DE4420157B4 - New growth / differentiation factor of the TGF-β family - Google Patents

Abstract

Use of a pharmaceutical composition containing a protein encoded by a DNA sequence which comprises (a) nucleotides 1783-2142, 640-2142 or 1837-2142 of SEQ ID NO: 1, (b) any of the sequences of (a ) nucleotide sequence corresponding to the degeneracy of the genetic code, (c) an allelic derivative of a nucleotide sequence corresponding to the sequences from (a) or (b), or (d) one having one of the sequences from (a), (b) or ( c) hybridizing under stringent conditions nucleotide sequence, provided that a DNA molecule according to (d) contains at least the coding for a mature protein of the TGF-β family share, for the prevention and / or treatment of osteoporosis and / or Arthrosis.

Description

The present invention relates to the use of a pharmaceutical composition containing TGF-β family growth / differentiation factor and DNA sequences coding therefor.

The TGF-β family of growth factors, including BMP, TGF and inhibin-related proteins (Roberts and Sporn, Handbook of Experimental Pharmacology 95 (1990), 419-472), is particularly relevant to a wide range of medical treatments and applications , These factors are useful in procedures involving wound healing and tissue repair. Furthermore, several members of the TGF-β family induce tissue growth, particularly bone growth, and therefore play a central role in inducing the development of cartilage and bone.

Wozney (Progress in Growth Factor Research 1 (1989), 267-280) and Vale et al. (Handbook of Experimental Pharmacology 95 (1990), 211-248) describe various growth factors, such as those related to the BMP (bone morphogenetic proteins) and the inhibin group. The members of these groups have significant structural similarities. The precursor of the protein consists of an amino-terminal signal sequence, a propeptide and a carboxy-terminal sequence of about 110 amino acids, which is cleaved off the precursor and is the mature protein. Furthermore, their members are defined by amino acid sequence homology. The mature protein contains the highest conserved sequences, especially seven cysteine residues conserved among the family members. The TGF-β-like proteins are multifunctional, hormonally active growth factors. They also have related biological activities, such as chemotactic attraction of cells, promotion of cell differentiation, and tissue-inducing capabilities, such as cartilage, bone-inducing capabilities. The U.S. Patent No. 5,013,649 discloses DNA sequences encoding osteoinductive proteins termed BMP-2, and U.S. Patent Application Serial Nos. 179,101 and 170,197 disclose the BMP proteins BMP-1 and BMP-3. Furthermore, many cell types are capable of synthesizing TGF-β-like proteins and virtually all cells have TGF-β receptors.

Overall, these proteins show differences in their structure, leading to significant variations in their exact biological function. Furthermore, they are found in a wide range of different tissue types and developmental stages. Consequently, they may differ in their exact function, e.g. B. have the required cellular physiological environment, their lifespan, their destinations, their needs for auxiliaries and their resistance to degradation. Thus, although numerous proteins that exhibit tissue-inductive, and in particular osteo-inductive, potential are described, their natural roles in the organism and, even more importantly, their medical relevance must be explored in detail. The presence of as yet unknown members of the TGF-β family, which are important for osteogenesis or differentiation / induction of other tissue types, is likely to be assumed. However, a major difficulty in isolating these new TGF-β-like proteins is that their functions can not yet be described accurately enough for the development of a distinctive bioassay. On the other hand, the expected nucleotide sequence homology to known members of the family is too low to allow screening by classical nucleic acid hybridization techniques. However, further isolation and characterization of novel TGF-β-like proteins is urgently needed to provide further inducing and differentiation proteins that meet all desired medical requirements. These factors could be used medicinally in the healing of damage and the treatment of degenerative diseases of the bones and / or other types of tissue, such as, for As kidney or liver, find.

In the patent application PCT / EP93 / 00350 there is provided a nucleotide and amino acid sequence for the TGF-β protein MP-52 indicating the sequence corresponding to the mature peptide and a majority of the sequence corresponding to the propeptide of MP-52. The complete sequence of the propeptide MP-52 is not disclosed.

The object underlying the present invention is to provide a pharmaceutical composition comprising members of the TGF-β protein family with mitogenic and / or differentiation inductive, e.g. B. osteoinductive potential, for use in prevention and / or therapy.

• (a) den für das reife Protein codierenden Anteil und gegebenenfalls weitere funktionelle Anteile der in SEQ ID NO. 1 gezeigten Nukleotidsequenz,
• (b) eine der Sequenz aus (a) im Rahmen der Degeneration des genetischen Codes entsprechende Nukleotidsequenz,
• (c) einem allelischen Derivat einer der Sequenzen aus (a) und (b) entsprechende Nukleotidsequenz, oder
• (d) eine mit einer der Sequenzen aus (a), (b) oder (c) hybridisierende Sequenz umfasst

unter der Voraussetzung, dass ein DNA-Molekül gemäß (d) zumindest den für ein reifes Protein der TGF-β-Familie codierenden Anteil enthält, zur Prävention und/oder Behandlung von Osteoporose und/oder Arthrose, und im Zusammenhang mit Angiogenese.This object is achieved by the use of a pharmaceutical composition containing a protein which is encoded by a DNA molecule, the

• (A) the proportion coding for the mature protein and optionally further functional portions of the in SEQ ID NO. 1 nucleotide sequence shown,
• (b) a nucleotide sequence corresponding to the sequence of (a) in the context of the degeneracy of the genetic code,
• (c) an allelic derivative of one of the sequences of (a) and (b) corresponding nucleotide sequence, or
• (d) a sequence which hybridizes with one of the sequences from (a), (b) or (c)

provided that a DNA molecule according to (d) contains at least the portion coding for a mature protein of the TGF-β family for the prevention and / or treatment of osteoporosis and / or osteoarthritis, and in connection with angiogenesis.

Further embodiments of the present invention relate to the subject matter of claims 3 to 6. Other features and advantages of the invention will become apparent from the description of the preferred embodiments and the drawings. The sequence protocols and drawings will now be briefly described.

SEQ ID NO. Figure 1 shows the complete nucleotide sequence of the DNA encoding TGF-β protein MP-52. The ATG start codon starts with nucleotide 640. The start of the mature protein begins after nucleotide 1782.

SEQ ID NO. Figure 2 shows the complete amino acid sequence of the TGF-β protein MP-52, which consists of the amino acid sequence shown in SEQ ID NO. 1 nucleotide sequence was derived.

