1 89 > ? 267-288 > and U le and collaborators í Hand book of. Experimental Pha rma col os 95 < 199T > ? 211 - 248) describe various growth factors? as for example those < =? ue are related to the BMP group ('morphogenetic proteins of the bones) and the group would inhibit. The members of these groups have systematic structural similarities. The precursor of the protein consists of an amino-terminal marker sequence? a sequential sequence i o r r r r 1 1 amino amino amino amino amino amino amino amino amino amino 11 11 11 11 11 11 11 11 11 11 11 11? - = which is detached from the precursor and represents the mature protein. Also? its members are defined by a homology of the amino acid sequence. The mature protein contains the sequences - =? Which are mostly preserved? in particular seven remains of cysteine are preserved among the members of the family. The proteins of the TQ'F-beta type are growth factors m u 11 i f u n c i o na 1 e =? ho rmo na 1 e n te a c t i vos. Do you have good biological related activities? as well as for eJem what the attraction -quotatacti ca of cells? the stimulus of cell differentiation and inductive faculties of you gone? as an example, in uctive faculties of cartilage and bone. The patent of the U.S.A. number 5? T 13? 649 discovers sequences of DNA - what is the code for the technology? called as BMP-2? and US patents. with serial numbers 179 1T1 and 17T 197 discover the proteins BMP BMP-1 V BMP-3. Additionally? many types of cells are able to synthesize proteins of the TSF-beta type? and virtually all cells have receptor. T? F-beta.

In its whole? these proteins show differences in their structure? which leads to remarkable variations of its exact biological functions. They are also in a variety of tissue classes and different stages of development. For the same? Can you use differences in what regards your exact function? for example, the cellular physiological environment required? to your average life? to your destination places? to their need for auxiliary factors and their ability to resist decomposition or destruction. Thus? even when a number of proteins are described that show an inductive potential of te J in particular, they are not included. s a c t i v ity is natural in the body and - more significantly still - its medical relevance must still be investigated in detail. It is presumed that the existence of still unknown members of the TGF-beta family is very likely to be of significance for osteosenesis or the differentiation or induction of other types of drugs. Nevertheless? a great difficulty in the isolation of these new TFG-beta type proteins? consists of what your D Functions still can not be described with sufficient accuracy to develop a bioassay capable of differentiating f with a high level of detection. On the other hand? the ho or i a -that was expected of the nucleotide sequence with respect to the known members of the family is too small to allow or enable a screening by the classical techniques of nucleic acid hybridization. However? it is absolutely necessary to isolate and characterize new proteins of the TGF-be a type? to be able to have more induction and differentiation proteins available ¿G that meet all the desired medical requirements. These factors could find a medial application in the healing of giving them and in the treatment of degenerative diseases of the bones and / or of other types of tissues? For example, kidney or liver.

In the patent application PCT -? P93 -'- 0? 350 is a nucleotide and amino acid sequence indicated for the protein TG'F-beta MP-52? where the sequence corresponding to the mature peptide and a large part of the sequence is indicated - corresponding to F opepti or MP-52. The complete sequence of the MP-52 propeptide is not discovered.

The task proposed by the present invention is to provide DNA sequences coding for new members of the TGF-beta ta protein family, as well as for the production of different proteins. tion? for example osteoindu tive. In particular, the task of the present invention consists in providing the complete DNA and amino acid sequence of the TGF MP-52 protein.

This task is solved by means of a DNA molecule that codes for a protein of the family TGF-beta? and that covers Ca) the portion - which matches the mature protein and eventu ally additional functional portions of the nucleotide sequence shown in SE? 3 ID NO. 1? Cb) a nucleotide sequence - corresponding to the sequence of Ca) within the framework of the degeneracy of the cod i go ne t i co? C) a nucleotide sequence - corresponding to a alelic derivative of one of the Ca sequences) and Cb)? or Cd) a sequence that hybridizes with one of the sequences of Ca)? Cb) or Cc)? with the condition that a molecule of DN? in accordance with Cd) contains at least the portion that codes for a mature protein of the TGF-beta family.

The additional embodiments of the invention relate to the object of claims 2 to 10. Other features and advantages of the invention will be apparent from the description of the preferred embodiments. The sequence protocols and drawings are now quickly described.

The SEQ. ID NO. 1 shows the sequence of the complete nucleotide of DNA - coding for the pro te i na TGF-beta MP-52. The ATG initiation codon begins with nucleotide 640. The onset of mature protein begins after nucleotide 1782.

The SEQ. ID NO. 2 shows the complete amino acid sequence of the TGF-beta protein MP-52? which is derived from the nucleotide sequence shown in SEQ. ID NO. 1.

Figure 1 shows a comparison of the amino acid sequence of MP-52 with some members of the BMP family with priiplecy in the first of the seven conserved cysteine radicals. + signifi a? that the amino acid is the same in all proteins compared; + yes-gnifica? that the amino acid matches at least one of the proteins compared to MP-52.

The crack 2 shows the nucleotide sequences of the olisonucleotide primers that were used in the present invention? and a comp tion of these sequences with known members of the TGF-beta family. M means A or C? S means C or G? R si-gni i a A or G? and K means G or T. 2a shows the primer sequence OD? 2b shows the sequence of the OID primer.

The present invention covers at least the portion coding for the protein matures? and also other functional portions of the nucleotide sequence shown in SEQ. ID NO. 1? as well as sequences that correspond to this sequence within the framework of the degeneracy of the genetic code? and derived alleles of these sequences. Additionally, the present invention also encompasses those sequences that hybridize with such sequences? The problem is that a DNA molecule of that nature contains at least the complete portion of the protein encoding a mature protein of the TGF-beta family.

The concept of "functional portion" in the sense of the presinvon means an F-ortion of protein that is able to act, for example, as a marker peptide portion? of propeptide? or bi n of mature protein? e = say? that is able to comply with at least one of the biological functions of the natural protein portions of the MP-52. • The region encoding the mature portion of the protein extends from nucleotides 1783-242 of the sequence shown in SEQ. ID NO. 1. The DNA molecule may optionally encompass additional functional portions of the sequence shown in SEQ. ID NO. 1? namely? the nucleotide sequences - coding for the peptide portion of labeling and -O propeptide. In a special preferal way? the DN molecule? covers the • sequence for the marking portion and the portion of p-ropep-tido? And the portion of the protein matures? e = say nucleotides 64T-2142 of the sequence shown in SEQ. ID NO. 1. On the other hand? the DNA molecule? apart from the portion that codes for the mature protein? can it also encompass functional portions of the labeling or promotions of other proteins? in particular of other proteins of the TGF-beta family? For example, the BMP proteins moned above. The corresponding nucleotide sequences can be extracted from the references moned above as? whose revelations we make with this reference.

Addition 1 The presinvon also covers a DHA molecule as defined above which additionally contains a 1T sequence non-coding intron between nucleotides 127T and 1271 of the sequence shown in SEQ. ID. DO NOT. 1. Is this intron sequence contained in the SKL 52 CH3) MP12 plasmid that is deposited in the DSM? and same that pres the genomic nucleic acid sequence of MP-52.

