DE19511243A1

DE19511243A1 - New growth / differentiation factor of the TGF-beta family

Info

Publication number: DE19511243A1
Application number: DE19511243A
Authority: DE
Inventors: Gertrud Hoetten; Helge Neidhardt; Rolf Bechtold; Jens Pohl
Original assignee: Biopharm Gesellschaft zur Biotechnologischen Entwicklung von Pharmaka mbH
Current assignee: Biopharm Gesellschaft zur Biotechnologischen Entwicklung von Pharmaka mbH
Priority date: 1994-07-01
Filing date: 1995-03-27
Publication date: 1996-01-04
Also published as: TW459044B; ZA955444B

Abstract

The invention concerns a protein of the TGF- beta family, the DNA which codes for it and a pharmaceutical composition containing such a protein.

Description

Die vorliegende Erfindung betrifft einen neuen Wachstums- /Differenzierungsfaktor der TGF-β-Familie und dafür codierende DNA-Sequenzen.The present invention relates to a new growth / Differentiation factor of the TGF-β family and coding for it DNA sequences.

Zu der TGF-β-Familie von Wachstumsfaktoren gehören die BMP-, TGF- und Aktivin/Inhibin-verwandten Proteine (Roberts und Sporn, Handbook of Experimental Pharmacology 95, 419-472 (1990)). Sie sind für einen weiten Bereich medizinischer Behandlungsmethoden und Anwendungen relevant. Diese Faktoren eignen sich in Verfahren, welche die Wundheilung und die Gewebewiederherstellung betreffen. Weiterhin induzieren mehrere Mitglieder der TGF-β Familie das Gewebewachstum, wie zum Beispiel das Wachstum von Knochen.The TGF-β family of growth factors include the BMP, TGF and activin / inhibin related proteins (Roberts and Sporn, Handbook of Experimental Pharmacology 95, 419-472 (1990)). They are more medical for a wide range Treatment methods and applications relevant. These factors are suitable in procedures that improve wound healing and Affect tissue restoration. Furthermore, several induce Members of the TGF-β family see tissue growth, such as Example of bone growth.

Wozney (Progress in Growth Factor Research 1 (1989), 267-280) und Vale et al. (Handbuch of Experimental Pharmacology 95 (1990), 211-248) beschreiben verschiedene Wachstumsfaktoren, wie etwa diejenigen, die mit der BMP- und der Aktivin/Inhibin- Gruppe verwandt sind. Die Mitglieder dieser Gruppe weisen signifikante strukturelle Ähnlichkeiten auf. Der Vorläufer des Proteins besteht aus einer aminoterminalen Signalsequenz, einer Propeptid- und einer carboxyterminalen Sequenz von 110 bis 140 Aminosäuren, die vom Vorläufer abgespalten wird und das reife Protein darstellt. Weiterhin sind ihre Mitglieder durch eine Aminosäuresequenzhomologie definiert. Das reife Protein enthält die am höchsten konservierten Sequenzen, insbesondere sieben Cysteinreste, die unter den Familiemitgliedern konserviert sind. Die TGF-β-artigen Proteine sind multifunktionelle, hormonell aktive Wachstumsfaktoren. Sie weisen auch verwandte biologische Aktivitäten, wie etwa chemotaktische Attraktion von Zellen, Förderung der Zelldifferenzierung und Gewebe-induzie rende Fähigkeiten auf. EP 0 222 491 A1 offenbart Sequenzen von Inhibin alpha und beta Ketten. Wozney (Progress in Growth Factor Research 1 (1989), 267-280) and Vale et al. (Manual of Experimental Pharmacology 95 (1990), 211-248) describe various growth factors, such as those with BMP and activin / inhibin Group are related. The members of this group point significant structural similarities. The forerunner of Protein consists of an amino terminal signal sequence, one Propeptide and a carboxy terminal sequence from 110 to 140 Amino acids that are split off from the precursor and the mature one Represents protein. Furthermore, their members are represented by a Amino acid sequence homology defined. The mature protein contains the most conserved sequences, especially seven Cysteine residues preserved among family members are. The TGF-β-like proteins are multifunctional, hormonally active growth factors. They also assign relatives biological activities, such as chemotactic attraction of Cells, promoting cell differentiation and tissue induction skills. EP 0 222 491 A1 discloses sequences of Inhibin alpha and beta chains.

Insgesamt zeigen die Proteine der TGF-β-Familie Unterschiede in ihrer Struktur, was zu erheblichen Variationen in ihrer genauen biologischen Funktion führt. Weiterhin werden sie in einem weiten Bereich unterschiedlicher Gewebearten und Entwicklungs stufen gefunden. Folglich können sie Unterschiede hinsichtlich ihrer genauen Funktion, z. B. der erforderlichen zellulären physiologischen Umgebung, ihrer Lebensdauer, ihrer Zielorte, ihrer Erfordernisse für Hilfsfaktoren und ihrer Beständigkeit gegen Abbau aufweisen. Obwohl zahlreiche Proteine, die ein Gewebe-induktives Potential zeigen, beschrieben werden, müssen ihre natürlichen Aufgaben im Organismus und noch bedeutsamer ihre medizinische Relevanz noch im Detail erforscht werden. Das Vorhandensein von noch unbekannten Mitgliedern der TGF-β- Familie, die für die Differenzierung/Induktion von verschiede nen Gewebearten bedeutsam sind, wird mit großer Wahrscheinlich keit angenommen. Eine große Schwierigkeit bei der Isolierung dieser neuen TGF-β-artigen Proteine besteht jedoch darin, daß ihre Funktionen noch nicht genau genug für die Entwicklung eines unterscheidungskräftigen Bioassays beschrieben werden können. Andererseits ist die erwartete Nukleotidsequenzhomolo gie zu bekannten Mitgliedern der Familie zu gering, um ein Screening durch klassische Nukleinsäurehybridisierungstechniken zu ermöglichen. Dennoch ist die weitere Isolation und Charak terisierung von neuen TGF-β-artigen Proteinen dringend erfor derlich, um weitere Induzierungs- und Differenzierungsproteine bereitzustellen, die alle gewünschten medizinischen Erforder nisse erfüllen. Diese Faktoren könnten medizinische Anwendung bei der Heilung von Schäden und der Behandlung von degenerati ven Erkrankungen von verschiedenen Geweben finden.Overall, the proteins of the TGF-β family show differences in their structure, causing significant variations in their exact biological function. Furthermore, they are in one wide range of different tissue types and development levels found. Hence, they can differ in terms their exact function, e.g. B. the required cellular physiological environment, their lifespan, their destinations, their requirements for auxiliary factors and their durability against degradation. Although numerous proteins make up a Show tissue inductive potential, must be described their natural functions in the organism and more importantly their medical relevance is still being researched in detail. The Presence of as yet unknown members of the TGF-β Family responsible for differentiation / induction of various important types of tissue are very likely accepted. A great difficulty in isolation of these new TGF-β-like proteins, however, is that their functions are not yet accurate enough for development a distinctive bioassay can. On the other hand, the expected nucleotide sequence is homolo Too few known members of the family to Screening using classic nucleic acid hybridization techniques to enable. Nevertheless, the further isolation and character Terization of new TGF-β-like proteins urgently needed necessary for further induction and differentiation proteins to provide all the medical needs you want meet nisse. These factors could be medical application in healing damage and treating degenerati Find diseases of different tissues.

In der Patentanmeldung PCT/EP93/00350 ist eine Nukleotid- und Aminosäuresequenz für das TGF-β-Protein MP-121 angegeben, wobei ein Großteil der dem reifen Peptid entsprechenden Sequenz angegeben ist. Die vollständige Sequenz des Propeptids MP-121 wird nicht offenbart.In the patent application PCT / EP93 / 00350 there is a nucleotide and Amino acid sequence given for the TGF-β protein MP-121, where much of the sequence corresponding to the mature peptide is specified. The full sequence of the MP-121 propeptide is not revealed.

Die der vorliegenden Erfindung zugrunde liegende Aufgabe besteht darin, DNA Sequenzen bereitzustellen, die für neue Mitglieder der TGF-β-Proteinfamilie mit mitogenem und/oder Differenzierungs-induktivem Potential codieren. Insbesondere besteht die Aufgabe der vorliegenden Erfindung darin, die vollständige DNA- und Aminosäuresequenz des TGF-Proteins MP-121 bereitzustellen.The object underlying the present invention is to provide DNA sequences that are new Members of the TGF-β protein family with mitogenic and / or Coding differentiation-inductive potential. Especially the object of the present invention is that complete DNA and amino acid sequence of the TGF protein MP-121 to provide.

Diese Aufgabe wird gelöst durch ein DNA-Molekül, das für ein Protein der TGF-β-Familie codiert undThis task is solved by a DNA molecule that is responsible for a Protein of the TGF-β family encoded and

a) the portion coding for the mature protein and given if necessary, further functional parts of the in SEQ ID NO. 1 nucleotide sequence shown,
b) one of the sequence from (a) in the context of the degeneration of the nucleotide sequence corresponding to genetic codes,
c) an an allelic derivative of one of the sequences from (a) and (b) corresponding nucleotide sequence, or
d) one with one of the sequences from (a), (b) or (c) hybridizing sequence

unter der Voraussetzung, daß ein DNA-Molekül gemäß (d) zumin dest den für ein reifes Protein der TGF-β-Familie codierenden Anteil enthält.on the condition that a DNA molecule according to (d) at least least that coding for a mature protein of the TGF-β family Share contains.

Weitere Ausführungsformen der vorliegenden Erfindung betreffen den Gegenstand der Ansprüche 2 bis 10. Andere Merkmale und Vorteile der Erfindung gehen aus der Beschreibung der bevor zugten Ausführungsformen hervor. Die Sequenzprotokolle und Zeichnungen werden jetzt kurz beschrieben.Further embodiments of the present invention relate to the subject of claims 2 to 10. Other features and Advantages of the invention emerge from the description of the preferred embodiments. The sequence listing and Drawings will now be briefly described.

SEQ ID NO. 1 zeigt die vollständige Nukleotidsequenz der für das TGF-β-Protein MP-121 codierenden DNA. Das ATG-Startcodon beginnt mit Nukleotid 128. Der Start des vollständigen reifen Proteins beginnt mit Nukleotid 836. SEQ ID NO. 1 shows the complete nucleotide sequence for that for DNA encoding TGF-β protein MP-121. The ATG start codon starts with nucleotide 128. The start of full maturity Protein starts with nucleotide 836.

SEQ ID NO. 2 zeigt die vollständige Aminosäuresequenz des TGF-β- Proteins MP-121, die aus der in SEQ ID NO. 1 gezeigten Nukleo tidsequenz abgeleitet wurde. Der Beginn des bevorzugten reifen Proteins liegt bei Aminosäure 237.SEQ ID NO. 2 shows the complete amino acid sequence of the TGF-β Protein MP-121, which is derived from the in SEQ ID NO. 1 nucleo shown tid sequence was derived. The beginning of the preferred ripening Protein is at amino acid 237.