1 Figure 3 shows a comparison of the amino acid sequence of MP-52 with some members of the BMP protein family starting at the first of the seven conserved cysteine residues. * means the amino acid is the same in all proteins compared; + means that the amino acid in at least one of the proteins matches that of MP-52.

2 Figure 12 shows the nucleotide sequences of the oligonucleotide primers used in the present invention and a comparison of these sequences with known members of the TGF-β family. M is A or C, S is C or G, R is A or G and K is G or T. 2a shows the sequence of the primer OD, 2b shows the sequence of the primer OID.

The present invention comprises at least the portion coding for the mature protein and optionally further functional portions of the portion shown in SEQ ID NO. 1 nucleotide sequence as well as sequences corresponding to this sequence in the context of the degeneracy of the genetic code and allelic derivatives of such sequences. Furthermore, the present invention also encompasses sequences which hybridize with such sequences, provided that such a DNA molecule completely contains at least the portion coding for a mature protein of the TGF-β family.

The term "functional portion" in the context of the present invention means a protein portion which is capable, for. B. act as signal peptide, propeptide or mature protein portion, d. H. to fulfill at least one of the biological functions of the natural protein components of MP-52.

The coding region for the mature portion of the protein ranges from nucleotides 1783-2142 of SEQ ID NO. 1 sequence shown. Optionally, the DNA molecule may contain further functional portions of the amino acid sequence shown in SEQ ID NO. 1, namely the nucleotide sequences coding for the signal or / and propeptide moiety. Most preferably, the DNA molecule comprises the sequence for the signal and propeptide moieties and the proportion of the mature protein, i. H. nucleotides 640-2142 of SEQ ID NO. 1 sequence shown. On the other hand, in addition to the coding for the mature protein portion of the DNA molecule also functional signal or / and Propeptidanteile of other proteins, in particular of other proteins of the TGF-β family, z. The above-mentioned BMP proteins. The corresponding nucleotide sequences can be taken from the abovementioned references, the disclosure of which is hereby incorporated by reference.

Also disclosed is a DNA molecule as defined above, which additionally contains between nucleotides 1270 and 1271 of the amino acid sequence shown in SEQ ID NO. 1 contains a non-coding intron sequence. This intron sequence is contained in the DSM deposited plasmid SKI 52 (H3) MP12, which has the genomic nucleic acid sequence of MP-52.

Also disclosed is the phage λ 15.1 encoded cDNA sequence of the MP-52 protein. This sequence begins with nucleotide 321 of SEQ ID NO. 1.

Although the allelic, degenerate and hybridizing sequences encompassed by the present invention have structural differences due to subtle changes in nucleotide or / and amino acid sequence, the proteins encoded by such sequences still have substantially the same beneficial properties as their use in principle allow the same medical applications.

In the present invention, the term "hybridization" means conventional hybridization conditions, preferably conditions having a salt concentration of 6 × SSC at 62-66 ° C, followed by a one-hour washing with 0.6 × SSC, 0.1% SDS at 62-66 ° C. More preferably, the term "hybridization" refers to stringent hybridization conditions having a salt concentration of 4 x SSC at 62 to 66 ° C, followed by a one hour wash with 0.1 x SSC, 0.1% SDS at 62 to 66 ° C.

Preferably, DNA sequences, as defined above, which are available from vertebrates, preferably mammals such as pigs, cows, and rodents such as rats or mice, and especially from primates such as humans, are used.

According to the invention in SEQ ID NO. 1 and designated as MP-52. The transcripts of MP-52 were obtained from embryonic tissue and encode a protein that shows considerable amino acid homology to the mature part of the BMP-like proteins (see 1 ). The protein sequences of BMP2 (= BMP2A) and BMP4 (= BMP2B) are described in Wozney et al., Science 242 (1988), 1528-1534. The corresponding sequences of BMP5, BMP6 and BMP7 are described in Celeste et al., Proc. Natl. Acad. Sci. USA 87 (1990), 9843-9847. Some typical sequence homologies specific for known BMP sequences have also been found in the propeptide part of MP-52, while other parts of the precursor part of MP-52 show significant differences from BMP precursors.

Also disclosed is a vector containing at least one copy of a DNA molecule as defined above. In such a vector, the DNA sequence as defined above is preferably operably linked to an expression control sequence. Such vectors are useful for the production of TGF-β-like proteins in stably or transiently transformed cells. Various animal, plant, fungal and bacterial systems can be used for transformation and subsequent cultivation. Preferably, the vectors for replication in the host cell contain necessary sequences and are autonomously replicable. Furthermore, the use of vectors containing selectable marker genes is preferred, whereby the transformation of a host cell is detectable.

Further disclosed is a host cell transformed with a DNA as defined above or a vector as defined above. Examples of suitable host cells include various eukaryotic and prokaryotic cells, such as E. coli, insect cells, plant cells, mammalian cells and fungi, such as yeast.

Also disclosed is a protein of the TGF-β family encoded by a DNA sequence according to claim 1. Preferably, the protein has the sequence shown in SEQ ID NO. 2, or optionally functional moieties thereof, and exhibits biological properties, such as tissue inductive, particularly osteoinductive and / or mitogenic, capabilities that may be relevant to a therapeutic application. The above features of the protein may vary depending on the formation of homodimers or heterodimers. Such structures may also prove suitable for clinical applications.

The biological properties of the proteins, in particular the mitogenic and osteoinductive potential can, for. In assays according to Roberts et al., PNAS 78 (1981), 5339-5343, Seyedin et al., PNAS 82 (1985), 2267-2271 or Sampath and Reddi, PNAS 78 (1981), 7599-7603 ,

Also disclosed is a method of producing a protein of the TGF-β family, which comprises culturing a host cell transformed with a DNA as defined above or a vector as defined above and removing the TGF-β protein from the cell or / and the culture supernatant wins. Such a method comprises culturing the transformed host cell in a suitable culture medium and purifying the TGF-β-like protein produced. In this way, the method enables the preparation of a sufficient amount of the desired protein for use in the medical Treatment or in applications using cell culture techniques that require growth factors. The host cell may be a bacterium such as Bacillus or E. coli, a fungus such as yeast, a plant cell such as tobacco, potato or Arabidopsis or an animal cell, especially a vertebrate cell line such as Mo, COS or CHO. Cell lines or an insect cell line.