Also, the cDNA sequence of the MP-52 protein encoded by fa-go lambda 15 is encompassed by the invon. I. This sequence begins with nucleotide 321 of SEQ. ID NO. 1.

Even when the alleles sequences? Degenerate and hi-bridging embodying the presinvon presstructural differences due to slight modifications in the nucleotide sequence and -O of the amino acids? Are the proteins encoded by these types of sequences still possessing very useful properties? that make possible their application in basically the same medicinal applications.

According to the presinvon? the term "hybridization" means the usual conditions of hybridization? preferably condi io is with a concation of salts of 6 x SSC at 62 to 66 degrees C? Are you taking a one hour wash with T.6 x SSC? T.1". ' of SDS at 62 to 66 degrees C. Particularly preferably the term "hybridization" falls on severe conditions of hybridization with a concation of salts of 4 x SSC at 62 to 66 degrees C, followed by a one-hour wash with T.1 x SSC? 0.1 Ji of SDS at 62 up to 66 degrees C.

Preferred embodim of the presinvon are the DNA sequences? as defined above? What can you get from vertebrates? preferably mammals? like for example pigs? cows or rod? like for example rats or mice? and especially of primates? as for example humans.

A preferred embodimof the presinvon is the sequence shown in SQ. ID NO. 1 and named as MP-52. Traps of the MP-52 were obtained from embryonic tissue and encoded for a pro te-na that shows considerable amino acid homology to the mature part of the BMP type proteins Cver fissure 1). The protein sequences of BMP2 C = BMP2A) and BMP4 C = BMP2B) are described with Uozney et al. Science 242 1988)? 1528-1534. The corresponding sequences of BMP5? BMF6 and BMP7 are described with Celeste and collaborators? Proc. Nati Acad. Sci. E.U.A. 87 C199T)? 9843 - 9847. Some typical sequence homologies? -which are specific for known BMP sequences were also found in the propeptide part of MP-52? iras that other parts of the precursor part of MP-52 show considerable differences with respect to BMP precursors.

Another additional object of the present invention is a vector that contains at least one copy of a DNA molecule according to the invention. In a vector of this type the DNA sequence according to the invention is preferably operably linked to an expression control sequence. Such vectors are suitable for the preparation of TGF-beta type proteins in stable or transiently transformed cells. Can different animal systems be used? vegetables? fungal or bacterial for the transformation and the subsequent cultivation. The vectors according to the invention preferably contain the sequences necessary for replication in the host cell and are replies in an autonomous manner. Additionally, the use of vectors that contain selectable marker genes is preferred. by which the transformation of a host cell can be checked.

Another additional object of the invention is a host cell which is transformed with a DNA according to the invention or with a vector according to the invention. Examples of suitable host cells comprise various eukaryotic and prokaryotic cells? as for example E. coli? c cells of insects? Plant cells? c cells of mammals fungi? as for example yeast.

A further object of the invention is a protein of the TGF-beta family that is encoded by a DNA sequence according to claim 1. The protein according to the invention preferably has the amino acid sequence shown in SEQ. ID NO. 2? or eventual more functional parts of it and shows biological properties? such as for example inductive capacity of tissue? Especially osteoi nductiva - '' or my tose nica? which can be relevant for a therapeutic application. The aforementioned characteristics of the protein may vary depending on the formation of homodimers or proteins. Such structures may also be appropriate for clinical applications.

The biological properties of the proteins according to the invention? In particular, the mitosinic and o = theo- ductive potential could be determined, for example, in tests according to Roberts et al. PNAS 78 C198D? 5339 - 5343? Seyedin and collaborators? PNAS 82 1985)? 2267 - 2271? or Sa path and Reddi? PNAS 78 198D? 7599-7603.

An optional object of the present invention is a procedure for the preparation of a TGF-beta family protein? which is characterized in that a human cell transformed with a DNA according to the invention or with a vector according to the invention is cultured to obtain the TGF-beta protein from the cell and / or from the excess of the culture. Such a method comprises culturing the transformed host cell in an appropriate culture medium and purifying the produced TGF-beta type protein. In this way, the process makes it possible to prepare a sufficient quantity of the desired protein for application in the medium-term cycle with the use of cell culture techniques in which they require growth factors. The host cell can be a bacterium? as for example E. coli? a honso? As for example yeast? a plant cell? as for example tobacco? potato or arabidopsi =? or an animal cell? in particular a line of mammalian cells? such as for example cell lines Mo-? COS- or CHO-? or a line of insect cells.

Yet another additional object of the present invention is the preparation of pharmaceutical compositions containing a pharmacologically effective amount of a TGF-beta type of the substance according to the invention as an active substance. Eventually, does a composition of this nature include a carrier substance? assistant? diluent? or filling? pharmaceutically acceptable Can a pharmaceutical composition of this kind be used in wound healing and in the restoration of tissue? So how to cure damage or bone disorders? of the cartilage? of connective tissue? of the skin? of the mucosa? epithelial or teeth? and in the case of dental implants? either alone or in combination with other active substances? for example, other proteins of the TGF-beta family or growth factors? such as for example EG'F C epidem l s owth factor) or PGDF Cplatelet derived growth factor). Additionally, a pharmaceutical composition of this kind can be used for the prevention of diseases. as for example for the prevention of osteoporosis and osteoarthritis.

Another possible clinical application of the TGF-beta type protein according to the invention is the use as a = upresor of the immunoretion to avoid rejection of tran = plant organs. or an application in relation to l-angiogenesis. The pharmaceutical composition in accordance with the invention can also be used prophylactically or in cosmetic surgery. Also? Is the use of composition not necessarily limited to human beings? but can you also understand the animals? especially domestic animals.

Finally e = another additional object of the present invention an antibody? Which can bind specifically to the proteins according to the invention? or such an antibody fragment for example Fab or Fab '). The procedures for the preparation of an antibody or specific antibody fragment are of the common technical domain of any average specialist. Preferably, such an antibody is a mono-ionic antibody. Such antibodies or antibody fragments may also be suitable for all diagnostics.

Ad ditionally the invention will be illustrated by the following example.

Example 1 Isolation of MP-52 1. 1 The complete RNA was isolated from embryonic human tissue from 8 to 9 weeks of age) according to the method of Chirswin et al. Biochemistry 18 C1979)? 5294-5299. The poly (A +) RNA was removed from the complete RNA by oligo Cdt) -chromatography according to the manufacturer's instructions Colu nas Quick poly CA) from S rata ge ne).

For the reverse transcription reaction, 1 to 2.5 ug of poly (A +) RNA was heated for 5 minutes at 65 degrees C? and they cooled quickly on ice. The reaction mixture contained 27 U of RNA-suard CPharmacia)? 2.5 s of oligo Cdt) 12-18 CPharmacia) .- 5 x buffer C25T mmol / l of Tris / HCl pH 8.5? 5T mmol / l of MsC12J 5T mmol / l of DTT? 5 mmol / l of each dNTP? 660 mmol / l KCl) and 2? U of tran = crypt = a AMU inverse C Boehringer Mannheim) by μ-3 of RNA polyCA-. The useful reaction mixture was incubated for 2 hours at 42 ° C.

