RO118451B1 - Polypeptide with dikinase orthophosphate pyruvate activity, dna encoding the same, recombinant vector with said dna and process for modifying a plant by means of said vector - Google Patents

Abstract

The present invention relates to a polypeptide with dikinase orthophosphate pyruvate activity, stable at low temperatures, containing the amino acid sequence from the 832 amino acid residue to the 955 amino acid residue, of the amino acid sequence number 5, excepting the fact that one or more amino acid residues are added, deleted or substituted, this conferring stability at low temperatures. The invention also relates to a cloned DNA encoding the previously defined polypeptide which has the nucleotide sequence presented in the serv. number 5, excepting the fact that one or more nucleotides are added, deleted or substituted. The said DNA is introduced in a recombinant vector which has a structure presented in figure 1 or 3, and which may express, in the host cell, a polypeptide having dikinase orthophosphate pyruvat activity, stable at low temperatures. The invention presents a process for modifying a plant of Flaveria bidentis or corn, for providing the stability at low temperatures, process where a previously defined recombinant vector is used as modifying agent.

Description

RO 118451 B

The present invention relates to a polypeptide with pyruvate orthophosphate dikinase activity (hereinafter referred to as "PPDK"), a DNA encoding it, a recombinant vector containing the DNA, and a process for transforming a Flaveria bidentis plant or corn, through this vector.

C ₄ plants have high photosynthetic capacities, under strong light, high temperature or low CO ₂ conditions. However, their photosynthetic capabilities are much reduced in low temperature conditions, except for those that are adapted to low temperature conditions. Although PPDK (EC 2.7.9.1, which catalyzes the reaction in which AMP, phosphoenolpyruvate and pyrophosphate are produced from ATP, pyruvate and orthophosphate) is one of the most important enzymes in the C ₄ pathway, its activity is not sufficient according to the rate of photosynthesis from the leaf tissue, so it is one of the enzymes that determines the rate of CO ₂ fixation in C ₄ photosynthesis. Moreover, it was revealed, together with the discovery of this enzyme, that it is sensitive to low temperature. in the case of PPDK from maize, the enzyme activity has an inflection point at 11.7°C. This temperature coincides with the limiting temperature for corn growth. From these it is considered that PPDK is one of the causes that reduce the photosynthesis rate of C ₄ plants at low temperature. Therefore, by improving the low temperature sensitivity of PPDK, the limiting growth temperature of maize can be lowered.

Flaveria brownii, which is a plant belonging to the Compositae family, is classified by the C ₃ /C ₄ intermediate type and its PPDK is known not to be substantially inactivated by low temperature treatment at 0°C (Burnell JN “A comparative study of the cold -sensitivity of pyruvate, Pi dikinase in Flaveria species", Plant Ceti Physiol. 31,295-2987 (1990)).

By cloning the gene encoding the low-temperature-stable Flaveria brownii PPDK and transforming a plant with the gene, it is expected that resistance to lower temperatures can be assigned to the plant.

The present invention relates to a polypeptide with pyruvate orthophosphate dikinase activity, stable at low temperatures, containing the amino acid sequence from amino acid residue 832 to amino acid residue 955 of amino acid sequence no. 5, except that one or more amino acid residues are added, deleted or substituted, this giving the polypeptide stability at low temperatures.

Also, the invention relates to a cloned DNA, which encodes the polypeptide defined above, which has the nucleotide sequence shown in seq. no. 5, except that one or more nucleotides are added, deleted or substituted.

This DNA is inserted into a recombinant vector, which has a structure shown in fig. 1 or 3 and which can express, in the host cell, a polypeptide having pyruvate orthophosphate dikinase activity, stable at low temperatures.

The invention presents a new process for transforming a Flaveria bidentis or corn plant, in which, as a transforming agent, the recombinant vector defined above is used.

The invention presents the advantage that it puts at the disposal of specialists new effective means for attributing the stability, at low temperatures, of plants.

in the following, the invention will be described in detail, with reference also to fig. 1...3:

- fig. 1 schematically shows a method of constructing an expression vector containing an example PPDK gene, according to the present invention;

- fig. 2 shows the change in enzyme activity as a function of time when PPDK of Flaveria brownii, Flaveria bidentis and maize, which were expressed in Escherichia coli, was kept at 0°C; and

- fig. 3 schematically shows a method of constructing an expression vector containing an example PPDK gene, according to the present invention.

RO 118451 B

To succeed in cloning the complete gene, the Flaveria brownii PPDK was intensively studied, 50 determining the nucleotide sequence of the gene and the amino acid sequence encoded by it, and to identify the region of the PPDK gene that confers low temperature stability, thereby completing the present invention.

Thus, the present invention provides a polypeptide having stable low-temperature PPDK activity having an amino acid sequence that is the same as the amino acid sequence of the 1/6 region of the entire C-terminal region of polypeptides (1) or (2) which follows, except that at least one amino acid residue of said 1/6 region is substituted with another amino acid residue, (1) a PPDK having an amino acid sequence shown in SEQ ID NO:1 to 4 of the Sequence Listing ; and (2) a polypeptide having an amino acid sequence with no less than 50% homology with said amino acid sequence (1), said polypeptide having low temperature stable PPDK activity.

The present invention also provides a cloned DNA encoding a polypeptide having low temperature stable PPDK activity according to the present invention. Additionally, the present invention provides data relating to a recombinant vector containing the DNA of the present invention that can express, in a host, a polypeptide having stable PPDK activity at low temperature. Additionally, the present invention features a plant that is transformed with DNA according to the present invention.

By the present invention, a gene encoding PPDK having stability at low temperature has been cloned and sequenced. In addition, the region in the gene conferring low temperature stability was also identified. Therefore, by transforming a plant having low-temperature-sensitive PPDK with the gene of the present invention, the low-temperature-sensitive PPDK can be exchanged for low-temperature-stable PPDK. In addition, by incorporating the above-mentioned region conferring low-temperature stability 75 into the corresponding region of the low-temperature-sensitive PPDK, the low-temperature-sensitive PPDK can be mapped to the low-temperature-stable PPDK. By this, the plant can be grown in a cold region, where the plant could not be grown otherwise. Therefore, it is expected that the present invention will contribute a lot to agriculture.

By the present invention, the low temperature stable PPDK gene from 80 Flaveria brownii was cloned and its nucleotide sequence and the deduced amino acid sequence encoded by it were determined. The nucleotide sequence and amino acid sequence are shown in SEQ ID NO:5 of the Sequence Listing. As described in detail in the following examples, this sequence was determined by extracting total RNAs from Flaveria brownii leaves; preparing a cDNA library according to a conventional method; carrying out a plate hybridization method, using a probe prepared by reference to the Flaveria bidentis PPDK gene region and the maize PPDK gene region, regions that have high homology; selection and donation of positive clones; and gene sequencing by the dideoxy method. The sequence has high homology with the PPDK gene of Flaveria bidentis which belongs to the same genus and has relatively high homology with the PPDK gene of maize. In addition, the sequences of the N-terminal region, the C-terminal region and the internal regions of the deduced amino acid sequence are completely the same as the corresponding sequences of PPDK from Flaveria brownii, directly purified from the green leaves of this plant. Therefore, it is apparent that the cloned gene is the PPDK gene from Flaveria brownii. The Flaveria bidentis PPDK gene was sequenced by plate hybridization, using maize cDNA as a probe; donation of positive clones; and gene sequencing by the dideoxy method.

RO 118451 B

The amino acid sequence shown in SEQ ID NO:5 is novel, and 40 amino acid residues thereof are different from the PPDK sequence of Flaveria bidentis, which belongs to the same genus. About 180 amino acid residues of it differ from the amino acid sequence of maize PPDK. Thus, despite the fact that the amino acid sequence of Flaveria brownii PPDK, shown in SEQ ID NO:5 has high homology with the amino acid sequence of Flaveria bidentis PPDK, which belongs to the same genus, Flaveria bidentis PPDK is sensitive to low temperature, while that of Flaveria brownii is cold stable. Thus, the small difference in amino acid residues brings with it an important difference in character. The present invention provides a cloned PPDK gene encoding the amino acid sequence set forth in SEQ ID NO:5. As mentioned above, this amino acid sequence is novel and has a pronounced effect, which is stability at low temperature. The gene according to the present invention is not restricted only to the one having the nucleotide sequence shown in SEQ ID NO:5, but to any nucleotide sequence encoding this amino acid sequence, which is included in the gene according to the present invention.

For the identification of the region in the Flaveria brownii PPDK gene shown in SEQ ID NO:5, the inventors of the present invention selected the region that confers stability at low temperature.

Thus, as described in detail in the examples that follow, the PPDK gene of Flaveria browniis split into three regions of approximately the same size by restriction enzymes; each of the regions was swapped with the corresponding region of the maize PPDK gene to form chimeric PPDK genes; and whether or not PPDKs encoded by the obtained chimeric genes have low temperature stability was determined. As a result, it was confirmed that the region conferring low temperature stability exists in the last 1/3 region of the Flaveria brownii PPDK gene. Additionally, this last 1/3 region was split by a restriction enzyme into two regions that are approximately the same size, and by the same method, the regions containing the low temperature stability region were determined. As a result, it was confirmed that the function of conferring low temperature stability is encoded in the upstream region of the Xhol site of the Flaveria brownii PPDK gene shown in SEQ ID NO:5. Thus, it was confirmed that the function of giving cold stability is located in the amino acid sequence between the arginine amino acid residue at position 832 and the valine amino acid residue at position 955, of the amino acid sequence presented in SEQ ID NO.:5 (amino acid sequence from the 836th amino acid residue to the 955th amino acid residue may hereinafter be referred to as "the sequence conferring low temperature stability").

