RU2136748C1

RU2136748C1 - Polypeptide showing activity of cold-resistant pyruvate-orthophosphate dikinase (variants), cloned dna encoding polypeptide, recombinant vector and method of plant transformation

Info

Publication number: RU2136748C1
Application number: RU96108242A
Authority: RU
Inventors: Шозо Охта; Сатору Усами; Джеймс Найджелл Бурнелл
Original assignee: Джепан Тобакко Инк.
Priority date: 1994-07-29
Filing date: 1995-05-30
Publication date: 1999-09-10
Also published as: CN1174093C; WO1996004369A1; RO118451B1; BR9506291A; UA28003C2; MX9601212A; CN1135770A

Abstract

FIELD: genetic engineering. SUBSTANCE: site of nucleotide sequence of gene encoding pyruvate-orthophosphate dikinase and responsible for expression of polypeptide showing activity with respect of resistance to cold is isolated. Incorporation of the indicated gene in plant cells using vector followed by regeneration of whole plants from cells ensures to obtain plants exhibiting resistance to cold. EFFECT: improved method of plant transformation. 13 cl, 34 dwg, 2 tbl, 8 ex

Description

Настоящее изобретение относится к новому полипептиду, обладающему активностью устойчивой к холоду пируват-ортофосфат дикиназы (которая в дальнейшем обозначается ПФДК), клонированной ДНК, кодирующей этот полипептид, и рекомбинантному вектору, содержащему эту ДНК, с целью получения устойчивых к холоду растений. Настоящее изобретение относится также к растениям, трансформированным с помощью ДНК в соответствии с настоящим изобретением. The present invention relates to a new polypeptide having cold resistant pyruvate orthophosphate dikinase activity (hereinafter referred to as PFDK), a cloned DNA encoding this polypeptide, and a recombinant vector containing this DNA in order to obtain cold resistant plants. The present invention also relates to plants transformed with DNA in accordance with the present invention.

Уровень техники. The prior art.

C₄- Растения имеют высокую способность к фотосинтезу в условиях сильного освещения, высокой температуры или низкого уровня CO₂. Однако их способность к фотосинтезу сильно понижается при низкой температуре за исключением тех растений, которые адаптировались к условиям низких температур. Хотя ПФДК (ЕС 2.7.9.1. , которая катализирует реакцию, в которой АМФ, фосфоенолпируват и пирофосфат образуются из АТФ, пирувата и ортофосфата) является одним из важных ферментов C₄ - пути, ее активность недостаточна в отношении скорости фотосинтеза в ткани листа, так что она является одним из ферментов, которые определяют скорость фиксации CO₂ при C₄-фотосинтезе. Кроме того, одновременно с открытием этого фермента было обнаружено, что этот фермент является чувствительным к холоду. В случае ПФДК кукурузы активность фермента имеет точку перегиба при 11,7^oC. Эта температура совпадает с граничной температурой роста кукурузы. Исходя из этого предполагают, что ПФДК является одной из причин, которые уменьшают скорость фотосинтеза в C₄- растениях при низкой температуре. Поэтому с помощью усовершенствования чувствительной к холоду ПФДК может быть понижена граничная температура роста кукурузы. Flaveria brownii, которая является растением, принадлежащим к семейству Compositae, классифицируется как промежуточный C₃/C₄-тип, и известно, что ее ПФДК значительно не инактивируется при низкотемпературной обработке при 0^oC (Burnell JN: А comparative study of the cold-sensitivity of pyruvate. Pi dikinase in Flaveria species.- Plant Cell PhysioL., 31, 295-97 (1990)).C ₄ - Plants have a high ability to photosynthesis in conditions of strong light, high temperature or low levels of CO ₂ . However, their ability to photosynthesis is greatly reduced at low temperatures, with the exception of those plants that have adapted to low temperature conditions. Although PFDK (EU 2.7.9.1., Which catalyzes a reaction in which AMP, phosphoenolpyruvate and pyrophosphate are formed from ATP, pyruvate and orthophosphate) is one of the important C ₄ pathway enzymes, its activity is insufficient in relation to the rate of photosynthesis in leaf tissue, so that it is one of the enzymes that determine the rate of CO ₂ fixation during C ₄ photosynthesis. In addition, simultaneously with the discovery of this enzyme, it was discovered that this enzyme is sensitive to cold. In the case of corn PPDK, the enzyme activity has an inflection point at 11.7 ^o C. This temperature coincides with the boundary temperature of corn growth. Proceeding from this, it is suggested that PPDK is one of the reasons that decrease the rate of photosynthesis in C ₄ plants at low temperature. Therefore, by improving the cold-sensitive PFDK, the boundary temperature of corn growth can be lowered. Flaveria brownii, which is a plant belonging to the Compositae family, is classified as an intermediate C ₃ / C ₄ type, and it is known that its PPDK is not significantly inactivated by low temperature treatment at 0 ^o C (Burnell JN: A comparative study of the cold- sensitivity of pyruvate. Pi dikinase in Flaveria species. - Plant Cell Physio L., 31, 295-97 (1990)).

При клонировании гена, кодирующего холодоустойчивую ПФДК Flaveria brownii, и трансформировании растения с этим геном ожидается, что в растение может быть привнесена сопротивляемость холоду. When cloning a gene encoding the cold-resistant PFDK Flaveria brownii and transforming a plant with this gene, it is expected that resistance to cold can be introduced into the plant.

Раскрытие сущности изобретения
Объектом настоящего изобретения является новый полипептид, обладающий активностью устойчивой к охлаждению ПФДК, клонированная ДНК, кодирующая этот полипептид, и рекомбинантный вектор, содержащий ДНК как средство для сообщения растениям устойчивости к холоду. Другим объектом настоящего изобретения является получение растений, трансформированных с помощью упомянутой выше ДНК в соответствии с настоящим изобретением.Disclosure of the invention
The object of the present invention is a new polypeptide having cooling-resistant PFDK activity, a cloned DNA encoding this polypeptide, and a recombinant vector containing DNA as a means to give plants resistance to cold. Another object of the present invention is the production of plants transformed with the aforementioned DNA in accordance with the present invention.

Для успешного осуществления клонирования полного гена ПФДК Flaveria brownii авторы изобретения провели тщательное исследование, в котором определили нуклеотидную последовательность гена и аминокислотную последовательность, которая ею кодируется, идентифицировали область ПФДК-гена, которая сообщает устойчивость к холоду, таким образом завершая настоящее изобретение. To successfully complete the cloning of the Flaveria brownii full PPDK gene, the inventors carried out a thorough study, which determined the nucleotide sequence of the gene and the amino acid sequence that it encodes, identified the region of the PFDK gene that reports cold resistance, thus completing the present invention.

Таким образом, настоящее изобретение обеспечивает получение полипептида, обладающего активностью холодоустойчивой ПФДК, который имеет такую же аминокислотную последовательность, как аминокислотная последовательность 1/6 части всей области последовательности следующих полипептидов (1) и (2) от C-конца, за исключением того, что по крайней мере один аминокислотный остаток из упомянутой 1/6 части области замещается другими аминокислотными остатками:
(1) ПФДК, имеющая аминокислотную последовательность, изображенную на листе последовательностей за NN от 1 до 4,
(2) полипептид, имеющий аминокислотную последовательность, которая имеет гомологию не менее 50% с упомянутой в (1) аминокислотной последовательностью, причем упомянутый полипептид обладает активностью устойчивой к холоду ПФДК.Thus, the present invention provides a polypeptide having a cold-resistant PFDK activity that has the same amino acid sequence as the amino acid sequence 1/6 of the entire sequence region of the following polypeptides (1) and (2) from the C-terminus, except that at least one amino acid residue from said 1/6 of the region is replaced by other amino acid residues:
(1) PFDK having the amino acid sequence shown on the sequence sheet for NN from 1 to 4,
(2) a polypeptide having an amino acid sequence that has a homology of at least 50% with the amino acid sequence mentioned in (1), said polypeptide having a cold-resistant PFDK activity.

Настоящее изобретение также обеспечивает получение клонированной ДНК, кодирующей полипептид, обладающий активностью холодоустойчивой ПФДК, в соответствии с настоящим изобретением. The present invention also provides the production of a cloned DNA encoding a polypeptide having the activity of cold-resistant PFDK in accordance with the present invention.

Настоящее изобретение также обеспечивает получение рекомбинантного вектора, содержащего ДНК в соответствии с настоящим изобретением, который может экспрессировать в клетке-хозяине полипептид, обладающий активностью устойчивой к холоду ПФДК. Кроме того, настоящее изобретение обеспечивает получение растения, которое трансформируется с помощью ДНК в соответствии с настоящим изобретением. The present invention also provides the production of a recombinant vector containing DNA in accordance with the present invention, which can express in the host cell a polypeptide having activity resistant to cold PFDK. In addition, the present invention provides a plant that is transformed with DNA in accordance with the present invention.

С помощью настоящего изобретения был клонирован ген, кодирующий ПФДК, имеющую устойчивость к холоду, и была определена его последовательность. Далее была идентифицирована область гена, которая обеспечивает устойчивость к холоду. Затем путем трансформирования растения, имеющего чувствительную к холоду ПФДК, с помощью гена в соответствии с настоящим изобретением чувствительная к холоду ПФДК может быть заменена на устойчивую к нему ПФДК. Далее путем включения упомянутой выше области, придающей устойчивость к холоду, в соответствующую область чувствительной к холоду ПФДК, чувствительная к холоду ПФДК может быть заменена на холодоустойчивую ПФДК. Благодаря этому можно культивировать растения в районах с холодным климатом, в которых до сих пор растения выращивать было невозможно. Вследствие этого ожидается, что настоящее изобретение внесет большой вклад в сельское хозяйство. Using the present invention, a gene encoding PFDK having resistance to cold was cloned, and its sequence was determined. Next, a gene region was identified that provides resistance to cold. Then, by transforming a plant having cold-sensitive PFDK using a gene according to the present invention, cold-sensitive PFDK can be replaced by a resistant PFDK. Further, by including the cold resistance region mentioned above in the corresponding region of cold sensitive PFDK, cold sensitive PFDK can be replaced by cold resistant PFDK. Thanks to this, plants can be cultivated in areas with a cold climate, in which it was still impossible to grow plants. Therefore, the present invention is expected to make a great contribution to agriculture.

Краткое описание чертежей
Фиг 1. На чертеже схематически изображен метод конструирования вектора экспрессии, содержащего пример гена ПФДК в соответствии с настоящим изобретением;
фиг 2. На чертеже показано изменение активности фермента со временем, когда ПФДК Flaveria brownii, Flaveria bidentis и кукурузы, которые были экспрессированы в Escherichia coli, выдерживали при 0^oC;
фиг 3. На чертеже схематически показан метод конструирования вектора экспрессии, содержащего пример гена ПФДК в соответствии с настоящим изобретением.Brief Description of the Drawings
Fig 1. The drawing schematically depicts a method of constructing an expression vector containing an example of the PPDK gene in accordance with the present invention;
Fig 2. The drawing shows the change in the activity of the enzyme over time, when PFDK Flaveria brownii, Flaveria bidentis and corn, which were expressed in Escherichia coli, was kept at 0 ^o C;
Fig 3. The drawing schematically shows a method for constructing an expression vector containing an example of the PPDK gene in accordance with the present invention.

Фиг. 4-34. Здесь отдельно показаны формулы аминокислотных и нуклеотидных последовательностей для иллюстрации конкретных примеров выполнения настоящего изобретения. FIG. 4-34. Separate formulas of amino acid and nucleotide sequences are shown here to illustrate specific exemplary embodiments of the present invention.

Лучший вариант выполнения изобретения. The best embodiment of the invention.