The deoxy nucleotide primers OD and OID shown in FIG. 2 were prepared on an automatic DNA synthesizer (CBioresearch). The purification was carried out by electrophoresis of denaturing polyacrylamide gel and isolation of the main bands of the sel by iso acrophoresis. The first and third years of the year, with the addition of half of the sequences of the nucleinic sequence of known members of the TGF-beta family and the selection of regions with the Higher rating index. A comparison of this region is shown in Figure 2. To facilitate the cloning, the two nucleotides contained EcoRI restriction cells and the OD additionally contained a Ncol restriction cell at its 5 'terminus.

In the PCR reaction, cDNA starting material corresponding to 2T n-g RNA polyCA + was used). The reaction was carried out in a volume of 5T Jul and co had 1 x C16.6 mmol PCR buffer / l of CNH4) 2S04? 67 mmol / L of Tris / HCl PH 8.8? 2 mmol / L of M-3C12? 6.7 mmol / l of EDTA? 1T mmol / l of b ta-mer a toe nol? 170 jus / nü of cow serum albumin CGibco)? 208 jjmoL-'l of each dNTP CPharmacia)? 30 p ol of each oligonucleotide COD and OID)? and 1.5 U of Ta-q- P lime rasa C Amp 1 i Ta? Perkin Elmer Ce tus). The reaction mixture was coated with paraffin and PCRs were carried out 40 ci. The products of the PCR reaction were measured by means of an ex-t ra c c t o n t co n t 1 / clo or f o rm and sequestered by ethanol precipitation.

The product of the PCR reaction was cut with the restriction enzymes Sphl C Pharm ia) and AlwNI CE i oi abs) according to the manufacturer's instructions.

The products of the restriction cut are fused by elect rof or es de sel de a-garosa. After I went with ethidium bromide? The results were cut out by separating them from the gel and isolated by extraction with phenol. The DNA obtained was then purified twice by extraction with w-n-chloro form. 1. 7 After ethanol precipitation, a quarter or one-fifth of the isolated DHAs were re-amplified. Which were the same conditions used for the primary ion amplification? except that the number of cycles was reduced to 13. The products of the r 5.m 1 i f i ca c i o n urifi a r o n? Are the same enzymes listed above re co rred? and the ? ~ Untrimmed products were isolated from the asarose angels 1 as they existed for the first time in the amplifi cation. The stage of re-amplification is repeated two times. 1. 8 After the last isolation of the product, the ampli fi cation products were cut by 4 U of EcoRI CPharmacia) following the instructions recommended by the manufacturer. A quarter of the restriction mixture was ligated to the vector pBluescriptI SK - + - CStrata-gene) by cutting with EcoRI. After the mulch, 24 clones were further analyzed by separation. The test cut with AlwNI and Sp l produced a new sequence? which is called MP-52.

The other clones contained annealed BMP6 sequences? and one contained a BMP7 sequence.

The clone was completed towards the 3 'end of the cDNA according to the method described in detail by Frohma n CA? ÍPÜ f i cations? published by Perkin-Elmer Corp ..- volume 5 C1990)? PP íl - 15). The same embryonal mRNA that was used for the isolation of the first fragment of MP-52 was reverse transcribed as previously mentioned. The amplification was carried out using the adaptation primer CAGAATTCGCATGCCATTTG'CGACG) and an internal primer CCTTGA6TACGA6GCTTTCCATCG) of the MP-52 sequence. The probes of the ampli fi cation are rearranged using a superimposed adaptation primer CATTCGCATGCCATGGTCGACTAAG) and a superimposed internal primer CGGA6CCCACGAATCAT8CAGTC) of the MP-52 sequence. The products of the invention? after the restriction cut with Ncol? were cloned and sequenced in a vector cut in the same manner CPUC 19 CPharmaci No. 27-4951-01) with a modified multiple cloning point containing a singular point of restriction N or I). The clones were characterized by their sequence solarization at the 3 'end of the known MF-5 sequence. One of them was used as a probe for the tracking of a gene bank or human genes following a method described in detail by Ausubel et al. CCurrent Protocol = i Molecular Biology? published by Greene Publishing Associates and Uiley-Interscience (1989)). From 8 x 10 lambda phages was isolated a phage Cl mbd 2.7.4) -which contained an insertion of approximately 2T kb? and it was deposited in the DSM with the depository number 7387. This clone contains? In addition to the isolated sequence of the mRNA by means of the all of amplification described? other sequence information at the 5 'end.

For the analysis of the sequence a HindIII fragment of approximate nte 7.5 kb was placed in a vector cut in the same way (Bluescript SK? Stratagene No. 212206). This plasmid designated as SKL 52 CH3) MFJ2 was also deposited in the DSM with the deposit number 7353. The sequence information shown in SEQ. ID NO. 1 comes from phage lambda 2.7.4 .. The ATG at position 640 is the first ATG within the reading frame (at position 403 a stop codon is found). Based on the sequence data it is to be assumed that in this case it is the initiation codon for the translation.

The DNA g nomi co has an i ntrop of approximately 2 kb between the base pairs 1270 and 1271 of the SEQ. ID NO. 1. The intron sequence is not shown. The authenticity of the cut-off point was confirmed by the sequencing of an amplification product that comes from a cDNA-containing this region. This information about the sequence was obtained with the aid of a 1-way method modi fi ed island? that this description is tall in Frohman CA plifications? published by Per in-Elmer Corpor tion? volume 5 C199T)? PP 11-15). The same embryonic RNA was reverse transcribed - which was also used for the isolation of the 3 'end of MP-52? using an internal primer of the MP-52 sequence CACAGCAGGTGGGTGGTGTGGACT) oriented in the 5 'direction. A poly (A) appendage was added to the end 57 of the first cDNA chain by the use of terminal transferase. Was a 2-step amplification carried out? Primarily by employing a primer consisting of oligo dT and a sequencing sequence CAGAATTCGCATGCCATGGTCGACGAAGC CT16))? and secondly employing an adaptation primer CA8AATTC6CATGCCATGGTCGACG) and an internal primer CCCAGCAGCCCATCCTTCTCC) of the MP-52 sequence. The products of the amplification were re-amplified using the same adaptation primer and an overlapping internal primer CTCCAGGGCACTAATGTCAAACACG) of the MP-52 sequence. Then? The products of the reactivation area were reactivated by using a CHTTCGCATGCCATGGTCG CGAAG) and an overlapping internal primer CACTAATGTCAAACHCGTACCTCTG) of the MP-52 sequence. The final products of the reamplification were cloned with the smooth ends in a vector CBluescriPt SK? Stratagene No. 2122T6) -which was cut with EcoRU. By the overlap of its sequence? the clones face up with the lambda DNA In addition, a cDNA bank is tracked? prepared with fibroblast RNA and cloned in larbdastl0. By doing this, 2 x i? Phages were tested? serving as a radioactive probe. a fragment of approximately 1 kb of the genomic MP-52 DNA (2 exon to the restriction point Hi nd 111 in the 3 'nontranslated region). Seventeen mixing plates were screened with PCR using primers from the 5 'and 3' region of the MP-52 sequence. After this, 8 phage plaques were isolated and isolated. The cDN was isolated from fagos through a partial EcoRI cleavage? and cloned into the Bluescript vector, which was also cut with EcoRI.