An object of the present invention is to provide pharmaceutical compositions containing a pharmaceutically effective amount of a TGF-β-like protein as defined above as an active ingredient. Optionally, such a composition comprises a pharmaceutically acceptable carrier, excipient, diluent or filler. Such a pharmaceutical composition can be used in wound healing and tissue repair as well as in the healing of bone, cartilage, connective tissue, skin, mucosal, epithelial or tooth damage, and in dental implants, either alone or in combination with other agents, e.g. Other proteins of the TGF-β family or growth factors such as EGF (epidermal growth factor) or PDGF (platelet derived growth factor). Furthermore, such a pharmaceutical composition in the disease prevention, such as. For the prevention of osteoporosis and osteoarthritis.

Another potential clinical application of the TGF-β-like protein as defined above is the use as an immune response suppressor to prevent rejection of organ transplants or use in conjunction with angiogenesis. The pharmaceutical composition according to the invention can also be used prophylactically or in cosmetic surgery. Furthermore, the application of the composition is not limited to humans, but may also include animals, especially pets.

Finally, an antibody is disclosed which can specifically bind to the proteins as defined above, or such an antibody fragment (e.g., Fab or Fab '). Methods of making such a specific antibody or antibody fragment are within the general skill of one of ordinary skill in the art. Preferably, such an antibody is a monoclonal antibody. Such antibodies or antibody fragments could also be useful in diagnostic methods.

Furthermore, the invention will be illustrated by the following example.

example 1

Isolation of MP-52

• 1.1 Total RNA was isolated from human embryonic tissue (8 to 9 weeks old) by the method of Chirgwin et al., Biochemistry 18 (1979), 5294-5299. Poly (A +) RNA was separated from total RNA by oligo (dT) chromatography according to the manufacturer's instructions (Stratagene Poly (A) Quick columns).
• 1.2 For the reverse transcription reaction, 1 to 2.5 μg of poly (A +) RNA was heated to 65 ° C for 5 minutes and cooled rapidly on ice. The reaction mixture contained 27 U RNA Guard (Pharmacia), 2.5 μg oligo (dT) 12-18 (Pharmacia), 5x buffer (250 mmol / l Tris / HCl pH 8.5, 50 mmol / l MgCl 2, 50 mmol / L DTT, 5 mmol / L of each dNTP, 600 mmol / L KCl) and 20 U AMV reverse transcriptase (Boehringer Mannheim) per μg poly (A +) RNA. The reaction mixture (25 μl) was incubated for 2 hours at 42 ° C.
• 1.3 The in 2 Deoxynucleotide primers OD and OID were prepared on an automatic DNA synthesizer (Biosearch). Purification was by denaturing polyacrylamide gel electrophoresis and isolating the major band from the gel by isotachophoresis. The oligonucleotides were designed by comparing the nucleic acid sequences of known members of the TGF-β family and selecting regions with the highest conservation. A comparison of this region is in 2 shown. To facilitate cloning, both nucleotides contained EcoRI restriction sites and OD additionally contained an NcoI restriction site at its 5'-terminus.
• 1.4 In the PCR reaction, 20 ng poly (A +) RNA corresponding cDNA from starting material was used. The reaction was carried out in a volume of 50 μl and contained 1 × PCR buffer (16.6 mmol / l (NH4) 2SO4, 67 mmol / l Tris / HCl pH 8.8, 2 mmol / l MgCl2, 6.7 μmol / L EDTA, 10 mmol / L β-mercaptoethanol, 170 μg / ml bovine serum albumin (Gibco), 200 μmol / L of each dNTP (Pharmacia), 30 μmol of each oligonucleotide (OD and OID) and 1.5 U Taq- Polymerase (AmpliTaq, Perkin Elmer Cetus) The reaction mixture was over-coated with paraffin and 40 cycles of PCR were performed The products of the PCR reaction were purified by phenol / chloroform extraction and concentrated by ethanol precipitation.
• 1.5 The PCR reaction product was digested with the restriction enzymes SphI (Pharmacia) and AlwNI (Biolabs) according to the manufacturer's instructions.
• 1.6 The products of restriction cleavage were fractionated by agarose gel electrophoresis. After staining with ethidium bromide, uncleaved amplification products were excised from the gel and isolated by phenol extraction. The resulting DNA was then purified twice by phenol / chloroform extraction.
• 1.7 After ethanol precipitation, one quarter or one fifth of the isolated DNA was reamplified using the same conditions as for the primary amplification, except that the number of cycles was reduced to 13. The reamplification products were purified, cut with the same enzymes as above, and the uncut products were isolated from agarose gels as explained above for the amplification products. The reamplification step was repeated twice.
• 1.8 Following final isolation from the gel, the amplification products were cleaved by 4 U EcoRI (Pharmacia) under the conditions recommended by the manufacturer. One quarter of the restriction mixture was ligated into the EcoRI digested vector pBluescriptII SK + (Stratagene). After ligation, 24 clones were further analyzed by sequencing. The AlwNI and SphI digested sample revealed a new sequence, designated MP-52. The other clones contained predominantly BMP6 sequences and one contained a BMP7 sequence.

The clone was completed to the 3 'end of the cDNA according to the method described in detail by Frohmann (Amplifications, published by Perkin-Elmer Corp., Issue 5 (1990), pp 11-15). The same embryonic mRNA used to isolate the first fragment of MP-52 was reverse transcribed as described above. Amplification was performed using the adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CTTGAGTACGAGGCTTTCCACTG) of the MP-52 sequence. The amplification products were reamplified using an overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and an overlapping internal primer (GGAGCCCACGAATCATGCAGTCA) of the MP-52 sequence. The reamplification products were cloned and sequenced after restriction cleavage with NcoI in a similarly cleaved vector (pUC 19 (Pharmacia No. 27-4951-01) with an altered multiple cloning site containing a unique NcoI restriction site). The clones were characterized by their sequence overlap at the 3 'end of the known MP-52 sequence. One of these was used as a probe to screen a human genomic library (Stratagene # 946203) according to a detailed review by Ausubel et al. (Current Protocols in Molecular Biology, published by Greene Publishing Associates and Wiley-Interscience (1989)). From 8 × 10 ⁵ λ phage, a phage (λ2.7.4) was isolated which contained an insertion of about 20 kb and deposited with DSM under accession number 7387. In addition to the sequence isolated from mRNA by the amplification methods described, this clone contains further sequence information at the 5 'end.