Fig. 1 zeigt einen Vergleich der Aminosäuresequenz von MP-121 mit einigen Mitgliedern der TGF-β-Familie (Inhibin α- und β- Ketten) mit Beginn am ersten der sieben konservierten Cystein reste. * bedeutet, daß die Aminosäure in allen verglichenen Proteinen gleich ist; + bedeutet, daß die Aminosäure in mindestens einem der Proteine im Vergleich zu MP-121 überein stimmt. Fig. 1 shows a comparison of the amino acid sequence of MP-121 with some members of the TGF-β family (inhibin α and β chains) starting from the first of the seven conserved cysteine residues. * means that the amino acid is the same in all compared proteins; + means that the amino acid in at least one of the proteins matches in comparison to MP-121.

Fig. 2 zeigt die Nukleotidsequenzen der Oligonukleotidprimer, die in der vorliegenden Erfindung verwendet wurden und einen Vergleich dieser Sequenzen mit bekannten Mitgliedern der TGF-β- Familie. M bedeutet A oder C, S bedeutet C oder G, R bedeutet A oder G und K bedeutet G oder T. 2a zeigt die Sequenz des Primers OD, 2b zeigt die Sequenz des Primers OID. Figure 2 shows the nucleotide sequences of the oligonucleotide primers used in the present invention and a comparison of these sequences with known members of the TGF-β family. M means A or C, S means C or G, R means A or G and K means G or T. 2 a shows the sequence of the primer OD, 2 b shows the sequence of the primer OID.

Im Rahmen der vorliegenden Erfindung umfaßt der Begriff "reifes Protein" darüber hinaus aber auch funktionelle Teilbereiche des Gesamtproteins, die im wesentlichen gleiche biologische Aktivität aufweisen und vorzugsweise solche Teilbereiche, die mindestens den Bereich der sieben in der TGF-β-Familie kon servierten Cysteine umfassen. Insbesondere ist es hierbei möglich, daß der N-Terminus des reifen Proteins leicht modifi ziert ist, also von der in SEQ ID NO. 2 gezeigten Sequenz abweicht. Es können hier sowohl zusätzliche Aminosäuren, die die Funktionalität des Proteins nicht beeinflussen, vorhanden sein als auch Aminosäuren fehlen, soweit auch in diesem Fall die Funktionalität nicht eingeschränkt ist. Bevorzugt ist jedoch, daß das Protein alle Aminosäuren ab Aminosäure 237 der in SEQ ID NO. 2 gezeigten Aminosäuresequenz enthält. Von anderen Familienmitgliedern der TGF-β-Familie ist bereits bekannt, daß das Anhängen zusätzlicher Aminosäuren an den N-Terminus des reifen Proteins die Aktivität nicht beeinträchtigt, wobei u. a. 6 zusätzliche Histidine am N-Terminus angehängt wurden.In the context of the present invention, the term "mature Protein "but also functional parts of the Total protein, which is essentially the same biological Have activity and preferably those areas that at least the range of seven in the TGF-β family con served cysteine. In particular, it is here possible that the N-terminus of the mature protein is slightly modified is adorned, that of the in SEQ ID NO. 2 sequence shown deviates. There can be both additional amino acids here do not affect the functionality of the protein as well as amino acids are missing, as far as in this case the functionality is not restricted. Is preferred however, that the protein contains all amino acids from amino acid 237 on in SEQ ID NO. 2 contains the amino acid sequence shown. From others Family members of the TGF-β family are already aware that appending additional amino acids to the N-terminus of the mature protein does not impair activity, with u. a. 6 additional histidines were attached to the N-terminus.

Die vorliegende Erfindung umfaßt also den für das reife Protein gemäß obiger Definition codierenden Anteil und gegebenenfalls weitere funktionelle Anteile der in SEQ ID NO. 1 gezeigten Nukleotidsequenz sowie Sequenzen, die dieser Sequenz im Rahmen der Degeneration des genetischen Codes entsprechen und alle lische Derivate solcher Sequenzen. Weiterhin umfaßt die vorliegende Erfindung auch mit derartigen Sequenzen hybridisie rende Sequenzen unter der Voraussetzung, daß ein solches DNA- Molekül zumindest den für ein reifes Protein der TGF-β-Familie (gemäß der obigen Definition) codierenden Anteil vollständig enthält und die biologische Aktivität erhalten bleibt.The present invention thus includes that for the mature protein portion coding according to the above definition and, if appropriate further functional parts of the in SEQ ID NO. 1 shown Nucleotide sequence as well as sequences that frame this sequence correspond to the degeneration of the genetic code and all lische derivatives of such sequences. Furthermore, the The present invention also hybridizes with such sequences sequences provided that such a DNA Molecule at least that for a mature protein of the TGF-β family (as defined above) coding part completely contains and the biological activity is preserved.

Der Begriff "funktioneller Anteil" im Sinne der vorliegenden Erfindung bedeutet einen Proteinanteil, der in der Lage ist, z. B. als Signalpeptid-, Propeptid- bzw. reifer Proteinanteil zu wirken, d. h. mindestens eine der biologischen Funktionen der natürlichen Anteile von MP-121 erfüllen.The term "functional part" in the sense of the present Invention means a portion of protein that is capable of e.g. B. as a signal peptide, propeptide or mature protein portion act, d. H. at least one of the biological functions of meet natural proportions of MP-121.

Der für den reifen Anteil des Proteins codierende Bereich reicht vorzugsweise von Nukleotid 836 bis zum Stopcodon, welches bei Nukleotid 1184 der in der SEQ ID NO. 1 gezeigten Sequenz beginnt. Gegebenenfalls kann das DNA-Molekül noch weitere funktionelle Anteile der in SEQ ID NO. 1 gezeigten Sequenz umfassen, nämlich die für den Signal oder/und Propep tidanteil codierenden Nukleotidsequenzen. Besonders bevorzugt umfaßt das DNA-Molekül die Sequenz für den Signal- und Propep tidanteil und den Anteil des reifen Proteins, d. h. die Nukleo tide 128 bis 1184 der in SEQ ID NO. 1 gezeigten Sequenz. Andererseits kann das DNA-Molekül neben dem für das reife Protein codierenden Anteil auch noch funktionelle Signal oder/und Propeptidanteile von anderen Proteinen, z. B. von Proteinen mit Cystine Knot Motif (Cell, Vol. 73 (1993), S. 421-424) und insbesondere von anderen Proteinen der TGF-β-Familie, z. B. den oben genannten Aktivin/Inhibin- oder BMP-Proteinen, insbesondere auch MP52 (siehe PCT/EP94/02630) umfassen. Die entsprechenden Nukleotidsequenzen sind aus den oben genannten Referenzen zu entnehmen, auf deren Offenbarung hiermit Bezug genommen wird. Wichtig ist hierbei, daß der richtige Leserahmen für das reife Protein erhalten bleibt. Je nachdem, in welchen Wirtszellen die Expression stattfindet, könnte das Vorhanden sein einer anderen Signalsequenz oder/und eines anderen Propeptidanteils die Expression positiv beeinflussen. Der Austausch von Propeptidanteilen durch entsprechende Anteile anderer Proteine ist z. B. bei Mol. Endocrinol. 5 (1991), 149-155 und Proc. Natl. Acad. Sci. USA 90 (1993), 2905-2909 be schrieben.The area coding for the mature portion of the protein preferably ranges from nucleotide 836 to the stop codon, which is found in nucleotide 1184 in SEQ ID NO. 1 shown Sequence begins. If necessary, the DNA molecule can still further functional parts of the in SEQ ID NO. 1 shown Include sequence, namely that for the signal and / or propep nucleotide sequences encoding the tid portion. Particularly preferred the DNA molecule comprises the sequence for the signal and propep tid percentage and the percentage of mature protein, d. H. the nucleo tide 128 to 1184 of the in SEQ ID NO. 1 sequence shown. On the other hand, the DNA molecule can be next to that for the mature one Protein coding portion also functional signal or / and propeptide portions of other proteins, e.g. B. from Proteins with Cystine Knot Motif (Cell, Vol. 73 (1993), p. 421-424) and in particular of other proteins of the TGF-β family, e.g. B. the above-mentioned activin / inhibin or BMP proteins, in particular also include MP52 (see PCT / EP94 / 02630). The corresponding nucleotide sequences are from the above To take references, to the disclosure of which reference is hereby made is taken. It is important that the correct reading frame for the mature protein is preserved. Whichever Host cell expression is taking place, could be the presence be another signal sequence and / or another Propeptide portion positively affect expression. Of the Exchange of propeptide parts by corresponding parts other proteins is e.g. B. at Mol. Endocrinol. 5 (1991), 149-155 and Proc. Natl. Acad. Sci. USA 90: 2905-2909 (1993) wrote.

Obwohl die allelischen, degenerierten und hybridisierenden Sequenzen, die von der vorliegenden Erfindung umfaßt werden, strukturelle Unterschiede aufgrund geringfügiger Änderungen in der Nukleotid- oder/und Aminosäuresequenz aufweisen, besitzen die von derartigen Sequenzen codierten Proteine noch im wesentlichen die gleichen nützlichen Eigenschaften, die ihren Einsatz in grundsätzlich den gleichen medizinischen Anwendungen ermöglichen.Although the allelic, degenerate and hybridizing Sequences encompassed by the present invention structural differences due to minor changes in have the nucleotide or / and amino acid sequence the proteins encoded by such sequences are still in the essentially the same useful properties that their Use in basically the same medical applications enable.

Gemäß vorliegender Erfindung bedeutet die Bezeichnung "Hybri disierung" übliche Hybridisierungsbedingungen, vorzugsweise Bedingungen mit einer Salzkonzentration von 6×SSC bei 62 bis 66°C, gefolgt von einem einstündigen Waschen mit 0,6×SSC, 0,1% SDS bei 62 bis 66°C.According to the present invention, the term "hybri "usual hybridization conditions, preferably Conditions with a salt concentration of 6 × SSC at 62 to 66 ° C, followed by a one hour wash with 0.6 × SSC, 0.1% SDS at 62 to 66 ° C.

Bevorzugte Ausführungsformen der vorliegenden Erfindung sind DNA-Sequenzen, wie oben definiert, die aus Wirbeltieren, vorzugsweise Säugern, wie etwa Schweinen, Kühen und Nagern, wie etwa Ratten oder Mäusen, und insbesondere von Primaten, wie etwa Menschen, erhältlich sind bzw. entsprechenden Sequenzen nachgebildet sind.Preferred embodiments of the present invention are DNA sequences, as defined above, from vertebrates, preferably mammals such as pigs, cows and rodents such as such as rats or mice, and especially primates such as such as humans, are available or corresponding sequences are reproduced.