A sequencing of one of the resulting plasmids SK52L15.1MP25 showed that the long nonsense phage (15.1) starts at nucleotide number 321 of the SEQ. ID NO. 1. The cutoff point (nucleotide 1270) was also confirmed by the instruction.

The plan SKL 52 (H3) MP12 = e deposited the I of December 1992 with the deposit number 7353 in the DSM (Deutsche Sammlung-g yon Mi oors nismen und Ze11 ku11ur n? Mascheroder We-g 1 b? 33TT Braunschweis).

The phage lambda 2.7.4. was deposited on January 13, 1993 with deposit number 7387 in the DSM.

The Plasmid SK52L15.1MP25 was deposited on July 16, 1993 with the deposit number 8421 in the DSM.

Example 2 Expression of the MP52 For the expression of the MP52, several systems are used. The use of vaccinating viruses as an expression system is described in detail and so that the expert can follow it in the Current Protocols in Molecular Biology CAu = ubel et al. Greene Publishins Associés and Wiley Interseience? Wiley & Sons) that in the following will be abbreviated as CP ba-Jo the chapter 16 unit 16.15 - 16.18. The system is based on the fact that DHA can be used in the genome of the vaccine virus through the use of certain vectors by homologous recombination. For this purpose, the vector used contains the TK C timidininasin gene) of the vaccine genome. To make possible a selection on re or bi na virus is it? the vector also contains the gene transferase E. co1 i-xa ti na-guani na-phosphori 1 bosyl Cgpt) CFa1 ner and collaborators? J. Ui ol. 62 (1988)? 1849 - 1854). In this vector, the cDNA was cloned with the entire region that _¿.-_ J code for MP52. The cDNA comes from the plasmid SK52L15.1MP25 (DSM? Deposit number 8421)? which however was first suppressed (delato) and provisionally cloned for the elimination of a large part of the 5 'untranslated region. For this the FJasmido SK52L15.1MP25 was linearized with Sali and the 5 'end was deleted (delegate) step by step with the Bean Kit ExoHI -' Muns (Stratagene # 20T33T) according to the specifications of the manufacturer. After the restriction with Ba HI? MP52 cDNAs deleted (deleted) to a greater or lesser extent were separated from the remaining vector on an agarose sel? were provisionally isolated and cloned (PSK52S) in a vector SK PBI uescript (Stratagene # 212206) restricted with EcoRU and BamHI following standard methods (Sambrook et al.? Molecular Cloning? second edition? Cold Spring Harbor Laboratory Press 1989). All restrictions were carried out following the manufacturer's instructions. The = complementary sequencing C osecuencion) with sequel = a (USB / Amersha # 70770) produced among other things a clone? which starts with nucleotide 576 in SEQ. ID NO. 1 (at a distance of 64 base pairs from the initiation codon). From this, the cDN insert was isolated through restriction Sali and S cl and cloned into the vector 1 mte sketched or cut for vaccinia (vaccinia) reconfiguration. The resulting plasmid (pBFJMP52s) was deposited in the DSM (deposit number 9217) on May 24, 1994 and was used for the production of vaccine viruses (vac ci no virus) re com bin n tes. For this they were infected (1 vi for every 18 cells) cells 143B CHuTk-? ATCC CRL 8383) confluent to 88"; with wild-type vaccinia virus in 2 ml of PBS? in 35 rn culture dishes for 38 minutes at room temperature and stirring occasionally. After aspirating the surplus and adding 2 ml of culture medium (MEM? Gibco BRL # 841-81895)? incubated for 2 hours at 37 degrees C. Then the medium was removed and the transformation of these cells was achieved with 1TT ng of PBP1MP52S? 2 ps of carrier DNA (calf thymus Boehringer Mannheim # 104175) and 10 Jul of lipofectin (Gibco BRL # 18292-811) in 1 ml of MEM? for 15 hours at 37 degrees C. After a-3 irrigate 1 ml of MEM with 2T '-: of FCS (Gibco BRL # T11-T629T> s continued incubating another 24 hours at 37 degrees C) and then the disabled cells They froze.

The selection of gpt on the xanthine-nanotetransferase transphosphonates and the isolation and amplifica- tion of individual conjugate viruses was carried out as described in unit 16.17 of the CP? ccn the difference that RKl 3 cells were used (ATCC CCL 37).

The integration of the MP52 cDNA into the virus gene was confirmed by the dot blot and southern blot analysis (unit 16.18 of the CP). A recombinant virus was introduced for analysis of expression in cell line 143B (HuTk-? ATCC CRL 8383? Human). Confluent cells were infected for 45 minutes at 37 degrees C with the amount of virus corresponding to the number of cells? and then the corresponding culture medium (MEM? Gibco BRL # 041-81895) was added with 18 *. of FCS and penicillin / streptomycin (1: 588? bibco BRL # 843-85148H). After 6 hours at 37 degrees C I withdraw the medium? the cells were washed twice with HBSS (Gi co BRL # 042-84188M) and production medium (for example MEM) was added without FCS. After 28 to 22 hours of production, the excess of cells was collected. The analysis of the expression was carried out by means of western blot = according to m all standard (unit 18.8 of the CP). For this? the proteins of 1T8 up to 588 ul of surplus cell culture? by adding the equivalent volume of acetone and incubation for at least one hour? they were precipitated on ice and separated by carbon. After the pellet resu = pen = in ion buffer with (7 M of urea? 1 *; of SDS? 7 M of fo = sodium hydrogen ion? 0.81 * •; bromo-phenol blue and, eventually, 1 '-from be ta-rner cap-toet nol) the separation was carried out in 15% polyacrylamide gels. As the marker p-rotein, a pre-fixed protein molecular weight standard was used (Gibco BRL # 26841-828). The transfer over PUDF membrane (I obilon #IPv? 88818) and the blocking of the membrane were carried out according to standard methods.

For the detection of MP52 on the membrane, polyclonal antibodies against MP52 were produced in both gallinaceous and rabbits. For this? the mature portion of the MP52 with 6 histidines in the N-terminus was squeezed and purified in E. coli? as described for example in Hochuli et al. (BIO ..- Technology? Uol. 6? 1321-1325 (1988)). With both antibodies, it is possible to check the expression of MP52 effectively. being that the MP52 di a is recognized with less efficiency than the monomer. For the western blot of fissure 3, chicken antibodies were used that were specifically purified through PEG precipitation (Th i ley et al.? BIO / Technology? Vol. 8? 934-938 (199T)) and through antigen. ligated to mature membrane imr52 with 6 rustids) (18.17 in Sambrook et al. Mo 1 ecu 1 ar C 1 onin? according to ed. co 1 d SP ri ng Ha r bo r Laboratory Press 1989). As a second antibody, A ti -Chic in I G was used with alkaline phosphatase coupled (Sisma A917Í). The detection was performed with the Tropix Western-Li-ght Protein Detection Kit (Serva # UL18RC) following the manufacturer's instructions.