С помощью настоящего изобретения был клонирован ген ПФДК, обладающей устойчивостью к холоду Flaveria brownii, и были определены его нуклеотидная и соответствующая ей аминокислотная последовательности. Нуклеотидная и аминокислотная последовательности представлены на фиг. 8 под номером Последовательность N 5. Как детально описано в последующих примерах, эта последовательность была определена путем экстракции тотальной РНК из листьев Flaveria brownii; приготовления библиотеки комплементарной ДНК (к-ДНК) в соответствии с общепринятым методом, выполнения метода гибридизации бляшек с использованием зонда, приготовленного путем соотнесения с областью гена ПФДК Flaveria bidentis и областью гена ПФДК кукурузы, которые имеют высокую степень гомологии; с помощью селекции и клонирования позитивных клонов, и определения последовательности гена дидеокси-методом. Последовательность имеет высокую гомологию с геном ПФДК Flaveria bidentis, принадлежащую тому же роду, и имеет сравнительно большую гомологию с геном ПФДК кукурузы. Кроме того, последовательности N-концевой области, C-концевой области и внутренних областей полученной аминокислотной последовательности являются полностью такими же, как соответствующие последовательности ПФДК Flaveria brownii непосредственно выделенной из зеленых листьев этого растения. Поэтому очевидно, что клонированный ген является геном ПФДК Flaveria brownii Ген ПФДК Flaveria bidentis был секвенирован путем проведения гибридизации бляшек, используя кДНК кукурузы в качестве зонда; клонирования позитивных клонов и определения последовательности гена с помощью дидеокси-метода. Using the present invention, the PFDK gene, which is resistant to the cold Flaveria brownii, was cloned, and its nucleotide and its corresponding amino acid sequence were determined. The nucleotide and amino acid sequences are shown in FIG. 8 under the number. Sequence N 5. As described in detail in the following examples, this sequence was determined by extraction of total RNA from the leaves of Flaveria brownii; preparing a library of complementary DNA (c-DNA) in accordance with the generally accepted method; performing a plaque hybridization method using a probe prepared by correlating with the region of the PFDK gene of Flaveria bidentis and the region of the PFDK gene of maize, which have a high degree of homology; by selecting and cloning positive clones, and determining the gene sequence by the dideoxy method. The sequence has a high homology with the Flavia bidentis PFDK gene belonging to the same genus and has a relatively large homology with the maize PFDK gene. In addition, the sequences of the N-terminal region, C-terminal region and the inner regions of the obtained amino acid sequence are completely the same as the corresponding PFDK sequences of Flaveria brownii directly isolated from the green leaves of this plant. Therefore, it is obvious that the cloned gene is the Flaveria brownii PPDK gene. The Flaveria bidentis PFDK gene was sequenced by plaque hybridization using maize cDNA as a probe; cloning positive clones and determining the gene sequence using the dideoxy method.

Аминокислотная последовательность, представленная под номером Последовательность N 5, является новой, и 40 аминокислотных остатков ее отличаются от аминокислотной последовательности ПФДК Flaveria bidentis, принадлежащей тому же роду. Около 180 ее аминокислотных остатков отличаются от аминокислотной последовательности ПФДК кукурузы. Таким образом, несмотря на тот факт, что аминокислотная последовательность ПФДК Flaveria brownii, представленная под номером Последовательность N 5, имеет высокую степень гомологии с аминокислотной последовательностью ПФДК Flaveria bidentis, принадлежащей к тому же роду, ПФДК Flaveria bidentis является холодочувствительной, в то время как аналогичный фермент Flaveria brownii является холодоустойчивым. Таким образом, небольшое различие в аминокислотных остатках сообщает важное различие в свойствах. Настоящее изобретение обеспечивает получение клонированного гена ПФДК, который кодирует аминокислотную последовательность N 5. Как упоминалось выше, эта аминокислотная последовательность является новой и обладает заметным влиянием на устойчивость к холоду. Ген в соответствии с настоящим изобретением не ограничивается геном, имеющего нуклеотидную последовательность, показанную под на фиг. 8 под N 5, однако любая нуклеотидная последовательность, которая кодирует эту аминокислотную последовательность, принадлежит к генам, на которые распространяется настоящее изобретение. The amino acid sequence represented by sequence number 5 is new, and its 40 amino acid residues differ from the amino acid sequence of PFDK Flaveria bidentis, belonging to the same genus. About 180 of its amino acid residues differ from the amino acid sequence of PFDK maize. Thus, despite the fact that the amino acid sequence of PFDK Flaveria brownii, presented under the number Sequence No. 5, has a high degree of homology with the amino acid sequence of PFDK Flaveria bidentis belonging to the same genus, PFDK Flaveria bidentis is cold-sensitive, while similar Flaveria brownii enzyme is cold resistant. Thus, a slight difference in amino acid residues provides an important difference in properties. The present invention provides a cloned PPDK gene that encodes the amino acid sequence N 5. As mentioned above, this amino acid sequence is new and has a significant effect on cold resistance. The gene in accordance with the present invention is not limited to a gene having the nucleotide sequence shown below in FIG. 8 under No. 5, however, any nucleotide sequence that encodes this amino acid sequence belongs to the genes to which the present invention extends.

Авторы настоящего изобретения попытались идентифицировать ту область гена ПФДК из Flaveria brownii которая показана на фиг. 8 под N 5, которая сообщает устойчивость к холоду. То есть, как описано детально в последующих примерах, ген ПФДК Flaveria brownii был разделен на три области, имеющие примерно одинаковый размер, при помощи ферментов рестрикции, при этом каждая из областей обменивалась с соответствующей областью гена ПФДК кукурузы с образованием химерных генов ПФДК, и исследовалось, обладают ли устойчивостью к холоду ПФДКиназы, которые кодируются полученными химерными генами. В результате было подтверждено, что область, ответственная за устойчивость к холоду, находится в последней трети области гена ПФДК Flaveria brownii. В дальнейшем эта последняя треть области была разделена с помощью фермента рестрикции на две области, имеющие примерно одинаковый размер, и было определено теми же методами, какой фрагмент содержит область, ответственную за устойчивость к холоду. В результате было подтверждено, что функция, сообщающая устойчивость к холоду, закодирована в области, находящейся ниже сайта Xho I гена ПФДК из Flaveria brownii, показанного на фиг. 8 под N 5. Таким образом, было подтверждено, что функция передачи устойчивости к холоду локализована внутри аминокислотной последовательности между 832-ым аминокислотным остатком, аргинином, и 955-ым аминокислотным остатком, валином, в аминокислотной последовательностью, показанной на фиг. 8 под N 5 (аминокислотная последовательность от 832 аминокислотного остатка до 955 аминокислотного остатка в дальнейшем может называться "последовательность, ответственная за устойчивость к холоду"). The present inventors have attempted to identify the region of the PPDK gene from Flaveria brownii which is shown in FIG. 8 under N 5, which reports resistance to cold. That is, as described in detail in the following examples, the Flaveria brownii PPDK gene was divided into three regions of approximately the same size using restriction enzymes, with each of the regions exchanging with the corresponding region of the maize PPDK gene to form chimeric PPDK genes, and studied whether they possess cold resistance PFD kinases, which are encoded by the obtained chimeric genes. As a result, it was confirmed that the region responsible for resistance to cold is in the last third of the region of the PFDK gene Flaveria brownii. Subsequently, this last third of the region was divided by a restriction enzyme into two regions of approximately the same size, and it was determined by the same methods which fragment contains the region responsible for cold resistance. As a result, it was confirmed that the function reporting resistance to cold was encoded in the region below the Xho I site of the PPDK gene from Flaveria brownii shown in FIG. 8 under N 5. Thus, it was confirmed that the function of transferring resistance to cold is localized within the amino acid sequence between the 832th amino acid residue, arginine, and the 955th amino acid residue, valine, in the amino acid sequence shown in FIG. 8 under N 5 (the amino acid sequence from 832 amino acid residues to 955 amino acid residues may hereinafter be referred to as the "sequence responsible for cold resistance").

То есть было доказано, что область, относящаяся к холодоустойчивости ПФДК, локализуется в 1/6 части всей области от C-конца. С другой стороны, нуклеотидная последовательность гена, кодирующая ПФДК из Flaveria bidentis, и соответствующая ей аминокислотная последовательность представлены на фиг. 4, последовательность N 1, а нуклеотидная последовательность гена, кодирующего ПФДК кукурузы и соответствующая ей аминокислотная последовательность представлены на фиг. 5, последовательность N 2 (Jornal of Biochemistry, 263. 11080-83 (1989)). На фиг. 6, последовательность N 3, представлены нуклеотидная последовательность гена, кодирующего ПФДК из Bacteroides symbiosus, которая является бактерией, и соответствующая нуклеотидной аминокислотная последовательность (Biochemistry, 29. 10757-65, (1990)). На Фиг.7, последовательность N 4 представлены нуклеотидная последовательность гена, кодирующего ПФДК Entamoeba histolytica, которая является бактерией, и соответствующая ей аминокислотная последовательность (Molecular and Biochemical Parasitology, 62. 153-56 (1993)). Как описано выше, настоящим изобретением было подтверждено, что область, отвечающая за устойчивость ПФДК к холоду, локализована в 1/6 части всей области от C-конца, и можно получить стабильную к холоду ПФДК путем замещения по крайней мере одного аминокислотного остатка в 1/6 части всей области от C-конца аминокислотной последовательности, показанной на фиг. 4-7 под N 1, 2, 3 или 4. Здесь термин "устойчивость к холоду" означает, что активность фермента после выдерживания фермента при 0^oC в течение 20 минут имеет не менее 60% первоначальной активности.That is, it was proved that the region related to cold resistance of PFDK is localized in 1/6 of the entire region from the C-terminus. On the other hand, the nucleotide sequence of the gene encoding the PPDK from Flaveria bidentis and its corresponding amino acid sequence are shown in FIG. 4, the sequence is N 1, and the nucleotide sequence of the gene encoding the PPDK of maize and its corresponding amino acid sequence are shown in FIG. 5, sequence N 2 (Jornal of Biochemistry, 263. 11080-83 (1989)). In FIG. 6, sequence No. 3, the nucleotide sequence of the gene encoding the PPDK from Bacteroides symbiosus, which is a bacterium, and the corresponding nucleotide amino acid sequence are presented (Biochemistry, 29. 10757-65, (1990)). 7, sequence N 4 shows the nucleotide sequence of the gene encoding PFDK Entamoeba histolytica, which is a bacterium, and its corresponding amino acid sequence (Molecular and Biochemical Parasitology, 62. 153-56 (1993)). As described above, the present invention has confirmed that the region responsible for cold resistance of PPDK is located in 1/6 of the entire region from the C-terminus, and cold-resistant PFDK can be obtained by replacing at least one amino acid residue in 1 / 6 parts of the entire region from the C-terminus of the amino acid sequence shown in FIG. 4-7 under N 1, 2, 3 or 4. Here, the term "resistance to cold" means that the activity of the enzyme after keeping the enzyme at 0 ^o C for 20 minutes has at least 60% of the initial activity.

Как упоминалось выше, поскольку область от 832 аминокислотного остатка, аргинина, до 955 аминокислотного остатка, валина, в аминокислотной последовательности, показанной на фиг. 8 под N 5, определяет холодоустойчивость, чувствительные к холоду ПФДКиназы, имеющие аминокислотные последовательности, показанные на Фиг. 4-7 под N 1-4, могут быть превращены в холодоустойчивые ПФДКиназы путем замещения соответствующих областей холодочувствительных ПФДКиназ на аминокислотную последовательность от 832 аминокислотного остатка, аргинина, до 955 аминокислотного остатка, валина, из аминокислотной последовательности, представленной на фиг. 8 под N 5. Этот факт является очень важным благодаря тому, что при его использовании любую из холодочувствительных ПФДКиназ можно превратить в холодоустойчивую. Способ придания ПФДК холодоустойчивости не ограничивается методом, описанным ниже в примерах, в которых последовательность, придающая ПФДК из Flaveria brownii холодоустойчивость, обменивается с соответствующим районом холодочувствительной ПФДК для приготовления химерного гена, но устойчивость к холоду может быть также придана с помощью специфического мутагенеза при замене соответствующего района холодочувствительной ПФДК растения на ту же самую последовательность, как последовательность Flaveria brownii, привносящая устойчивость к холоду. Поэтому любая ДНК, которая кодирует полипептид, обладающий активностью ПФДК, содержащий описанную выше последовательность, ответственную за холодоустойчивость, относится к сфере настоящего изобретения. В частности, ПФДК, в которой 869-ый аминокислотный остаток в аминокислотной последовательности, показанной на фиг. 4 под N 1, замещен на пролин, и ПФДК, в которой 885-ый и 952-ой аминокислотные остатки в аминокислотной последовательности, показанной на фиг. 4 под N 1, замещен на лейцин и валин, соответственно, являются холодоустойчивыми. As mentioned above, since the region is from 832 amino acid residues, arginine, to 955 amino acid residues, valine, in the amino acid sequence shown in FIG. 8 under No. 5 defines cold resistance, cold-sensitive PFD kinases having the amino acid sequences shown in FIG. 4-7 under N 1-4 can be converted into cold-resistant PFDKinases by substituting the corresponding regions of cold-sensitive PFDKinases with an amino acid sequence from 832 amino acid residues, arginine, to 955 amino acid residues, valine, from the amino acid sequence shown in FIG. 8 under N 5. This fact is very important due to the fact that with its use any of the cold-sensitive PFDKinases can be turned into a cold-resistant one. The method of imparting cold-resistance to PFDK is not limited to the method described in the examples below, in which the sequence that confers cold-resistance to PFDK from Flaveria brownii is exchanged with the corresponding region of cold-sensitive PFDK for the preparation of the chimeric gene, but cold resistance can also be given by specific mutagenesis by replacing the corresponding mutagenesis area of the cold-sensitive PFDK plant to the same sequence as the Flaveria brownii sequence, which brings resistance to cold. Therefore, any DNA that encodes a polypeptide having PFDK activity containing the cold resistance sequence described above is within the scope of the present invention. In particular, PFDK, in which the 869th amino acid residue in the amino acid sequence shown in FIG. 4 under N 1 is substituted for proline, and PPDK, in which the 885th and 952nd amino acid residues in the amino acid sequence shown in FIG. 4 under N 1, substituted for leucine and valine, respectively, are cold resistant.