Thus, the region related to cold stability of PPDK was shown to be located in region 1/6 of the entire C-terminal region. On the other hand, in SEQ ID NO:1 of the Sequence Listing are the nucleotide sequence of the Flaveria bidentis PPDK encoding gene and the amino acid sequence encoded thereby, and in SEQ ID NO:2 are the nucleotide sequence of the maize PPDK encoding gene and the deduced amino acid sequence encoded thereby {Biochemistry 29, 10757-10765 (1990)). in SEQ ID NO:4, the nucleotide sequence of the gene encoding PPDK of Entamoeba histolytica, which is a bacterium, and the deduced amino acid sequence encoded thereby {MolecularandBiochemical Parasitology 62,153-156 (1993)) are shown. As described above, it has been shown by the present invention that the region related to the low temperature stability of PPDK is located in the 1/6 region of the entire C-terminal region; it is possible to obtain PPDK stable at low temperature by substituting at least one amino acid residue in the 1/6 region of the entire C-terminal region of the amino acid sequence shown in SEQ ID NO:1,2, 3 or 4.

RO 118451 B

Here, the term "stable at low temperature" means that the enzyme activity after allowing the enzyme to stand at 0°C for 20 min is not less than 60% of the initial 145 activity.

As noted above, because the region from the 832nd amino acid, arginine, to the 955th amino acid residue, valine, of the aminocidal sequence shown in SEQ ID NO:5 defines cold stability , the low-temperature-sensitive PPDKs having the aminicidal sequence shown in SEQ ID NO:1-4 can be transformed into the low-temperature-stable PPDKs by substituting the corresponding regions of the cold-sensitive PPDKs with the sequence aminoacid from the 832nd amino acid residue, ariginine, to the 955th amino acid residue, valine, of the aminoacidic sequence shown in SEQ ID NO:5. This finding is very important because by using it, any desired cold-sensitive PPDK can be converted into a cold-stable PPDK. 155 The method of conferring low temperature stability to a PPDK is not restricted to the method described in the examples below, in which the low temperature stability conferring sequence of the Flaveria brownii PPDK is exchanged with the corresponding low temperature sensitive region of the PPDK, to prepare a chimeric gene, but low-temperature stability can be conferred by changing the corresponding region of the low-temperature-sensitive PPDK of a plant with the same sequence as confers cold stability in Flaveria brownii by site-directed mutagenesis. Therefore, any DNA encoding a polypeptide having PPDK activity, which contains the sequence conferring low temperature stability, described above, is within the scope of the present invention. in particular PPDK in which the 869th amino acid residue of the aminicidal sequence shown in SEQ ID NO:1 is substituted by 165 proline, and PPDK in which the 885th and 952nd amino acid residue of the sequence amino acid shown in SEQ ID NO:1 is substituted by leucine and valine, respectively, have low temperature stability.

The PPDKs that can be given low temperature stability are not limited to those shown in SEQ ID NO:1-4, and can be any of those that have no less than 170 homology to the sequences shown in SEQ ID NO: :1-4. Preferably, the nucleotide sequence of the gene encoding PPDK, to which low temperature stability can be attributed, has homology to the Flaveria brownii PPDK gene in an amount of not less than 48.5%, more preferably not less than 90 %.

It is well known in the art that there are cases where the physiological activity of a physiologically active peptide is maintained even if the aminicidal sequence of the peptide is changed to a small extent and even if one or more amino acids in the amino acid sequence are substituted or deleted, or even if one or more amino acids are added to the amino acid sequence. Therefore, polypeptides having the same amino acid sequence as shown in SEQ ID NO:5, except that the polypeptides have such modifications but have stable PPDK activity at low temperature, are included within the scope of the present invention. In other words, polypeptides having the same amino acid sequence as that shown in SEQ ID NO:5, except that one or more amino acids are added, deleted or substituted, but having stable PPDK activity at low temperature, are included in of the present invention. similarly, DNAs having the same nucleotide sequence as that of SEQ ID NO:5, except that one or more nucleotides are added, deleted or substituted, and which encode polypeptides having temperature-stable PPDK activity low, also falls within the scope of the present invention.

RO 118451 B

Modifications of DNA, resulting in the addition, deletion or substitution of the amino acid sequence encoded by it can be achieved by site-specific mutagenesis which are well known in the art (eg, Nucleic Acid Research, Vol. 10, No. 20, p. 6487 -6500, 1982). As used herein, "one or more amino acids" means the number of amino acids that may be added, deleted, or substituted by site-specific mutagenesis.

Site-specific mutagenesis can be accomplished, for example, by using a synthetic oligonucleotide primer complementary to a single-stranded DNA phage, except for the desired mutation that follows. Thus, using the synthetic oligonucleotide mentioned above as a primer, a complementary strand is produced by a phage and bacterial-host cells are transformed with the double-stranded DNA obtained. The culture of transformed bacterial cells is plated on agar and plates are formed from a single cell, containing the phage. Theoretically 50% of the new colonies contain the phage, which has a single-stranded strand carrying the mutation, and 50% of the remaining colonies contain the phage having the original sequence. The plates obtained are then hybridized with a synthetic probe, treated with kinase at a temperature at which the probe hybridizes with DNA that has exactly the same sequence as the DNA with the desired mutation, but not with the original DNA sequence, which is not complete complementary to the probe. Plates where hybridization was observed are then collected, cultured, and DNA recovered.

In addition, in the aforementioned site-specific mutagenesis, methods for the substitution, deletion or addition of one or more amino acids without loss of enzyme activity include a method in which the gene is treated with a mutagen and a method in which the gene is selectively cleaved, a specific nucleotide is retrieved, added or substituted, and then the gene is ligated.

By transforming a plant with the PPDK gene of Flaveria brownii or with a DNA encoding a polypeptide containing the sequence conferring low temperature stability, which has PPDK activity, a cold-resistant plant can be obtained. Examples of preferred plants that can be transformed include, but are not limited to, corn, sugarcane, millet, pasture grass, and sorghum.

Methods for transforming plants have already been established, and the method using Agrobacterium tumefaciens can be preferably used. The method for transforming plants using Agrobacterium tumefaciens is well known in the art. Both dicotyledonates (eg, Japanese Patent Application (Kokai) No. 4-330234) and monodicotyledonates (WO 94/00977) can be converted by this method. Alternatively, DNA can be introduced into plant protoplasts by electroporation or other methods well known in the art. Additionally, transformation can also be accomplished by attaching DNA to tungsten particles and other such methods, and by implanting the particles into a plant embryo. Concrete methods of such transformations are described in the following examples.

The present invention will now be described concretely by means of examples. However, the present invention is not limited to the examples below.

Example 1. Flaveria brownii PPDK Gene Cloning and Sequencing (1) cDNA Bank Preparation and Full-Length cDNA Cloning (I) cDNA Bank Preparation

By the guanidine hydrochloride/phenol method, total RNAs were isolated from green leaves (60 g) of Flaveria brownii. This method yielded 26.5 mg of RNA after lithium precipitation. Then, 118.9 µg of poly(A) ⁺ RNA was obtained from 13.2 mg of RNA, according to a

RO 118451 Β conventional methods, using a column containing Oligo dT cellulose Type 7 (commercially available from Pharmacia). The TimeSaver cDNA 235 Synthesis Kit (commercially available from Pharmacia), the Lambda ZAPII vector (commercially available from STRATAGENE) and the packaging reagent attached to the Ăgtlo cDNA cloning system (commercially available from AMERSHAM) were used to prepare the cDNA bank. Using an EcoRI/NotI linker, a cDNA library was prepared, in which DNA fragments are inserted into the EcoRI site of Lambda ZAPII vectors.

The size of the prepared cDNA library was 415,000 pfu. As host cells, 240 XIII-Blue cells were used.

(ii) Probe preparation

Using a primer that has the sequence 5': GACGGCTAAAAAGAGGGT (designated based on regions of Flaveria bidentis PPDK and maize PPDK that have high homology) and an R primer that has the sequence TATCGAGAAACCTTCTATAC (part of Flaveria bidentis PPDK 245 sequence, complementary strand) , a DNA fragment originating from Flaveria brownii RNA was amplified by reverse transcription PCR and the amplified DNA fragment was inserted into the pCRII vector (commercially available from INVITROGEN). Using the obtained vector as a template and using the same primers as mentioned above, the DNA was amplified, and the PCR product was subjected to electrophoresis followed by DNA recovery from the gel using 250 SUPREC-ol (commercially available from TAKARA SHUZO) . Through this process a DNA fragment can be obtained, which has a size of 428 bp starting from the 24th bp upstream of the N-terminus of the mature protein. This fragment was labeled with ³² P using the Multiprime DNA labeling system (commercially available from AMERSHAM) to prepare a probe.

(iii) Cloning of full-length cDNA from Flaveria brownii 255

The cDNA library was screened by the plate hybridization method, using the aforementioned DNA fragment as a probe. Hybond N ⁺ (AMERSHAM) was used as the hybridization filter, and hybridization was performed in 6x SSC containing 5x Denhalt's solution, 0.1% SDS, and 100 µg/ml DNA from denatured salmon gonads at 65° C overnight. Washing was done with 2 x SSC containing 0.1% SDS at room temperature for 5 min; with 260 2 x SSC containing 0.1% SDS at room temperature for 90 min; and 1x SSC containing 0.1% SDS at 68°C for 90 min. This operation yielded 28 independent positive clones. From these, 11 plaques that showed strong signals were selected and subjected to a 2nd screening. This was done in the same way as the first, except that the time of the second wash was 60 min. As a result, positive, independent plaques originating from a single phage were obtained from 6,265 clones. To check the sizes of the inserted DNA fragments, PCR was performed using primer R, described above, M13PrimerM4 (GTTTTCCCAGTCACGAC, commercially available from TAKARA SHUZO), and M13PrimerRV (CAGGAAACAGCTATGAC, commercially available from TAKARA SHUZO) as primers, and using phage as matrix. As a result, two clones contained the total Iun-270 cDNA. After this, by in vivo excision, the inserted DNA fragments were subcloned into a plasmid vector pBluescriptIISK (commercially available from STRATAGENE). The recombinant plasmids obtained by subcloning were named p411 and p631.