The western blot of Figure 3 shows that only specific bands of MP52 are present with the recombinant viruses? but not with the virus type s l va Je (without integrated foreign DHA). The expression of MP52 leads to a secreted pro tein with a molecular weight of approximately 25 kDa that manifests in the gel under non-network conditions. Under the red u ti conditions the protein flows in the sel to 14 to 15 kDa. These results show that MP52 is expressed as mature protein. In what refers to the weak bands that appear in the we = tern blot in the region above 68 kDa? probably it is remains of uncut precursor proteins. The flow behavior also confirms the theoretical molecular weights that must be derived from the SEQ. IN NO. 2? according to which the mature monomeric MP52 has a size of 13.6 kDa.

It can be demonstrated that the expression of MP52 and the cleavage of the precursor protein to obtain the •OR. Mature MP52 is possible in different cell lines. The cells that were tested were C127 (ATCC CRL 1616? Mouse)? BHK21 (ATCC CCL 10? Hamster)? MRC-5 (ATCC CCL 171? Human)? and Swiss 3T6-albino (ATCC CCL 96? mouse).

Expression and excision or cut were also shown in another eukaryotic expression system. 38 For this, the MP52 cDNA (starting with nucleotide 576) was cloned into the expression plate PS65 (S trata-gene # 216201). PSamid PSK52S was restricted with Clal and Xbal and? by tracing with T4 polymerase, the projecting ends of the MP52 insert were blunted. Cloning in the PSG5 vector restricted with EcoR I and also with blunt ends by treatment with T4 polymerase was carried out in a standard methods. All the reactions in ima cas were carried out according to the indications of the manufacturers. The correct orientation of the MP52 insert was ensured by restrictive analysis and complementary coaction (co = sequence) with the T7 primer (Stratagene # 388382). The resulting F-SG52S (deposited on 17. T5.94 in the DSM with the DSM 9284 deposit number) can be co-trans or m r with a vector that codes for a selectable marker? as for example the gene for resistance to 6418? to obtain stable cell lines. For this end? PS'G52S was trans-formed with plasmid F-3616 (deposited on 05.05.94 in DSM with deposit number DSM 9283) in L929 cells (ATCC: CCL i? mouse) with 1 i PO fe k tina ( 6 ibc BRL # 18292-011) Dac ue rdoa 1 si tions of the manufacturer. The selection with G418 was carried out according to methods known to the experts (unit 9.5 of CPj ') and resulted in a cell line that produces mature MP52 that can be checked or verified with the we = tern blot.

Another additional expression vector for MP52 was made using the FJa = Mido PABWN (Niwa et al., Gene 1T8 (1991)? 193-208 and figure 4)? which was made available by Dr. Miyazaki.

For this, the Hind III fragment was isolated from the plasmid pSKSS's? which starts with nucleotide 576 of SEQ. ID NO. 1? and the outgoing sections were dulled by the Klenow fragment treatment. By means of the ligation of the adapter, a cut-off point for restriction Not I was introduced at both ends of the fragment.

Adapter: A6C8GCCGCT TCGCCG6CGA The PABWN vector was restricted with Xho I? Did you also deal with the Klenow fragment? and it is dephosphorylated with the alkaline phosphates inste = ti of the calf (Boehringer Mannheim). The same phosphorylated adapter is attached by ligating it? so that an insertion of the MP52 fragment was now possible? after the restriction with Not I? at the Not I cutoff point of the vector that had been -generated. The resulting expression vector will be referred to as Hind III ion - MP52 - 'PABWN. All the reactions that were carried out for the cloning were carried out in accordance with standard methods (for example, unit 3.16 of the Cf ?.

The structure of the Hind III-MP52 / PABWN expression vector was confirmed by = sequence and charge-based ratios of the restriction. Hind III - MP52 - PABWN conti ne the sequence MP52 starting with the first step 576 and ending with the nucleotide 2278 in the SEQ. ID NO. 1.

Hind III - MP52 .-- F-ABWN is transfected to L * cells? and from this stable transformations were established.

For this, 4 jig of the plasmids (Hind III - MP52 / pABWN or pABWN) were tested in 5 x 18 L cells on a 6 cm culture dish? using 20 pl of Lip f retinal reagent (Gibco BRL # 18324-812). For this, solution A (4 s of the respective plasmid DHA in 288 ul of OPTI-MEM I (Gibco ERL # 31985) was carefully mixed with solution B (28 JJI of LiPofectAMIHA reagent in 2TT ul of OPTI-MEM I ) and incubated for 45 minutes at room temperature for the formation of the DHA liposome complex During this the cells were washed once with 2 ml of OPTI-MEM I. For each * (mouse fibroblasts) transfection 1.6 ml of OPTI-MEM I was added to the vessel with the DNA liposome complex. The solution • it was mixed thoroughly and with it the washed cells were coated. The cells were incubated with the diluted complex for 5 hours at 37 degrees C in the C02 incubator. After incubation, 2 ml of DMEM were added (Gibco BRL? Modified Eagle's Eagle medium modified) / 28", FCS, 24 hours after transfection, the medium was replaced with DMEM-J8"; FCS fresh. 48 hours after the start of the transfection? the cells were transferred to a tray of # Cultivation of 10 cm. 72 hours after the start of transfection, the 6418 selection was started with a concentration of 808 ug / ml. Stable signs appeared after 1 to 2 weeks.

We obtained 5 ml of conditioned DMEM? with or without FCS? of the confluent transformants that had grown 3 days = in a ch-arola of culture of 10 crn. Lo = two different cell culture surpluses (Hind 111-MP52 / F-ABWH # and PABWN) of transfected cells as well as cells are examined in the we = tern blot. In doing so, mature MP5Í was found in the conditioned medium as well as in the cells of transfected Hind 111-MF'52 / pABWN cells. The clones were continued cloning and the MP52 producing cells were selected in each case according to the western blot analysis. Those estimated by the western blot analyzes showed an MP52 production of up to 1 mg / l.

Example Biological activity of the MP52 To demonstrate the biological activity of MP52 and document the usefulness of this invention for medical applications 1 is for the reconstruction and other disease of the bones. conducted several experiments in vitro and in vivo. 1. Essays in vi tro i. There is an increase in the synthesis of glucosaminosis (GAG) in conditions after stimulation with TGF-beta (Hira i and collaborators? Biochemistry and Biophy = ica Acta 969 (1988)? 91-99). - It was investigated if the MP52 and J er ce as ii is this influence. U t i 1 i n the surplus of cell cultures (DMEM with 18 '- of FCS) of transforms of L cells that produce MP52 C transfected with Hind 111 -MP52--'? ABWN) tested the chondrosenic activity of MP52 in primary cultures of fetal limbs of rats.