ПФДКиназы, которым должна быть сообщена устойчивость к холоду, не ограничиваются теми, которые показаны на фиг. 4-7 под N 1-4, сюда относятся также такие, которые имеют не менее 50% гомологии в последовательностях, показанных на фиг. 4-7 N 1-4. Предпочтительно, чтобы нуклеотидная последовательность гена, кодирующего ПФДК, которой должна быть придана холодоустойчивость, обладала гомологией с геном ПФДК из Flaveria brownii в количестве не менее, чем 48.5%, более предпочтительно не менее 90%. PFD kinases to which cold resistance should be reported are not limited to those shown in FIG. 4-7 under N 1-4, this also includes those that have at least 50% homology in the sequences shown in FIG. 4-7 N 1-4. Preferably, the nucleotide sequence of the gene that encodes PFDK to be cold-resistant has homology to the PFDK gene from Flaveria brownii in an amount of not less than 48.5%, more preferably not less than 90%.

Специалистам хорошо известно, что имеют место случаи, когда физиологическая активность физиологически активных пептидов сохраняется, даже если аминокислотная последовательность пептида подвергается в небольшой степени модификации, то есть, если одна или несколько аминокислот в аминокислотной последовательности замещается или отсутствует, или если одна или несколько аминокислот добавляется к аминокислотной последовательности. Поэтому полипептиды, имеющие ту же аминокислотную последовательность, как показанная на фиг. 8 под N 5 а также полипептиды, модифицированные вышеуказанным образом, обладающие активностью устойчивой к холоду ПФДК, относятся к области настоящего изобретения, а также полипептиды, имеющие ту же самую аминокислотную последовательность, как показано на фиг. 8 под N 5, содержащие на одну или несколько аминокислот больше или меньше, или замещенные на другие аминокислоты, и которые обладают активностью устойчивой к холоду ПФДК, относятся к сфере настоящего изобретения. Аналогично, ДНК, имеющие те же нуклеотидные последовательности, как показано на фиг. 8 под N 5, а также такие, где один или несколько нуклеотидов добавляются, отсутствуют или замещаются, и которые кодируют полипептиды, обладающие активностью устойчивой к холоду ПФДК, также относятся к области настоящего изобретения. It is well known to those skilled in the art that there are cases where the physiological activity of physiologically active peptides is maintained even if the amino acid sequence of the peptide is slightly modified, that is, if one or more amino acids in the amino acid sequence is replaced or absent, or if one or more amino acids is added to the amino acid sequence. Therefore, polypeptides having the same amino acid sequence as shown in FIG. 8 under N 5, as well as polypeptides modified in the aforementioned manner, possessing cold-resistant PFDK activity, are within the scope of the present invention, as well as polypeptides having the same amino acid sequence as shown in FIG. 8 under N 5, containing one or more amino acids more or less, or substituted with other amino acids, and which have cold-resistant PPDK activity, are within the scope of the present invention. Similarly, DNAs having the same nucleotide sequences as shown in FIG. 8 under No. 5, as well as those where one or more nucleotides are added, absent or substituted, and which encode polypeptides having cold-resistant PFDK activity, are also within the scope of the present invention.

Модификация ДНК, которая вызывает добавление, утрату или замещение в аминокислотной последовательности, которая ею кодируется, может быть достигнута с помощью направленного мутагенеза, который хорошо известен специалистам (например, Nucleic Acid Research, 10, N 20, 6487-6500, (1982)). В принятой здесь терминологии "одна или несколько аминокислот" означает количество аминокислот, которые могут быть добавлены, утрачены или замещены посредством направленного мутагенеза. Modification of DNA that causes addition, loss or substitution in the amino acid sequence that it encodes can be achieved using directed mutagenesis, which is well known in the art (e.g., Nucleic Acid Research, 10, N 20, 6487-6500, (1982)) . In the terminology used herein, “one or more amino acids” means the number of amino acids that can be added, lost or substituted by targeted mutagenesis.

Направленный мутагенез может осуществляться, например, при использовании синтетического олигонуклеотидного праймера, комплементарного однонитевой фаговой ДНК, кроме тех случаев, когда желательная мутация выполняется следующим образом. Она состоит в том, что, при использовании в качестве праймера упомянутого выше синтетического олигонуклеотида, фагом воспроизводится комплементарная цепь, и бактериальные клетки хозяина трансформируются с помощью полученной двухцепочечной ДНК. Культура трансформированных бактериальных клеток засевается в агар, и бляшки формируются из единственной клетки, содержащей фаг. Теоретически 50% новых колоний содержат фаг, имеющий однонитевую цепь, несущую мутацию, а другие 50% колоний содержат фаг, имеющий исходную последовательность. Полученные бляшки затем подвергаются гибридизации с обработанным киназой синтетическим зондом при температуре, при которой зонд гибридизируется с ДНК, имеющей точно такую же последовательность, как ДНК, имеющая нужную мутацию, а не с исходной последовательностью ДНК, которая не является полностью комплементарной зонду. Затем бляшки, в которых наблюдалась гибридизация, собирали, культивировали, и ДНК объединяли. Directed mutagenesis can be carried out, for example, using a synthetic oligonucleotide primer complementary to single-stranded phage DNA, except in cases where the desired mutation is performed as follows. It consists in the fact that when using the synthetic oligonucleotide mentioned above as a primer, a complementary strand is reproduced by the phage, and the host bacterial cells are transformed using the obtained double-stranded DNA. A culture of transformed bacterial cells is seeded in agar, and plaques are formed from a single cell containing phage. Theoretically, 50% of the new colonies contain a phage having a single strand chain carrying a mutation, and the other 50% of the colonies contain a phage having the original sequence. The resulting plaques are then hybridized with a kinase-treated synthetic probe at a temperature at which the probe hybridizes to a DNA having exactly the same sequence as the DNA having the desired mutation, and not to the original DNA sequence, which is not completely complementary to the probe. Then the plaques in which hybridization was observed were collected, cultured, and DNA was combined.

В дополнение к упомянутому выше направленному мутогенезу методы замещения, удаления или добавления одной или нескольких аминокислот без потери ферментативной активности включают метод, в котором ген обрабатывается мутагеном, и метод, в котором ген избирательно расщепляется, выбранный нуклеотид удаляется, добавляется или замещается, а затем ген сшивается. In addition to the targeted mutogenesis mentioned above, methods for substituting, removing or adding one or more amino acids without loss of enzymatic activity include a method in which a gene is processed by a mutagen and a method in which a gene is selectively cleaved, a selected nucleotide is deleted, added or replaced, and then the gene stitched.

Посредством трансформирования растения с помощью гена ПФДК из Flaveria browbii или с помощью ДНК, кодирующей полипептид, содержащий последовательность, придающую холодоустойчивость, и обладающий активностью ПФДК, можно получить устойчивое к холоду растение. К предпочтительным примерам растений, которые должны быть трансформированы, относятся кукуруза, сахарный тростник, просо, ежовник и сорго, но этим список не ограничивается. By transforming a plant using the PFDK gene from Flaveria browbii or using DNA encoding a polypeptide containing a sequence that confers cold resistance and has PFDK activity, a cold resistant plant can be obtained. Preferred examples of plants to be transformed include corn, sugarcane, millet, blackberry and sorghum, but this is not limited to.

Методы трансформирования растений уже были установлены, и предпочтение может быть отдано методу, использующему Agrobacterium tumefaciens. Метод трансформирования растений, использующий Agrobacterium tumefaciens, хорошо известен специалистам. Этим методом могут быть трансформированы как двудольные растения (например, Японская выложенная заявка (Kokai) N 4-330234), так и однодольные растения (WO 94/00977). В качестве альтернативы, можно вводить ДНК в протопласты растений с помощью метода электропорации или подобного широко известного метода. Кроме того, трансформацию можно также проводить путем присоединения ДНК к частицам вольфрама и подобным и имплантировать частицы в зародыши растения. Конкретное осуществление этих методов трансформации описывается в приведенных ниже примерах. Plant transformation methods have already been established, and preference may be given to a method using Agrobacterium tumefaciens. A plant transformation method using Agrobacterium tumefaciens is well known in the art. By this method, both dicotyledonous plants (for example, Japanese Laid-open Application (Kokai) N 4-330234) and monocotyledonous plants (WO 94/00977) can be transformed. Alternatively, DNA can be introduced into the protoplasts of plants using the electroporation method or a similar well-known method. In addition, the transformation can also be carried out by attaching DNA to tungsten particles and the like, and implanting the particles into plant embryos. The specific implementation of these transformation methods is described in the examples below.

Примеры. Examples.

Теперь настоящее изобретение будет более конкретно описано с помощью следующих примеров. Однако, настоящее изобретение приводимыми примерами не ограничивается. Now the present invention will be more specifically described using the following examples. However, the present invention is not limited to the examples given.

1. Клонирование и секвенирование гена ПФДК из Flaveria brownii. 1. Cloning and sequencing of the PPDK gene from Flaveria brownii.

(1) Приготовление библиотеки кДНК и клонирование полной последовательности кДНК;
(i) Приготовление библиотеки кДНК.(1) Preparation of a cDNA library and cloning of the complete cDNA sequence;
(i) Preparation of a cDNA library.

Из зеленых листьев (60 грамм) F. brownii суммарные РНК были выделены с помощью гуанидинхлорид-фенольного метода. Этим методом было получено 26.5 мг РНК после осаждения литием. Затем из 13.2 мг РНК было получено 118.9 мкг пoли(A)⁺ РНК в соответствии с обычным методом, с использованием колонки, содержащей олиго-dT -целлюлозу типа 7 (выпускается PHARMACIA). Для приготовления библиотеки кДНК использовали выпускаемый PHARMACIA набор TIMESAVER для синтеза кДНК, вектор Lambda ZAPII, выпускаемый STRATAGENE и упаковывающий реагент, привязанный к кДНК клонирующей системе (λ gt10, выпускаемый AMERSHAM. Используя связывающий агент EcoRI/NotI, была приготовлена библиотека кДНК, в которой фрагменты ДНК включены в сайт EcoRI векторов Lambda ZAPII. Размер полученной библиотеки кДНК составлял 415000 бляшкообразующих единиц. В качестве клеток-хозяев использовались XL1-клетки.From the green leaves (60 grams) of F. brownii, total RNA was isolated using the guanidine chloride-phenolic method. By this method, 26.5 mg of RNA was obtained after lithium precipitation. Subsequently, 118.9 μg of (A) ⁺ RNA field was obtained from 13.2 mg of RNA according to the conventional method using a column containing type 7 oligo dT cellulose (manufactured by PHARMACIA). The cDNA library was prepared using the TIMESAVER PHARMACIA cDNA synthesis kit, the Lambda ZAPII vector, produced by STRATAGENE and the packaging reagent bound to the cDNA cloning system (λ gt10 manufactured by AMERSHAM. Using the EcoRI / NotI binding agent, a cDNA library was prepared in which fragments DNA was included in the EcoRI Lambda ZAPII vector site. The resulting cDNA library was 415,000 plaque forming units. XL1 cells were used as host cells.

(ii) Приготовление зонда. (ii) Preparation of the probe.