For sequence analysis, a HindIII fragment of about 7.5 kb was subcloned into a similarly cut vector (Bluescript SK, Stratagene No. 212206). This plasmid, designated SKL 52 (H3) MP12, was also deposited with DSM under accession number 7353. The in SEQ ID NO. Sequence information shown in Fig. 1 is from phage λ 2.7.4. The ATG at position 640 is the first ATG within the reading frame (at position 403, a stop codon occurs). Based on the sequence data, it can be assumed that this is the start codon for translation.

The genomic DNA contains an intron of about 2 kb between base pairs 1270 and 1271 of SEQ ID NO. 1. The sequence of the intron is not shown. The accuracy of the splice site was confirmed by sequencing an amplification product derived from a cDNA containing this region. This sequence information was obtained by a slightly modified method, which is described in detail in Frohman (Amplifications, published by Perkin-Elmer Corporation, Issue 5 (1990), pp 11-15). The same embryonic RNA that was also used to isolate the 3'-end of MP-52 was reverse transcribed using an internal 5'-directed primer of the MP-52 sequence (ACAGCAGGTGGGTGGTGTGGACT). A polyA tail was added to the 5 'end of the first cDNA strand using terminal transferase. A 2-step amplification was performed, first by using a primer consisting of oligo dT and an adapter sequence (AGAATTCGCATGCCATGGTCGACGAAGC (T16)) and secondly an adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (CCAGCAGCCCATCCTTCTCC) of the MP-52 sequence. The amplification products were reamplified using the same adapter primer and an overlapping internal primer (TCCAGGGCACTAATGTCAAACACG) of the MP-52 sequence. Subsequently, the reamplification products were reamplified using an overlapping adapter primer (ATTCGCATGCCATGGTCGACGAAG) and an overlapping internal primer (ACTAATGTCAAACACGTACCTCTG) of the MP-52 sequence. The Reamplifizierungsendprodukte were with blunt ends into a vector (Bluescript SK, Stratagene No. 212206) cleaved with EcoRV. The clones were characterized by their sequence overlap with the DNA of λ 2.7.4. characterized.

Furthermore, a cDNA library prepared from RNA from fibroblasts and cloned in λgt10 was screened. In this case, 2 × 10 ⁶ phages were tested, with a ca. 1 kb fragment of the genomic MP-52 DNA (second exon up to the HindIII restriction site in the 3'-untranslated region) serving as the radioactive probe. 17 mixed plaques were picked which were checked by PCR using primers from the 5 'and 3' region of the MP-52 sequence. Thereupon 8 phage plaques were selected and separated. The cDNA was isolated from the phage via EcoRI partial cleavage and cloned into the Bluescript vector, also digested with EcoRI.

Sequencing of one of the resulting plasmids SK52L15.1MP25 revealed that the longest phage (15.1) at nucleotide # 321 of SEQ ID NO. 1 starts. Furthermore, sequencing confirmed the splice site (nucleotide 1270).

The plasmid SKL 52 (H3) MP12 was deposited under the accession number 7353 at DSM (German Collection of Microorganisms and Cell Cultures, Mascher or Weg 1b, 3300 Braunschweig) on December 10, 1992.

Phage λ 2.7.4 was deposited at DSM on January 13, 1993 under accession number 7387.

Plasmid SK52L15.1MP25 was deposited under the accession number 8421 at DSM on July 16, 1993.

Example 2

Expression of MP52

Different systems were tested for the expression of MP52. The use of vaccinia virus as an expression system is described in detail and to one skilled in the art in Current Protocols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wiley-Interscience, Wiley & Sons) abbreviated below to CP under Chapter 16 Unit 16.15- 16.18 described. The system relies on the possibility of integrating foreign DNA into the vaccinia virus genome using specific vectors by homologous recombination. For this purpose, the vector used contains the TK (thymidine kinase) gene from the vaccinia genome. In order to allow selection for recombinant viruses, the vector further contains the E. coli xanthine-guanine phosphoribosyl transferase gene (gpt) (Falkner et al., J. Virol., 62 (1988), 1849-1854). Into this vector, the cDNA was cloned with the entire coding region for MP52. The cDNA comes from the plasmid SK52L15.1MP25 (DSM, accession number 8421), which was initially deleted and intercloned to remove a large portion of the 5 'untranslated region. For this purpose, the plasmid SK52L15.1MP25 was linearized with SalI and gradually deleted the 5 'end with the ExoIII / Mung bean kit (Stratagene # 200330) according to the manufacturer. After restriction with BamHI, the differently deleted MP52 cDNAs were separated from the residual vector by means of an agarose gel, isolated and purified by standard methods (Sambrook et al., Molecular Cloning, second edition, Cold Spring Harbor Laboratory Press 1989) in a pBluescriptII restricted with EcoRV and BamHI SK vector (Stratagene # 212206) between cloned (pSK52s). All restrictions were made according to the manufacturer. Sequencing with Sequenase (USB / Amersham # 70770) yielded, inter alia, a clone encoding nucleotide 576 in SEQ ID NO. 1 (64 base pairs away from the start codon) starts. From this, the cDNA insert was isolated via SalI and SacI restriction and cloned into the similarly cleaved vector for recombination in vaccinia. The resulting plasmid (pBP1MP52s) was deposited with DSM (accession number 9217) on May 24, 1994 and used for the production of recombinant vaccinia viruses. To this end, 80% confluent 1438 cells (HuTk, ATCC CRL 8303) in 35 mm culture dishes were infected with vaccinia wild-type virus in 2 ml PBS for 30 minutes at room temperature with occasional shaking (1 virus per 10 cells). After aspirating the supernatant and adding 2 ml of culture medium (MEM, Gibco BRL # 041-01095), it was incubated for 2 hours at 37 ° C. The medium was then removed and the transformation of these cells with 100 ng of pBP1MP52s, 2 μg of carrier DNA (calf thymus, Boehringer Mannheim # 104175) and 10 μl of lipofectin (Gibco BRL # 18292-011) in 1 ml MEM for 15 h at 37 ° C reached. After addition of 1 ml of MEM with 20% FCS (Gibco BRL # 011-06290), incubation was continued for a further 24 hours at 37 ° C and the lysed cells were subsequently frozen.