For this, the four limbs of rat fetuses with 16 days of life were used. After trypsin them? the obtained cells were spread on 24-well plates coated with F-12 medium (Nutrie t Mixture Ham's F-12? Gibco BRL # 21788) with 18"-. ' of FCS on type I col ag ng at a rate of 3 x 18 cells and were cultured approximately 2 days until confluence at 508 July of culture medium (medium F-12 with 18% of FCS). ) was added in each case 56 pl of conditioned medium (KM) of Hind III-MF'52 / pABWN-L cell transfectants? of PABWN-L cell transfectants? Or only medium (DMEM with 18"of FCS). Throughout an e = Time phase of 8? 3? 6 and 9 days the medium F-12 was used with 1T". of FCS as well as the corresponding additions. Every three days a replacement of the average with its corresponding aggregates was carried out. After this, the culture was cultured for another 2 days in the F-12 medium without FCS in the case of the corresponding aggregates (conditioned media or control media)? and then 35S sulfate was added for 6 hours. The 35S incorporated into polysaccharides was determined from F-ues of digestion with pr panase E and precipitation as described in Hiraki and collaborators (Biochirnica et Biophysica Acta 969 (1988)? 91-99). rahla 1 Rad i o c t i v i d ad (cp / well) Number of DMEM (10'.FCS) KM of tran = fec- KM of tran = fec-dias of so many L cells of cellular = of c control room the PABWN-L the HindlII- MP52 / PABUN-L 3728 + 114 3685 + 120 4879 + 422 4188 + 135 4154 ± 29 '- "? -. T j. J_" i? - -?' * 3546 ± 16T 3318 + 115 9890 + 1260 * 11? O: + 218 3633 ¿167 7520 + 160 * The values refer to +/- S.E.M. for 3 or 4 crops *: P < 0.81 vs DMEM and KM of PABWN-L cell transfectants t- 1 u 11 i P 1 e d S c h f faith) Is this shown in table 1? the surplus of the cell culture of the tctants - which produce MP52 stimulate significantly the synthesis of GAG in comparison with the pure culture medium (DMEM with 18"of FCS) or with the surplus of the cell culture of transfected L cells of pABWN This shows that the MP52 can stimulate the differentiation of condi- tions. 1. 2 An effect described for some members of the BMP family e = the increase in phosph activity at alkaline rate (ALP) in osteoblasts. The clonal cell line of rat R0B-C26 is counted among the osteoblasts that present a state of relatively early maturity (Vamaguchi et al.? Clacif? Ti = sue Int. 49 (1991)? 221 JÍZD '. For example, the MP52? ability to increase ALP activity is described by Vamaguchi yclb radores (J. Cell Biol. 113 (1991)? 681- 687) » The influence of MP52 on C'26 cells was examined as follows: C26 cells were given at a rate of 3 x 18 ** cells per well in a 24-well plate? and were cultured in alpha-MEM (Gibco BRL) / 18"of FCS until confluence.For each WELL, 588 pl of the culture medium of the C-26 cells was added to 56 μl of the surplus cell culture of the cells. transfectant = from L-cell producers (Hind III-MP52 / pABUN) producing MP52 or from excess cell culture of PABWN-L? O cell transfectants only from surplus cell culture (DMEM with 1T "of FCS) cells L. A replacement of the medium with the aggregates and respondents was carried out every three days. The ALP activity in the = cell extracts was determined after 0? 3? 6? 9 and 12 days with the help of standard techniques that T £ Are they based on the P- nor tro feni 1 -phosphate as a substratum? is described, for example, in Takuwa et al. (Arn J. Physiol. 257 (1989)? E797-E8T3.

Table 2 ALP activity (nmol / min) by POZO Number of DMEM (1 T'-FCS) KM of tran = fec-KM of trans fe ic-days of cells Cells tester of control cell the pABUN-L the HindlII- MP52-- -PABWN-L 8 41.8 + 2.8 41.8 + 2.8 41. 2.8 136. 3 + 3.7 1-? E¡ p, + r. ' 1SJ.3 + 14.2 * f, 129. B + 7.S 119.3 + 6.4 258.8 + 118. 4 + 118.1 + 2.8 258.4 + 10.6 * 12 I l •? + • "'125.3 i 6.8 OT"? 8 ± 11.8 * Lo = values refer to + "- S. D. for 4 crops *! P < 8.81 vs DMEM and KM of pABWN-L cell transfectants (Scheffe's t-test) Is this shown in table 2? ALP activity is significantly increased by the addition of MP52 compared to DMEM / 18"; Pure FCS and the medium of PABWN-infected L-cells This result shows that MP52 can not only produce the differentiation of co-drugs but also the differentiation and maturation of o = theoblasts.

An additional osteoblast cell line (MC3T3-E1? Mouse) - which by treatment with BMP-2 shows an increase in ALP activity as described in Tacuwa et al. (Biochem. BioPhy =. Res. Com. 174 (1991 )? 96 - 181)? does not give any modification of the ALP activity after incubation with conditioned medium of transfertransfering L-cells (hind III-MP52 / pABWN) that produce MP52? or with medium after the production of MP52 med i a n the infection v i r us va c u n 1 e = (va c c i n i) reconi nantes. This indicates that MP52 partly possesses a cellular specificity that differs from BMP-2. DIFFERENTIAL FUNCTIONS Co nd ices N o st d o ff ers 1 users of d is ti no pa ra 1 a l b e r i n g l i s i l i i i a t i t i t TGF-beta p aced to be of no rrne re 1 va ncia med ici na 1.

Experi entos en vi ' 2. 1 The most relevant POSI bi 1 to investigate bone development (of bones) is based = obr 48 bone formation ectopic i n vivo. This can be carried out, for example, by the implantation of a demineralized bone matrix (Urist? Science 158 (1965)? 893-899). Can the same process be induced by the combination of the inductive mechanism with the inductive protections of the o = teoblasti? as the eu is for example described in Sampath et al. (PNAS * 78 (1981)? 7599-7683). This process of bone formation is similar to that of embryonic cartilaginous bone formation and bone healing in adults. With this? this method offers the possibility of investigating the # proteins in relation to their ability to induce bone in vi. * Proc. Nati Acad. Sci. E.U.A.

For an experiment of this nature, it was partially purified and MP52 protein was implanted? same as that obtained by expression in the vaccine system (vaccinia system) (see example 2).

For this, 143B * cells (HuTk-? ATCC CRL 8383) were cultured in culture trays and rotating bottles until confluence and? or was described in Example 2 for expression analysis? were infected with viru = recombinants? They were washed? and they were given or accumulated for about 20 hours MP52 in MEM (Gi co BRL? approximately 1 ml by 18 cells). As a control, the same culture was carried out by infection with wild type vi. The surplus of the cell culture (medium condition) of each culture was collected and centrifuged (48000 x g for 38 minutes at 4 degrees C). To eliminate viruses? l = surpluses were filtered through inorganic filters (pore size 8.1 jum? Whatman? Anotop 25). In the course of the characterization of MP52 it could be shown that this protein binds with sefaro = heparin. This behavior was used for a partial purification. For this the conditioned medium filtered and centrifuged? Was it carried to a final concentration of 58 niM of Tris PH 7.8? 188 mM NaCl? and 6 M of urea? and was it charged in a column from hep-ari to CHiTrap? registered trademark? Pharmacia # 17-8487-81) -which was equilibrated in buffer C58 mM Tris pH 7.8? 188 mM HaCl? and 6 M urea). The loaded column was washed with buffer A and? with a linear gradient towards 188 *. of buffer B (58 mM of Tris PH 7.8? 688 mM of NaCl? and 6 M of urea)? it was eluted within a period of 58 minutes (2.5 ml per fraction) at a flow rate of 8.5 ml / min. The use of urea is not e = mandatory. Through the analysis we = tern blot (see example 2) it was possible to verify that the MP52 elutes reproducibly mainly in 2 fractions to approximately 258 to 488 M NaCl. Aliquots of these fractions were also checked in 15-inch polyamide cans, held with silver according to the manufacturer's instructions (Sil vr Stain-II? Daiichi #SE 148888) and the fractions = e joined together. The comparative fractions after the purification of the conditioned medium after the infection of the wild-type viruses were also pooled from the analysis in gels stained with silver.