Eine besonders bevorzugte Ausführungsform der vorliegenden Erfindung ist die in SEQ ID NO. 1 gezeigte und als MP-121 bezeichnete Sequenz. Die Transkripte von MP-121 wurden aus Leber-Gewebe erhalten und codieren für ein Protein, das eine beträchtliche Aminosäurehomologie zum reifen Teil der Inhi bin/Aktivin-artigen Proteine zeigt (siehe Fig. 1). Die Proteinsequenzen von humanem α-Inhibin, Inhibin βA und Inhibin βB sind bei Mason et al. (Biochem. Biophys. Res. Comm. 135, 957-964 (1986)) beschrieben. Einige typische Sequenzhomologien, die für bekannte Inhibin-Sequenzen spezifisch sind, wurden auch im Propeptidteil von MP-121 gefunden, während andere Teile des Propeptids von MP-121 erhebliche Unterschiede zu Inhibin- Propeptiden zeigen.A particularly preferred embodiment of the present invention is that in SEQ ID NO. 1 and shown as MP-121. The transcripts of MP-121 were obtained from liver tissue and code for a protein which shows considerable amino acid homology to the mature part of the Inhi bin / activin-like proteins (see Fig. 1). The protein sequences of human α-inhibin, inhibin βA and inhibin βB are described by Mason et al. (Biochem. Biophys. Res. Comm. 135, 957-964 (1986)). Some typical sequence homologies specific to known inhibin sequences were also found in the propeptide part of MP-121, while other parts of the propeptide of MP-121 show significant differences from inhibin propeptides.

Ein weiterer Gegenstand der vorliegenden Erfindung ist ein Vektor, der mindestens eine Kopie eines erfindungsgemäßen DNA- Moleküls enthält. In einem derartigen Vektor ist die erfin dungsgemäße DNA-Sequenz vorzugsweise operativ mit einer Expressionskontrollsequenz verknüpft. Solche Vektoren eignen sich zur Herstellung von TGF-β-artigen Proteinen in stabil- oder transient-transformierten Zellen. Verschiedene Tier-, Pflanzen-, Pilz- und Bakteriensysteme können zur Transformation und die anschließende Kultivierung verwendet werden. Vorzugs weise enthalten die erfindungsgemäßen Vektoren für die Replika tion in der Wirtszelle notwendige Sequenzen und sind autonom replizierbar. Weiterhin ist die Verwendung von Vektoren bevorzugt, die selektierbare Markergene enthalten, wodurch die Transformation einer Wirtszelle nachweisbar ist.Another object of the present invention is a Vector which contains at least one copy of a DNA Contains molecule. In such a vector, this is invented DNA sequence according to the invention preferably surgically with a Expression control sequence linked. Such vectors are suitable to produce TGF-β-like proteins in stable or transiently transformed cells. Various animal, Plant, fungal and bacterial systems can be used for transformation and the subsequent cultivation can be used. Preferential wise contain the vectors of the invention for the replica tion in the host cell and are autonomous replicable. Furthermore, the use of vectors preferred, which contain selectable marker genes, whereby the Transformation of a host cell is detectable.

Ein weiterer Gegenstand der Erfindung ist eine Wirtszelle, die mit einer erfindungsgemäßen DNA oder einem erfindungsgemäßen Vektor transformiert ist. Beispiele von geeigneten Wirtszellen umfassen verschiedene eukaryontische und prokaryontische Zellen wie, etwa E.coli, Insektenzellen, Pflanzenzellen, Säugerzellen und Pilze, wie etwa Hefe.Another object of the invention is a host cell that with an inventive DNA or an inventive Vector is transformed. Examples of suitable host cells include various eukaryotic and prokaryotic cells such as E.coli, insect cells, plant cells, mammalian cells and mushrooms, such as yeast.

Ein weiterer Gegenstand der Erfindung ist ein Protein der TGF- β-Familie, das von einer DNA-Sequenz nach Anspruch 1 codiert wird. Vorzugsweise weist das erfindungsgemäße Protein die in SEQ ID NO. 2 gezeigte Aminosäuresequenz oder gegebenenfalls funktionelle Anteile davon (wie oben definiert) auf und zeigt biologische Eigenschaften, wie etwa Gewebe-induktive Fähigkei ten, die möglicherweise für eine therapeutische Anwendung relevant sind. Die oben genannten Merkmale des Proteins können abhängig von der Bildung von Homodimeren oder Heterodimeren mit anderen Proteinen mit Cystine Knot Motif und insbesondere TGF- β-Proteinen variieren. Solche Strukturen können sich ebenfalls für klinische Anwendungen geeignet erweisen und bilden daher ebenfalls einen Gegenstand der vorliegenden Anmeldung. Bevor zugte Heterodimere schließen Heterodimere aus einem Monomer des erfindungsgemäßen Proteins und Monomeren der α-, βA- oder βB- Inhibin-Ketten ein. Die sich aus der Heterodimerbildung ergebenden Eigenschaften können mehr in Richtung der Eigen schaften von Aktivin bzw. Inhibinen verschoben sein. Wenn z. B. ein Heterodimer mit Inhibin u-Proteinen bzw. mit anderen Inhibin β-Proteinen gebildet wird, wird davon ausgegangen, daß das MP121/Inhibin (α-Kette)- bzw. MP121/Aktivin (βA oder βB- Kette)-Heterodimer die Herstellung von Follikel-stimulierendem Hormon (FSH) inhibieren bzw. aktivieren könnte. MP121/Aktivin Heterodimere könnten auch z. B. Einfluß auf die Mesoderm- Entwicklung nehmen. Es kann weiterhin erwartet werden, daß heterodimere Formen mit einem Mitglied der BMP-Gruppe der TGF- β-Proteine dazu führen, daß BMP-ähnliche Aktivitäten verstärkt werden, wie z. B. die Fähigkeit, die Knochenbildung, Knorpelbil dung oder Bildung von Bindegewebe zu induzieren bzw. zu fördern.Another object of the invention is a protein of TGF β family encoded by a DNA sequence according to claim 1 becomes. The protein according to the invention preferably has the in SEQ ID NO. 2 amino acid sequence shown or optionally functional portions thereof (as defined above) and shows biological properties, such as tissue inductive ability that may be for therapeutic use are relevant. The above characteristics of the protein can depending on the formation of homodimers or heterodimers other proteins with Cystine Knot Motif and especially TGF- β proteins vary. Such structures can also prove and form suitable for clinical applications also an object of the present application. Before pulled heterodimers include heterodimers from a monomer of protein and monomers according to the invention of the α-, βA- or βB- Inhibin chains. Resulting from heterodimer formation resulting properties can be more towards the eigen be shifted by activin or inhibins. If e.g. B. a heterodimer with inhibin u proteins or with others Inhibin β proteins is formed, it is believed that the MP121 / inhibin (α chain) - or MP121 / activin (βA or βB- Chain) heterodimer the production of follicle-stimulating Could inhibit or activate hormone (FSH). MP121 / Activin Heterodimers could also e.g. B. Influence on the mesoderm Take development. It can still be expected that heterodimeric forms with a member of the BMP group of TGF β proteins cause BMP-like activities to increase be such. B. the ability to form bones, cartilage induction or formation of connective tissue promote.

Ein weiterer Gegenstand der Erfindung sind daher heterodimere Proteine eines erfindungsgemäßen Proteins der TGF-β-Familie, das von einer DNA-Sequenz nach Anspruch 1 codiert wird, mit einem Monomer eines Proteins mit Cystine Knot Motif, bevorzugt eines anderen Mitglieds der TGF-β-Familie. Ähnliche heterodi mere Proteine sind in der WO 93/09229, EP 0 626 451 A2 und J. Biol. Chem. 265 (1990), 13198-13205 beschrieben. Another object of the invention is therefore heterodimeric Proteins of a protein of the TGF-β family according to the invention, which is encoded by a DNA sequence according to claim 1, with a monomer of a protein with Cystine Knot Motif, preferred of another member of the TGF-β family. Similar heterodi Other proteins are described in WO 93/09229, EP 0 626 451 A2 and J. Biol. Chem. 265 (1990), 13198-13205.

Ein weiterer Gegenstand der Erfindung sind chimäre Proteine, die funktionelle Derivate bzw. Anteile des Proteins gemäß SEQ ID NO. 2, insbesondere funktionelle Anteile des reifen Proteins aufweisen und darüber hinaus Anteile eines anderen Proteins. Das andere Protein kann hierbei wiederum ein Protein mit Cystine Knot Motif sein, das vorzugsweise auch zur TGF-β- Familie gehört, wie z. B. insbesondere MP52 (PCT/EP94/02630). Es können jedoch auch Anteile eines komplett anderen Proteins vorhanden sein, z. B. Rezeptor-bindende Domänen von Proteinen, welche dem ursprünglichen MP121-Protein eine andere Spezifität verleihen.The invention further relates to chimeric proteins, the functional derivatives or portions of the protein according to SEQ ID NO. 2, in particular functional parts of the mature protein have and also portions of another protein. The other protein can in turn be a protein Cystine Knot Motif, which is also preferred for TGF-β Family belongs, such as B. in particular MP52 (PCT / EP94 / 02630). However, it can also contain parts of a completely different protein be present, e.g. B. receptor-binding domains of proteins, which gives the original MP121 protein a different specificity to lend.

Die biologischen Eigenschaften der erfindungsgemäßen Proteine, vorzugsweise MP-121, können z. B. in Assays gemäß Wrana et al. (Cell 71, 1003-1014 (1992)), Ling et al. (Proc. Natl. Acad. of Science, 82, 7217-7221 (1985)), Takuwa et al. (Am. J. Physiol., 257, E797-E803 (1989)), Fann und Patterson (Proc. Natl. Acad. of Science, 91, 43-47 (1994)), Broxmeyer et al. (Proc. Natl. Acad. of Science, 85, 9052-9056 (1988)), Green et al. (Cell, 71, 731-739 (1992)) oder Partridge et al. (Endocrinology, 108, 213-219 (1981)) bestimmt werden.The biological properties of the proteins according to the invention, preferably MP-121, e.g. B. in assays according to Wrana et al. (Cell 71, 1003-1014 (1992)) Ling et al. (Proc. Natl. Acad. Of Science, 82: 7217-7221 (1985)), Takuwa et al. (Am. J. Physiol., 257, E797-E803 (1989)), Fann and Patterson (Proc. Natl. Acad. of Science, 91, 43-47 (1994)), Broxmeyer et al. (Proc. Natl. Acad. of Science, 85, 9052-9056 (1988)), Green et al. (Cell, 71, 731-739 (1992)) or Partridge et al. (Endocrinology, 108, 213-219 (1981)).