By the PCR described above, it was shown that the library prepared as described above was a library containing sufficiently long inserts that was complete for the 275 cDNA search. Thus, for the isolation of Flaveria brownii mRNAs it is advantageous to use the method described above and to obtain a large amount of mRNAs by treating a large amount of RNAs at once as described above.

RO 118451 Β in addition, since the cDNA library described above contains a number of inserts that are sufficiently long, the search for full-length cDNA was possible to perform easily by preparing a probe using a primer that hybridizes to a region in the vicinity the processing region of the desired protein.

(2) Determination of the total nucleotide sequence of the cDNA and comparison of the deduced amino acid sequence

To determine the total nucleotide sequence of the inserted p631 cDNA, deletion mutants were prepared. Deletion mutants were prepared using Deletion-Kit for KiloSequence (commercially available from TAKARA SHUZO). However, the exonuclease III reaction was stopped by transferring the reaction mixture to Mung Bean Nuclease buffer maintained at 65°C. Nucleotide sequence determination was performed using a purified plasmid using the Qiagen Plasmid Mini Kit (commercially available from Diagen), the Taq Dydeoxy terminator Cycle Kit (commercially available from ABI), and the Applied Biosystems 373A DNA Sequencer (ABI). Both strands were sequenced, except for parts of them. Based on the determined nucleotide sequence, the amino acid sequence was determined. The determined nucleotide sequence and amino acid sequence are shown in SEQ ID NO:5 of the Sequence Listing.

It should be noted that in preparing the deletion clones for sequencing the isolated cDNA, it was important to preheat the Mung Bean Nuclease buffer to 65°C, as the reaction could not be stopped by simply transferring the reaction mixture to the Mung Bean buffer Nucleases. Additionally, since the sequence up to about 600-900 bp of the larger vector and the insert could not be determined by deletion of the downstream insert alone, it was necessary to perform the deletion from both ends.

On the other hand, PPDK was purified directly from Flaveria brownii and the amino acid sequences of its N-terminal, C-terminal and internal regions were determined. PPDK was purified as follows. Green leaves were minced in a threefold volume of the extraction buffer. After centrifugation, ammonium sulfate was added to the supernatant to 30% saturation and the precipitated proteins were removed. Subsequently, ammonium sulfate was added to 70% saturation and the precipitated proteins were recovered. The recovered proteins were applied to Sephadex G25 (commercially available from PHARMACIA) to remove salts. The resulting was applied to a DEAE-Sepharose column (PHARMACIA) and proteins adsorbed to the column were eluted by HCl, which has a gradient of 50-400 mM. Fractions having PPDK activity were combined and concentrated by 70% saturation ammonium sulfate followed by desalting with Sephadex G25. The resulting was then applied to a hydroxyapatite column. Adsorbed proteins were eluted through phosphate buffer, which has a phosphate gradient from 10 mM to 40 mM. Fractions having PPDK activity were combined and concentrated by 70% saturation ammonium sulfate followed by desalting with Sephadex G25. The resulting was subjected to SDS-PAGE, and the PPDK band was excised. Protein was recovered from the gel by electroelution. Through this process, the PPDK sample was obtained, purified in an amount of about 5-10 nmol. The purified PPDK obtained in this way showed a single band in SDS-PAGE.

Next, the amino acid sequences of the N-terminal, C-terminal and internal regions of the thus obtained purified PPDK were determined. The amino acid sequence of the N-terminal region was determined by transferring the protein to a PVDF membrane and then determining the sequence using a gas-phase amino acid sequencer. The amino acid sequence of the N-terminal region was determined by digesting purified PPDK with carboxypeptidase and estimating the amino acid sequence based on the relationship between the composition of the released amino acids and the digestion time.

RO 118451 B

The amino acid sequences of the internal regions were determined by determining the N-terminal amino acid sequence of the peptides generated by digestion of the protein with a protease. The details of this method are as follows. Initially, as in the case of determining the amino acid sequence of the N-terminal region, PPDK from green leaves of Flaveria browniia was partially purified and subjected to a regular SDS-PAGE. The gel was stained with Coomassie Brilliant Blue R250 and the PPDK band excised. The excised gel was equilibrated in equilibration buffer (Tris-HCl pH 6.8, 125 mM, 1 mM EDTA, 0.1% SDS) and inserted into a well, followed by a second SDS-PAGE. Here, along with the equilibrated gel, a coating solution (Tris-HCl pH 6.8, 125 mM, 1 mM EDTA, 0.1% SDS, 0.01% BPB, 20% glycerol) and a enzymatic (Tris-HCl pH 6.8, 125 mM, EDTA 1 mM, 0.1% SDS, 0.01% BPB, 10% glycerol, lysyl endopeptidase 1-5 µg or V8 proteases 0.01-0.1 µg ). After performing the electrophoresis, for the same time, the protein digestion was performed in the concentrated gel (the electrical supply was interrupted, and the gel was left to stand for 45 min). Then, the electrophoresis was restarted, and the resulting was transferred to a PVDF membrane in the same way as for determining the N-terminal sequence, and the amino acid sequences of the digested fragments were determined from their N-termini using the sequencer amino acids in gas phase

The determined sequences of the N-terminal, C-terminal and internal regions are as follows:

330

335

340

N-terminal sequence: Asn Pro Val Ser Pro Pro Val (72-78) C-terminal sequence: Leo - Ala Ala * Val Val (948-955) Intense sequence (1): Lys Leu Tyr Glu Phe Leu Val Asn Ala Gin Gly - Asp Val Val Ala (349-365) Intense sequence (2): Gin Leu Leu Ala Pro Pro Ala Met Ser Asn Ala Leu - Thr (592-605) Intense sequence (3): Leu Thr Ala Asp Thr Gly Met Ser Lys Asp Glu lle Tyr Ser Arg lle Glu (721-738) Intense sequence (4): Ala - - - Ser Phe Gly Thr

345

350

Asn Asp Leu Cis Gin Met Val Phe Gly - Ser (844-862) in the amino acid sequences described above means glutamine, but it could not be analyzed by the analyzer used, and it means that the analysis result was unclear. The numbers in parentheses indicate the amino acid number of the corresponding region in the amino acid sequence shown in SEQ ID No: 5. Although parts of the internal sequences (2) and (4) are different from the amino acid sequence shown in SEQ ID No: 5, it is believed that this is due to amino acid sequencing errors. As is well known, errors are produced by amino acid sequences with considerable frequency, and no substantial errors are produced by DNA sequencing.

355

360

Since the amino acid sequence shown in SEQ ID NO: 5 corresponds well with the partial amino acid sequences directly determined in the purified PPDK described above, it was confirmed that the amino acid sequence shown in SEQ ID NO: 5 is the amino acid sequence of PPDK. The amino acid sequence shown in SEQ ID NO: 5 was compared to the amino acid sequences of known PPDKs from Flaveria bidentis and maize. As a result, 40 amino acid residues {Flaveria bidentis) and about 180 amino acid residues (maize) were different in the region of the mature protein. In addition, from the results described above, it was believed that in the amino acid sequence shown in SEQ ID NO: 5, the amino acid sequence from the 1st to the 71st amino acid does not exist in the mature protein, but there is a transient peptide, necessary for passing through membranes, which is processed after passing through the membranes. The differences between the amino acid sequences of the mature Flaveria brownii and Flaveria bidentis proteins are shown in Table 1 below.

365

370

RO 118451 B

Table 1

375

the brownies bidentis Amino acid numbers and 5 Phe 6 Ser 380 the amino acids that are 10 Pros 11 Leo different i. 15 Asn 16 Arg 28 Thr 29 Asn 40 Pros 41 Ser 385 41 Ala 42 Ser 48 Arg 47 Leo 49 Arg 48 Thr 50 Lys 49 Pros 390 52 Ser 50 Ala 57 Islands 55 Pros 61 Thr 59 Ser 62 Gly 60 Ser 395 66 Leo 64 Pros 81 Thr 79 Ala 92 Asn 90 Arg 97 Lys 95 Arg 400 114 Ala 112 Ser 140 Lys 138 Ser 150 Leu 148 Ser 154 Gin 152 Asp 405 170 Ala 168 Pro 201 Asp 199 Ala 205 Ala 203 Gly 263 Ala 261 Wave 410 265 Gin 263 Lys 323 Cys 321 Ser 356 Wave 354 Islands 374 Wave 372 Gly 415

RO 118451 B

Table 1 (continued)

the brownies bidentis 420 Amino acid numbers 382 Glu 380 Asp and the amino acids that are 385 Arg 383 Lys 392 Wave 390 Glu different i 396 Arg 394 Gly 465 Asn 463 Asp 490 Wave 488 Cys 564 Wave 562 lle 430 583 Ser 581 Thr 605 Thr 603 lle 672 Ala 670 Wave 723 Thr 721 Ala 435 724 Ala 722 Wave 730 Lys 728 Ala 736 Arg 734 Lys 739 Lys 737 Asn 440 777 Asn 775 Thr 803 Gly 801 Ser 818 Leo 816 Wave 838 Asp 836 Glu 445 841 Ala 839 Gly 845 Glu 843 Asp 871 Pro 869 Gin 875 Ser 873 Ala 450 887 Leo 885 lle 954 Wave 952 lle

Example 2. Production of PPDK by Flaveria brownii in E.coli and measurement of stability at low temperature 4 ₅₅

To confirm that the low-temperature stable enzyme is now produced from Flaveria brownii PPDK cDNA isolated as described above, expression in E.coli was performed as follows.