Further investigations revealed that MP52 also binds with hydroxyapatite. For this reason, in principle, is an additional P u r i f i ca tio n through the hydroxyapta column? or alternatively supplement a column of heparin with a hydroxyapatite column (for example BIO-RAD? Eco no-pac HTP). It is also conceivable to use other known methods = for what are the experiences for adi c i o n t i n g s? How can I use the filter columns? ion exchange columns? affinity columns? columns of-that metallic cough? or columns that are based on reciprocal hydrophobic interaction.

^ Protein MP52 pre-purified by chromatography on heparin sepharose? or the proteins that still count inan correspondingly? which also = e found in the = infected cell culture surplus of wild types? they were further purified with the aid of a reverse phase high pressure liquid chromatography column. For this, a C8 column was balanced (Aquapore RP38T? Applied Biosystems? 7 Jim particle size? 388 A pore size) with 18"; of buffer B (Tampon A: trifluoroacetic acid or 8.1"buffer acetonitrile 90"; tricalcium trifluoroacetic acid 0.1".). After loading the column with the joined fractions of the. column of hepa squabble? Same fractions that contain MP52? it was washed extensively with buffer B 18"; The bound product was eluted with the following gradients from 18 to 58"; from tarnpon B over 28 minutes and from 58 to 188". ' of buffer B over 58 minutes Fractions of 588 ul and = e were collected both in the western blot as well as in silver-stained gels .. Under the selected conditions, the MP52 pro tein elutes approximately in the range of 55 to 65 / 'of acetonitrile The fractions with MP52 were joined together, the same was done with the corresponding fractions of the control purification of the surplus cell culture of the cells infected with the pos.

Even the MP52 protein partially purified? in a concentration estimated or evaluated according to a western blot analysis of 58 ng / ml. - showed a clear increase in ALP activity on R0B-C26 cells after three days of incubation.

The MP52 protein partially purified? and the control protein of the cell culture surpluses correspondingly partially purified after infection with wild type virus? they reconstituted # with matrix and implanted in rats? in order to test the capacity of cartilage and bone formation.

In principle, it should be possible to use various matrix materials known to the experts? that is to say? natural matrices (also modified) and produced in synthetic form? however, they prefer biocompatible porous materials that can be biologically disintegrated in vivo. In these experiments, rat bone matrix was used? which is essentially prepared in a similar manner as described in Samp th et al. (PNAS 88 (1983)? 6591-6595). The bones of ra ta? (f u r and tibi)? Is it possible to have a 24-hour operation in 0.6 M HCL? and the still existing bone marrow was eliminated with infection. After washing with water and three hours of defatting in a mixture of chloroform / methanol (1/1)? the bones dried in the air? Are they ultra frozen? They sprayed like this in a mill? and sieved to obtain particles of a size from 400 to 1888 pm. The matrix was then extra-Jo for 7 days at room temperature in 4 M guanidinium HCl in the presence of protease inhibitors. After washing abundantly with asua? the matrix was lyophilized and stored at 4 degrees C.

Marriages treated in this way no longer alone show an ossi fi cation inductive activity. # The product can be combined with the extracted product according to various methods that are known to those skilled in the art.

The MP52 protein or the control protein? that they had been purified both on sepharose hep-arina as well as by liquid phase I and high-pressure vapor control? = e respectively 25 mg of matrix per implant in the tri-fluoroacetic acid / tri-uoroacetic acid solution of the elution? = e they mixed well? they were deep-frozen and lyophilized.

For the implantation of the matrix-bound MP52, two rats (whi testar) of approximately 3 months = age were used? who were anesthetized by the intramuscular injection of a narcotic agent (8.2 l of Ro pun (Bayer) mixed with 8.5 rnl of Ketanest 58 (Parke Davi =)) at a rate of 8.14 rnl per 188 g of body weight. For the implants, b bags were prepared bi laterally in the stomach musculature (below the thorax, starting approximately 8.5 cm down from the arch of the lower rib). The MP52 bound to the matrix (Approximately 2 to 4 ju-g sesun estimated on western blots)? as well as the corresponding control proteins bound to matrix? they were moistened with a solution of 8.9"• of table salt (Delta Pharma) and put into the muscle bags, the muscle bags, as well as the necessary cuts d < the skin were sewn next. They were in the UP with numbers with C 1 ic 1 OSPO fight A (Sa nd i rnm a).

After 18? Or after 26 days? The implants were removed from the rats and fixed for histological examination. It goes < that the preparation with MP52 already allowed to suppose macroscopically the formation of bone after 26 days =? Is it incorporated in a tactic for the production of thin layers? the other implants were incorporated in to fine. The mineralized cartilage and bone tissues are highlighted in black by the von Ko = sa staining technique (Rome i s? B.? Mikros opische Technik? Ed: Boeek? P.? Urban und Schwarzenbers? M uen chen? Bal Thymus re? Wien (1989)). In the trie rom a e co rd o rd o r co r o r o r o r o n o n = 0 o n-Go 1 d ne r (Rome is? B.? My krosko ísche Technik? Ed: Boeck? P.: Urban und Schuarzenbers? Muenchen? Bal ti m re? Wien (1989)) mineralized bone tissue and collagen stain bright green? the osteoid e = red and the cytoplasm reddish brown. Both staining techniques were used on the implants of the two rats. With both coloration techniques, e was able to verify in both experimental animals a clear cartilage and bone formation in the implants containing MP52. The corresponding implants with control protein did not show cartilage or bone formation of any kind. The pro rata part of the first degree of cartilage with eond roe and areas of cartilage with incipient formation of extracellular matrix? y = u ineralization in concentric circles is higher in the 18-day MP52 implant than in the 26-day implant. But also in the 18-day implant, bone tissue already mature can be checked with vectorial osteoid formation as well as individual osteocytes in the bone. Additionally, closed ossicles with incipient bone marrow formation can be recognized. In the 26-day implant can also check areas of cartilage with incipient formation of matrix and calcification? but nevertheless the prorata part of mineralized bone tissue dyed green with osteocytes and borders of o = teoid has increased notably. Also in this implant = e can check the formation of bone marrow with presence or ex- tence isolated from ce 1 u 1 as g rasas. A d m a n d i t i n t i n t i t i n f i c t i n f i c t i t i n t the fissure 5 shows the check by staining (von Ko = sa) of the bone of the total implant after 26 days. In fissure 6 = e shows a small non-cut of the same implant with coloration according to Mas = on-Goldner. It shows active bone with an edge of cuboidal and osteoid osteoblasts in which the isolated inset theo bias can be recognized. Otherwise, osteocytes isolated in the mineralized bone are visible (in the original preparation with green coloration). The bone marrow formation e = likewise verifiable.