Ein weiterer Gegenstand der vorliege den Erfindung ist ein Verfahren zur Herstellung eines Proteins der TGF-β-Familie, welches dadurch gekennzeichnet ist, daß man eine mit einer erfindungsgemäßen DNA oder einem erfindungsgemäßen Vektor transformierte Wirtszelle kultiviert und das TGF-β-Protein aus der Zelle oder/und aus dem Kulturüberstand gewinnt. Ein solches Verfahren umfaßt die Kultivierung der transformierten Wirts zelle in einem geeigneten Kulturmedium und die Reinigung des erzeugten TGF-β-artigen Proteins. Auf diese Weise ermöglicht das Verfahren die Herstellung einer ausreichenden Menge des gewünschten Proteins zum Einsatz bei der medizinischen Behand lung oder in Anwendungen unter Verwendung von Zellkulturtechni ken, bei denen Wachstumsfaktoren benötigt werden. Die Wirts zelle kann ein Bakterium, wie etwa Bacillus oder E.coli, ein Pilz, wie etwa Hefe, eine Pflanzenzelle, wie etwa Tabak, Kartoffel oder Arabidopsis oder eine tierische Zelle, ins besondere eine Wirbeltierzellinie, wie etwa Mo-, Cos- oder CHO- Zellinien oder eine Insektenzellinie sein. Bei der Herstellung in Bakterien kann es vorkommen, daß das erfindungsgemäße Protein in Form von Einschlußkörpern (inclusion bodies) produziert wird. Diese inclusion bodies werden dann nach an sich bekannten Methoden renaturiert und das Protein dann in einer aktiven Form erhalten (siehe z. B. Jaenicke, R. u. Rudolph, R., Protein Strukcture, ed. Creighton, T.E., IRL Press, Chapter 9) . Zur Herstellung von heterodimeren Proteinen mit anderen Mitgliedern der TGF-β-Familie werden beide Protein monomere entweder in derselben Zelle oder getrennt exprimiert, wobei auch eine gemeinsame Renaturierung bei anfallenden Formen von inclusion bodies geeignet erscheint. Bei Coexpression in derselben Zelle sind insbesondere auch virale Systeme, wie z. B. das Baculoviren-System oder das Vaccina Virus System geeignet.Another object of the present invention is a Process for the production of a protein of the TGF-β family, which is characterized in that one with a DNA according to the invention or a vector according to the invention transformed host cell and cultivated the TGF-β protein the cell or / and from the culture supernatant. Such one The method involves culturing the transformed host cell in a suitable culture medium and cleaning the produced TGF-β-like protein. This way the process of producing a sufficient amount of the desired protein for use in medical treatment or in applications using cell culture technology where growth factors are needed. The hosts cell can be a bacterium such as Bacillus or E. coli Fungus, such as yeast, a plant cell, such as tobacco, Potato or Arabidopsis or an animal cell, ins especially a vertebrate cell line, such as Mo-, Cos- or CHO- Cell lines or an insect cell line. In the preparation of in bacteria it can happen that the invention Protein in the form of inclusion bodies is produced. These inclusion bodies are then turned on known methods and then renatured the protein in an active form (see e.g. Jaenicke, R. u. Rudolph, R., Protein Structure, ed. Creighton, T.E., IRL Press, Chapter 9). For the production of heterodimeric proteins with other members of the TGF-β family, both are protein monomers expressed either in the same cell or separately, also a common renaturation in the case of forms of inclusion bodies appears suitable. With coexpression in In particular, the same cell are also viral systems, such as. B. the baculovirus system or the vaccina virus system.

Die Herstellung von heterodimeren Proteinen ist prinzipiell dem Fachmann bekannt und z. B. in der WO 93/09229 und der EP 0 626 451 A2 beschrieben.The production of heterodimeric proteins is basically the same Known expert and z. B. in WO 93/09229 and EP 0 626 451 A2.

Die Herstellung von chimären Proteinen mit anderen Protein anteilen erfordert eine entsprechende Veränderung auf DNA- Ebene, die dem Fachmann geläufig ist und durch ihn durchgeführt werden kann (EMBO J. 10 (1991), 2105-2110; Cell 69 (1992), 329-341; J. Neurosci. 39 (1994), 195-210).The production of chimeric proteins with other protein share requires a corresponding change to DNA Level that is familiar to and carried out by the expert (EMBO J. 10 (1991), 2105-2110; Cell 69 (1992), 329-341; J. Neurosci. 39: 195-210 (1994).

Noch ein weiterer Gegenstand der vorliegenden Erfindung ist die Bereitstellung von pharmazeutischen Zusammensetzungen, die eine pharmazeutisch wirksame Menge eines erfindungsgemäßen TGF-β- artigen Proteins als Wirkstoff enthalten. Gegebenenfalls umfaßt eine solche Zusammensetzung einen pharmazeutischen aktzeptablen Träger-, Hilfs-, Verdünnungs- oder Füllstoff. Eine solche pharmazeutische Zusammensetzung kann bei der Wundheilung und Gewebewiederherstellung alleine oder in Kombination mit anderen Wirkstoffen, z. B. anderen Proteinen der TGF-β-Familie oder Wachstumsfaktoren, wie etwa EGF (epidermal growth factor) oder PDGF (platelet derived growth factor) verwendet werden. Ferner kann eine solche pharmazeutische Zusammensetzung bei der Krankheitsprävention verwendet werden.Yet another object of the present invention is that Providing pharmaceutical compositions containing a pharmaceutically effective amount of a TGF-β- according to the invention like protein as an active ingredient. If necessary includes such a composition is a pharmaceutical acceptable Carrier, auxiliary, diluent or filler. Such pharmaceutical composition can help in wound healing and Tissue restoration alone or in combination with others Active ingredients, e.g. B. other proteins of the TGF-β family or Growth factors such as EGF (epidermal growth factor) or PDGF (platelet derived growth factor) can be used. Further can such a pharmaceutical composition in the Disease prevention can be used.

Weitere Gegenstände sind pharmazeutische Zusammensetzungen, die erfindungsgemäße heterodimere Proteine oder/und chimäre Proteine enthalten.Other items are pharmaceutical compositions that heterodimeric proteins or / and chimeric proteins according to the invention Contain proteins.

Bevorzugt wird die erfindungsgemäße pharmazeutische Zusammen setzung eingesetzt zur Behandlung und Prävention von Knochen-, Knorpel-, Bindegewebs-, Haut-, Schleimhaut-, Endothel-, Epithelial-, Neuronal-, Hirn-, Renal- oder Zahnschädigungen, zur Anwendung bei Zahnimplantaten, zur Anwendung in Wundhei lungs- oder Gewebewiederherstellungsprozessen, als Morphogen zum Einsatz zur Induktion von Lebergewebewachstum, Induktion der Proliferation von Vorläuferzellen oder Knochenmarkszellen, zur Beibehaltung eines Differenzierungszustandes und zur Behandlung von Fertilitätsstörungen oder zur Empfängnisverhü tung.The pharmaceutical combination according to the invention is preferred used for the treatment and prevention of bone, Cartilage, connective tissue, skin, mucous membrane, endothelial, Epithelial, neuronal, brain, renal or tooth damage, for use with dental implants, for use in wounds recovery or tissue recovery processes, as a morphogen used for induction of liver tissue growth, induction the proliferation of progenitor cells or bone marrow cells, to maintain a state of differentiation and Treatment of fertility disorders or for contraception tung.

Eine andere mögliche klinische Anwendung des erfindungsgemäßen TGF-β-artigen Proteins ist die Verwendung als Suppressor der Immunreaktion zur Vermeidung der Abstoßung von Organtrans plantaten oder ein Einsatz im Zusammenhang mit der Angiogenese. Ferner kann das erfindungsgemäße Protein zur Fertilitäts steigerung oder Empfängnisverhütung eingesetzt werden. Die erfindungsgemäße pharmazeutische Zusammensetzung kann auch prophylaktisch oder in der kosmetischen Chirugie verwendet werden. Weiterhin ist die Anwendung der Zusammensetzung nicht auf Menschen beschränkt, sondern kann auch Tiere, insbesondere Haus- und Nutztiere umfassen.Another possible clinical application of the invention TGF-β-like protein is use as a suppressor of the Immune response to avoid organ trans rejection plantations or an application related to angiogenesis. Furthermore, the protein according to the invention can be used for fertility increase or contraception. The Pharmaceutical composition according to the invention can also used prophylactically or in cosmetic surgery will. Furthermore, the application of the composition is not limited to humans, but can also be animals, in particular Include domestic and farm animals.

Im übrigen kann bei heterodimeren Proteinen und chimären Proteinen die Einsatzmöglichkeit und Spezifität auch durch den Anteil des anderen Proteins bzw. anderen Monomers wie gewünscht variiert werden. Incidentally, heterodimeric and chimeric proteins The possible uses and specificity also by the proteins Proportion of the other protein or monomer as desired can be varied.

Generell können mit den erfindungsgemäßen Proteinen Krankheiten behandelt werden, die mit der Expression von MP121 zusammen hängen, einerseits durch die Erhöhung der Menge bzw. der Aktivität an vorhandenem MP121, auf der anderen Seite auch durch Unterdrückung der MP121-Aktivität. So ist ein weiterer Gegenstand der Erfindung die Herstellung von Antisense-Nu kleinsäuren und Ribozymen, die die Translation von MP121 hemmen. Diese Hemmung kann entweder durch Maskieren der mRNA mit einer Antisense-Nukleinsäure erfolgen oder durch Spaltung mit einem Ribozym.In general, diseases can be caused by the proteins according to the invention treated with the expression of MP121 depend on the one hand by increasing the amount or the Activity on existing MP121, on the other hand too by suppressing MP121 activity. So is another The invention relates to the production of antisense nu small acids and ribozymes, which are the translation of MP121 inhibit. This inhibition can either be by masking the mRNA with an antisense nucleic acid or by cleavage with a ribozyme.

Die Herstellung von Antisense-Nukleinsäuren ist bekannt (Weintraub, H.M., Scientific American 262: 40 (1990)). Die Antisense-Nukleinsäuren hybridisieren mit der entsprechenden mRNA und bilden ein doppelsträngiges Molekül, welches dann nicht mehr translatiert werden kann. Die Verwendung von Antisense-Nukleinsäuren ist z. B. aus Marcus-Sekura, C.J., Anal. Biochem. 172 (1988), S. 289-295 bekannt.The production of antisense nucleic acids is known (Weintraub, H.M., Scientific American 262: 40 (1990)). The Antisense nucleic acids hybridize with the corresponding one mRNA and form a double-stranded molecule, which then can no longer be translated. The usage of Antisense nucleic acids is e.g. B. from Marcus-Sekura, C.J., Anal. Biochem. 172 (1988), pp. 289-295.

Ribozyme sind RNA-Moleküle, die die Fähigkeit besitzen, spezifisch andere einzelsträngige RNA-Moleküle ähnlich wie DNA- Restriktionsendonukleasen zu spalten. Die Herstellung von Ribozymen ist in Cech, J. Amer. Med. Assn. 260 (1988), S. 3030 beschrieben.Ribozymes are RNA molecules that have the ability specifically other single-stranded RNA molecules similar to DNA To cleave restriction endonucleases. The production of Ribozymes are described in Cech, J. Amer. Med. Assn. 260 (1988), p. 3030 described.

Erfindungsgemäß ist es hierbei auch möglich, geeignete Vektoren mit der erfindungsgemäßen DNA-Sequenz in vitro oder in vivo in Patientenzellen zu transfizieren oder die Vektoren in vitro in Zellen zu transfizieren und diese dann einem Patienten zu implantieren. Ebenso können MP121-Antisense-Polynukleotide in Zellen eingebracht werden, die eine ungewünschte Expression von MP121 zeigen.According to the invention, it is also possible to use suitable vectors with the DNA sequence according to the invention in vitro or in vivo in To transfect patient cells or in vitro the vectors Transfect cells and then deliver them to a patient implant. MP121 antisense polynucleotides can also be used in Cells are introduced that have an undesired expression of Show MP121.