Используя праймер, имеющий последовательность 5': GACGGCTAAAAAGAGGGT, сконструированный на основе областей ПФДК из Flaveria bidentis и ПФДК кукурузы, которые в значительной степени гомологичны, и R-праймер, имеющий последовательность TATCGAGAAACCTTCTATAC (часть последовательности ПФДК из Flaveria bidentis, комплементарная цепь), размножали обратной транскрипцией в цепной полимеразной реакции (ЦПР) фрагмент ДНК, происходящий из РНК F. brownii, и накопленные фрагменты ДНК были включены в pCRII-вектор, выпускаемый INVITROGEN. Используя полученный вектор в качестве матрицы, а также те же самые праймеры, которые упоминались выше, ДНК была размножена, и продукт ЦПР подвергали электрофорезу, за которым следовало выделение ДНК из геля с использованием Suprec-01, выпускаемым TAKARA SHUZO. С помощью этого процесса может быть получен фрагмент ДНК, имеющий размер 428 комплементарных пар оснований, начиная от 24-ой пары оснований по направлению от N-конца зрелого белка. Для приготовления зонда этот фрагмент был помечен ³²P с использованием системы Multiprime для внесения метки в ДНК, выпускаемой AMERSHAM.Using a primer having a 5 ′ sequence: GACGGCTAAAAAGAGGGT constructed from the PFDK regions of Flaveria bidentis and maize PFDK, which are substantially homologous, and the R primer having the TATCGAGAAACCTTCTATAC sequence (part of the PFDK sequence from Flaveria bidentis is incomplete) by transcription in a chain polymerase reaction (CPR) a DNA fragment derived from F. brownii RNA and accumulated DNA fragments were included in the pCRII vector manufactured by INVITROGEN. Using the resulting vector as a template, as well as the same primers mentioned above, the DNA was propagated and the CPR product was subjected to electrophoresis, followed by isolation of the DNA from the gel using Suprec-01 manufactured by TAKARA SHUZO. Using this process, a DNA fragment having a size of 428 complementary base pairs, starting from the 24th base pair in the direction from the N-terminus of the mature protein, can be obtained. To prepare the probe, this fragment was labeled with ³² P using the Multiprime system for labeling DNA manufactured by AMERSHAM.

(iii) Клонирование всей последовательности кДНК Flaveria brownii. (iii) Cloning of the entire Flaveria brownii cDNA sequence.

Библиотеку кДНК подвергли скринингу с помощью метода гибридизации бляшек, используя упомянутый выше фрагмент ДНК в качестве зонда. В качестве фильтра для гибридизации использовали Hybond N⁺ (AMERSHAM), и гибридизацию проводили в шестикратном SSC-буфере, содержащем 5-кратный раствор Денхальта (Denhalt), 0.1% ДСН (додецилсульфата натрия) и 100 мкг/мл денатурированной ДНК из спермы лосося при 65^oC в течение ночи. Промывание проводили 2 х SSC, содержащим 0.1% ДСН, при комнатной температуре в течение 5 минут; и 2 х SSC, содержащим 0.1% ДСН при комнатной температуре в течение 90 минут; и 1 х SSC, содержащим 0.1% ДСН при 68^oC в течение 90 минут. Таким путем было получено 28 независимых положительных клонов. Из них 11 бляшек, которые давали сильные сигналы, были собраны и подвергнуты повторному скринингу. Повторный скрининг был выполнен тем же самым способом, как и первый скрининг за исключением того, что время второго промывания составляло 60 минут. В результате из 6 клонов были получены независимые положительные бляшки, происходящие из единственного фага. Чтобы проверить размеры вставленных фрагментов ДНК, была проведена ЦПР с использованием описанного выше R-праймера, а также выпускаемых TAKARA SHUZO в качестве праймеров М 13PrimerM4 (GTTTTCCCAGTCACGAC) и M13PrimerRV (CAGGAAACAGCTATGAC), и с использованием фага в качестве матрицы. В результате 2 клона содержали всю последовательность кДНК. После этого путем вырезания in vivo вставленные фрагменты ДНК были субклонированы в плазмидный вектор pBluescriptIISK(-), выпускаемый STRATAGENE. Полученные при субклонировании рекомбинантные плазмиды были названы р411 и р631.The cDNA library was screened using a plaque hybridization method using the above DNA fragment as a probe. Hybond N ⁺ (AMERSHAM) was used as a hybridization filter, and hybridization was performed in a six-fold SSC buffer containing a 5-fold Denhalt solution, 0.1% SDS (sodium dodecyl sulfate) and 100 μg / ml denatured salmon sperm DNA at 65 ^o C during the night. Washing was carried out with 2 x SSC containing 0.1% SDS at room temperature for 5 minutes; and 2 x SSC containing 0.1% SDS at room temperature for 90 minutes; and 1 x SSC containing 0.1% SDS at 68 ^° C for 90 minutes. In this way, 28 independent positive clones were obtained. Of these, 11 plaques that gave strong signals were collected and re-screened. Repeated screening was performed in the same manner as the first screening except that the second washing time was 60 minutes. As a result, independent positive plaques derived from a single phage were obtained from 6 clones. To check the size of the inserted DNA fragments, DPC was carried out using the R primer described above, as well as those manufactured by TAKARA SHUZO as primers M 13PrimerM4 (GTTTTCCCAGTCACGAC) and M13PrimerRV (CAGGAAACAGCTATGAC), and using phage as a template. As a result, 2 clones contained the entire cDNA sequence. Thereafter, by in vivo excision, the inserted DNA fragments were subcloned into the plasmid vector pBluescriptIISK (-) manufactured by STRATAGENE. The recombinant plasmids obtained by subcloning were named p411 and p631.

С помощью описанной выше ЦПР было найдено, что библиотека, приготовленная так, как описано выше, была библиотекой, содержащей достаточно длинные вставки, которые были подходящими для скрининга кДНК. Таким образом для выделения мРНК из Flaveria brownii выгодно использовать описанный выше метод и получать большое количество матричных РНК сразу путем обработки большого количества РНК как описано выше. Using the above DPC, it was found that the library prepared as described above was a library containing sufficiently long inserts that were suitable for cDNA screening. Thus, to isolate mRNA from Flaveria brownii, it is advantageous to use the method described above and to obtain a large number of messenger RNAs immediately by processing a large amount of RNA as described above.

Далее, поскольку описанная выше библиотека кДНК содержит несколько достаточно длинных вставок, было возможно легко выполнить скрининг всей последовательности кДНК путем приготовления зонда, полученного при использовании праймера, который гибридизируется с областью по соседству с операторной областью нужного белка. Further, since the cDNA library described above contains several sufficiently long inserts, it was possible to easily screen the entire cDNA sequence by preparing a probe obtained using a primer that hybridizes to a region adjacent to the operator region of the desired protein.

(2) Определение суммарной нуклеотидной последовательности кДНК и сравнение с соответствующей аминокислотной последовательностью. (2) Determination of the total cDNA nucleotide sequence and comparison with the corresponding amino acid sequence.

Для определения суммарной нуклеотидной последовательности вставленных фрагментов р631 кДНК были приготовлены делеционные мутанты. Делеционные мутанты были приготовлены при использовании Набора для делеции для килопоследовательности, выпускаемого фирмой TAKARA SHUZO. Однако, реакция под действием экзонуклеазы III останавливалась при переносе реакционной смеси в буферный раствор нуклеазы бобов Mung, выдержанный при 65^oC. Определение нуклеотидной последовательности было выполнено при использовании плазмиды, очищенной с помощью наборов Qiagen Plasmid Mini Kit (выпускаемого DIAGEN), Taq DyeDeoxy Terminator Cycle Sequencing Kit (выпускаемого ABI) и Applied Biosystems 373A DNA Sequencer (ABI). Обе цепи были секвенированы за исключением некоторых их участков. На основании определенной нуклеотидной последовательности была определена аминокислотная последовательность. Установленная нуклеотидная последовательность и аминокислотная последовательность представлены на фиг. 8 под N 5.To determine the total nucleotide sequence of the inserted fragments of p631 cDNA, deletion mutants were prepared. Deletion mutants were prepared using the Kill Sequence Deletion Kit manufactured by TAKARA SHUZO. However, the reaction by exonuclease III was stopped when the reaction mixture was transferred to a Mung bean nuclease buffer solution, maintained at 65 ^° C. The nucleotide sequence was determined using a plasmid purified using Qiagen Plasmid Mini Kit (manufactured by DIAGEN), Taq DyeDeoxy Terminator Cycle Sequencing Kit (manufactured by ABI) and Applied Biosystems 373A DNA Sequencer (ABI). Both chains were sequenced with the exception of some of their sections. Based on a specific nucleotide sequence, an amino acid sequence was determined. The determined nucleotide sequence and amino acid sequence are shown in FIG. 8 under N 5.

Следует заметить, что при приготовлении вырезанных клонов для секвенирования выделенной кДНК было важно предварительно нагреть буферный раствор нуклеазы бобов Mung до 65^oC, поскольку реакция не может быть остановлена просто переносом реакционной смеси в буферный раствор нуклеазы. Далее поскольку последовательность на участке в 600-900 пар оснований от границы между вектором и вставкой не может быть определена с помощью делеции вставки только с расположенного выше конца, было необходимо выполнить делецию с двух концов.It should be noted that when preparing cut clones for sequencing the isolated cDNA, it was important to pre-heat the Mung bean nuclease buffer solution to 65 ^° C, since the reaction cannot be stopped simply by transferring the reaction mixture to the nuclease buffer solution. Further, since the sequence in the area of 600-900 base pairs from the boundary between the vector and the insert cannot be determined using a deletion of the insert only from the higher end, it was necessary to perform a deletion from both ends.

С другой стороны, ПФДК была очищена непосредственно из Flaveria brownii, и была определена ее аминокислотная последовательность с N-конца, C-конца и во внутренних областях. ПФДК была очищена следующим образом. Зеленые листья перемалывались в трехкратном объеме экстрагирующего буфера. После центрифугирования к супернатанту был добавлен сульфат аммония до 30% насыщения, и выпавшие белки удаляли. Сульфат аммония был еще добавлен до 70% насыщения, и выпавшие белки были собраны. Собранные белки наносили на Sephadex G25, выпускаемый PHARMACIA для удаления солей. Полученный таким образом раствор был нанесен на колонку с DEAE-Sepharose (PHARMACIA), и адсорбированные на колонке белки элюировали KCl, используя градиент 50 - 400 мМ. Фракции, обладающие активностью ПФДК, были собраны и сконцентрированы с помощью сульфата аммония при 70% насыщении, за чем следовало обессоливание на сефадексе G25. Полученный раствор был нанесен на колонку с гидроксиапатитом. Адсорбированные белки элюировались фосфатным буфером в градиенте фосфата от 10 мМ до 40 мМ. Фракции, обладающие активностью ПФДК, объединяли и концентрировали с помощью сульфата аммония при 70% насыщении затем обессоливали на сефадексе G25. Полученное вещество подвергали электрофорезу на полиакриламидных пластинках в присутствии додецилсульфата натрия, и полоски ПФДК вырезали. Белки регенерировали из геля с помощью электроэлюции. По этому методу очищенный образец ПФДК был получен в количестве около 5-10 нМ. Очищенная таким образом ПФДК в ДСН-ПААГ электрофорезе проявлялась в виде единственной полоски. On the other hand, PFDK was purified directly from Flaveria brownii, and its amino acid sequence was determined from the N-terminus, C-terminus and in the inner regions. PFDK was purified as follows. Green leaves were ground in three times the volume of extraction buffer. After centrifugation, ammonium sulfate was added to the supernatant to 30% saturation, and the precipitated proteins were removed. Ammonium sulfate was still added to 70% saturation, and the precipitated proteins were collected. The collected proteins were loaded onto a Sephadex G25 manufactured by PHARMACIA to remove salts. The solution thus obtained was loaded onto a DEAE-Sepharose column (PHARMACIA), and the proteins adsorbed on the column were eluted with KCl using a gradient of 50-400 mM. Fractions with PFDK activity were collected and concentrated using ammonium sulfate at 70% saturation, followed by desalination on Sephadex G25. The resulting solution was applied to a hydroxyapatite column. Adsorbed proteins were eluted with a phosphate buffer in a phosphate gradient from 10 mM to 40 mM. Fractions with PFDK activity were combined and concentrated with ammonium sulfate at 70% saturation, then desalted on Sephadex G25. The resulting material was subjected to electrophoresis on polyacrylamide plates in the presence of sodium dodecyl sulfate, and strips of PPDK were excised. Proteins were regenerated from the gel using electroelution. According to this method, a purified PFDK sample was obtained in an amount of about 5-10 nM. The PFDK thus purified in SDS-PAGE electrophoresis was manifested as a single strip.