To remove the transit peptide and ligate the DNA to an expression vector so that the reading frames coincide, restriction sites were introduced as follows. 460

p631 was digested with Saci and recycled to obtain p631Sacl (a plasmid like p631 except that the region downstream of the Saci site is deleted). PCR was performed using p631Sacl as a template and using primer 4: GATATCAATCCGGTGTCTCCTCC, which contains the EcoRV site prepared based on the sequence in the vicinity of the processing region

RO 118451 Β and M13 RV primer (commercially available from TAKARA SHUZO) complementary to the vector sequence and the amplified fragment was subcloned into pCRII. A fragment containing the N-terminal region was excised using EcoRV and Saci restriction enzymes. Three DNA fragments, which are: the thus excised DNA fragment, the Sac1-HindIII fragment from p631 (containing the remaining region of the PPDK cDNA) and a fragment obtained by digesting pKK233-2 with NcoI, were ligated after blunting the ends with Klenow and then digesting the resulting Hindlll (Fig. 1). E.coli MV1184 was transformed with the resulting plasmid and used for expression experiments. 1 ml of a pre-cultured medium was diluted with 9 ml of fresh LB medium (containing 50 mg/l ampicillin) and the resultant cultured with shaking for 3 h at 37°C. Then, IPTG was added at a concentration of 5 mM and culture was continued for another 3 h followed by collection of cells by centrifugation. Cells were suspended in 0.5 ml of an extraction buffer (50 mM Hepes-KOH pH 7.5, 10 mM MgSO ₄ , 1 mM EDTA, 5 mM DTT) and lysozyme was added at a concentration of approximately 0 .5 mg/ml. The suspension was left on ice for 5 min and then treated with an ultrasonic disruptor (Model UCD-130T (commercially available from COSMOBIO) for 30 s each for a total of 5 min, extracting the enzyme. the result was centrifuged with a microcentrifuge for 10 min, and the supernatant was applied to a Sephadex G25 column equilibrated with a column buffer (50 mM Hepes-KOH pH 7.0, 10 mM MgCl ₂ , 2 mM EDTA, 10 mM DTT) to remove low molecular weight substances.The resulting was allowed to stand at 25°C for not less than 30 min, thereby making the association to the tetramer, which was then used to measure the activity.

PPDKs produced in E.coli cells from Flaveria brownii, Flaveria bidentis, and maize (harvest Queen) PPDK cDNAs showed essentially the same mobility as plant-derived enzymes in SDS-PAGE. Although the molecular weights of the mature enzymes, which are expected from the respective cDNAs, are approximately the same, the apparent molecular weights on SDS-PAGE differ substantially. This has been shown to be due to differences in amino acid compositions and not to protein deletion processing or post-translational modifications such as the attachment of saccharide chains. The low-temperature stability of each PPDK produced by E.coli was identical to the corresponding enzyme originating from each plant. Low-temperature stability of Flaveria brownii PPDK is achieved without a plant-specific auxiliary factor or post-translational processing, so it is expected that low-temperature stable PPDK is produced by introducing the cDNA into maize and expressing it. Fig. 2 shows the relationship between the time interval after placing the enzyme at 0°C and the relative activity of PPDK.

In the process described above for the production of active PPDK in E.coli, the cDNA, from which the region encoding the transit peptide was removed, was inserted into the expression vector. For this it was important to precisely pair the site to be cut with the corresponding site at the N-terminal of the enzyme originating from the plant.

The amount of enzyme produced in E.coli Primer used (F. brownii) MITAKKRVFTF... - 2 MIPVSPPVTTTKKRVFTF... + 3 MINPVSPPVI I IKKRVFTF... ++ 4 N P VSPPVTTTKKR VFTF... (enzyme originating from leaves)

RO 118451 B

Table

The amount of enzyme produced in E.coli Primer used (F. bidentis) MITAKKRVFTF... +4- MIPVSPPVTTAKKRVFTF... - TAKKRVFTF... (enzyme originating from leaves) (maize) MATKKRVFTF... ++ TTKKRVFTF... (enzyme originating from leaves)

515

520

More specifically, at the time of the Flaveria brownii cDNA expression experiment, the expression of the maize and Flaveria bidentis PPDKs had been successful, with reference to the maize cutting site in both cases. Thus, in Flaveria brownii cDNA expression, DNA was first cut at the same site using primer 2, and it was chosen for cDNA expression after construction of an expression vector containing the cDNA. However, it did not occur in all PPDKs. Then, based on the sequence of the N-terminal region of the enzyme originating from leaves, an expression vector was constructed in which the inserted cDNA contains an additional sequence, which encodes the extension of the enzyme towards the N-terminal direction by 7 residues, using primer 3, and expression was achieved using the expression vector. As a result, the production of PPDK was confirmed. However, even with this expression vector, the amount of enzyme produced was small, so the enzyme obtained was not in sufficient quantity to measure its activity. Thus, an expression vector was constructed using primer 4 in which the inserted cDNA still contains an additional sequence that conditions the extension of the 535 enzyme towards the N-terminal direction by 1 residue, and expression was performed using the expression vector. As a result, a large amount of PPDK was produced and its stability at low temperature was confirmed. The nucleotide sequences of primer 2 and primer 3 were as follows:

primer 2: CGGTGTCTCCTCCCGGATATCACGGCTAAAAAGAG 540 primer 3: TTGATATCCCGGTTGTCTCCTCCGGTA.

Example 3. Identification of regions conferring low temperature stability in the PPDK gene of Flaveria brownii (1) Chimeras of Flaveria brownii and Flaveria bidentis

The expression vectors recombined according to a conventional method using 545 restriction enzymes. Thus, the EcoRI-HindIII fragment of pKK.-brownii was exchanged with the corresponding fragment of pKK-bidentis (a plasmid obtained by inserting Flaveria bidentis cDNA into pKK 223-2 as in the construction of pKK-brownii) to obtain a plasmid pKK-011. On the other hand, the EcoRI-HindIII fragment of pKK-bidentis was exchanged with the corresponding fragment of pKK-brownii to obtain a plasmid pKK-100. similarly 550 changed the Ndel-HindIII fragments to obtain pKK-001 and pKK-110. In addition, the XhoHindllI fragment of pKK-110 was exchanged with the corresponding fragment of pKK-bidentis to obtain pKK-1101, and the XhoI-HindllI fragment of pKK-bidentis was exchanged with the corresponding fragment of pK-brownii to obtain pKK -1110. In order to subsequently finely recombine the Xhol-Hindl11 fragments, the fragments were ligated by PCR (linear POR method). Thus, primers complementary to the nucleotide sequence in the Xhal-Hindlll fragment were prepared,

RO 118451 Β sequence that is common in bidentis and brownii, which is an F-link primer: GCAGAGATGATGTTGGCAAGand an R-link primer: CTTGCCAACATGATCCTGC. Using the browniisau bidentis Xhol-Hindlll fragment subcloned into pBluescript SK(-) as a template, and using the link-F/RV or M4/link-R primer combination the first POR was performed. The obtained fragments (4 types in total) were purified by cutting them out of the gel. Using the mixture of the fragment encoding the former half of brownia and the fragment encoding the latter half of bidentis, or the mixture of the fragment encoding the former half of bidentis and the fragment encoding the latter half of brownia as a template, and using primers M4/RV, a second POR. The amplified linked fragments were digested with XhoI and HindIII, and the results were swapped with the corresponding region of pKK-bidentis to obtain pKK-link01 and pKK-link10. Another chimeric gene pair was prepared using the Pstl site between the recombination site in the PCR ligation and the HindIII site. Thus, the XhoI-Pstl fragment of pKK-link10 and the Pstl-HindIII fragment of pKK-bidentis were inserted into the XhoI-HindIII site of pKK-bidentis (three-fragment annealing reaction), to obtain pKK-link101. similarly, the XhoI-Pstl fragment of pKK-bidentis and the Pstl-HindIII fragment of pKK-browniis inserted into the XhoI-HindIII site of pKK-bidentis, to obtain pKK-link110.

The 40 sites, where the amino acid residues are different between Flaveria brownii and Flaveria bidentis PPDK proteins, exist mainly in the N-terminal and C-terminal region, and are not so numerous in the central region, in other words, in active site. Thus, the cDNAs were divided into three regions which are the front, middle and back regions using EcoRI- and Ndel-sites, which are commonly present in both genes, and these exchangeable fragments were swapped to prepare chimeric genes. By checking these chimeric genes it was determined which region is related to low temperature stability. As a result, low temperature stability is acquired when the protein contains the posterior 1/3 region of the Flaveria brownii cDNA. When the protein contains the back 1/3 region of the Flaveria bidentis cDNA, the protein was sensitive to low temperature. Then, the back 1/3 region was split into 2 regions by restriction enzyme, and the respective fragments were inserted into the corresponding regions of pKK-bidentis and checked for low temperature stability. As a result, the region upstream of the Xhol site (ie, the 1/6 region from the C-terminus) was both necessary and sufficient to achieve low-temperature stability. Then, a chimeric gene containing the 1/6 back region (Xhaol-Hindl11 fragment containing 7 amino acid residue substitutions) was prepared by the PCR linearization method and the amplified gene was inserted into pKK-bidentis, followed by stability measurement at their low temperature. As a result, a pKK-link10 chimeric enzyme, having most of the back region containing 4 substitutions, was stable at low temperature, while a pKK-link01 chimeric enzyme, having the former half of the back region containing 3 substitutions, a was sensitive to low temperature. Then, the back region was recombined using a PstI restriction enzyme to prepare chimeric genes having two amino acid substitutions per gene, and the low temperature stability of the resulting gene was checked. As a result, all chimeric genes exhibited low temperature stability. Thus, it has been accepted that there are two or more regions related to low temperature stability.