Eine Unterdrückung der MP121-Aktivität kann auch erfolgen durch Bindung von Molekülen, die im Gegensatz zu MP121 keine Signalweiterleitung auslösen, an die MP121-Rezeptoren. The MP121 activity can also be suppressed by binding molecules that, unlike MP121, do not Trigger signal forwarding to the MP121 receptors.

Es sind daher im Rahmen der Erfindung auch die Rezeptoren für MP121 an Zellen von Interesse. Zum Auffinden von Rezeptoren können zunächst verschiedene Zellinien auf ihr Bindungsverhal ten von radioaktiv markiertem MP121 (¹²⁵J-MP121) mit anschlie ßendem cross-linking getestet werden. Von Zellen, die MP121 binden, kann nachfolgend eine cDNA-Bibliothek in einem Ex pressionsvektor (erhältlich bei InVitrogen) angelegt werden. Zellen, die mit Rezeptor-cDNA transfiziert wurden, können dann über die Bindung von radioaktiv markiertem MP121 selektiert werden. Dies sind dem Fachmann bekannte Methoden, wie sie z. B. für die Isolierung von Acitivin- (Mathews, L.S. & Vale, W.W., Cell 65 (1991), 973-982) und TGF-β-Rezeptoren Typ II (Lin, H. Y. et al., Cell 68 (1992), 775-785) verwendet wurden. Es ist in Analogie zu den bekannten Activin-Rezeptoren zu vermuten, daß es sich bei dem MP121-Rezeptor ebenfalls um einen in diese Familie gehörenden Rezeptorkomplex handelt, so daß zum Auf finden von Teilen des heteromeren Komplexes weitere dem Fachmann bekannte Methoden, wie z. B. PCR mit degenerierten Oligonukleotiden, verwendet werden können. Diese Methode ist z. B. auch bei den Activin- und TGF-β-Rezeptoren Typ I angewen det worden (Tsuchida et al., Proc. Natl. Acad. Sci. USA 90 (1993), 11242-11246; Attisano et al., Cell 75 (1993), 671-680; Franzen et al., Cell 75 (1993), 681-692).It is therefore also within the scope of the invention the receptors for MP121 on cells of interest. To find receptors can first different cell lines on their binding behavior radioactively labeled MP121 (¹²⁵J-MP121) with cross-linking. Of cells, the MP121 can bind a cDNA library in an Ex pressure vector (available from InVitrogen). Cells transfected with receptor cDNA can then selected for the binding of radioactively labeled MP121 will. These are methods known to the person skilled in the art, such as, for. B. for the isolation of active- (Mathews, L.S. & Vale, W.W., Cell 65 (1991), 973-982) and TGF-β receptors type II (Lin, H. Y. et al., Cell 68 (1992), 775-785) were used. It is in Analogy to the known activin receptors to suspect that the MP121 receptor is also one of them Family belonging receptor complex acts, so that on find parts of the heteromeric complex more Methods known to those skilled in the art, such as, for. B. PCR with degenerate Oligonucleotides can be used. This method is e.g. B. also with the Activin and TGF-β receptors type I. (Tsuchida et al., Proc. Natl. Acad. Sci. USA 90 (1993), 11242-11246; Attisano et al., 1993, Cell 75: 671-680; Franzen et al. (1993) Cell 75: 681-692).

Schließlich ist ein weiterer Gegenstand der vorliegenden Erfindung ein Antikörper, der spezifisch an die erfindungs gemäßen Proteine binden kann, oder ein derartiges Antikörper fragment (z. B. Fab oder Fab′). Verfahren zur Herstellung eines solchen spezifischen Antikörpers oder Antikörperfragments gehören zum allgemeinen Fachwissen des Durchschnittfachmanns. Vorzugsweise ist ein solcher Antikörper ein monoklonaler Antikörper. Solche Antikörper oder Antikörperfragmente könnten sich auch für diagnostische Methoden eignen.Finally, another subject of the present Invention an antibody that is specific to the Invention can bind appropriate proteins, or such an antibody fragment (e.g. Fab or Fab ′). Process for producing a such specific antibody or antibody fragment belong to the general specialist knowledge of the average specialist. Such an antibody is preferably a monoclonal Antibody. Such antibodies or antibody fragments could are also suitable for diagnostic methods.

Weiterhin soll die Erfindung durch die folgenden Beispiele veranschaulicht werden. The invention is further intended to be illustrated by the following examples are illustrated.

example 1 Isolation of MP-121

1.1 Total RNA was derived from human liver tissue (40 years old Mann) using the Chirgwin et al. (Biochemistry, 18, 5294-5299 (1979)) isolated. Poly (A +) RNA was extracted from the total RNA by oligo (dT) chromatography according to the regulations of Manufacturer (Stratagene Poly (A) Quick columns) separated.
1.2 For the reverse transcription reaction, 1 to 2.5 µg of poly (A +) RNA were heated to 65 ° C. for 5 minutes and quickly cooled on ice. The reaction mixture contained 27 U RNA-Guard (Pharmacia), 2.5 μg oligo (dT) 12-18 (Pharmacia), 5 × buffer (250 mmol / l Tris / HCl pH 8.5, 50 mmol / l MgCl₂, 50 mmol / l DTT, 5 mmol / l of each dNTP, 600 mmol / l KCl) and 20 U AMV reverse transcriptase (Boehringer Mannheim) per µg poly (A +) - RNA. The reaction mixture (25 µl) was incubated at 42 ° C for 2 hours. The cDNA pool was kept at -20 ° C.
1.3 The deoxynucleotide primers OD and OID shown in FIG. 2 were produced on an automatic DNA synthesizer (biosearch). The purification was carried out by denaturing polyacrylamide gel electophoresis and isolation of the main band from the gel by isotachophoresis. The oligonucleotides were designed by comparing the nucleic acid sequences of known members of the TGF-β family and selecting regions with high conservation. A comparison of this region is shown in FIG. 2. To facilitate cloning, both oligonucleotides contained Eco RI sites and OD additionally contained an Nco I restriction site at its 5'-terminus.
1.4 In the PCR reaction, 20 ng of poly (A +) RNA was obtained cDNA (see 1.2) used as starting material. The Reaction was carried out in a volume of 50 µl and contained 1 × PCR buffer (16.6 mmol / l (NH₄) ₂SO₄, 67 mmol / l Tris / HCl pH 8.8, 2 mmol / l MgCl₂, 6.7 µmol / l EDTA, 10 mol / l β- Mercaptoethanol, 170 µg / ml bovine serum albumin (Gibco), 200 µmol / l of each dNTP (Pharmacia), 30 pmol of each Oligonu Kleotide (OD and OID) and 1.5 U Taq polymerase (AmpliTaq, Perkin Elmer Cetus). The reaction mixture was covered with paraffin layers and 40 PCR cycles were carried out. The PCR reaction products were purified by phenol / chloroform Extraction cleaned and concentrated by ethanol precipitation trated.
1.5 Half of the PCR reaction products were with the Restriction enzymes SphI (Pharmacia) and AlwNI (Biolabs) split according to the manufacturer's instructions. The second half was in a series of reactions with Ava I (BRL), AlwN I (Biolabs) and Tfi I (Biolabs) cut. The Restrictions were in 100 ul with 8 U enzyme over 2 to 12 Hours at 37 ° C (except for Tfi I at 65 ° C).
1.6 The restriction cleavage products were by Fractionated agarose gel electrophoresis. After staining with Ethidium bromide was not cleaved amplification products cut out of the gel and by phenol extraction isolated. The DNA obtained was then run through twice Phenol / chloroform extraction cleaned.
1.7 After ethanol precipitation, a quarter or a Fifth of the DNA isolated reamplified, being the same Conditions as used for primary amplification except that the number of cycles has been reduced to 13. The Reamplification products were purified using the same Enzymes as cut above and the uncut products were, as explained above for the amplification products Agarose gels isolated. The reamplification step was repeated.
1.8 After the last isolation from the gel, the Amplification products by 4 U Eco RI (Pharmacia) among the split the conditions recommended by the manufacturer. A quarter of the restriction mixture was cleaved with Eco RI Vector pBluescript SK + (Stratagene) ligated. After ligation 24 clones of each enzyme combination were sequenced analyzed further. The approach with AlwN I and Sph I ge was cut, contained no new sequences, only BMP6 and Inhibin βA sequences. 19 identical new sequences, MP-121 were cut with Ava I, AlwN I and Tfi I found approaches. These plasmids were pSK-MP121 (OD / OID) called. One sequence differed mainly from this found sequence on two nucleotides. The ligation and Transformation in E. coli was carried out as in Sambrook et al., Molecu lar cloning: A laboratory manual (1989) described by guided.

Der Klon wurde zum 3′-Ende der cDNA nach der ausführlich von Frohmann (veröffentlicht von Perkin-Elmer Corp., Amplifica tions, 5, 11-15 (1990)) beschriebenen Methode vervollständigt.The clone became the 3'-end of the cDNA according to the details of Frohmann (published by Perkin-Elmer Corp., Amplifica tions, 5, 11-15 (1990)).

Dieselbe Leber-mRNA, welche zur Isolation des ersten MP-121 Fragmentes benutzt wurde, wurde, wie oben beschrieben, revers transcribiert unter Verwendung von Oligo dT (16mer) verbunden mit dem Adapterprimer (AGAATTCGCATGCCATGGTCGACGAAGC -T₁₆). Die Amplifikation wurde mit dem Adapterprimer (AGAATTCGCATGCCATGGTCGACG) und einem internen Primer (GGCTACGCCATGAACTTCTGCATA), nach der MP-121 Sequenz herge stellt, durchgeführt. Die Amplifikationsprodukte wurden mit einem weiteren internen Primer (ACATAGCAGGCATGCCTGGTATTG), hergestellt nach der MP-121 Sequenz, und dem Adapterprimer reamplifiziert. Die Reamplifikationsprodukte wurden nach Restriktion mit Sph I in den ebenso geschnittenen Vektor pT7/T3 U19 (Pharmacia) kloniert und sequenziert. Die Klone wurden durch ihre Sequenzüberlappung mit dem bereits bekannten Teil der MP121-Sequenz charakterisiert. Ein Klon, genannt p121Lt 3′ MP13, wurde benutzt, um ein Nco I (stumpf gemacht mit T4 Polymerase)/Sph I Fragment zu isolieren. Dieses Fragment wurde in einen der oben erwähnten pSK-MP121 (OD/OID) Vektoren kloniert, dessen OD-Primer Sequenz zum T7 Primer der pSK Multiple Cloning Site orientiert war. Dazu wurde der Vektor mit SphI und SmaI restringiert. Das Konstrukt wurde pMP121DFus6 genannt. Es beinhaltet die MP-121 Sequenz von Position 922 bis 1360 wie in SEQ ID NO.1 gezeigt.The same liver mRNA used to isolate the first MP-121 Fragment was used, was reversed as described above transcribed using Oligo dT (16mer) linked with the adapter primer (AGAATTCGCATGCCATGGTCGACGAAGC -T₁₆). The Amplification was done with the adapter primer (AGAATTCGCATGCCATGGTCGACG) and an internal primer (GGCTACGCCATGAACTTCTGCATA), according to the MP-121 sequence poses, carried out. The amplification products were with another internal primer (ACATAGCAGGCATGCCTGGTATTG), made according to the MP-121 sequence and the adapter primer reamplified. The reamplification products were after Restriction with Sph I in the similarly cut vector pT7 / T3 U19 (Pharmacia) cloned and sequenced. The clones were through their sequence overlap with the already known part the MP121 sequence. A clone called p121Lt 3 ′ MP13, was used to make an Nco I (blunted with T4 Polymerase) / Sph I fragment to isolate. This fragment was into one of the pSK-MP121 (OD / OID) vectors mentioned above cloned whose OD primer sequence to the T7 primer of the pSK Multiple cloning site was oriented. To do this, the vector was created with SphI and SmaI restricted. The construct became pMP121DFus6 called. It contains the MP-121 sequence from position 922 to 1360 as shown in SEQ ID NO.1.