The gpt selection for xanthine-guanine phosphoribosyl transferase and isolation and amplification of individual recombinant viruses was essentially as described in Unit 16.17 of the CP, with the difference that RK13 cells (ATCC CCL 37) were used.

Integration of the MP52 cDNA into the virus genome was confirmed by dot blot and Southern blot analysis (CP Unit 16.18). A recombinant virus was used for expression analyzes in cell line 143B (HuTk, ATCC CRL 8303, human). The confluent cells were infected with the number of viruses corresponding to the number of cells for 45 minutes at 37 ° C and then the appropriate culture medium (MEM, Gibco BRL # 041-01095) with 10% FCS and penicillin / streptomycin (1: 500, Gibco BRL # 043-05140H). After 6 hours at 37 ° C, the medium was removed, the cells were washed twice with z. HBSS (Gibco BRL # 042-04180M) and production medium (e.g., MEM) added without FCS. After 20 to 22 hours of production, the cell supernatant was collected. The expression was analyzed by Western blots according to standard methods (CP Unit 10.8). For this, the proteins were precipitated from 100 to 500 μl of cell culture supernatant by addition of the equivalent volume of acetone and incubation of at least one hour on ice and centrifuged off. After resuspension of the pellet in loading buffer (7 M urea, 1% SDS, 7 mM sodium dihydrogen phosphate, 0.01% bromophenol blue and optionally 1% β-mercaptoethanol), the separation was carried out in 15% polyacrylamide gels. As marker proteins, a pre-stained protein molecular weight standard (Gibco BRL # 26041-020) was used. Transfer to PVDF membrane (Immobilon # IPVH00010) and blocking of the membrane were done by standard methods.

For the detection of MP52 on the membrane, polyclonal antibodies to MP52 had been generated in both chickens and rabbits. For this purpose, the mature portion of MP52 with 6 histidines at the N-terminus in E. coli was expressed and purified, such. As described in Hochuli et al. (BIO / Technology, Vol. 6, 1321-1325 (1988)). With both antibodies it is possible to specifically detect expression of MP52, whereby dimeric MP52 is recognized less efficiently than monomeric. For the Western blot in 3 For example, chicken antibodies raised via PEG precipitation (Thalley et al., BIO / Technology Vol. 8, 934-938 (1990)) and membrane-bound antigen (mature MP52 with 6 histidines) (18.17 in Sambrook et al , Molecular Cloning, second edition, Cold Spring Harbor Laboratory Press 1989). The second antibody used was anti-chicken IgG coupled with alkaline phosphatase (Sigma A9171). Detection was carried out with the Tropix Western-Light Protein Detection Kit (Serva # WL10RC) according to the manufacturer's instructions.

The western blot in 3 shows that only with the recombinant viruses, but not in the wild-type viruses (without integrated foreign DNA) MP52 specific bands occur. Expression of MP52 results in a secreted protein with a molecular weight of approximately 25 kDa appearing in the gel under non-reducing conditions. Under reducing conditions, the protein runs at 14 to 15 kDa in the gel. These results show that MP52 is expressed as a dimeric mature protein. The weak bands in the region above 60 kDa appearing in Western blot are probably residues of uncut precursor proteins. The running behavior also confirms the SEQ ID NO. 2 derived theoretical molecular weights, according to which mature, monomeric MP52 has a size of 13.6 kDa.

The expression of MP52 and cleavage of the precursor protein to mature MP52 is demonstrably possible in different cell lines. C127 (ATCC CRL 1616, mouse), BHK21 (ATCC CCL 10, hamster), MRC-5 (ATCC CCL 171, human), and 3T6 Swiss albino (ATCC CCL 96, mouse) cells were tested.

Expression and cleavage to mature MP52 has also been demonstrated in another eukaryotic expression system. For this, the cDNA of MP52 (beginning with nucleotide 576) was cloned into the expression plasmid pSG5 (Stratagene # 216201). The plasmid pSK52s was restricted with ClaI and XbaI and blunted by T4 polymerase treatment on the overhanging ends of the MP52 insert. The cloning in the EcoRI-restricted and also blunt-ended by T4 polymerase treatment vector pSG5 was carried out according to standard methods. All enzymatic reactions were carried out according to the manufacturer's instructions. The correct orientation of the MP52 insert was confirmed by restriction analysis and annealing with the T7 primer (Stratagene # 300302). The resulting plasmid pSG52s (deposited with the DSM accession number DSM 9204 on 17.05.94) can be labeled with a vector which codes for a selectable marker, such as e.g. As the gene for G418 resistance, are cotransformed to obtain stable cell lines. For this purpose, pSG52s was cotransformed with the plasmid p3616 (deposited with the DSM accession number DSM 9203 on 17.05.94) into L929 cells (ATCC CCL1, mouse) with lipofectin (Gibco BRL # 18292-011) according to the manufacturer's instructions. The selection with G418 was carried out by methods known to the person skilled in the art (CP, unit 9.5) and resulted in a cell line which produced detectably mature MP52 in the Western blot.

Another expression vector for MP52 was generated using the plasmid pABWN (Niwa et al., Gene 108 (1991), 193-200 and 4 ), by Dr. med. Miyazaki was made available.

For this purpose, the Hind III fragment from the plasmid pSK52s, which was labeled nucleotide 576 in SEQ ID NO. 1 starts, isolated and the overhanging ends rendered blunt-ended by treatment with Klenow fragment. By ligation of the adapter, a Not I restriction site was introduced at both fragment ends. Adapter:

The vector pABWN was restricted with Xho I, also treated with the Klenow fragment and dephosphorylated with calf intestinal alkaline phosphatase (Boehringer Mannheim). The same phosphorylated adapter was ligated so that insertion of the MP52 fragment following restriction with Not I into the generated Not I site of the vector was possible. The resulting expression vector is hereinafter referred to as Hind III-MP52 / pABWN. All reactions for the cloning were carried out according to standard methods (eg CP unit 3.16).

The structure of the Hind III-MP52 / pABWN expression vector was confirmed by sequencing and restriction mapping. Hind III-MP52 / pABWN contains the MP52 sequence starting with nucleotide 576 and ending with nucleotide 2278 in SEQ ID NO. 1.

Hind III-MP52 / pABWN was transfected into L-cells (mouse fibroblasts) and stable transformants were established therefrom.