(2) Maize chimeras and Flaveria brownii

Using a PPDK-F primer: CTCACTGTTCGAAGAGAAGC and an mNdel primer: CATATGCTCTGTCCGGCATAATC (complementary side chain) containing Ndel site as primers and maize PPDK cDNA as template, PCR was performed and the amplified fragment was subcloned into pCR II. This fragment was excised from pCR II by Saci and NdeI. This fragment, the Sac1-SmaI fragment (vector fragment) of pKK-PPDK, obtained by cDNA digestion of

RO 118451 B

PPDK of Flaveria brownii, cleaving the resultant with the Klenow fragment and then digesting the resulting with NdeI, were lysed by the linearization reaction of three fragments (Fig. 3), to obtain pKK-mz/bro(Nde). PCR was performed using primer PPDK and an mXho primer: CTCGAGGGATCTCAATCATTG (complementary strand), and maize PPDK as template. The resulting fragment was subcloned into pCR II, and the insert excised by Sac and XhoI from pCR II. The excised fragment was ligated with the Sac1-XhoI fragment (vector fragment) of pKK-mz/bro(Nde), to obtain pKK-mz/bro(Xho).

Both chimeric enzymes containing the 1/3 C-terminal region (NdelHindlll fragment) of brownii PPDK in maize PPDK and the chimeric enzyme containing the 1/6C-terminal region (Xhol-Hindl11 fragment) of brownii PPDK in maize PPDK showed low temperature stability as strong as that of brownie. Thus, since low-temperature stability could be assigned to maize PPDK by that amino acid sequence considerably different from that of F.brownii, it was considered that low-temperature stability could be given to PPDK from various plants by introducing the 1/3 region of back or the 1/6 C-terminal region. Because the maize/F.brownii chimeric PPDK prepared in this way contains the transit peptide of the maize PPDK as it is, if a plant has a problem with the transport of PPDK to chloroplasts, where the transit peptide is also originating from in Flaveria brownii it is appreciated that this problem can be overcome by introducing this chimeric gene instead of the original gene from F. brownii.

(3) Point-mutated clones

The amino acid residues of the Xhol-HindIII fragment of PPDK browniis changed one by one from the brownii type to the bidentis type. Similarly, the amino acid residues of the Xhol-HindIII fragment of PPDK-bidentis shifted one by one from the bidentis type to the brownii type. The introduction of the mutation was achieved by subcloning the XhoI-HindIII fragments of the PPDK cDNAs of F. brownii and F. bidentis into pBluescript IISK(-), and then nucleotide substitution by the Kunkel method using the Megalabel kit (commercially available from TAKARA SHUZO) and Mutan- K kit (commercially available from TAKARA SHUZO). The sequence of the primers used to introduce the mutants was shown in Table 2. After confirming the mutated nucleotide sequence by a DNA sequencer, these fragments were inserted into the XholHindlll site of PPDK-bidentis.

§ 605

610

615

620

625

630

635

Table 2

Primers used to prepare point-mutated clones

______ Introduction of mutation from F.brownii type to Fbidentis type 836DE 5'GCAATCTCTTCAGCAATC 839 AG 5'GCTTCTTTTCCAATCCATC 843ED 5'CGAAAAGAAATCGGCTTC 869PQ 5'GAAAGATAAATCTGCAAAAAACTTG 873 SA 5'GCCTTGAGCAAGATAAATC 885 LI 5'TTCTGGTCAATAACCTCAATG 952 VI 5'GCTTAAACAATGACTTGTGC 836ED 5'CCAATCCATCAGCTATTAAAG 839GA b'GC 1 1 U 1 1 1 1 GUAATCTCTTC

640

645

RO 118451 B

Table 2 (continued)

Introducing the mutation from F.brownii type to F.bidentis type 843 DE 5'CGAAAAGAACTCAGCTTC 869QP 5'CAAGATAAATCGGCAAAAACTTG 873 AS 5'GAATGCCTTGAGAAAGATAAATC 885 IL 5'CTTTCTGGTCAAGAACCTCAAATG 952 IV 5'GCTTAAACAACGACTTGTGC

All enzymes in which an amino acid residue in the Xhol-Hindl 11 region of pKK-1110, an amino acid that is different between F.brownii and F.bidentis, has been substituted for the corresponding amino acid residue of the bidentis type show stability at low temperature. Thus, it is believed that there are a multitude of mutations that confer low-temperature stability (since low-temperature stability is not lost only by changing one amino acid residue). Then, enzymes in which an amino acid residue from the Xhol-HindllI region of pKK-bidentis, an amino acid residue that is different between F.brownii and F.bidentis, was substituted for the corresponding browniis-type amino acid residue, were checked to see if they acquired temperature stability low. Thus, the enzyme activity was measured after treatment at 0°C, after 20 min. As a result, by mutating 860Gln—►Pro, the enzyme acquired stability at low temperature (the activity after cold treatment is 60..70% of the initial activity). With the mutation of 885lle-+Leu or 952lle->Val, the loss of activity at low temperature was slightly prevented. Considering these results and the results of the chimeric enzyme described in (1) (pKK-link110), it was assumed that the enzyme acquires stability at low temperature when these mutations coexist. From these results, it was concluded that the three amino acid residues, 869Pro, 185Leu and 952Val are related to low temperature stability. However, among these residues related to the low temperature stability of the brownie, as for 869Pro and 885Leu these residues are of the PPDK brownie type from corn. Therefore, the low temperature stability is not necessarily achieved only by these residues being of brownii type, but these residues are considered to confer complete thermal stability in the PPDK sequence of brownii or bidentis. Therefore, in cases where low-temperature stability must be given to a PPDK originating from a different species, whose amino acid sequence is considerably different from that of brownii or bidentis, it is preferable not to introduce point mutations and prepare a chimeric gene in which the region conferring low temperature stability is inserted as was done for maize PPDK.

Example 4. Treatment of maize with the PPDK gene of Flaveria brownii according to the method of Gordon-Kamm W.J. et al. (The plant Cell 2:603-618, 1990) or Kosier M.G. et al. (Bio/Technology 11:194-200, 1993) fine gold or tungsten particles are coated with pKK-brownies and the coated particles are implanted into immature maize embryo or suspension cell cultures. From the treated cells, the transformants are selected, and the obtained calluses of the transformants are cultivated according to a conventional method, after which plants are regenerated from the calluses. The transformation method is not limited to the particle bombardment method, transformation methods including electroporation (Rhodes C.A. et al., Science 240: 204-207, 1988), the PEG method can be used

RO 118451 Β (Amstrong C.L. et al., Plant Cell reports 9: 335-339,1990), tissue electroporation method (D'Halluin K. Et al., The Plant Cell 4: 1495-1505,1992), method Agrobacterium (Hiei V. and Komari T. WO 9400977) and the like. From the obtained plants, seeds are recovered that germinate to regenerate plants. PPDK is isolated from the leaves of the obtained 695 plants and checked for stability at low temperature. In transformed and non-transformed plants, the effect of temperature on the rate of photosynthesis is verified. Transformation stability is maintained by propagating maize plants exhibiting high photosynthetic rates for several generations and measuring photosynthetic rates at different temperatures, as well as measuring the low-temperature stability of PPDKs isolated from plants. 700

Example 5. Transformation of Flaveria bidentis with the Flaveria brownii PPDK gene

An intermediate vector containing the full-length cDNA shown in SEQ ID NO: 5 and a reporter gene is inserted into a non-virulent Ti plasmid of Agrobacterium tumefaciens. This can be accomplished by the method described in Draper J. et al., editors Plant Genetic Transformation and Gene Expression-a laboratory manual, Blackwell Scientific 705 Publication (ISBN O-632-02172-1).

On the other hand, leaf tissue or callus of Flaveria bidentis becomes infected with Agrobacterium tumefaciens mentioned above. This can be done by culturing the tissue or callus with Agrobacterium tumefaciens. Infected cells are selected based on drug resistance. Whole plants are regenerated from the selected stem by conventional methods. From the obtained plants, seeds are recovered and germinated for plant regeneration. PPDK is isolated from the leaves of the obtained plants and the stability at low temperature is checked. The effect of temperature on the rate of photosynthesis is checked in transformed and non-transformed plants. Transformation stability is maintained by propagating plants exhibiting high rates at low temperature for several generations and by 715 measuring the photosynthetic rates at different temperatures, as well as the low temperature stability, of PPDKs isolated from plants.