1.9 A Dde I fragment of pMP-121DFus6, which from position 931 to 1304 in SEQ ID NO. 1 is enough to screen one human liver cDNA library (Clontech, # HL3006b, bot 36223) used, as detailed in Ausubel et al. (Current Protocols in Molecular Biology, published by Greene Publishing Associates and Wiley-Interscience (1989)) is. 24 mixed plaques were picked from 8.1 × 10⁵ phages and isolated. This resulted in 10 clones which were subjected to PCR using Ver application of the primers LO2 (ACATAGCAGGCATGCCTGGTATTG) and LOI1 (CTGCAGCTGTGTTGGCCTTGAGA) from the Dde I fragment, a positive Signal, selected and isolated. The cDNA was over an EcoRI restriction was isolated from the phages and into the pBluescript SK vector loo also cleaved with Eco RI kidney.

Eine Sequenzierung eines der resultierenden Plasmide, SK121L9.1, zeigte, daß das Startcodon an Position 128 von SEQ ID NO. 1 beginnt, da drei Stopp-Codons in-frame vor diesem Startcodon an Position 62, 77 und 92 liegen. Der Start des reifen MP121 liegt bei Position 836 von SEQ ID NO. 1, legt man die Sequenzanalogie zu anderen TGF-β Proteinen zu Grunde, was der Aminosäure 237 in SEQ NO. 2 entspricht. Das Stoppcodon beginnt an Position 1184 der SEQ ID NO. 1.Sequencing one of the resulting plasmids, SK121L9.1, showed that the start codon at position 128 of SEQ ID NO. 1 starts because there are three stop codons in-frame before this Start codon at positions 62, 77 and 92. The start of the Tire MP121 is at position 836 of SEQ ID NO. 1, you put the sequence analogy to other TGF-β proteins is based on what amino acid 237 in SEQ NO. 2 corresponds. The stop codon starts at position 1184 of SEQ ID NO. 1.

Das Plasmid SK121L9.1 wurde unter der Hinterlegungsnummer 9177 bei der DSM am 26.4.94 hinterlegt.The plasmid SK121L9.1 was deposited under the accession number 9177 deposited with the DSM on April 26, 1994.

Example 2 Expression of MP121

Die Expression von MP121 ist sowohl in eukaryontischen als auch in prokaryontischen Systemen möglich. Expression of MP121 is both in eukaryotic and also possible in prokaryotic systems.

Für die Expression in Prokaryonten wurde nur der reife Anteil von MP121 verwendet. Nach Aufreinigung kann das in E.coli als Monomer exprimierte reife MP121 Protein dann zu einem Dimer zurückgefalten werden. Um die Aufreinigung des MP121 zu vereinfachen, können an den N-Terminus des reifen Proteins zusätzlich 6 Histidine gehängt werden, die durch Bindung an Nickelchelat-Säulen die Aufreinigungdes Proteins erleich tern.Only the mature part was used for expression in prokaryotes used by MP121. After purification, this can be done in E.coli Monomer then expressed mature MP121 protein into a dimer be folded back. To clean up the MP121 too can simplify to the N-terminus of the mature protein an additional 6 histidines are attached by binding to Nickel chelate columns facilitate protein purification tern.

Beispielhaft wurde der reife Anteil von MP121 (Aminosäure 237 bis 352 in SEQ ID NO. 2) mit 13 zusätzlichen Aminosäuren einschließlich 6 Histidinen am N-Terminus (MHHHHHHKLEFAM) in dem prokaryontischen Vektor pBP4 exprimiert. Dieser Vektor ist ein pBR322 Derivat mit Tetracyclinresistenz der zusätz lich den T7 Promoter aus dem pBluescript II SK Plasmid (Stra tagene) enthält. Weiterhin enthält der Vektor nach dem T7-Promoter eine ribosomale Bindestelle und ein Startcodon gefolgt von 6 Codons für Histidin. Hinter mehreren singulären Restriktionsschnittstellen wie Eco RI, Xho I, Sma I und Apa I für die Insertion von Inserts sowie Stopcodons in allen drei Leserahmen folgt ein Terminator (T⌀). Zum Erhalt der cDNA für den reifen Anteil von MP121 wurde eine PCR mit den beiden Oligonukleot iden GAATTCGCCATGGGCATCGACTGCCAAGGAGG und CCGCTCGAGAAGCTTCAACTGCACCCACAGGC auf dem Plasmid SK121L9.1 (DSM Hinterlegungsnummer: 9177) durchgeführt. Beide Oligo nukleotide enthalten an den Enden hinzugefügte Restriktions schnittstellen (Eco RI und Nco I bzw. Xho I und Hind III).The mature part of MP121 (amino acid 237 to 352 in SEQ ID NO. 2) with 13 additional amino acids including 6 histidines at the N-terminus (MHHHHHHKLEFAM) in the prokaryotic vector pBP4. This vector is a pBR322 derivative with tetracycline resistance Lich the T7 promoter from the pBluescript II SK plasmid (Stra days) contains. Furthermore, the vector after contains T7 promoter a ribosomal binding site and a start codon followed by 6 codons for histidine. Behind several singular Restriction interfaces such as Eco RI, Xho I, Sma I and Apa I for the insertion of inserts and stop codons in all three A terminator (T⌀) follows the reading frame. To get the cDNA for the mature part of MP121 was PCR with the two Oligonucleotides GAATTCGCCATGGGCATCGACTGCCAAGGAGG and CCGCTCGAGAAGCTTCAACTGCACCCACAGGC on plasmid SK121L9.1 (DSM deposit number: 9177). Both oligo nucleotides contain restrictions added at the ends interfaces (Eco RI and Nco I or Xho I and Hind III).

Das resultierende 377 bp Fragment wurde stumpfendig in den mit Eco RV restringierten Vektor pBluescript II SK (Stra tagene) zwischenkloniert. Ein Klon mit der Orientierung des 5′, Endes von MP121 zum T7-Promoter wurde mit Eco RI restringiert und das resultierende Insert (0.38 kb) in den ebenfalls mit Eco RI restringierten pBP4 Vektor kloniert. Die richtige Orientierung des Inserts beim resultierenden Plasmid pBP4MP121His wurde durch Restriktionsanalyse und Sequenzie rung festgestellt. Das Plasmid pBP4MP121His wurde am 30.1.1995 bei der DSM (Hinterlegungsnummer: 9704) hinterlegt. The resulting 377 bp fragment was blunt-ended in the with Eco RV restricted vector pBluescript II SK (Stra days) cloned in between. A clone with the orientation of the 5 ′, end of MP121 to T7 promoter was with Eco RI restricted and the resulting insert (0.38 kb) in the also cloned with Eco RI restricted pBP4 vector. The correct orientation of the insert in the resulting plasmid pBP4MP121His was determined by restriction analysis and sequencing determined. The plasmid pBP4MP121His was created on 30.1.1995 deposited with the DSM (deposit number: 9704).

Die Expression von MP121 Protein kann durch gleichzeitige Bereitstellung von T7-RNA Polymerase erfolgen. Die T7-RNA Polymerase kann über verschiedene Methoden bereitgestellt werden, wie z. B. ein zweites Plasmid mit einem Gen für T7 RNA Polymerase oder durch Infektion mit Phagen, die für die T7 RNA Polymerase codieren oder aber durch spezielle Bakterien stämme, die das Gen für T7 RNA Polymerase integriert haben. Unter Verwendung des Bakterienstammes BL21(DE3)pLysS (Nova gen, #69451-1) und Induktion der T7 RNA Polymerase-Expression nach Herstellerangaben mit IPTG, wird das reife MPI2I Protein mit His-Tag (MP121His) in Einschlußkörpern gebildet. Das Protein zeigt in SDS-Polyacrylamid-Gelen (15%) ein apparentes Molekulargewicht von knapp 16 kD (theoretisches Molekularge wicht: 14.2 kD) wie es representativ im Westernblot der Fig. 3 gezeigt ist. Die mit pBP4 transformierten Bakterien als Kontrollen zeigen jeweils keine Anfärbung spezifischer Ban den. Aufgrund des His-Tag kann dieses Protein über Nickel chelatbildende Säulen wie z. B. beschrieben in Hochuli et al. (BIO/Technology Vol. 6, 1321-1325 (1988)) gereinigt werden.MP121 protein can be expressed by simultaneously providing T7 RNA polymerase. The T7 RNA polymerase can be provided by various methods, such as. B. a second plasmid with a gene for T7 RNA polymerase or by infection with phages that code for the T7 RNA polymerase or by special bacteria that have integrated the gene for T7 RNA polymerase. Using the bacterial strain BL21 (DE3) pLysS (Nova gen, # 69451-1) and inducing T7 RNA polymerase expression according to the manufacturer's instructions with IPTG, the mature MPI2I protein with His tag (MP121His) is formed in inclusion bodies. The protein in SDS-polyacrylamide gels (15%) has an apparent molecular weight of almost 16 kD (theoretical molecular weight: 14.2 kD), as is shown representatively in the Western blot of FIG. 3. The bacteria transformed with pBP4 as controls each show no staining of specific bands. Because of His day, this protein can be chelated by nickel columns such as. B. described in Hochuli et al. (BIO / Technology Vol. 6, 1321-1325 (1988)).

Eine zusätzliche Reinigung ist möglich über eine Reversed Phase HPLC. Es wurde einer Reversed Phase Säule (Nucleosil 300-7C4 von Macherey-Nagel, Art. 715023) mit einer Flußrate von 2 ml/min und einem Acetonitrilgradienten in 0.1% TFA von 0 bis 90% in 100 min verwendet. Unter diesen Bedingungen eluiert MP121His ab ca. 40% Acetonitril.Additional cleaning is possible via a reversed HPLC phase. A reversed phase column (Nucleosil 300-7C4 from Macherey-Nagel, Art. 715023) with a flow rate of 2 ml / min and an acetonitrile gradient in 0.1% TFA of 0 to 90% used in 100 min. Under these conditions elutes MP121His from approx. 40% acetonitrile.