For this purpose, in each case 4 μg of the plasmids (Hind III-MP52 / pABWN or pABWN) were transfected into 5 × 10 ⁵ L cells on a 6 cm culture dish using 20 μl LipofectAMINE reagent (Gibco BRL # 18324-012). Solution A (4 μg of the respective plasmid DNA in 200 μl OPTI-MEM I (Gibco BRL # 31985)) was mixed carefully with solution B (20 μl LipofectAMINE reagent in 200 μl OPTI-MEM I) and at room temperature for 45 minutes Formation of the DNA-liposome complex incubated. During this time, the cells were washed once with 2 ml of OPTI-MEM I. For each transfection, 1.6 ml of OPTI-MEM I was added to the DNA-liposome complex vessel. The solution was mixed gently, covering the washed cells. The cells were incubated with the diluted complex for 5 hours at 37 ° C in the CO ₂ incubator. After incubation, 2 ml of DMEM (Gibco BRL, Dulbecco's Modified Eagle Medium) / 20% FCS was added. 24 hours after transfection, the medium was replaced with fresh DMEM / 10% FCS. 48 hours after the start of transfection, the cells were transferred to a 10 cm culture dish. 72 hours after the start of transfection, G418 selection was started at a concentration of 800 μg / ml. The stable clones appeared after 1 to 2 weeks.

5 ml of conditioned DMEM with or without FCS was obtained from confluent transformants grown in a 10 cm culture dish for 3 days. The 2 different cell culture supernatants (HindIII-MP52 / pABWN and pABWN) of transfected cells and cell lysates were examined by Western blot. In this case, mature MP52 was found in conditioned medium as well as in cell lysates of HindIII-MP52 / pABWN transfected cells. Clones were further cloned and MP52 producing cells were selected by Western blot analysis. Estimates from Western blot analysis revealed MP52 production up to 1 mg / l.

Example 3:

Biological activity of MP52

To demonstrate the biological activity of MP52 and demonstrate the usefulness of this invention for medical applications for the prevention and / or treatment of bone disease, several in vitro and in vivo experiments were performed.

1. In vitro assays

1.1

Since an increase in glycosaminoglycan (GAG) synthesis in chondrocytes after TGF-β stimulation has been described (Hiraki et al., Biochimica et Biophysica Acta 969 (1988), 91-99), it was investigated whether MP52 also exerts this influence. Using cell culture supernatants (DMEM with 10% FCS) of MP52-producing L-cell transformants (transfected with Hind III-MP52 / pABWN), the chondrogenic activity of MP52 in primary cultures was tested from fetal rat extremities.

The four extremities of 16-day-old rat fetuses were used for this purpose.

After trypsinization, the recovered cells were plated in F-12 medium (Nutrient Mixture Ham's F-12, Gibco BRL # 21700) with 10% FCS on Collagen Type I coated 24-well plates containing 3 x 10 ⁵ cells and incubated for ca. 2 days Confluence cultivated. To 500 μl culture medium (F-12 medium with 10% FCS) was in each case 56 μl conditioned medium (KM) of HindIII-MP52 / pABWN-L-cell transfectants, of pABWN-L-cell transfectants or only medium (DMEM with 10% FCS). given. Over a period of 0, 3, 6 and 9 days, F-12 medium with 10% FCS and the appropriate additives was used. Every three days there was a change of the medium with the appropriate additives. Thereafter, the culture was cultured for a further 2 days in F-12 medium without FCS in the presence of the appropriate additives (conditioned media or control medium) and then added to ³⁵ S-sulfate for 6 hours. ³⁵ S incorporated into polysaccharides after pronase E digestion and precipitation as described in Hiraki et al. (Biochimica et Biophysica Acta 969 (1988), 91-99). Table 1: Radioactivity (cpm / well) Number of incubation days DMEM (10% FCS) from control L cells KM of pABWN-L cell transfectants KM of HindIII-MP52 / pABWN-L cell transfectants 2 3720 ± 114 3865 ± 120 4879 ± 422 5 4188 ± 135 4154 ± 29 8223 ± 275 * 8th 3546 ± 160 3310 ± 115 9890 ± 1260 * 11 3679 ± 18 3633 ± 167 7520 ± 160 * Values refer to ± SEM for 3 or 4 culture approaches
*: p <0.01 vs DMEM and KM of pABWN-L cell transfectants (Scheffe's multiple t-test)

As shown in Table 1, the cell culture supernatants of MP52-producing transfectants significantly stimulated GAG synthesis as compared to pure culture medium (DMEM with 10% FCS) or cell culture supernatant of pABWN-transfected L cells. This shows that MP52 can stimulate ccddifferentiation.

1.2

A reported effect for some members of the BMP family is the enhancement of alkaline phosphatase (ALP) activity in osteoblasts. The rat clonal cell line ROB-C26 (C-26) is one of the osteoblasts of a relatively early stage of maturation (Yamaguchi et al., Calcif Tissue Int 49 (1991), 221-225).

For osteoinductive proteins such. For example, BMP-2 is the ability to increase ALP activity in Yamaguchi et al. (J. Cell Biol. 113 (1991), 681-687).

The influence of MP52 on C26 cells was examined as follows: The C26 cells were seeded at 3x10 ⁴ cells per well in a 24-well plate and cultured in α-MEM (Gibco BRL) / 10% FCS to confluency , 56 μl of the cell culture supernatant of MP52-producing L-cell transfectants (Hind III-MP52 / pABWN) or cell culture supernatant of pABWN-L-cell transfectants or only cell culture supernatant (DMEM with 10% FCS) of L cells were added to 500 μl of the C cell per well. 26 cell culture medium given. A medium change with the appropriate additions were made every three days. The ALP activity in the cell extracts was determined after 0, 3, 6, 9 and 12 days using standard techniques based on p-nitrophenyl phosphate as substrate, such as. As described by Takuwa et al. (Am J. Physiol 257 (1989), E797-E803). Table 2: ALP activity (nmol / min) per well Number of incubation days DMEM (10% FCS) from control L cells KM of pABWN-L cell transfectants KM of HindIII-MP52 / pABWN-L cell transfectants 0 41.8 ± 2.8 41.8 ± 2.8 41.8 ± 2.8 3 136.3 ± 3.7 125.8, ± 2.3 181.3 ± 14.2 * 6 129.0 ± 7.8 119.3 ± 6.4 258.0 ± 8.3 * 9 118.4 ± 3.7 110.1 ± 2.8 258.4 ± 10.6 * 12 121.2 ± 3.2 125.3 ± 6.0 237.8 ± 11.0 * Values refer to ± SD for 4 culture approaches
*: p <0.01 vs DMEM and KM of pABWN-L cell transfectants (Scheffe's multiple t-test)

As shown in Table 2, ALP activity by MP52 addition increases significantly as compared to pure DMEM / 10% FCS medium and medium of pABWN-infected L cells. This result shows that MP52 can not only effect chondrocyte differentiation but also osteoblast differentiation and maturation.