Далее были определены N-концевая, C-концевая и внутренние аминокислотные последовательности полученной таким образом очищенной ПФДК. А именно, аминокислотная последовательность N-концевой области определялась путем переноса белка на мембрану из поливинилиденфторида (PVDF) и затем определения последовательности, используя газофазный аминокислотный секвенатор. Аминокислотная последовательность C-концевого района была определена при гидролизе очищенной ПФДК карбоксипептидазой Y и основываясь на отношении между составом выделившихся аминокислот и временем гидролиза. Аминокислотные последовательности внутренних областей были определены путем установления аминокислотных последовательностей с N-концов пептидов, полученных в результате гидролиза белка протеазой. Детали этого метода следующие. Во-первых, как в случае определения аминокислотной последовательности N-концевой области, ПФДК из зеленых листьев Flaveria brownii была частично очищена и подвергнута обычному ДСН-ПААГ-электрофорезу. Гель окрашивали Кумасси бриллиантовым голубым R250, и полосу ПФДК вырезали. Вырезанный гель уравновешивали с уравновешивающим буферным раствором (125 мМ Трис-HCl-буфер, pH 6.8, 1 мМ ЭДТА, 0.1% ДСН) и вносили в лунку, за чем следовал второй электрофорез в ДСН-ПААГ. Раствор для наслаивания (125 мМ Трис-HCl-буфер, pH 6.8, 1 мМ ЭДТА, 0.1% ДСН, 0.01% бромфенолового синего (БФС), 20% глицерина) и раствор фермента (125 мМ Трис-HCl -буфер, pH 6.8, 1 мМ ЭДТА, 0.1% ДСН, 0.01% БФС, 10% глицерина, 1-5 мкг лизил эндопептидазы или 0.01-0.1 мкг протеазы V8) были добавлены вместе с уравновешенным гелем. После проведения электрофореза в течение некоторого времени, осуществляли гидролиз белка в концентрированном геле (электрическое напряжение было снято, и гель оставили на 45 минут). Затем опять продолжили электрофорез, и полученное вещество перенесли на мембрану PVDF так же, как при определении N-концевой последовательности, и аминокислотная последовательность полученного при гидролизе фрагмента была определена с его N-конца, используя газофазный аминокислотный секвенатор. Next, the N-terminal, C-terminal and internal amino acid sequences of the purified PPDK thus obtained were determined. Namely, the amino acid sequence of the N-terminal region was determined by transferring the protein to the membrane from polyvinylidene fluoride (PVDF) and then determining the sequence using a gas phase amino acid sequencer. The amino acid sequence of the C-terminal region was determined by hydrolysis of purified PPDK carboxypeptidase Y and based on the ratio between the composition of the released amino acids and the hydrolysis time. Amino acid sequences of internal regions were determined by establishing amino acid sequences from the N-termini of the peptides obtained by protein hydrolysis by a protease. The details of this method are as follows. First, as in the case of determining the amino acid sequence of the N-terminal region, PPDK from green leaves of Flaveria brownii was partially purified and subjected to ordinary SDS-PAGE electrophoresis. The gel was stained with Coomassie brilliant blue R250, and the PFDK strip was excised. The excised gel was equilibrated with a balancing buffer solution (125 mM Tris-HCl buffer, pH 6.8, 1 mM EDTA, 0.1% SDS) and added to the well, followed by a second electrophoresis in SDS-PAGE. Layering solution (125 mm Tris-HCl buffer, pH 6.8, 1 mm EDTA, 0.1% SDS, 0.01% bromophenol blue (BPS), 20% glycerol) and an enzyme solution (125 mm Tris-HCl buffer, pH 6.8, 1 mM EDTA, 0.1% SDS, 0.01% BFS, 10% glycerol, 1-5 μg of lysyl endopeptidase, or 0.01-0.1 μg of V8 protease) were added together with a balanced gel. After electrophoresis for some time, the protein was hydrolyzed in a concentrated gel (the voltage was removed and the gel was left for 45 minutes). Then, electrophoresis was continued again, and the obtained substance was transferred onto the PVDF membrane as in the determination of the N-terminal sequence, and the amino acid sequence of the fragment obtained by hydrolysis was determined from its N-terminus using a gas-phase amino acid sequencer.

Установленная последовательность N-концевого участка, C-концевого участка и внутренних областей белка следующая :
N-концевая последовательность : Asn Pro Val Ser Pro Pro Val (72-78);
C-концевая последовательность: Leu-Ala Ala*-Val Val (948-955);
Внутренние последовательности :
(1) Lys Leu Туг Glu Phe Leu Val Asn Ala Gin Gly-Asp Val Val Ala (349-365);
(2) Gin Leu Leu Ala Pro Pro Ala Met Ser Asn Ala Leu-Thr (592-605);
(3) Leu Thr Ala Asp Thr Gly Met Ser Lys Asp Glu Ile Tyr Ser Arg Ile Glu (721- 738);
(4) Ala- - - Ser Phe Gly Thr Asn Asp Leu Cys Gin Met Val Phe Gly - Ser (844- 862).The sequence of the N-terminal region, the C-terminal region and the internal regions of the protein is as follows:
N-terminal sequence: Asn Pro Val Ser Pro Pro Val (72-78);
C-terminal sequence: Leu-Ala Ala * -Val Val (948-955);
Inner sequences:
(1) Lys Leu Tug Glu Phe Leu Val Asn Ala Gin Gly-Asp Val Val Ala (349-365);
(2) Gin Leu Leu Ala Pro Pro Ala Met Ser Asn Ala Leu-Thr (592-605);
(3) Leu Thr Ala Asp Thr Gly Met Ser Lys Asp Glu Ile Tyr Ser Arg Ile Glu (721-738);
(4) Ala- - - Ser Phe Gly Thr Asn Asp Leu Cys Gin Met Val Phe Gly - Ser (844-862).

В приведенных выше аминокислотных последовательностях "*" означает глутамин, который не может быть определен использованным анализатором, а " - " означает, что результат анализа был неясен. Числа в скобках указывают номер аминокислоты в соответствующей области аминокислотной последовательности, показанной на фиг. 8 под N 5. Хотя части внутренних последовательностей (2) и (4) отличаются от аминокислотной последовательности, показанной на фиг. 8 под N 5, полагают, что это связано с ошибками аминокислотного секвенатора. Хорошо известно, что причиной ошибок довольно часто являются аминокислотные секвенаторы, в то время как секвенаторы ДНК практически не дают ошибок. In the above amino acid sequences, “*” means glutamine, which cannot be determined by the analyzer used, and “-” means that the result of the analysis was unclear. The numbers in parentheses indicate the amino acid number in the corresponding region of the amino acid sequence shown in FIG. 8 to N 5. Although parts of the internal sequences (2) and (4) are different from the amino acid sequence shown in FIG. 8 under No. 5, it is believed that this is due to errors in the amino acid sequencer. It is well known that amino acid sequencers are often the cause of errors, while DNA sequencers produce almost no errors.

Поскольку аминокислотная последовательность, представленная на фиг. 8 под N 5, хорошо согласуется с частичными аминокислотными последовательностями, непосредственно определенными в описанной выше очищенной ПФДК, было подтверждено, что аминокислотная последовательность, показанная на фиг. 8 под N 5, является аминокислотной последовательностью ПФДК. Аминокислотную последовательность, показанную на фиг. 8 под N 5, сравнивали с аминокислотной последовательностью известных ПФДК Flaveria bidentis и кукурузы. В результате 40 аминокислотных остатков у Flaveria bidentis и около 180 аминокислотных остатков у кукурузы, соответственно, имели отличия на участке последовательности зрелого белка. Далее из описанных выше результатов можно предполагать, что в аминокислотной последовательности, представленной на фиг. 8 под N 5, в зрелом белке не существует аминокислотной последовательности с 1-го по 71-й остаток, но переходный пептид необходим для прохождения через мембраны, который после прохождения через мембраны отщепляется с образованием зрелого белка. Различия между аминокислотными последовательностями зрелых белков из Flaveria brownii и Flaveria bidentis показаны ниже в Таблице 1. Since the amino acid sequence shown in FIG. 8 under N 5, is in good agreement with the partial amino acid sequences directly determined in the purified PFDK described above, it was confirmed that the amino acid sequence shown in FIG. 8 under N 5 is the amino acid sequence of PFDK. The amino acid sequence shown in FIG. 8 under No. 5, were compared with the amino acid sequence of the known PFDKs of Flaveria bidentis and corn. As a result, 40 amino acid residues in Flaveria bidentis and about 180 amino acid residues in corn, respectively, had differences in the portion of the mature protein sequence. Further, from the above results, it can be assumed that in the amino acid sequence shown in FIG. 8 under No. 5, in the mature protein there is no amino acid sequence from the 1st to the 71st residue, but the transition peptide is necessary for passing through the membrane, which, after passing through the membrane, is cleaved to form a mature protein. The differences between the amino acid sequences of mature proteins from Flaveria brownii and Flaveria bidentis are shown below in Table 1.

2. Генерация ПФДК Flaveria brownii в E. coli и измерение устойчивости к холоду. 2. Generation of PFDK Flaveria brownii in E. coli and measurement of resistance to cold.

Для того чтобы подтвердить, что устойчивый к холоду фермент действительно продуцируется кДНК, кодирующей ПФДК из Flaveria brownii, выделенной как описано выше, проводили экспрессию в Е. coli следующим образом. In order to confirm that the cold-resistant enzyme is actually produced by cDNA encoding PFDK from Flaveria brownii isolated as described above, expression was performed in E. coli as follows.

Для того чтобы удалить транзитный пептид и лигировать ДНК с экспрессируемым вектором так, чтобы рамки считывания совпадали, были включены рестрикционные сайты следующим образом. Рекомбинантная плазмида р631 подвергалась гидролизу под действием SacI и рециклизовалась с образованием р631 Sac (та же самая плазмида р631, за исключением того, что ниже расположенная область сайта SacI вырезана). ЦПР проводили, используя р631 Sac в качестве матрицы и праймер 4: GATATCAATCCGGTGTCTCCTCC, содержащий сайт EcoRV, полученный на основании последовательности в области, соседней с операционной областью, и праймер М 13 RV, выпускаемый фирмой TAKARA SHUZO, комплементарный последовательности вектора, размноженный фрагмент был субклонирован в pCRII. Фрагмент, содержащий N-концевую область, был вырезан, используя рестрикционные ферменты EcoRV и SacI. Были лигированы три фрагмента ДНК, то есть, вырезанный таким образом фрагмент ДНК, фрагмент SacI-HindIII из р631 (содержащий оставшуюся часть кДНК, кодирующей ПФДК) и фрагмент, полученный при гидролизе рКК233-2 с помощью Ncol, образованием тупых концов под действием фрагмента Кленоу и последующего гидролиза полученной структуры с помощью HindIII (фиг 1). Вместе с полученной плазмидой был трансформирован MV1184 Е. coli и использован для экспериментов по экспрессии. Один мл прокультивированной среды разбавляли 9 мл свежей среды LB, содержащей 50 мг/л ампициллина, и полученные клетки культивировали при перемешивании в течение 3 часов при 37^oC. Затем добавили изопропил-бета-D-тиогалактозид (IPTG) до концентрации 5 мМ, и культивирование продолжали еще в течение 3 часов, затем собирали клетки центрифугированием. Клетки суспендировали в 0.5 мл экстрагирующего буфера (50 мМ Hepes-KOH, pH 7.5, 10 мМ MgSO₄ 1 мМ ЭДТА, 5 мМ DTT) и добавляли лизоцим до конечной концентрации около 0.5 мг/мл. Суспензию оставили стоять во льду в течение 5 минут и затем обработали с помощью ультразвукового измельчителя (модель UCD-130T, выпускаемая фирмой COSMOBIO) в течение 5 мин дозами по 30 сек каждая, экстрагируя таким образом фермент. Продукт центрифугировали на микроцентрифуге в течение 10 мин, и супернатант нанесли на колонку Sephadex G25, уравновешенную с буфером (50 мМ HEPES-KOH, pH 7.0, 10 мМ MgCl₂, 2 мМ EDTA, 10 мМ DDT) для удаления низкомолекулярных веществ. Полученный продукт оставляли при 25^oC в течение не менее 30 минут, при этом происходила ассоциация до тетрамера, который затем использовался для измерения активности.In order to remove the transit peptide and to ligate the DNA with the expressed vector so that the reading frames coincided, restriction sites were included as follows. The recombinant plasmid p631 was hydrolyzed by SacI and recycled to form p631 Sac (the same plasmid p631, except that the lower region of the SacI site was excised). DPCs were performed using p631 Sac as template and primer 4: GATATCAATCCGGTGTCTCCTCC containing an EcoRV site derived from a sequence in a region adjacent to the operating area and an M 13 RV primer manufactured by TAKARA SHUZO, a complementary vector sequence, the propagated fragment was subcloned in pCRII. A fragment containing the N-terminal region was excised using restriction enzymes EcoRV and SacI. Three DNA fragments were ligated, i.e., a DNA fragment thus cut, a SacI-HindIII fragment from p631 (containing the remainder of the cDNA encoding PPDK) and a fragment obtained by hydrolysis of pKK233-2 with Ncol, blunt ends under the action of the Klenow fragment and subsequent hydrolysis of the resulting structure using HindIII (FIG. 1). Together with the obtained plasmid, E. coli MV1184 was transformed and used for expression experiments. One ml of cultured medium was diluted with 9 ml of fresh LB medium containing 50 mg / L ampicillin, and the resulting cells were cultured with stirring for 3 hours at 37 ^° C. Isopropyl-beta-D-thiogalactoside (IPTG) was then added to a concentration of 5 mM, and cultivation was continued for another 3 hours, then cells were collected by centrifugation. Cells were suspended in 0.5 ml of extraction buffer (50 mM Hepes-KOH, pH 7.5, 10 mM MgSO ₄ 1 mM EDTA, 5 mM DTT) and lysozyme was added to a final concentration of about 0.5 mg / ml. The suspension was left to stand on ice for 5 minutes and then treated with an ultrasonic grinder (model UCD-130T manufactured by COSMOBIO) for 5 minutes in doses of 30 seconds each, thus extracting the enzyme. The product was centrifuged in a microcentrifuge for 10 min, and the supernatant was applied to a Sephadex G25 column, equilibrated with a buffer (50 mM HEPES-KOH, pH 7.0, 10 mM MgCl ₂ , 2 mM EDTA, 10 mM DDT) to remove low molecular weight substances. The resulting product was left at 25 ^° C. for at least 30 minutes, with association to the tetramer, which was then used to measure activity.