Der Nachweis, daß es sich um MP121 Protein handelt, wurde jeweils über Western blot Analyse mit MP121 spezifischen Antikörpern geführt. Polyklonale Antikörper gegen MP121 wurden sowohl in Hühnern als auch in Kaninchen erzeugt. Zum Erhalt des Antigens für die Immunisierung wurde ein Teil des reifen Anteils von MP121 (Aminosäure 260 bis 352 in SEQ ID NO. 2) mit den ersten 98 Aminosäuren der Polymerase des MS2-Bakteriophagen fusioniert und in E.coli exprimiert. Nach Isolation der Einschlußkörper wurde das Fusionsprotein (MS2-MP121) auf Polyacrylamid-Gelen separiert und nach Kup ferfärbung durch Elektroelution (Tessmer, U. & Dernick, R., IBL (1990) 8-13) für die Immunisierung isoliert. Mit Antikörpern sowohl aus Hühnern als auch aus Kaninchen ist es möglich, spezifisch Expression von MP121 nachzuweisen. Für den schema tisierten Western blot in Fig. 3 wurden Hühner-Antikörper verwendet, die über PEG-Präzipitation (Thalley B. S. u. Car roll, S.B., BIO/Technology Vol. 8, 934-938 (1990)) und über Membrangebundenes Antigen (Fusionsprotein (MS2-MP121)) (18.17 in Sambrook et al. Molecular Cloning, second edition, Cold Spring Harbor Laboratory Press 1989) weitergehend aufgerei nigt waren. Als zweiter Antikörper wurde Anti-Chicken IgG mit gekoppelter alkalischer Phosphatase (Sigma A9171) eingesetzt. Die Detektion erfolgte mit dem Tropix Western-Light Protein Detection Kit (Serva #WL10RC) nach Herstellerangaben.The proof that it is MP121 protein was carried out by Western blot analysis with MP121-specific antibodies. Polyclonal antibodies to MP121 were raised in both chickens and rabbits. To obtain the antigen for the immunization, part of the mature portion of MP121 (amino acids 260 to 352 in SEQ ID NO. 2) was fused with the first 98 amino acids of the polymerase of the MS2 bacteriophage and expressed in E. coli. After isolation of the inclusion bodies, the fusion protein (MS2-MP121) was separated on polyacrylamide gels and after copper staining by electroelution (Tessmer, U. & Dernick, R., IBL (1990) 8-13) for immunization. Antibodies from both chickens and rabbits make it possible to specifically detect expression of MP121. For the schematic Western blot in FIG. 3, chicken antibodies were used, which via PEG precipitation (Thalley BS and Car roll, SB, BIO / Technology Vol. 8, 934-938 (1990)) and via membrane-bound antigen ( Fusion protein (MS2-MP121)) (18.17 in Sambrook et al. Molecular Cloning, second edition, Cold Spring Harbor Laboratory Press 1989). Anti-Chicken IgG with coupled alkaline phosphatase (Sigma A9171) was used as the second antibody. Detection was carried out using the Tropix Western-Light Protein Detection Kit (Serva # WL10RC) according to the manufacturer's instructions.

Um biologisch aktives Material zu erhalten, kann das in E.coli exprimierte und aufgereinigte monomere MP121 zu einem dimeren MP121 zurückgefalten werden. Dies kann nach Methoden wie z. B. beschrieben von Jaenicke, R. & Rudolph, R. (Protein structure, ed. Creighton, T.E., IRL Press, Chapter 9) erfol gen.In order to obtain biologically active material, this can be done in E.coli expressed and purified monomeric MP121 into one dimeric MP121 can be folded back. This can be done according to methods such as B. described by Jaenicke, R. & Rudolph, R. (Protein structure, ed. Creighton, T.E., IRL Press, Chapter 9) suc gene.

Für die Expression in eukaryontischen Zellen wurde das Vaccinia Viren Expressionssystem verwendet, wie es ausführ lich und für den Fachmann nacharbeitbar in den Current Proto cols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wiley-Interscience, Wiley & Sons), im folgen den abgekürzt mit CP, unter Chapter 16 Unit 16.15-16.18 be schrieben ist. Das System beruht darauf, daß Fremd-DNA unter Verwendung bestimmter Vektoren durch homologe Rekombination in das Vaccinia Virus Genoms integriert werden kann. Zu diesem Zweck enthält der verwendete Vektor das TK (Thymidin kinase) Gen aus dem Vaccinia Genom. Um eine Selektion auf rekombinante Viren zu ermöglichen, enthält der Vektor weiter hin das E.coli Xanthin-Guanin-Phosphoribosyl-Transferase Gen (gpt) (Falkner, F.G. & Moss, B., J. of Virol. 62 (1988), 1849-1854). In diesen Vektor wurde die cDNA mit dem gesamten codierenden Bereich für MP121 kloniert. For expression in eukaryotic cells, the Vaccinia virus expression system used as it explains Lich and reworkable in the Current Proto for the specialist cols in Molecular Biology (Ausubel et al., Greene Publishing Associates and Wiley-Interscience, Wiley & Sons), below abbreviated CP, under Chapter 16 Unit 16.15-16.18 be is written. The system relies on foreign DNA under Use of certain vectors by homologous recombination can be integrated into the vaccinia virus genome. To for this purpose the vector used contains the TK (thymidine kinase) gene from the vaccinia genome. To make a selection The vector further contains enabling recombinant viruses the E.coli xanthine guanine phosphoribosyl transferase gene (gpt) (Falkner, F.G. & Moss, B., J. of Virol. 62 (1988), 1849-1854). The cDNA with the entire coding area for MP121 cloned.

Um die 5′ und 3′ nicht translatierten Bereiche aus dem ur sprünglichen Plasmid SK121L9.1 (DSM, Hinterlegungsnummer: 9177) zu verkürzen und an den Enden singuläre Restriktions schnittstellen einzufügen, waren PCR Reaktionen und Zwischen klonierungen notwendig. Alle PCR Reaktionen wurden mit dem Plasmid SK121L9.1 (DSM Hinterlegungsnummer: 9177) durchge führt. Zur Verkürzung des 5′ nicht translatierten Endes wurde der Primer CCCGGATCCGCTAGCACCATGACCTCCTCATTGCTTCTG mit einer eingefügten Bam HI und NheI Restriktionsschnittstelle in einer PCR mit einem internen Primer (CCCTGTTGTCCTCTAGAAGTG) benutzt. Das gewonnene Fragment wurde in Bluescript SK (Stratagene) zwischenkloniert, sequenziert und auf Überein stimmung mit der in SEQ ID NO. 1 gezeigten Sequenz überprüft. Für ein verkürztes 3′ nicht translatiertes Ende wurde das Sph I/Eco RI Fragment (0.22 kb) aus dem Plasmid pBP4MP121His verwendet.Around the 5 'and 3' non-translated areas from the original Original plasmid SK121L9.1 (DSM, deposit number: 9177) and shorten singular restrictions at the ends To insert interfaces were PCR reactions and intermediate cloning necessary. All PCR reactions were carried out with the Plasmid SK121L9.1 (DSM accession number: 9177) leads. To shorten the 5 'untranslated end was the primer CCCGGATCCGCTAGCACCATGACCTCCTCATTGCTTCTG with one inserted Bam HI and NheI restriction site in a PCR with an internal primer (CCCTGTTGTCCTCTAGAAGTG) used. The fragment obtained was in Bluescript SK (Stratagene) intercloned, sequenced and matched in line with that in SEQ ID NO. 1 shown sequence checked. For a shortened 3 'untranslated end, the Sph I / Eco RI fragment (0.22 kb) from the plasmid pBP4MP121His used.

Die beiden End-Fragmente von MP121 wurden über interne Re striktionsschnitte (Xba I und Sph I) mit der fehlenden mitt leren DNA Sequenz aus dem Plasmid SK121L9.1 (DSM Hinterle gungsnummer: 9177 ) nach Standardmethoden (Sambrook et al. Molecular Cloning, second edition, Cold Spring Harbor Labora tory Press 1989) verbunden. Die so erhaltene verkürzte cDNA mit dem vollständigen Leserahmen für MP121 (Nukleotid 128 bis Nukleotid 1184 in SEQ ID No. 1) konnte über Ausnutzung der Restriktionsschnitte Bam HI und Eco RI in den ebenso ge schnittenen Vektor pBPI kloniert werden. Das resultierende Plasmid pBPIMP121 wurde am 12.1.95 bei der DSM (Hinterle gungsnummer: 9665) hinterlegt.The two end fragments of MP121 were internal re restriction cuts (Xba I and Sph I) with the missing mitt DNA sequence from the plasmid SK121L9.1 (DSM Hinterle number: 9177) according to standard methods (Sambrook et al. Molecular Cloning, second edition, Cold Spring Harbor Labora tory Press 1989). The truncated cDNA thus obtained with the complete reading frame for MP121 (nucleotide 128 bis Nucleotide 1184 in SEQ ID No. 1) could take advantage of the Restriction cuts Bam HI and Eco RI in the same ge cloned vector pBPI can be cloned. The resulting Plasmid pBPIMP121 was released on January 12, 1995 at the DSM (Hinterle number: 9665).

Das Plasmid pBPIMP121 wurde für die Herstellung von rekom binanten Vaccinia Viren eingesetzt. Dazu wurden zu 80% kon fluente 143B Zellen (HuTk-, ATCC CRL 8303) in 35 mm Kultur schalen mit Vaccinia Wildtyp Virus in 1 ml PBS für 30 Minuten bei Raumtemperatur unter gelegentlichem Schütteln infiziert (1 Virus auf 10 Zellen). Nach Absaugen des Überstandes und Zugabe von 2 ml Kulturmedium (MEM, Gibco BRL #041-01095 mit 1:500 verdünntem Penicillin und Streptomycin Gibco BRL #043-05140) wurde für 2 Stunden bei 37°C inkubiert. Das Medium wurde anschließend entfernt und die Transformation dieser Zellen mit 100 ng pBPIMP121, 2 µg Träger DNA (Kalbs thymus, Ultraschall behandelt, Boehringer Mannheim #104175) und 10 µl Lipofektin (Gibco BRD #18292-011) in 1 ml MEM für ca. 15 h bei 37°C erreicht. Nach Zugabe von 1 ml MEM mit 20% FCS (Sigma #F-7524) wurde für weitere 24 Stunden bei 37°C inkubiert und die lysierten Zellen anschließend eingefroren.The plasmid pBPIMP121 was used for the production of recom Binary vaccinia viruses are used. For this purpose, 80% of the fluent 143B cells (HuTk, ATCC CRL 8303) in 35 mm culture bowl with vaccinia wild-type virus in 1 ml PBS for 30 minutes infected at room temperature with occasional shaking (1 virus on 10 cells). After aspirating the supernatant and Add 2 ml culture medium (MEM, Gibco BRL # 041-01095 with 1: 500 diluted penicillin and streptomycin Gibco BRL # 043-05140) was incubated for 2 hours at 37 ° C. The Medium was then removed and the transformation of these cells with 100 ng pBPIMP121, 2 µg carrier DNA (calf thymus, treated with ultrasound, Boehringer Mannheim # 104175) and 10 µl lipofectin (Gibco BRD # 18292-011) in 1 ml MEM for reached approx. 15 h at 37 ° C. After adding 1 ml MEM with 20% FCS (Sigma # F-7524) was kept at 37 ° C for an additional 24 hours incubated and the lysed cells then frozen.