Another osteoblast cell line (MC3T3-E1, mouse), which as described in Takuwa et al. (Biochem. Biophys. Res. Com. 174 (1991), 96-101) described by BMP-2 treatment shows an increase in ALP activity, gives after incubation with conditioned medium of MP52 producing L-cell transfectants (Hind III-MP52 / pABWN) or medium after MP52 production by infection with recombinant vaccinia viruses no change in ALP activity. This indicates that MP52 z. T. has one of BMP-2 deviating cell specificity. Different functions due to different target sites for the individual TGF-β family members can be of great medical relevance.

2. In vivo experiments

2.1

The most meaningful way to study bone development is based on ectopic bone formation in vivo. This can, for. B. induced by implantation of demineralized bone matrix (Urist, Science 150 (1965), 893-899). By combining inactive matrix with bone-inducing proteins, the same process can be induced as it is, for. B. is described in Sampath et al. (PNAS Proc.Natl.Acad.sci., USA 78 (1981), 7599-7603). This bone formation process is similar to that of embryonic endochondral bone formation and adult bone healing. Thus, this method offers the opportunity to study proteins for their ability to induce bone in vivo.

For such an experiment, MP52 protein obtained by expression in the vaccinia system (see Example 2) was partially purified and implanted.

For this, 143B cells (HuTk-, ATCC CRL 8303) were grown to confluence in culture dishes and roller bottles and, as described in Example 2 for expression analyzes, infected with recombinant viruses, washed and MP52 in MEM for about 20 hours (Gibco BRL, ca. 1 ml per 10 ⁶ cells). As a control, the same approach was carried out by infection with wild-type viruses. Cell culture supernatant (conditioned medium) from each batch was collected and centrifuged (40,000 x g for 30 minutes at 4 ° C). To remove the viruses, the supernatants were filtered through inorganic filters (0.1 μm pore size, Whatman, Anotop 25). In the course of the characterization of MP52 it could be shown that this protein binds to heparin sepharose. This behavior was exploited for a partial cleaning. Thereto, the filtered and centrifuged conditioned medium was brought to a final concentration of 50mM Tris pH 7.0, 100mM NaCl and 6M urea and placed on a heparin column (HiTrap ^™ , Pharmacia # 17-0407-01) equilibrated in Buffer A (50 mM Tris pH 7.0, 100 mM NaCl and 6 M urea). The loaded column was washed with buffer A and eluted with a linear gradient to 100% buffer B (50 mM Tris pH 7.0, 600 mM NaCl and 6 M urea) at a flow rate of 0.5 ml / min within 50 min (2.5 ml per fraction). The use of urea is not mandatory. Western blot analysis (see Example 2) verified that MP52 reproducibly elutes mainly in 2 fractions at approximately 250 to 400 mM NaCl. Aliquots of these fractions were also examined in 15% polyacrylamide gels (Silver Stain-II, Daiichi # SE140000) stained with silver according to the manufacturer's instructions and the fractions were pooled. The comparable fractions after purification of conditioned medium after infection with wild-type virus were also pooled after analysis in silver-stained gels.

Further studies on MP52 revealed that MP52 also binds to hydroxyapatite. Therefore, it is possible in principle to achieve an additional purification by a hydroxyapatite column, or to replace a heparin column by a hydroxyapatite column (for example: BIO-RAD, Econo-pac HTP). Conceivable for other purifications, other methods known in the art such. As gel columns, ion exchange columns, affinity columns, metal chelates columns or columns based on hydrophobic interactions.

The MP52 protein pre-purified by heparin sepharose chromatography or the correspondingly contaminating proteins, which are also present in the wild-type infected cell culture supernatants, were further purified by reversed phase HPLC. For this, a C8 column (Aquapore RP300, Applied Biosystems, particle size: 7 μm, pore size: 300 Å) was equilibrated with 10% buffer B (Buffer A: 0.1% trifluoroacetic acid; Buffer B: 90% acetonitrile, 0.1%). trifluoroacetic acid). After loading the column with the pooled MP52-containing fractions of the heparin column, extensive washing with 10% buffer B was performed. The bound protein was eluted with the following gradient: 10 to 50% buffer B over 20 minutes and 50 to 100% buffer B over 50 minutes. Fractions of 500 μl were collected and analyzed in both Western blot and silver stained gels. The MP52 protein elutes approximately in the range of 55 to 65% acetonitrile under the chosen conditions. The fractions with MP52 were pooled. The same was done with the corresponding fractions from the control purification of cell culture supernatant of cells infected with wild-type virus.

Also, partially purified MP52 protein showed a marked increase in ALP activity on ROB-C26 cells after three days of incubation, as estimated by Western blot analysis at 50 ng / ml.

Partially purified MP52 protein or control protein from the correspondingly partially purified cell culture supernatants after wild-type virus infection was reconstituted with matrix and implanted in rats in order to demonstrate the ability to form cartilage and bone.

In principle, various matrix materials known to those skilled in the art should be usable, i. H. natural (also modified) and synthetically produced matrices, but preferred are biocompatible, in vivo biodegradable porous materials. In these experiments, rat bone matrix was used, which was essentially similar to Sampath et al. (PNAS 80 (1983), 6591-6595) was prepared. The rat bones (femur and tibia) were demineralized in 0.6 M HCL for 24 hours and then any remaining bone marrow removed. After washing with water and degreasing for 3 hours in a chloroform / methanol (1/1) mixture, the bones were air-dried, deep-frozen, pulverized in a mill and sieved particle sizes between 400 to 1000 microns. Subsequently, the matrix was extracted for 7 days at room temperature in 4 M guanidinium HCl in the presence of protease inhibitors. After extensive washing with water, the matrix was lyophilized and stored at 4 ° C. Matrices treated in this way alone no longer show bone-inducing activity.

Protein can be combined with the extracted bone matrix by various methods known to those skilled in the art.