Полученные в клетках Е. coli ПФДКиназы из кодирующих ПФДК кДНК из Flaveria brownii, Flaveria bidentis и кукурузы (сорт Harvest Queen) имели в основном одинаковую подвижность при электрофорезе в системе ДСН-ПААГ как ферменты, происходящие из растений. Хотя молекулярные массы зрелых ферментов, которые, как ожидается из структуры соответствующих кДНК, являются практически одинаковыми, кажущиеся молекулярные массы, определенные с помощью ДСН-ПААГ-электрофореза, значительно различаются. Было доказано, что это происходит благодаря различию в аминокислотном составе, а не из-за процесса делеции белков или модификации после трансляции, например, в результате присоединения углеводных цепей. Устойчивость к холоду каждой ПФДК, полученной в Е. coli, была идентична соответствующему ферменту, происходящему из каждого растения. Так холодоустойчивость ПФДК из Flaveria brownii достигается без дополнительного фактора, специфичного для этого растения, или обработки после трансляции, так что ожидается, что холодоустойчивая ПФДК получается при введении кДНК в кукурузу и ее экспрессировании. На фиг. 2 показано соотношение между временем, которое проходит с момента выдерживания фермента при 0^oC, и относительной активностью ПФДК.PFDKinases obtained in E. coli cells from PFDK-encoding cDNA from Flaveria brownii, Flaveria bidentis and corn (Harvest Queen cultivar) had basically the same mobility during electrophoresis in the SDS-PAGE system as enzymes derived from plants. Although the molecular weights of mature enzymes, which are expected from the structure of the corresponding cDNAs, are almost the same, the apparent molecular weights determined by SDS-PAGE electrophoresis vary significantly. It has been proven that this is due to differences in amino acid composition, and not due to the process of protein deletion or modification after translation, for example, as a result of the attachment of carbohydrate chains. The cold resistance of each PPDK obtained in E. coli was identical to the corresponding enzyme originating from each plant. Thus, the cold resistance of PFDK from Flaveria brownii is achieved without an additional factor specific for this plant or processing after translation, so it is expected that cold-resistant PFDK is obtained by introducing cDNA into corn and expressing it. In FIG. 2 shows the relationship between the time that has passed since the enzyme was kept at 0 ^° C and the relative activity of PFDK.

В описанной выше методике получения активной ПФДК в Е. coli кДНК, из которой был удален участок, кодирующий транзитный пептид, была вставлена в вектор экспрессии. Для этого было важно точно подогнать сайт, который должен быть вырезан, к сайту, соответствующему N-концевой последовательности фермента, происходящего из этого растения (табл. 2). In the method described above for the preparation of active PFDK in E. coli cDNA, from which the region encoding the transit peptide was deleted, was inserted into the expression vector. For this, it was important to precisely fit the site to be cut to the site corresponding to the N-terminal sequence of the enzyme originating from this plant (Table 2).

В частности, одновременно с выполнением эксперимента по экспрессии кДНК из Flaveria brownii была успешно проведена экспрессия ПФДКиназ из кукурузы и Flaveria bidentis по отношению к вырезаемому сайту в кукурузе в обоих случаях. Так при экспрессии кДНК Flaveria brownii, также сначала ДНК была вырезана у того же самого сайта, с использованием праймера 2, и была предпринята попытка экспрессировать кДНК после конструирования вектора экспрессии, содержащего кДНК. Однако, ПФДК не продуцировалась вовсе. Затем, основываясь на последовательности N-концевого участка фермента, происходящего из листьев, был сконструирован вектор экспрессии, с использованием праймера 3, в котором включенная кДНК содержит дополнительную последовательность, кодирующую фермент, которая увеличена на N-конце на 7 остатков, и экспрессия проводилась с использованием вектора экспрессии. В результате было подтверждено образование ПФДК. Однако, даже с этим вектором экспрессии количество образовавшегося фермента было мало, так что фермент не был получен в количестве, достаточном для измерения его активности. Таким образом, был создан вектор экспрессии, в котором включенная кДНК содержит еще дополнительную последовательность, кодирующую фермент, которая увеличена с N-конца на 1 остаток, с использованием праймера 4. Экспрессию проводили с использованием вектора экспрессии. В результате было получено большое количество ПФДК, и была подтверждена его холодоустойчивость. Нуклеотидные последовательности праймеров 2 и 3 приводятся ниже. In particular, simultaneously with the experiment on cDNA expression from Flaveria brownii, expression of PFDKinases from maize and Flaveria bidentis was successfully carried out with respect to the excised site in maize in both cases. Thus, in the expression of Flaveria brownii cDNA, DNA was also first cut at the same site using primer 2, and an attempt was made to express cDNA after constructing an expression vector containing cDNA. However, PFDK was not produced at all. Then, based on the sequence of the N-terminal portion of the enzyme originating from the leaves, an expression vector was constructed using primer 3, in which the included cDNA contains an additional sequence encoding the enzyme, which is increased at the N-terminus by 7 residues, and expression was performed with using an expression vector. As a result, the formation of PFDK was confirmed. However, even with this expression vector, the amount of enzyme formed was small, so that the enzyme was not obtained in an amount sufficient to measure its activity. Thus, an expression vector was created in which the included cDNA contains an additional sequence encoding an enzyme that is increased from the N-terminus by 1 residue using primer 4. Expression was performed using the expression vector. As a result, a large number of PFDK was obtained, and its cold resistance was confirmed. The nucleotide sequences of primers 2 and 3 are given below.

Праймер 2 : CGGTGTCTCCTCCGGATATCACGGCTAAAAAGAG
Праймер 3: TTGATATCCCGGTTGTCTCCTCCGGTA
3. Идентификация области в гене ПФДК из Flaveria brownii, отвечающей за холодоустойчивость.Primer 2: CGGTGTCTCCTCCGGATATCACGGCTAAAAAGAG
Primer 3: TTGATATCCCGGTTGTCTCCTCCGGTA
3. Identification of the region in the PFDK gene from Flaveria brownii, responsible for cold resistance.

(1) Химерная ДНК из Flaveria brownii и Flaveria bidentis. (1) Chimeric DNA from Flaveria brownii and Flaveria bidentis.

Вектора экспрессии рекомбинировали в соответствии с обычным методом, используя рестрикционные ферменты. В частности, фрагмент EcoRI-HindIII из pKK-brownii обменивался с соответствующим фрагментом pKK-bidentis (плазмида, полученная включением кДНК Flaveria bidentis в рКК 223-2 при конструировании pKK-Zwoww) для получения плазмиды рКК-011. С другой стороны, фрагмент EcoRI-HindIII из рКК- bidentis был обменен с соответствующим фрагментом pKK-brownii, чтобы получить плазмиду рКК-100. Аналогично, фрагменты NdetI-HindIII обменивались для получения рКК-001 и рКК-100. Далее фрагмент XhoI-HindIII из рКК-110 был обменен с соответствующим фрагментом pKK-bidentis для получения рКК-1101, а фрагмент Xho-HindIII из pKK-bidentis обменивался с соответствующим фрагментом pKK-brownii для получения рКК-1110. Для дальнейшей рекомбинации фрагментов XhoI-HindIII, эти фрагменты были связаны с помощью ЦПР (метод связывания ЦПР). В частности, были приготовлены праймеры, комплиментарные нуклеотидной последовательности во фрагменте XhoI-HindIII, последовательность которого является общей в bidentis и brownii, то есть были приготовлены F-звено праймера: GCAGAGATGATGTTGGCAAG и R-звено: CTTGCCAACATCATCTCTGC. Используя фрагмент XhoI-HindIII bidentis или brownii субклонированный в pBluescript SК(-) в качестве матрицы, и используя комбинацию праймеров F-звено/RV или М4/R-звено, была выполнена первая ЦПР. Полученные фрагменты (всего 4 типа) были очищены путем вырезания из геля. Используя смесь фрагмента, кодирующего первую часть brownii и фрагмента, кодирующего последнюю часть bidentis, или смесь фрагмента, кодирующего первую часть bidentis, и фрагмента, кодирующего последнюю часть brownii, в качестве матрицы, и используя праймеры M4/RV, была проведена вторая ЦПР. Накопленные связанные фрагменты подвергали гидролизу Xhol и HindIII, и продукт превращения обменивался с соответствующей областью рКК- bidentis с образованием pKK-link01 и pKK-link10. Другая пара химерных генов была приготовлена, используя сайт PstI между местом рекомбинации при связывании в ЦПР и областью HindIIL To есть, фрагмент XhoI-PstI из рКК- Unk10 и фрагмент PstI-HindIII из рКК- bidentis были включены в сайт XhoI- HindIII из рКК- bidentis (реакция, связывающая три фрагмента) для получения pKK-link101. Аналогично, фрагмент XhoI-PstI из рКК- bidentis и фрагмент PstI-HindIII из рКК- brownii были включены в сайт Xhol- HindIII из рКК- bidentis, чтобы получить pKK-link110. Expression vectors were recombined in accordance with a conventional method using restriction enzymes. In particular, an EcoRI-HindIII fragment from pKK-brownii was exchanged with the corresponding pKK-bidentis fragment (plasmid obtained by incorporation of Flaveria bidentis cDNA into pKK 223-2 when constructing pKK-Zwoww) to obtain plasmid pKK-011. On the other hand, the EcoRI-HindIII fragment from pKK-bidentis was exchanged with the corresponding pKK-brownii fragment to obtain the plasmid pKK-100. Similarly, fragments of NdetI-HindIII were exchanged to obtain pKK-001 and pKK-100. Next, the XhoI-HindIII fragment from pKK-110 was exchanged with the corresponding pKK-bidentis fragment to obtain pKK-1101, and the Xho-HindIII fragment from pKK-bidentis was exchanged with the corresponding pKK-brownii fragment to obtain pKK-1110. For further recombination of XhoI-HindIII fragments, these fragments were coupled by DPC (DPC binding method). In particular, primers were prepared that were complementary to the nucleotide sequence in the XhoI-HindIII fragment, the sequence of which is common in bidentis and brownii, i.e., the primer F link: GCAGAGATGATGTTGGCAAG and R link: CTTGCCAACATCATCTCTGC were prepared. Using the XhoI-HindIII bidentis or brownii fragment subcloned into pBluescript SK (-) as a template, and using a combination of primers F-link / RV or M4 / R-link, the first DPC was performed. The resulting fragments (4 types in total) were purified by excision from the gel. Using a mixture of a fragment encoding the first part of brownii and a fragment encoding the last part of bidentis, or a mixture of a fragment encoding the first part of bidentis and a fragment encoding the last part of brownii as a matrix, and using M4 / RV primers, a second DPC was performed. The accumulated bound fragments were hydrolyzed by Xhol and HindIII, and the conversion product was exchanged with the corresponding region of pKK-bidentis to form pKK-link01 and pKK-link10. Another pair of chimeric genes was prepared using the PstI site between the recombination site upon binding in the CSP and the HindIIL To region, the XhoI-PstI fragment from pKK-Unk10 and the PstI-HindIII fragment from pKK-bidentis were included in the XhoI-HindIII site from pKK- bidentis (a reaction linking three fragments) to obtain pKK-link101. Similarly, an XhoI-PstI fragment from pKK-bidentis and a PstI-HindIII fragment from pKK-brownii were included in the Xhol-HindIII site from pKK-bidentis to obtain pKK-link110.