RO 118451 B

LIST OF SEQUENCES

SEQ ID NO: 1

SEQUENCE LENGTH: 2915

SEQUENCE TYPE: nucleic acid

SEQUENCE DESCRIPTION:

CGATCTCCTT CTGCTATTGC TGATATCTCA AXTTCACAGG TGAAGAAGG ATG ATG ACT 58

Met Met Ser

TCG TTG TCT GTT GAA GGT ATG CTT CTC AAG TCA GCC CGT GAG ¹ TCG TGC 106 Serum Lion Serum Wave Goofy Gly meth Lion Lion Lys Serum. That Arg Goofy Serum Cys 5 10 15 TTA GCC GCG AGM CTG AAG CAA CGG CGA AAC GTC NECK CTC CGG CGA TTG 154 Lion Pro That Arg Wave Lys Gin Arg Arg Assn Gly Asp Lion Arg Arg Lion 20 25 30 35 AAC CaCl CaCl CGT CAA TCG TCG TTT CTC CGG TCT TTA ACT GCC GCG AGM 202 Assn His His Arg Gin Serum Serum Phew Wave Arg Cys Lion Thr Pro That Arg 40 45 50 GTT AGC AGM Approx GAG TTG CGC AGC ACT GGC TTA ACT GCC GCC CGA GCA 250 Wave Serum Arg Pro Glu Lion Arg Serum Serum Gly Lion Thr Pro Pro Arg That 55 is 65 GTT how AAT GCC CTG TCT CCT GCC GTG ACG ACG GTC AAA AAG AGG GTT 298 Wave Lion Assn Pro Wave Serum Pro Pro Wave Thr Thr That Lys Lys Arg Wave 70 75 80 TTC ACT TTT GGT AAA GGA AGM ACT GAA GGC AAC AGG GAC ATG AAA TCC 346 Phew Thr Phew Gly Lys Gly Arg Serum Goofy Gly Assn Arg Asp meth Lys Serum 85 90 95 TTG TTG GGA GGA AAA GGA GCA AAT CTT GTC GAG and ATG TCA . AGC : att ¹ GGT 394

RO 118451 B

Leo Leo 100 Gly Gly Lys Gly Ala Asn Leu Ala Glu Met Ser Ser lle Gly 760 105 110 115 CTA TCA GTT CCT CCT GGG CTC ACT. ATT TCA ACT < GAA GCA TGT ¹ GAG GAA 442 Lion Serum Wave Pro Pro Gly Lion Thr Ile Serum Thr Goofy That Cys Goofy Goofy 765 120 125 130 DAD CAA CAA AAT GGA AAG AGC CTA CCT Approx GTC TTG TGG NECK GAG ATT 490 Tyre Gin Gin Assn Gly Lys Serum Lion Pro Pro Gly Lion Trp Asp Goofy Ile 770 135 140 145 TCA GAA GGC TTA NECK DAD GTC CAG AAA GAG ATG TCT GCA TCT CTC GTC 538 serum Goofy Gly Lion Asp Tyre Wave Gin Lys Goofy meth Serum That Serum Lion Gly 150 155 160 775 GAC GCC TCT AAA CCT CTC CTC CTT TCC GTC CCT TCG GTC GTC GCC THREAD 586 Asp Pro Serum Lys Pro Lion Lion Lion Serum Wave Arg Serum Gly That That Ile 165 170 175 780 TCT ATG CCT Goth ATG ATG GAC ACT GTA TTG AAT CTC GGG CTT AAT NECK 634 Serum meth Pro Gly meth meth Asp Thr Wave Lion Assn Lion Gly Lion Assn Asp ISO 185 190 195 785 GAG GTC GTA GTC GTC CTA GTC GGC AAA ACT GGA GCA CGG TTT GCC DAD 682 Goofy Wave Wave That Gly Lion That Gly Lys Serum Gly That Arg Phew That Tyre two hundred 205 210 GAC TCG DAD AGM AGG TTT CTC NECK ATG TTT GGC AAC GTT GTA ATG GTC 730 790 Asp Serum Tyre Arg Arg Phew Lion Asp meth Phew Gly Assn Wave Wave meth Gly 215 220 225 ATC GCC HOW TCA TTA TTT GAC GAA AAG TTA . GAG CAG ATG AAA . GTC ' GAA 778 795 Ile Pro His Serum Lion Phew Asp Goofy Lys Lion . Goofy Gin i Met . Lys That and Glu 230 235 240 AAA GGG ATT HOW CTC GAC acc NECK CTC ACT ’ GCT GC1 ' GA1 ' CTI ¹ ΆΆί l THROAT 826

800

RO 118451 B

805 Lys Gly 245 Ile His Leo Asp Thr Asp Leu Thr Ala Ala Asp Leu Lys Asp 250 255 CTT GTT GAG AAA cue AAG AAC GTG DAD GTG GAA GCA. AAG GGC GAA AAG 874 Lion Wave Goofy Lys Tyre Lys Assn Wave Tyre Wave Goofy That Lys Gly Goofy Lys 810 260 265 270 275 TTT CCC ACA NECK Approx AAG AAA CAG CTA GAG TTA GCA GTG AAT GTC GTT 922 Phew Pro Thr Asp Pro Lys Lys Gin Lion Goofy Lion That Wave Assn That Wave 815 280 285 290 TTT NECK TCT TGG GAC AGC Approx AGG GCC AAT AAG cue AGM AGT ATT AAC 970 Phew Asp Serum Trp Asp Serum Pro Arg That Assn Lys Tyre Arg Serum authorities Assn 295 300 305 820 CAG THREAD ACT GGA TTA AAG GGG ACT GCA GTT AAC ATT CAA AGC ATG GTG 1018 Gin authorities Thr Gly Lion Lys Gly Thr That Wave Assn authorities Gin Serum meth Wave 310 315 320 825 TTT GGC AAC ATG GGA AAC ACT TCA GGA ACT GGT GTT CTT TTC ACT AGG 1066 Phew Gly Assn meth Gly Assn Thr Serum Gly Thr Gly Wave Lion Phew Thr Arg 325 330 335 AAC Approx AGC acc GGT GAG AAG AAG CTA cue GGG GAG TTT TTA ATC AAT 1114 830 Assn Pro Serum Thr Gly Goofy Lys Lys Lion Tyre Gly Goofy Phew Lion authorities Assn 340 345 350 355 GTC CAG GGA GAG NECK GTT GTT GTC GGG ATC AGA ACA Approx GAA NECK TTG 1162 835 That Gin Gly Goofy Asp Wave Wave That Gly authorities Arg Thr Pro Goofy Asp Lion 360 365 370 GGG acc ATG GAG ACT TGC ATG CCT NECK GCA . cue l AAA . GAG I CTT GTG GAG 1210 840 Gly Thr meth Goofy Thr Cys meth Pro Asp That Tyr Lys Glu Leo and Val Goofy 375 380 385 AAC TGC GAG ATC TTA GAG GGA > CAC cue : AAA GA1 ' ATG ATG GAT ' ATT GAA 1258

RO 118451 B

Asn Cys Glu Ile Leu Glu Gly His Tyr Lys Asp Met Met Asp Ile Glu 845 & 390 395 400 TTC ACA GTT CAA GAA. CANCER AGG CTT TGG 1 WG TTG CAA TGC ( :yeah. ACA GGG 1306 Phew Thr Wave Gin Goofy. Assn Arg Lion Trp i Leo Gin Cys J \rg Thr Gly 405 410 415 850 AAA. CGT ACT GGT AAA GGT GCA GTG yes ATT GCA CTA ATG NECK GTG AAC 1354 Lys Arg Thr Gly Lys Gly That Wave Arg Xle Ala Val Asp Met Wave Assn 420 425 430 435 855 GAA GGG CTA ATT NECK ACT AGM ACA GCA. ATT AAG AGG GTT GAG ACT CAA 1402 Goofy Gly Lion authorities ASp Thr Arg Thr That Ile Lys Arg Wave Goofy Thr Gin HOW CTA NECK CAG 440 CTT CTT HOW Approx CAG 445 TTT GAG THROAT GCC TCT 450 GTC cue 1450 860 His Lion Asp Gin Lion Lion His Pro Gin Phe Glu Asp Pro Serum That Tyre - 455 460 465 AAA AGC HOW GTG GTA GCA acc GGT TTG CCA GCA TCC CCC GGG GCA GTC 1498 865 Lys Serum His Wave Wave That Thr Gly Lion Pro Ala Ser Pro Gly That That 470 475 480 GTG GGA CAG GTT ALL TTT ACT GCA GAG GAT GCA GAA l ACA TGG repent * GCA 1546 870 Wave Gly Gin Wave Cya Phew Serum That Goofy Asp Ala Glu Thr Trp Hiya > Alas 485 490 495 CAA GGA AAG AGT GTC ATC TTG GTA ► AGG ACC GAA ACi L AGC Approx . GAA THROAT 1594 Gin Gly Lys Serum That authorities Lion Wave Arg Thr Glu Thr Ser Pro > Glu Asp 875 500 505 510 515 GTT GGT GGT ATG in CAT GCA . GCA . GTC 'GGA ATC TTA ACC GCT AGJ L GGA GGC 1642 Wave Gly Gly meth . His That take to take to and Gly Ile Leo Thr Ala Spring jGl; !f Gly 880 520 525 530

ATG ACA TCA CAT

GCA GCG GTG GTG GCT CGC GGA TGG GGC AAA TGT TGT

1690

RO 118451 B

885 Met Thr Ser His Ala Ala Val Val Ala Arg Gly Trp Gly Lys Cya Cys 535 540 545 GTT ICC GOT TOT GCT GAT ATT CGT OTG AAC GAT GAT ATG AAG ATT TTT 1738 890 Val Ser Gly Cys Ala Asp Ile Arg Val Asn Asp Asp Met Lys Ile Phe 550 555 560 ACG ATT GGC GAC COT OTG ATT AAA GAA GGC GAC TGG CTT TCT CTT AAT 1786 895 Thr Ile Gly Asp Arg Val Ile Lys Glu Gly Asp Trp Leu Ser Leu Asn 565 570 575 GOT ACA ACT GOT GAA OTC ATA TTG GOT AAA CAG CTA CTG GCT CCA CCT 1834 900 и Gly Thr Thr Gly Glu Val Ile Leu Gly Lys Gin Leu Leu Ala Pro Pro 580 585 590 595 GCA ATG AGC AAT GAC TTA GAA ATA TTC ATG TCA TGG GCT GAT CAA GCA 1882 them 905 Ala Met Ser Asn Asp Leu Glu Ile Phe Met Ser Trp Ala Asp Gin Ala 600 605 610 AGG COT CTC AAG GTT ATG GCA AAT GCA GAC ACA CCT AAT GAT GCA TTA 1930 910 Arg Arg Leu Lys Val Met Ala Asn Ala Asp Thr Pro Asn Asp Ala Leu 615 620 625 ACA GCC AGA AAC AAT GCT GCA CAA GGG ATC GGG CTC TCT AGA ACT GAA 1978 915 Thr Ala Arg Asn Asn Gly Ala Gin Gly Ile Gly Leu Cys Arg Thr Glu 630 635 640 CAT ATG TTT TTC GCT TCT GAT GAG AGG ATC AAA GCT CTA AGA AAG ATG 2026 920 His Met Phe Phe Ala Ser Asp Glu Arg Ile Lys Ala Val Arg Lys Met 645 650 655 ATC ATG GCG CTC ACT CCA GAA CAA AGA AAA OTG GCT CTA GAT CTC TTA 2074 ! 925 Ile Met Ala Val Thr Pro Glu Gin Arg Lys Val Ala Leu Asp Leu Leu 660 665 670 675 CTC CCA TAC CAA AGA TCC GAT TTT GAG GGC ATT TTC CGA GCA ATG GAT 2122