MP52 protein or control protein, purified by both Heparin Sepharose and Reversed Phase HPLC, was combined in the acetonitrile / trifluoroacetic acid solution after elution with 25 mg matrix per implant, well mixed, frozen and lyophilized.

For the implantation of matrix-bound MP52, two approximately 3-month-old rats (Whistar) were used, obtained by intramuscular injection of a narcotizing agent (0.2 ml Rompun (Bayer) mixed with 0.5 ml Ketanest 50 (Parke Davis)) with 0, 14 ml per 100 g body weight had been anesthetized. For the Implants were prepared bilaterally in abdominal muscles (below the thorax, starting approximately 0.5 cm below the lowest costal arch). The matrix-bound MP52 (approximately 2 to 4 g as estimated on Western blots) and the corresponding matrix-bound control proteins were moistened with 0.9% saline (Delta Pharma) and transferred to the muscle pockets. The muscle pockets and the necessary incisions were then sutured. The rats were immunosuppressed with cyclosporin A (Sandimmun).

After 18 or 26 days, the implants were removed from the rats and fixed for histological examination. Since the implant with MP52 was already macroscopically suggestive of bone formation after 26 days, it was embedded in methyl methacrylate to make thin sections, and the other implants were embedded in paraffin. Mineralized cartilage and bone tissues are highlighted in black by the technique described by Kossa Färbetechnik (Romeis, B .; Microscopy Technique, Ed: Böck, P. Urban and Schwarzenberg, Munich, Baltimore, Vienna (1989)). In trichrome staining according to Masson-Goldner (Romeis, B .; Microscopic Technique, Ed: Böck, P. Urban and Schwarzenberg, Munich, Baltimore, Vienna (1989)) mineralized bone tissue and collagen are stained bright green, osteoid is red and cytoplasm reddish-brown. Both staining techniques were applied to the implants from both rats. With both staining techniques, significant cartilage and bone formation could be detected in the implants containing MP52 in both animals. The corresponding implants with control protein showed no cartilage or bone formation. The proportion of cartilage precursors with chondrocytes and cartilage areas with onset of extracellular matrix formation and their mineralization in concentric circles is higher in the MP52 implant after 18 days than in 26 days. However, mature bone tissue with vectorial osteoid formation as well as individual osteocytes in the bone are also detectable in the implant after 18 days. Furthermore, closed ossicles are recognizable with incipient bone marrow formation. Cartilage areas with incipient matrix formation and calcification are also detectable on the implant after 26 days, but the proportion of green-stained mineralized bone tissue with osteocytes and osteoid spaces has increased significantly. Bone marrow formation with isolated fatty cell deposits can also be detected in this implant. To illustrate shows 5 the colorectal evidence (of Kossa) of the bone material from the total implant after 26 days. In 6 a small section of the same implant is shown after Masson-Goldner staining. It shows active bone with a border of cuboidal osteoblasts and osteoid in which single walled osteoblasts are recognizable. Furthermore, individual osteocytes are visible in the mineralized bone tissue (stained green in the original preparation). Bone marrow formation is also detectable.

The experiment shows that recombinantly produced MP52 alone, in combination with a matrix, is able to induce endochondral bone formation.

2.2

To confirm the results, another ectopic bone formation test was performed using the MP52 L cell transformants. MP52-producing (Hind III-MP52 / pABWN transfected) and non-producing (pABWN-transfected) L-cells (1 x 10 ⁶ cells) were injected into the bilateral leg musculature of three male nude mice each. After three weeks, all animals were killed, the thigh muscles were separated and examined with both low-energy X-rays and histopathology.

As listed in Table 3, X-ray analysis shows dense material at the injection sites in the muscle tissue of all MP52-producing L cells.

Histological examination revealed simple cartilage formation and calcified cartilage formation in the muscles. These results also confirm that MP52 can induce echondodral bone formation. Table 3: MP52 producing cells (HindIII-MP52 / pABWN) Control cells (pABWN) dense material in X-ray analysis 3.3 0/3 Chondrocytes in histology 3.3 0/3 Calcifying cartilage formation in histology 3.3 0/3

The experiments carried out confirm that MP52 protein stimulates the formation of cartilage from undifferentiated mesenchymal cells, as well as the differentiation and maturation of osteoblasts. This results in endochondral bone formation similar to the induction cascade in embryonic bone formation and bone healing in fractures.

SEQ ID NO: 2

The conditions listed in the experiments should be regarded as an illustration of the MP52 activity and not as a limitation. The invention may also be studied and characterized in other ways. SEQ ID NO. 1

SEQ ID NO: 2

Claims (6)

Use of a pharmaceutical composition containing a protein encoded by a DNA sequence which comprises (a) nucleotides 1783-2142, 640-2142 or 1837-2142 of SEQ ID NO: 1, (b) any of the sequences of (a in the context of the degeneracy of the genetic code corresponding nucleotide sequence, (c) an allelic derivative of one of the sequences of (a) or (b) corresponding nucleotide sequence, or (d) a nucleotide sequence which hybridizes with one of the sequences from (a), (b) or (c) under stringent conditions, provided that at least one DNA molecule according to (d) comprises at least that for a mature TGF protein. β-encoding portion for the prevention and / or treatment of osteoporosis and / or osteoarthritis. Use of a pharmaceutical composition containing a protein encoded by a DNA sequence which (a) nucleotides 1783-2142, 640-2142 or 1837-2142 of SEQ ID NO: 1, (b) one of the sequences of (a) nucleotide sequence corresponding to the degeneracy of the genetic code, (c) an allelic derivative of one of the sequences of (a) or (b) corresponding nucleotide sequence, or (d) a nucleotide sequence which hybridizes with one of the sequences from (a), (b) or (c) under stringent conditions, provided that a DNA molecule according to (d) contains at least the portion coding for a mature protein of the TGF-β family in connection with angiogenesis. Use according to one of claims 1 or 2, characterized in that the protein has the amino acid sequence shown in SEQ ID NO. 2, or optionally functional moieties thereof. Use according to one of claims 1 to 3, characterized in that the composition additionally contains carriers, auxiliaries, diluents and / or fillers. Use according to one of claims 1 to 4, characterized in that the composition additionally contains a further growth factor. Use according to claim 5, characterized in that the growth factor is EGF, PDGF or a protein of the TGF-β family.

Images