Сорок положений, в которых аминокислотные остатки отличаются для зрелых ПФДК из Flaveria bidentis и Flaveria brownii, находятся главным образом в их N- и C-концевых областях, но их не так много во внутренних областях, то есть, в активном центре. Таким образом, кДНК были подразделены на три области, а именно на голову, середину и хвост, с использованием сайтов EcoRI и сайты Ndel, которые обычно существуют в обоих генах, и эти фрагменты были, чередуясь, обменены для приготовления химерных генов. При проверке этих химерных генов было определено, какая область отвечает за холодоустойчивость. В результате устойчивость к холоду приобретается, когда белок содержит 1/3 хвостовой области кДНК из Flaveria brownii В противоположность этому, когда белок содержит 1/3 хвостовой области кДНК из Flaveria bidentis, белок является чувствительным к холоду. Затем 1/3 хвостовой области была разделена на два фрагмента с помощью рестрикционного фермента Xhol, и фрагменты были соответственно введены в соответствующие области pKK-bidentis, и была проверена холодоустойчивость. В результате обнаружено, что область, расположенная ниже сайта Xhol (то есть, 1/6 области с C-конца) была необходима и достаточна для достижения холодоустойчивости. Далее химерный ген, содержащий 1/6 хвостовой области (фрагмент Xhol- HindIII, содержащий 7 замещений аминокислотных остатков) был приготовлен методом связывающей ЦПР, и размноженный ген был введен в рКК- bidentis, за чем следовало измерение холодоустойчивости. В результате обнаружено, что химерный фермент pKK-link10, включающий самый конец хвостового района, в котором содержится 4 замещения, был устойчивым к холоду, в то время, как химерный фермент pKK-link01, содержащий первую половину хвостовой части, в которой содержится 3 замещения, был чувствителен к холоду. Затем хвостовая область рекомбинировала при использовании рестрикционного фермента PstI для того, чтобы приготовить химерный ген, имеющий два аминокислотных замещения на ген, и устойчивость к холоду полученных генов была проверена. В результате все химерные гены обнаруживали холодоустойчивость. Таким образом, было предположено, что имеется два или более участков, ответственных за холодоустойчивость. The forty positions in which amino acid residues differ for mature PFDKs from Flaveria bidentis and Flaveria brownii are mainly in their N- and C-terminal regions, but there are not so many in the inner regions, that is, in the active center. Thus, cDNAs were subdivided into three regions, namely, the head, middle and tail, using EcoRI sites and Ndel sites, which usually exist in both genes, and these fragments were interchanged and exchanged for the preparation of chimeric genes. When checking these chimeric genes, it was determined which region is responsible for cold resistance. As a result, resistance to cold is acquired when the protein contains 1/3 of the tail region of cDNA from Flaveria brownii. In contrast, when the protein contains 1/3 of the tail region of cDNA from Flaveria bidentis, the protein is sensitive to cold. Then, 1/3 of the tail region was divided into two fragments using the Xhol restriction enzyme, and the fragments were respectively introduced into the corresponding pKK-bidentis regions, and cold resistance was checked. As a result, it was found that the region below the Xhol site (i.e., 1/6 of the region from the C-terminus) was necessary and sufficient to achieve cold resistance. Next, a chimeric gene containing 1/6 of the tail region (Xhol-HindIII fragment containing 7 substitutions of amino acid residues) was prepared by binding to PCR, and the propagated gene was introduced into pKK-bidentis, followed by a measurement of cold resistance. As a result, it was found that the pKK-link10 chimeric enzyme, including the very end of the tail region, which contains 4 substitutions, was resistant to cold, while the pKK-link01 chimeric enzyme, containing the first half of the tail region, which contains 3 substitutions , was sensitive to cold. The tail region was then recombined using the PstI restriction enzyme in order to prepare a chimeric gene having two amino acid substitutions per gene, and the cold resistance of the resulting genes was tested. As a result, all chimeric genes showed cold tolerance. Thus, it was suggested that there are two or more sites responsible for cold resistance.

(2) Химерная ДНК из Flaveria brownii и кукурузы. (2) Chimeric DNA from Flaveria brownii and maize.

Используя праймер F-ПФДК: CTCACTGTTCGAAGAGAAGC и праймер mNdeI: CATATGCTCTGTCCGGCATAATC (комплементарная часть цепи), содержащий сайт Ndel в качестве праймеров, и кДНК, кодирующую ПФДК кукурузы в качестве матрицы, была проведена ЦПР, и накопленный фрагмент был субклонирован в pCR II. Этот фрагмент был вырезан из pCR II с помощью SacI и NdeL Этот фрагмент, фрагмент Sacl-Smal (векторный фрагмент) из рКК-ПФДК и фрагмент, полученный при гидролизе кДНК, кодирующей ПФДК К brownii, путем сшивки с помощью фрагмента Кленоу и последующего гидролиза полученной ДНК с помощью Ndel, были соединены в трех связывающих фрагменты реакциях (фиг. 3) с получением pKK-mz/bro(Nde). Была проведена ЦПР с использованием праймера ПФДК-F и праймера mXhoI: CTCGAGGGATCTCAATCATTG (комплементарная цепь) и ПФДК кукурузы в качестве матрицы. Полученный фрагмент был субклонирован в pCR II, и вставка была вырезана с помощью SacI и Xhol из pCR II. Вырезанный фрагмент был лигирован с фрагментом SacI - Xhol (векторный фрагмент) из рКК- mz/bro(Nde) для получения pKK-mz/bro(Xho). Using the F-PFDK primer: CTCACTGTTCGAAGAGAAGC and the mNdeI primer: CATATGCTCTGTCCGGCATAATC (complementary part of the chain) containing the Ndel site as primers, and cDNA encoding maize PFDK was transformed into the CPS fragment, and accumulated II fragment. This fragment was cut from pCR II using SacI and NdeL. This fragment, a Sacl-Smal fragment (vector fragment) from rKK-PFDK and a fragment obtained by hydrolysis of cDNA encoding PPDK K brownii, by crosslinking using the Klenow fragment and subsequent hydrolysis of the obtained DNA using Ndel, were combined in three fragment-binding reactions (FIG. 3) to give pKK-mz / bro (Nde). CPR was performed using the PFDK-F primer and the mXhoI primer: CTCGAGGGATCTCAATCATTG (complementary chain) and maize PFDK as template. The resulting fragment was subcloned into pCR II, and the insert was cut using SacI and Xhol from pCR II. The excised fragment was ligated with the SacI - Xhol fragment (vector fragment) from pKK-mz / bro (Nde) to obtain pKK-mz / bro (Xho).

Как химерный фермент, содержащий 1/3 часть C-концевой области (фрагмент NdeI-HindIII) ПФДК из F. brownii в составе ПФДК кукурузы, так и химерный фермент, содержащий 1/6 часть C-концевой области (фрагмент XhoI-HindIII) ПФДК F. brownii в составе ПФДК кукурузы проявляли такую же холодоустойчивость, как F. brownii. Таким образом, поскольку холодоустойчивость могла быть привнесена в ПФДК кукурузы, аминокислотный состав которой значительно отличается от состава F. brownii, полагают, что устойчивость к холоду может быть сообщена ПФДКиназам различных растений путем введения 1/3 хвостовой области или 1/6 C-концевого района. Поскольку полученная таким образом из кукурузы и F. brownii химерная ПФДК содержит транзитный пептид из ПФДК кукурузы как он есть, то, если трансформированное растение имеет затруднение в транспортировке холодоустойчивой ПФДК в хлоропласты, в которых транзитный пептид также происходит из F. brownii, предполагается, что эта проблема должна быть преодолена путем введения этого химерного гена вместо гена, порождаемого F. brownii. Both a chimeric enzyme containing 1/3 of the C-terminal region (NdeI-HindIII fragment) PFDK from F. brownii as a part of maize PPDK, and a chimeric enzyme containing 1/6 of the C-terminal region (XhoI-HindIII fragment) of PPDK F. brownii as part of PFDK maize showed the same cold resistance as F. brownii. Thus, since cold tolerance could be introduced into the PPDK of maize, the amino acid composition of which is significantly different from the composition of F. brownii, it is believed that cold resistance can be imparted to PFDKinases of various plants by introducing 1/3 of the tail region or 1/6 of the C-terminal region . Since the chimeric PPDK thus obtained from corn and F. brownii contains a transit peptide from corn PPDK as it is, then if the transformed plant has difficulty transporting the cold-resistant PFDK to chloroplasts, in which the transit peptide also originates from F. brownii, it is assumed that this problem must be overcome by introducing this chimeric gene instead of the gene generated by F. brownii.

(3) Точечномутировавшие клоны. (3) Spotted clones.

Аминокислотные остатки фрагмента XhoI-HindIII в рКК- brownii были заменены один за другим от типа brownii к типу bidentis. Аналогично аминокислотные остатки XhoI-HindIII в рКК- bidentis были заменены один за другим от типа bidentis к типу brownii. Введение мутаций было проведено с помощью субклонирования фрагментов XhoI-HindIII кДНК, кодирующих ПФДК из F. brownii и F. bidentis, в pBluescript IISK(-), а затем путем замещения нуклеотидов по методу Кункеля (Kunkel), используя набор Megalabel и набор Mutan-K, производимых TAKARA SHUZO. Последовательность праймеров, использованных для введения мутаций, показана в Таблице 3. После подтверждения мутантной нуклеотидной последовательности с помощью ДНК-секвенатора эти фрагменты были включены в сайт XhoI-HindIII в pKK-bidentis. The amino acid residues of the XhoI-HindIII fragment in pKK-brownii were replaced one after another from brownii to bidentis. Similarly, the amino acid residues of XhoI-HindIII in pKK-bidentis were replaced one after the other from the bidentis type to the brownii type. Mutations were introduced by subcloning XhoI-HindIII cDNA fragments encoding PPDK from F. brownii and F. bidentis into pBluescript IISK (-), and then by substituting the nucleotides according to the Kunkel method using the Megalabel kit and the Mutan- kit K manufactured by TAKARA SHUZO. The sequence of primers used to introduce the mutations is shown in Table 3. After confirmation of the mutant nucleotide sequence using a DNA sequencer, these fragments were included in the XhoI-HindIII site in pKK-bidentis.