RO 118451 B

Leu Pro Tyr Gin Arg Ser Asp Phe Glu Gly lle Phe Arg Ala Met Asp 680 685 690=

GGA CTT CCT GTA ACT ATC CGC CTT CTA GAC CCT CCA CTT CAT GAG TTT 2170

Gly Leu Pro Val Thr lle Arg Leu Leu Asp Pro Pro Leu His Glu Phe 695 700705

TTA CCC GAA GCT GAT CTA GAA CAC ATA CTG AAC GAA CTT GCA GTC GAC 2218 935

Leu Pro Glu Gly Asp Leu Glu His Xle Val Aan Glu Leu Ala Val Aap 710 715720

ACA GGC ATG ACT GCA GAT GAA ATC TAT TCA AAA ATC GAA AAT CTA TCT2266

Thr Gly Met Ser Ala Aap Glu lle Tyr Ser Lys lle Glu Asn Leu Ser940

725 730735

GAA GTG AAC CCT ATG CTT GGT TTC CGT GGT TGC AGA TTA GGG ATT TCA2314

Glu Val Asn Pro Met Leu Gly Phe Arg Gly Cys Arg Leu Gly lleSer

945

740 745 750755

TAC CCC GAG CTA ACA GAA ATG CAA GTT CGT GCG ATC TTT CAA GCT GCA2362

Tyr Pro Glu Leu Thr Glu Met Gin Val Arg Ala lle Phe Gin AlaAla

950 760 765770

GTG TCT ATG ACC AAT CAG GGG GTG ACT GTA ATA CCA GAG ATC ATG CTT2410

Val Ser Met Thr Aan Gin Gly Val Thr Val Xle Pro Glu lle Met Val

775 780 785955

CCG TTA CTG GGG ACA CCT CAG GAA TTA CCT CAT CAA ATC AGT GTA ATT2458

Pro Leu Val Gly Thr Pro Gin Glu Leu Arg His Gin lle Ser Val Xle

790 795800

960

CGT GGA CTA GCT GCA AAT GTG TTT GCT GAA ATG GGG GTG ACA TTG GAA 2506

Arg Gly Val Ala Ala Asn Val Phe Ala Glu Met Gly Val Thr Leu Glu ®05 810815

965

TAT AAA CTG GGA ACG ATG ATT GAG ATT CCT CGA GCT GCT TTA ATA GCT 2554

RO 118451 B

970 Tyr Lys Wave 820 Gly Thr Met Ile Glu Ile Pro Arg Ala Ala Leu Ile Ala 825 830 835 GAA GAG ATT GGA AAA GAA GTC NECK TTC TTT TCG TTT GGA acc AAT NECK 2602 Goofy Goofy authorities Gly Lys Goofy That Asp Phew Phew Serum Phew Gly Thr Assn. Asp 975 840 845 850 CTG ACC CAG ATG ACA TTT GGG cue AGC AGM NECK NECK GTT GGC AAG TTT 2650 Lion Thr Gin meth Thr Phew Gly Tyre Serum Arg Asp Asp Wave Gly Lys Phew 855 860 865 980 TTG CAG ATT DAD CTT GTC CAA GGC ATT CTG CAG HOW NECK Approx TTT GAG 2698 Lion Gin authorities Tyre Lion That Gin Gly authorities Lion Gin H1S Asp Pro Phew Goofy 870 875 880 985 GTT ATT GAC CAG AAA GGG GTG GGT CAG TTG ATT AAG ATG GTC ACG GAG 2746 Wave authorities Asp Gin Lys Gly Wave Gly Gin Lion authorities Lys meth That Thr Goofy 885 890 895 990 AAA GGT CGT GCA GCA AAT CCT AAC TTA AAG GTT GGG THREAD TGT GGG GAG 2794 Lys Gly Arg That That Assn Pro Assn Lion Lys Wave Gly authorities cys Gly Goofy 900 905 910 915 HOW GGT GGG GAG CCT TCT TCT GTT GCA TTT TTT NECK GGA GTT GGA CTA 2842 995 Hi s Gly Gly Goofy Pro Serum Serum Wave That Phew Phew Asp Gly Wave Gly Lion 920 925 930 NECK DAD GTG TCG TGC TCT Approx TTT AGG GTT CCT ATC GCA AGG - TTG GCC 2890 1000 Asp Tyre Wave Serum Cys Serum Pro Phew Arg Wave Pro authorities That Arg Lion That 935 940 945 GTC GCA CAA GTC ATT GTT TAAGCT 2915 1005 That That Gin Wave authorities Wave

950

RO 118451 B

SEQ ID NO: 2

SEQUENCE LENGTH: 288o 1010

SEQUENCE TYPE: nucleic acid

SEQUENCE DESCRIPTION:

CGGCGCAGTA GGGGATCGGA AGG ATG GCG GCA TCG GTT TCC AGG GCC ATC TGC 53

Met Ala Ala Ser Val Ser Arg Ala Ile Cys

1 5 10 GTA CAG AAG CCG GGC TCA AAA TGC ACC AGG GAC AGG GAA GCG ACC TCC 101 1020 Wave Gin Lya Pro Gly Ser Lya Cys Thr Arg Asp Arg Glu . Ala Thr Ser 15 20 25 TTC GCC CGC CGA TCG GTC GCA GCG CCG AGG CCC CCG CAC GCC AAA GCC 149 ₁₀₂₅ Phe Ala Arg Arg Ser Val Ala Ala Pro Arg Pro Pro His Ala Lys Ala 30 35 40 CGC CGG CGT CAT CCG CTC CGA CTC CGG CGC GGG ACG GGG CCA CAT TGC 197 Arg Arg Arg His Pro Leo Arg Leo Arg Arg Gly Thr Gly 1030 Pro His Cys 45 50 55 TCG CCG CTG AGG GCC GTC GTT GAC GCC GCG CCG ATA CAG ACG ACC AAA 245 Serum Pro Leo Arg Ala Val Val Asp Ala Ala Pro Xle Gin Thr Thr Lys 1035 60 65 70 AAG AGG GTG TTC CAC TTC GGC AAG GGC AAG AGC GAG GGC AAC AAG ACC 293 Lys Arg Val Phe His Phe Gly Lys Gly Lys Ser Glu Gly Asn Lys Thr i ₀₄ 0 75 80 85 90 ATG AAG GAA CTG CTG GGC GGC AAG GGC GCG AAC CTG GCG GAG ATG GCG 341 Met Lya Glu Leo Leo Gly Gly Lys Gly Ala Asn Leu Ala Glu Met Ala 1045 95 100 105 AGC ATC GGG CTG TCG GTG CCG CCA GGG TTC ACG GTG TCG î ACG GAG GCG 389 Gly sterils Leo Ser Val Pro Pro Gly Phe Thr Val Ser Thr Glu Ala

1050

RO 118451 B

110 115 120 1055 TGC CAG CAG cue CAG < GAC < GCC i GGG' GTC 1 SCC 1 CTC CCC v ICG GGG < CTC 1 CGG 437 Cys Gin Gin Tyre Gin. Aap j May Gly' Cys J Me: Lion Pros 1 Me Gly Leo' Fr 125 130 L35 1060 GCC GAG ATC CTC GAC GGC CTG CAG TGG GTG GAG GAG' CAP ATG GGC । GCC 4B5 That Goofy authorities Wave Aap Gly Lion Gin Trp Wave Goofy G1U' ryr meth Gly. Me 140 145 150 1065 acc CTG GGC NECK GCC CAG CGC GCC CTC CTG CTC TCC CTC CGC TCC GGC 533 Thr Lion Gly Aap Pro Gin Arg Pro Lion Lion Lion Serum Wave Arg Serum Gly 155 160 165 170 GCC GCC CTG TCC ATG CCC GGC ATG ATG GAC ACG GTG CTC AAC CTG GGG 581 1070 That That Wave Serum meth Pro Gly meth meth Aap Thr Wave Lion Aan Lion Gly 175 180 185 CTC AAC GAC GAA GTG GCC GCC GGG CTG GCG GCC AAG AGC GGG GAG CGC 629 1075 Lion Aan Aap Goofy Wave That That Gly Lion That That Lys Serum Gly Goofy Arg 190 195 two hundred TTC GCC cue GAC TCC TTC CGC CGC TTC CTC GAC ATG TTC GGC AAC GTC 677 Phew That Tyre Aap serum Phew Arg Arg Phew Lion Aap meth Phew : Gly Aan wave 1080 205 210 215 GTC ATG GAC ATC CCC CGC TCA CTG TTC GAA . GAG AAG CTT 'GAG CaCl ATG 725 Wave meth Aap authorities Pro Arg Serum Lion Phew Goofy . Goofy l Lys Lion and Glu His meth 1085 220 225 230 AAG GAA TCC AAG GGG CTG AAG and AAC GAC acc ! GAC : ctc ACG GCC : tct GAC 773 Lys Goofy Serum Lys Gly Lion Lys Assn Aap Thr Ass > Leo Thr Ala and Ser Aap 1090 235 240 245 250 CTC AAA . GAG CTC GTG ggt CAG и TAC : AAG r GAC ; GTC TAC : CTC TCJ in GCC : AAG 821 Lion Lys Goofy . Lion Wave Gly ’ Gir and Tyr Lys 1 Glu Va: 1 Tyr Leo Shei c Ala and Lys