Die gpt Selektion auf die Xanthin-Guanin-Phosphoribosyl- Transferase und Isolation und Amplifizierung einzelner rekom binanter Viren erfolgte im wesentlichen wie in Unit 16.17 der CP beschrieben, mit dem Unterschied, daß RK13 Zellen (ATCC CCL 37) verwendet wurden.The gpt selection for the xanthine guanine phosphoribosyl Transferase and isolation and amplification of individual recom binary viruses occurred essentially as in Unit 16.17 of the CP described, with the difference that RK13 cells (ATCC CCL 37) were used.

Die Integration der MP121 cDNA in das Virus Genom wurde durch Dot blot Analyse (CP Unit 16.18) bestätigt. Ein rekombinantes Virus aus der Transfektion mit pBPMP121 sowie der Wildtyp Virus wurden für Expressionsanalysen in den Zellinien 143B (HuTk-, ATCC CRA 8303, human) und NIH-3T3 (DSM ACC 59, swiss mouse embryo) eingesetzt. Die Zellen wurden nach den Angaben der Vertreiber kultiviert. Die konfluenten Zellen wurden mit der dreifachen Anzahl an Viren für 30 Minuten bei 37°C infi ziert und anschließend das entsprechende Kulturmedium mit 10% FCS und Penicillin/Streptomycin (1 : 500, Gibco BRD #043-05140) zugefügt. Nach 6 Stunden bei 37°C wurde das Medium entfernt, die Zellen zweimal mit z. B. HBSS (Gibco BRD #14180-046) gewaschen und Produktionsmedium (MEM für HuTk- bzw. DMEM mit 4.5 g/l Glucose und NEAA (Gibco BRL #11140-035) für NIH-3T3 jeweils versetzt mit Aprotinin (Fluka #10820, 50 U/ml) und Penicillin/Streptomycin) ohne FCS zugesetzt. Nach 20 bis 22 Stunden Produktion wurde der Zellüberstand gesammelt. Die Analyse der Expression erfolgte durch Western blots nach Standardmethoden (CP Unit 10.8). Dafür wurden die Proteine aus 1 bis 3 ml Zellkulturüberstand durch Zugabe des äquiva lenten Volumens an Aceton und Inkubation von mindestens einer Stunde auf Eis präzipitiert und abzentrifugiert. Nach Re suspension des Pellets in Auftragspuffer (7 M Harnstoff, 1% SDS, 7 mM Natriumdihydrogenphosphat, 0,01% Bromphenolblau und gegebenenfalls 1% β-Mercaptoethanol) erfolgte die Auf trennung in 15%igen Polyacrylamidgelen. Als Markerproteine wurde ein vorgefärbter Protein-Molekulargewicht s standard (Gibco BRL #6041-020) eingesetzt. Der Transfer auf PVDF Membran (Immobilon #IPVH00010) und das Abblocken der Membran erfolgten nach Standardmethoden.The integration of the MP121 cDNA into the virus genome was accomplished by Dot blot analysis (CP Unit 16.18) confirmed. A recombinant Virus from transfection with pBPMP121 as well as the wild type Virus were used for expression analysis in cell lines 143B (HuTk-, ATCC CRA 8303, human) and NIH-3T3 (DSM ACC 59, Swiss mouse embryo). The cells were made according to the information the distributor cultivated. The confluent cells were with three times the number of viruses for 30 minutes at 37 ° C infi adorned and then the appropriate culture medium with 10% FCS and penicillin / streptomycin (1: 500, Gibco BRD # 043-05140) added. After 6 hours at 37 ° C, the medium was removed the cells twice with z. B. HBSS (Gibco BRD # 14180-046) washed and production medium (MEM for HuTk or DMEM with 4.5 g / l glucose and NEAA (Gibco BRL # 11140-035) for NIH-3T3 each mixed with aprotinin (Fluka # 10820, 50 U / ml) and Penicillin / streptomycin) added without FCS. After 20 to 22 The cell supernatant was collected for hours of production. The Expression was analyzed by Western blots Standard methods (CP Unit 10.8). For that, the proteins from 1 to 3 ml of cell culture supernatant by adding the equiva volume of acetone and incubation of at least one Hour precipitated on ice and centrifuged. According to Re suspension of the pellet in order buffer (7 M urea, 1% SDS, 7mM sodium dihydrogenphosphate, 0.01% bromophenol blue and optionally 1% β-mercaptoethanol) was carried out separation in 15% polyacrylamide gels. As marker proteins became a pre-stained protein molecular weight s standard (Gibco BRL # 6041-020). The transfer to PVDF Membrane (Immobilon # IPVH00010) and blocking the membrane were made using standard methods.

Eine repräsentative schematisierte Zeichnung der Western blot Ergebnisse in Fig. 3 zeigt, daß bei den rekombinanten Viren MP121 spezifische Banden auftreten. Die Expression von MP121 in NIH-3T3 Zellen führt zu einem sekretierten Protein mit einem im Gel unter nicht reduzierenden Bedingungen erschei nenden Molekulargewicht von ungefähr 18 kDa (erwartetes theoretisches Molekulargewicht: 25 kD). Unter reduzierenden Bedingungen läuft das Protein bei ungefähr 15 kDa im Gel (erwartetes theoretisches Molekulargewicht: 12.5 kD). Diese Ergebnisse zeigen, daß MP121 wie zu erwarten als dimeres reifes Protein exprimiert wird. Das relativ wenig verlang samte Laufverhalten des dimeren MP121 Proteines gegenüber dem monomeren MP121 Protein ist wahrscheinlich mit einer globulä ren Struktur zu begründen. Die Prozessierung des Vorläufer proteines zum reifen Protein konnte auch in HuTK-Zellen gezeigt werden. Bei mit Wildtyp Viren (ohne integrierte Fremd-DNA) infizierten Zellen (HuTK- oder NIH-3T3) traten keine Banden im Western blot auf.A representative schematic drawing of the Western blot results in FIG. 3 shows that specific bands occur in the recombinant viruses MP121. Expression of MP121 in NIH-3T3 cells results in a secreted protein with a molecular weight of approximately 18 kDa appearing in the gel under non-reducing conditions (expected theoretical molecular weight: 25 kD). Under reducing conditions, the protein runs in the gel at approximately 15 kDa (expected theoretical molecular weight: 12.5 kD). These results show that, as expected, MP121 is expressed as a dimeric mature protein. The relatively little slower running behavior of the dimeric MP121 protein compared to the monomeric MP121 protein is probably due to a globular structure. The processing of the precursor protein to the mature protein could also be demonstrated in HuTK cells. In cells infected with wild-type viruses (without integrated foreign DNA) (HuTK- or NIH-3T3), no bands appeared in the Western blot.

Das Vaccinia Expressionssystem eignet sich bei Kotransfektion mit rekombinanten Vaccinia Viren, die für unterschiedliche Mitglieder der TGF-β-Familie codieren, insbesondere auch für die Bildung von Heterodimeren. Über Affinitätssäulen mit spezifischen Antikörpern gegen die einzelnen TGF-β-Familien mitglieder ist es dann möglich, Heterodimere von Homodimeren zu trennen. Insbesondere von Interesse sind dabei die α- sowie die βA- und βB-Ketten der Inhibine. The vaccinia expression system is suitable for cotransfection with recombinant vaccinia viruses that are used for different Code members of the TGF-β family, especially for the formation of heterodimers. About affinity columns with specific antibodies against the individual TGF-β families it is then possible for members to make heterodimers of homodimers to separate. Of particular interest are the α- as well as the βA and βB chains of the inhibins.

SEQ ID NO. 1 SEQ ID NO. 1

SEQ ID NO. 2 SEQ ID NO. 2nd

Claims

1. DNA molecule which codes for a protein of the TGF-β family and

a) the portion coding for the mature protein and optionally further functional portions of the in SEQ ID NO. 1 nucleotide sequence shown,
b) a nucleotide sequence corresponding to the sequence from (a) in the context of the degeneration of the genetic code,
c) a nucleotide sequence corresponding to an allelic derivative of one of the sequences from (a) and (b), or
d) a nucleotide sequence hybridizing with one of the sequences from (a), (b) or (c) comprises, provided that a DNA molecule according to (d) completely at least the portion coding for a mature protein of the TGF-β family contains.

2. DNA molecule according to claim 1, characterized, that in addition to one of the parts (a) to (d) of claim 1 has a nucleic acid sequence which is suitable for at least one Part of another protein is encoded and arranged so that a fusion protein results after expression.

3rd vector, characterized, that he has at least one copy of a DNA molecule Claim 1 or 2 contains.

4. host cell, characterized, that with a DNA according to claim 1 or 2 or one Vector is transformed according to claim 3.

5. host cell according to claim 4, characterized, that they are a bacterium, a fungus, a vegetable or is an animal cell.

6. Protein of the TGF-β family derived from a DNA sequence Claim 1 or 2 is encoded.

7. Protein according to claim 6, characterized, that it is the one in SEQ ID NO. 2 amino acid sequence shown or optionally has functional portions thereof.

8. chimeric protein, characterized, that it is a protein according to claim 6 or 7 and at least contains part of another protein.

9. heterodimeric protein, characterized, that it consists of a monomer of a protein according to claim 6, 7 or 8 and a monomer of another protein from the Superfamily with "Cystine Knot Motif" exists.

10. A method for producing a protein according to one of the Claims 6 to 8, characterized, that one cultivates a host cell according to claim 4 or 5 and the protein from the cell and / or the culture supernatant wins.

11. Process for the production of a heterodimeric protein according to claim 9, characterized, that one coexpression of both monomers in one Host cell.

12. Process for the production of a heterodimeric protein according to claim 9, characterized, that there is a common renaturation of inclusion bodies of both monomers.

13. Pharmaceutical composition, characterized, that they contain at least one protein according to one of claims 6 to 9 as an active ingredient, optionally together with pharmazeu table usual carrier, auxiliary, dilution or filling contains substances.

14. Pharmaceutical composition according to claim 13 for Treatment or prevention of bone, cartilage, Connective tissue, skin, mucous membrane, endothelial, epithelial, Neuronal, brain, renal or tooth damage, for Use on dental implants, for use in wounds recovery or tissue recovery processes, as Morphogen for use in induction of liver tissue wax tum, induction of proliferation of progenitor cells or Bone marrow cells, to maintain a difference condition and for the treatment of fertility disorders or for contraception.

15. anti-sense RNA, characterized, that they are complementary to part of a DNA molecule according to claim 1.

16. ribozyme, characterized, that it is an RNA molecule that is transcribed after a DNA molecule according to claim 1, specifically cleaves.

17. Use of an antisense RNA according to claim 15 or a ribozyme according to claim 16 for blocking the Expression of a protein according to any one of claims 6 and 7.

18. Use of a DNA sequence according to claim 1 or 2 or of a vector according to claim 3 for in vitro or in vivo Transfection of patient cells.

19. Antibodies or antibody fragments, characterized, that they are attached to a protein according to any one of claims 6 to 9 tie.

20. receptor, characterized, that a protein according to one of claims 6 and 7 speci binds fish to him.