Все ферменты, в которых один аминокислотный остаток в области XhoI-HindIII в рКК-1110, тот, который различен для F. brownii и F. bidentis, был замещен на соответствующий аминокислотный остаток типа bidentis, обладали холодоустойчивостью. Таким образом, полагают, что имеется множество мутаций, которые сообщают устойчивость к холоду (поскольку холодоустойчивость не теряется при замене только одного аминокислотного остатка). Затем были приготовлены ферменты, в которых один аминокислотный остаток в области XhoI-HindIII pKK-bidentis, тот аминокислотный остаток, который различен в F. brownii и F. bidentis, замещался на соответствующий аминокислотный остаток типа brownii и было проверено, приобрели ли ферменты холодоустойчивость. В частности, измерялась активность фермента после обработки его в течение 20 минут при температуре 0^oC. В результате при замене Gln⁸⁶⁹ на Pro фермент приобрел холодоустойчивость (активность после обработки холодом составляет 60-70% первоначальной активности). При замене Ile⁸⁸⁵ на Leu или Ile⁹⁵² на Val немного уменьшалась потеря активности при низкой температуре. Принимая во внимание эти результаты и результаты по химерному ферменту pKK-link110, описанному в (1), предположили, что фермент приобретает холодоустойчивость, когда эти мутации сосуществуют. Из этих результатов был сделан вывод о том, что три аминокислотных остатка, а именно Pro⁸⁶⁹, Leu⁸⁸⁵ и Val⁹⁵² определяют наличие холодоустойчивости. Однако, среди этих остатков, определяющих холодоустойчивость у brownii находятся такие, а именно Pro⁸⁶⁹ и Leu⁸⁸⁵, которые в ПФДК кукурузы также имеют тип brownii. Поэтому холодоустойчивость не обязательно приобретается благодаря тому факту, что эти остатки имеют тип brownii, но полагают, что эти остатки придают полную устойчивость к холоду в аминокислотной последовательности ПФДКиназ из F. brownii и F. bidentis. Поэтому в тех случаях, когда холодоустойчивость должна быть сообщена ПФДК, происходящих из различных видов, аминокислотная последовательность которых значительно различается от F. brownii и F. bidentis, предпочтительно не вводить точечные мутации, а приготовить химерный ген, в который вводится область, придающая холодоустойчивость, как было выполнено для ПФДК кукурузы.All enzymes in which one amino acid residue in the XhoI-HindIII region in pKK-1110, one that is different for F. brownii and F. bidentis, was replaced by the corresponding amino acid residue of the bidentis type, had cold resistance. Thus, it is believed that there are many mutations that report resistance to cold (since cold resistance is not lost when only one amino acid residue is replaced). Then enzymes were prepared in which one amino acid residue in the region of XhoI-HindIII pKK-bidentis, that amino acid residue that is different in F. brownii and F. bidentis, was replaced by the corresponding amino acid residue of type brownii and it was checked whether the enzymes had acquired cold resistance. In particular, the activity of the enzyme was measured after processing it for 20 minutes at a temperature of 0 ^o C. As a result, when Gln ^{869 was} replaced with Pro, the enzyme acquired cold resistance (activity after treatment with cold is 60-70% of the initial activity). When Ile ^{885 was} replaced by Leu or Ile ⁹⁵² by Val, the loss of activity at a low temperature was slightly reduced. Taking into account these results and the results for the chimeric pKK-link110 enzyme described in (1), it was suggested that the enzyme acquires cold resistance when these mutations coexist. From these results, it was concluded that three amino acid residues, namely, Pro ⁸⁶⁹ , Leu ⁸⁸⁵ and Val ⁹⁵² determine the presence of cold resistance. However, among these residues that determine the cold resistance of brownii, there are those, namely, Pro ⁸⁶⁹ and Leu ⁸⁸⁵ , which also have the brownii type in maize PPDK. Therefore, cold resistance is not necessarily acquired due to the fact that these residues are of type brownii, but it is believed that these residues give complete resistance to cold in the amino acid sequence of PFDKinases from F. brownii and F. bidentis. Therefore, in cases where cold resistance should be reported to PFDK originating from different species, the amino acid sequence of which varies significantly from F. brownii and F. bidentis, it is preferable not to introduce point mutations, but to prepare a chimeric gene into which a region that confers cold resistance is introduced, as was done for PFDK corn.

(4) Трансформация кукурузы геном ПФДК из Flaveria brownii. (4) Transformation of maize with the PPDK gene from Flaveria brownii.

В соответствии с методом Гордона-Камма (Gordon-Kamm W.J. et al : The Plant Cell, 2, 603-618 (1990)) или Козиеля (Koziel M.G. et al : BioTechnology , 11, 194-200 (1993)) мелкие частицы золота или вольфрама покрываются pKK-brownii, и покрытые частицы имплантируются в незрелые зародыши кукурузы или суспендированные культуральные клетки. Из этих обработанных клеток выбираются трансформанты, а полученный из трансформантов каллус культивируется в соответствии с обычным методом, за чем следует регенерация растений из каллуса. Метод трансформации не ограничен методом шотган (particle gun method), но методы трансформации, которые могут быть использованы, включают метод электропорации (Rhodes C.A. et al : Science, 240. 204-207 (1988)), метод с полиэтиленгликолем (PEG-метод) (Armstrong C.L. et al: Plant Cell Reports, 9, 335-339 (1990)), метод электропорации тканей (D' Halluin К. et al: The Plant Cell, 4, 1495-1505 (1992)), метод с использованием агробактерий (Agrobacterium) (Hiei Y. & Komari Т., WO 9400977) и подобные. С полученных таким образом растений были собраны и пророщены семена для регенерации растений. ПФДК выделяется из листьев полученных растений, и измеряется ее устойчивость к холоду. Для трансформированных и нетрансформированных растений оценивается влияние температуры на скорость фотосинтеза. Стабильность трансформации гарантируется быстрым развитием растений кукурузы, которые обнаруживают хорошую скорость фотосинтеза при низкой температуре для многих поколений, а также измерением скорости фотосинтеза при различных температурах и измерением холодоустойчивости ПФДКиназ, выделенных из различных растений. According to the Gordon-Kamm method (Gordon-Kamm WJ et al: The Plant Cell, 2, 603-618 (1990)) or Cosiel (Koziel MG et al: BioTechnology, 11, 194-200 (1993)) small particles of gold or tungsten is coated with pKK-brownii, and coated particles are implanted into immature maize embryos or suspended culture cells. Transformants are selected from these treated cells, and the callus obtained from the transformants is cultured in accordance with the usual method, followed by the regeneration of plants from callus. The transformation method is not limited to the particle gun method, but transformation methods that can be used include the electroporation method (Rhodes CA et al: Science, 240. 204-207 (1988)), the polyethylene glycol method (PEG method) (Armstrong CL et al: Plant Cell Reports, 9, 335-339 (1990)), tissue electroporation method (D 'Halluin K. et al: The Plant Cell, 4, 1495-1505 (1992)), agrobacterium method (Agrobacterium) (Hiei Y. & Komari T., WO 9400977) and the like. Seeds for plant regeneration were collected and germinated from plants obtained in this way. PFDK is isolated from the leaves of the resulting plants, and its resistance to cold is measured. For transformed and non-transformed plants, the effect of temperature on the rate of photosynthesis is estimated. The stability of the transformation is guaranteed by the rapid development of corn plants, which exhibit good photosynthesis rate at low temperature for many generations, as well as by measuring the speed of photosynthesis at various temperatures and by measuring the cold hardiness of PFDKinases isolated from various plants.

(5) Трансформация Flaveria bidentis геном ПФДК из Flaveria brownii
Промежуточный вектор, содержащий всю последовательность кДНК, показан на фиг. 8 N 5, и репортерный ген, вводится в разоруженную Ti-плазмиду Agrobacterium tumefaciens. Эта операция может выполняться по методу, описанному Драптером (Drapter J. et al. eds., Plant Genetic Transformation and Gene Expression- a laboratory manual, Blackwell Scientific Publications (ISBN 0-632-02172-1)).(5) Transformation of Flaveria bidentis with the PPDK genome from Flaveria brownii
An intermediate vector containing the entire cDNA sequence is shown in FIG. 8 N 5, and the reporter gene, is introduced into the disarmed Ti plasmid Agrobacterium tumefaciens. This operation can be performed according to the method described by Draper (Drapter J. et al. Eds., Plant Genetic Transformation and Gene Expression-laboratory manual, Blackwell Scientific Publications (ISBN 0-632-02172-1)).

С другой стороны, ткань листьев или каллуса Flaveria bidentis инфицируется упомянутыми выше бактериями Agrobacterium tumefaciens. Эта операция может быть выполнена при культивировании ткани или каллуса вместе с Agrobacterium tumefaciens. Инфицированные клетки отбираются на основании устойчивости к действию лекарств. Из выбранных каллусов выращивали целые растения обычными методами. С полученных растений собираются и проращиваются семена для воспроизводства растений. ПФДК выделяется из листьев полученных растений, и определяется ее холодоустойчивость. Для трансформированных и нетрансформированных растений изучается влияние температуры на скорость фотосинтеза. Стабильность трансформации гарантируется быстрым развитием растений кукурузы, которые демонстрируют высокую скорость фотосинтеза при низкой температуре для многих поколений, и измерением скорости фотосинтеза при различных температурах и холодоустойчивости выделенных из растений ПФДКиназ. On the other hand, leaf or callus tissue of Flaveria bidentis is infected with the aforementioned bacteria Agrobacterium tumefaciens. This operation can be performed by culturing tissue or callus with Agrobacterium tumefaciens. Infected cells are selected based on drug resistance. Whole plants were grown from the selected calli by conventional methods. Seeds for plant reproduction are collected and germinated from the resulting plants. PFDK is isolated from the leaves of the obtained plants, and its cold resistance is determined. The effect of temperature on the rate of photosynthesis is studied for transformed and non-transformed plants. The stability of the transformation is guaranteed by the rapid development of maize plants, which demonstrate a high rate of photosynthesis at low temperature for many generations, and by measuring the rate of photosynthesis at various temperatures and cold resistance of PFDKinases isolated from plants.

Claims

1. A polypeptide having the activity of cold-resistant pyruvate orthophosphate dikinase, which has the same amino acid sequence as the amino acid sequence of 1/6 of the C-terminal region of one of the following polypeptides (1) and (2), except that at least one amino acid residue in said 1/6 part is replaced by another amino acid residue: (1) pyruvate orthophosphate dikinase having the amino acid sequence shown in FIGS. 4 to 7, and (2) a polypeptide having an amino acid sequence, Thoraya has homology of not less than 50% of the mentioned in (1) the amino acid sequence, wherein said polypeptide has an activity of pyruvate ortofosfatdikinazy cold resistance.

2. A polypeptide having the amino acid sequence shown in Fig. 8, or the same sequence shown in Fig. 8, except that one or more amino acids is added, removed or replaced, said polypeptide having the activity of cold-resistant pyruvate orthophosphate dicinase.

3. The polypeptide according to claim 2, having the amino acid sequence shown in Fig.

4. A polypeptide containing the amino acid sequence from the 832th to 955th amino acid residue of the amino acid sequence shown in Fig. 8, or containing the same amino acid sequence as the amino acid sequence from the 832th to 955th amino acid residue of the amino acid sequence, shown in Fig. 8, except that one or more amino acid residues are added, deleted or substituted, which may indicate cold resistance to a polypeptide having pyruvate-orth activity ofosfatdikinase, wherein said polypeptide has the activity of cold resistant pyruvate orthophosphate dikinase.

5. The polypeptide according to claim 4, containing the amino acid sequence from the 832th to 955th amino acid residue of the amino acid sequence shown in Fig. 8, wherein said polypeptide has the activity of cold-resistant pyruvate orthophosphate dikinase.

6. The polypeptide according to claim 1, in which the region of the pyruvate orthophosphate dikinase amino acid sequence corresponding to the amino acid sequence of the 832th to 955th amino acid residue of the amino acid sequence shown in Fig. 8 is replaced by the amino acid sequence shown in Fig. 8, or an amino acid sequence having the same amino acid sequence shown in Fig. 8, except that one or more amino acids are added, removed or substituted, which can give a cold worthiness to a polypeptide having pyruvate orthophosphate dikinase activity.

7. The polypeptide according to claim 6, in which the region of the pyruvate orthophosphate dikinase amino acid sequence corresponding to the amino acid sequence of the 832th to 955th amino acid residue of the amino acid sequence shown in Fig. 8 is replaced by the amino acid sequence shown in Fig. 8.

8. The polypeptide according to claim 1, which has the same amino acid sequence as shown in Fig. 8, except that the 869th amino acid residue is substituted for proline.

9. The polypeptide according to claim 1, which has the same amino acid sequence as shown in Fig. 8, except that the amino acid residues 885th and 952nd are replaced by leucine and valine, respectively.

10. Cloned DNA encoding a polypeptide according to any one of claims 1 to 9.

11. The DNA of claim 10, having the nucleotide sequence shown in FIG. 8, or having the same nucleotide sequence as shown in FIG. 8, except that one or more nucleotides are added, deleted or substituted, and a coding polypeptide having cold-resistant pyruvate orthophosphate dikinase activity.

12. The recombinant vector containing the DNA of claim 10, which can express in the host cell a polypeptide having the activity of cold-resistant pyruvate orthophosphate dikinase.

13. The method of transformation of plants, characterized in that as the transforming agent using DNA according to claim 10.

Priority on points and signs:
07/29/94 according to claim 1; with claims 2 and 11, related to the sequence shown in Fig; item 3; paragraphs 4 and 6 related to the sequence of amino acids from 832th to 955th amino acid residue in the sequence of Fig.8; p. 5, 7 to 9; pp. 10, 12, 13 in terms of references to claims 1 to 9, relating to the sequence shown in Fig. 8, and to the amino acid sequence from 832th to 955th amino acid residue of said sequence of Fig. 8;
12/01/94 at paragraphs 2 and 11, related to the sequence shown in FIG. 8, but with the addition, exclusion or substitution of one or more amino acids or nucleotides; claims 4 and 6 related to the amino acid sequence of the 832th to 955th amino acid residue in the sequence of FIG. 8, but with the addition, removal or substitution of one or more of the aforementioned amino acid residues; paragraphs 10, 12, 13 in part of the references to paragraphs 2, 4, 6 related to the sequence shown in Fig. 8 with the addition, exclusion or substitution of one or more amino acids in it, and to the sequence from 832 to 955 -th amino acid residue from the sequence of Fig. 8 with the addition, removal or substitution of one or more of the indicated amino acid residues.