The experiment shows that the MP52 produced in recombinant form? alone in combination with a matrix? e = capable of inducing cartilaginous bone formation.

In order to confirm the results, another ecological training test was carried out or = ea? using lo = L-cell transformants of MP52. L cells (1 x íTb • cells) producing MP52 (tra scfetada = from Hind III-MP52 /? ABWN) and not producing MP52 (transfected from PABWN) were injected into the thigh musculature in both thighs of respectively 3 nude mice . After three weeks = e they sacrificed all the animals? = e I separate the musculature from the = thighs? and is it examined both by radiation given by X-ray energy? as well as hi topa tol o-3i carne te. F Is this listed in table 3? X-ray analysis shows dense material in places d < = the joints in the muscle tissue of all L u-qe cells produce MP52. With histological examinations, the formation of simple cartilage and the formation of calcified cartilage in the muscles could be verified. Also these results confi rm? that MP52 can nd uci r bone formation ca r t i 1 agi nosa.

Ta b 1 to 3 cells that produce MP52 control cells (Hind III-MP52 --- PABWN) CPABWM) Dense material in the X-ray analysis 8/3 Conduction of the histology 0 /; Formation of calcifying cartilage in histology 3/3 8 - J The experiments carried out confirm that "the MP52 protein stimulates the formation of cartilage from undifferentiated mesenchymal cells. as well as the differentiation maturation of osteoblasts. This leads to a gummy cartilage formation that is sem to the induction cascade of the embryonic bone formation and to the healing of bones in the case of fractures. 58 The conditions stated in the following should be considered as an illustration of the activity of MP52 and not as a limitation. The invention can be investigated and characterized in other ways as well.

- - I KNOW THAT. ID NO. 1 TYPE OF SEQUENCE: Nucleic acid sequence NAME V PROCEDURES G n-MP-52 LONGITU s 2783 nucleotides TITfiG? £ AG aCJ ^^ TiaTK_aGTI AG3IT ^^ CG? ITCX ITCTCCI ICAA ^^ ITGAAAG? -ACTCC ^^ a32TGTICTCT IO3IGTC ^^ J £ I CTIG TIT3313 ^ C ^^ G C X3GñCTTG3GC ^^ v-ytrrttppr, t > r C-X3333C-? iC ^ AIOCC-? A ^^ CAGC C ^ AG? AGGA? G & AC ^^ CITOC ^ 33AG3CAAGG-A CCCC ^ GGCAACA £ _X ^ 333TG ^^ AAAG332AAaCTGACCGA GTCCCG GC ^^ G CCTGG? GC5fiTG3G TGC G33 ^ GCXXX ^ GCX33CCG3 AG20CSGCCI ^^ CAG ICTGOGGGGAGCTS ^^ G3CTICACCGCG2CGD? CG3 ^^ / 3 * AGftAA-X_GGft-XT ^^ AACTK-AAG3A ^ 533 TGG K ^^ CAC "IXX2-? G333CIG ^ CCO 23C 53C ft CX ^ ^ GT ITCn333 G3 A AICa ^^^ CAG3AA C G G3C * 33AC? A _ ^^ C C XTICI TGAG G G. ^^ C 33A isC O a ^ nCT3C GA2tp ^ TC ?? AñTC3GftCIGAGTC ^^ TCCTC ^ 2IO332CITCTC? ^^ GIGíVS3RIGI 2G3i GTIft ^^ CCT I KNOW THAT. ID NO. 2 TYPE OF SEQUENCES Sequence of amino acid. NAME V FROCEDENCE: Prot i na-MP-52 LENGTH: 581 ami no acids MRLPKLLTFL L YLAWLDLE FICTVLGAPD LGQRPQGTRP GLAKAEAKER PPLARNVFRP GGHSYGGGAT NANARAKGGT GQTGGLTQPK KDEPKKLPPR PGGPEPKPGH PPQTRQATAR TVTPKGQLPG GKAPPKAGSV PSSFLLKKAR EPGPPREPKE PFRPPPITPH EYMLSLYRTL SDADRKGGNS SVKLEAGLAN TITSFIDKGQ DDRGPWRKQ RYVFDISALE KDGLLGAELR ILRKKPSDTA KPAAPGGGRA AQLKLSSCPS GRQPASLLDV RSVPGLDGSG EVFDIWKLF RNFKNSAQLC Lelea ERGR AVDLRGLGFD RAARQVHEKA LFLVFGRTKK RDLFFNEIKA RSGQDDKTVY EYLFSQRRKR RAPLATRQGK RPSKNLKARC SRKALHVUFK DMGWDD IIA PLEYEAFECE GLCEFPLRSE LEPTNHAVIQ TLMNSMDP? S TPPTCCVPTR LSPISILFID SANNWYKQY EDMWESCGC R

Claims (1)

- NOUETY OF THE INVENTION Having described the invention, consider it as a novelty and? Thus? You claim our property as contained in the following clauses.

1. DNA molecule that codes for a TGF-beta family protein that is characterized because it covers Ca) the portion coding for the mature protein and eventually other functional parts of the nucleotide sequence shown in the SQ. ID NO. 1? (fa) a nucleotide sequence - corresponding to the sequence of Ca) within the framework of the degeneracy of the genetic code? c) a nucleotide sequence - which corresponds to a derivative allele of one of the sequences of (a) and (b)? or (d) a nucleotide sequence - which hybridizes with one of the sequences of (a)? (b) or (c) - 5 - with the proviso that a DNA molecule according to (d) contains at least in its entirety the portion coding for a mature pro tein of the TGF-beta family. . [^ Uector? which is characterized in that r contains at least one copy of a DNA molecule according to clause 1. Host cell? which is characterized because - it is transformed with a DHA according to clause 1 or with . 'elula h h? uUé < lawn? what is characterized because it is a bacterium? a fungus? a plant cell or an animal cell. . Pro tein of the TGF-beta family - which is characterized because it is encoded by a DNA sequence according to clause 1. ft Protein according to clause 5? which is characterized in that it presents the amino acid sequence shown in SEQ. ID NO. 2? or eventually portions of this function. \ Procedure for the preparation of a protein of the TGF-beta family? What is characterized is that a host cell is cultured according to clause 3 or 4, and the TGF-beta protein is obtained from the cell and / or the body of the cell. Pharmaceutical composition - which is characterized by at least one protein according to clause 5 or 6 as active substance? eventually in combination with carrier substances? ? _ auxiliaries? thinners or fillers? pharmaceutically common. Pharmaceutical composition according to the treatment or prevention of bone injuries? of the cartilage? of connective tissue? of the skin? of the mucosa? epithelial or teeth? to be applied in the case of dental implants and to be used in wound healing and tissue restoration processes. I ^ Antibodies or fragments of antibodies? They are classified because they link to a protein according to clause 5 or 6. - - Low protest to tell the truth? What is the best known method for practicing the present invention? he is the one who is! wing in the description of this application. In witness whereof I sign you here: Mexico? D. F. to August 9, 1994, Biopharm Ge = ellschaft zur biotechnologischen Entwi ckl uns von Pharmaka mbH F