RO 118451 B

GGA GAG 255 260 265 1095 CCA TTC CCC TCA GAC CCC AAG AAG CAG CTG GAG CTA GCA GTG 869 Gly Goofy Pro Phew Pro Serum Asp Pro Lys Lys Gin Lion Goofy Lion That Wave 270 275 280 CTG GTC GTG TTC AAC TCG TGG GAG AGC CCC AGG GCC AAG AAG cue AGG 917 1100 Lion That Wave Phew Assn serum Trp Goofy Serum Pro Arg That Lys Lys Tyre Arg 285 290 295 AGC ATC AAC CAG ATC ACT GGC CTC AGG GGC acc GCC GTG AAC GTG CAG 965 1105 Serum authorities Assn Gin authorities Thr Gly Lion Arg Gly Thr That Wave Assn Wave Gin 300 305 310

TGC ATG GTG TTC GGC AAC ATG GGG AAC ACT TCT GGC ACC GGC GTG CTC 1013 1110 Cys Met Val Phe Gly 315 Asn Met Gly Asn Thr Ser Gly Thr Gly Val Leu 320 325 330 TTC ACC AGG AAC CCC AAC ACC GGA GAG AAG AAG CTG TAT GGC GAG TTC 1061 Phe Thr Arg Asn Pro 335 Asn Thr Gly Glu Lys Lys Leu Tyr Gly Glu Phe 340 345 1115 CTG GTG AAC GCT CAG GOT GAG GAT GTG GTT GCC GGA ATA AGA ACC CCA 1109 Leo Val Asn Ala Gin 350 Gly Glu Asp Val Val Ala Gly Ile Arg Thr Pro 355 360 1120 GAG GAC CTT GAC GCC Glu Asp Leu Asp Ala 365 ATG AAG AAC CTC ATG CCA CAG GCC TAC GAC GAG Met Lys Asn Leu Met Pro Gin Ala Tyr Asp Glu 370 375 1157 1125 CTT GTT GAG AAC TGC Leu Val Glu Asn Cys 380 AAC ATC CTG GAG AGC CAC TAC AAG GAA ATG CAG Asn Ile Leu Glu Ser His Tyr Lys Glu Met Gin 385 390 1205 1130 GAT ATC GAG TTC ACT Asp Ile Glu Phe Thr GTC CAG GAA AAC AGG CTG TGG ATG TTG CAG TGC Val Gin Glu Asn Arg Leu Trp Met Leu Gin Cys 1253

RO 118451 Β 1135 395 400 405 410

Η AGG ACA GGG AAA COT ACG GGC AAA AGT GCC OTG AAG ATC GCC GTG GAC 1301 Arg Thr Gly Lys Arg Thr Gly Lys Ser Ala Val Lys lle Ala Val Asp 1140 415 420 425 j ATG GTT AAC GAG GGC CTT GTT GAG CCC CGC TCA GCG ATC AAG ATG OTA 1349

Met Val Asn Glu Gly Leu Val Glu Pro Arg Ser Ala lle Lys Met Val j ¹¹⁴⁵ 430 435440

GAG CCA GGC CAC CTG GAC CAG CTT CTT CAT CCT CAG TTT GAG AAC CCG1397

Glu Pro Gly His Leu Asp Gin Leu Leu His Pro Gin Phe Glu AsnPro

1150 ^{445 450455}

TCG GCG TAC AAG GAT CAA GTC ATT GCC ACT GOT CTG CCA GCC TCA CCT1445 j Ser Ala Tyr Lys Asp Gin Val lle Ala Thr Gly Leu Pro Ala Ser Pro

460 465470

1155 j GGG GCT GCT GTG GGC CAG GTT OTG TTC ACT GCT GAA GAT GCT GAA GCA 1493

Gly Ala Ala Val Gly Gin Val Val Phe Thr Ala Glu Asp Ala Glu Ala *75 480 485490

1160 TGG CAT TCC CAA GGG AAA GCT GCT ATT CTG OTA AGG GCG GAG ACC AGC 1541 Trp His Ser Gin Gly Lys Ala Ala lle Leu Val Arg Ala Glu Thr Ser 495 500505

CCT GAG GAC GTT GOT GGC ATG CAC GCT GCT GTG GGG ATT CTT ACA GAG 1589 1103 Pro Glu Asp Val Gly Gly Met His Ala Ala Val Gly lle Leu Thr Glu 510 515 520

AGG GGT GGC ATG ACT TCC CAC GCT GCT GTG GTC GCA CGT TGG TGG GGG 1637 1170 Arg Gly Gly Met Thr Ser His Ala Ala Val Val Ala Arg Trp Trp Gly i 525 530 535

AAA TGC TGC GTC TCG GGA TGC TCA GGC ATT CGC OTA AAC GAT GCG GAG 1685

1175

Lys Cys Cys Val Ser Gly Cys Ser Gly lle Arg Val Asn Asp Ala Glu

RO 118451 B

540 545 550 AAG CTC GTG. ACG: ATC GGA AGC i CAT < TTG ( CTG GTC ( 3a GCT । GAG 1 PGG i CTG 1733 1180 Lys Lion Wave Thr authorities Gly Serum: His ¹ / of : Leo; Arg Glu Gly Glu' Crp Lion 555 560 565 570 TCG CTG AAT GGG TCG ACT GTC GAG i GTG. ATC CTT i GGG AAG CAG CCG CTT 1781 Serum Lion Aan Gly Serum Thr Gly Goofy wave authorities Leo' Gly Lys Gin: Pro Lion 1185 575 580 585 TCC Approx Approx GCC CTT ACT GTC NECK CTG GGA ACT' TTC ATG GCC TGG CTG 1829 Serum Pro Pro That Lion Serum Gly Asp Lion Gly Thr Phew meth That Trp Wave 1190 590 595 600 NECK NECK GTT AGM AAG CTC AAG CTC CTG GTC AAC GCC NECK acc CCT NECK 1877 Asp Asp Wave Arg Lya Lion Lys Wave Lion That Assn That Asp Thr Pro ASP 605 610 615 1195 NECK GCA TTG ACT GCG CGA AAC AAT GGG GCA CAA GGA ATT GGA TTA TGC 1925 Asp That Lion Thr That Arg Assn Assn Gly That Gin Gly authorities Gly Lion Cys 620 625 630 1200 CGG ACA GAG CaCl ATG TTC TTT GTC TCA GAC GAG AGG ATT AAG GTC GTC 1973 Arg Thr Goofy His meth Phew Phew That Serum Asp Goofy Arg authorities Lys That Wave 635 640 645 650 1205 AGG CAG ATG ATT ATG GTC CCC ACG CTT GAG CTG AGG CAG CAG GCG CTC 2021 Arg Gin meth authorities meth That Pro Thr Lion Goofy Lion Arg Gin Gin That Lion 655 660 665 GAC CGT CTC TTG ACG DAD CAG AGG TCT GAC TTC GAA . GGC : att TTC : CCT 2069 1210 Asp Arg Lion Lion Thr Tyre Gin Arg Serum Asp Phew Goofy in Gly Ile Phew ! Arg 670 675 680 GTC ATG NECK GGA CTC GCC GTG f ACC ATC : CGP l CTC CTC ; GAC : quantity Bcc • TCT 2117 1215 That meth Asp Gly Lion Pro Wave Thr authorities and Arg 1 Ron and Lions 1 Asj ) lol and Prc > Ser

RO 118451 B

1220 685 690 695 cue GAG TTC CTT Approx GAA GGG AAC ATC GAG GAC ATT GTA AGT GAA ¹ ΓΤΑ 2165 Tyre Goofy Phew Lion Pro Goofy Gly Assn Ile Goofy. Asp Ile Wave Serum Goofy Lion 700 705 710 1225 TGT GTC GAG ACG GGA GCC AAC CAG GAG NECK GCC CTC GCG CGA ATT GAA 2213 Cys That Goofy Thr Gly That Assn Gin Goofy Asp That Lion That Arg Ile Goofy и ! 715 720 725 730 1230 AAG CTT TCA GAA GTA AAC GCC ATG CTT GGC TTC CGT GGG TGC AGG CTT 2261 Lys Lion Serum Goofy Wave Assn Pro meth Lion Gly Phew Arg Gly Cys Arg Lion 735 740 745 1235 GGT THREAD TCG cue CCT GAA TTG ACA GAG ATG CAA GCC CGG GCC ATT TTT 2309 4 Gly Ile Serum Tyre Pro Goofy Lion Thr Goofy meth Gin That Arg That Ile Phew 750 755 760 и 1240 GAA GTC GTC THREAD GCA ATG acc AAC CAG GGT GTT CAA GTG TTC Approx GAG 2357 Goofy That That Ile That meth Thr Assn Gin Gly Wave Gin Wave Phew Pro Goofy 765 770 775 THREAD ATG GTT CCT CTT GTT GGA ACA Approx CAG GAA CTG GGG HOW CAA GTG 2405 1245 Ile meth Wave Pro Lion Wave Gly Thr Pro Gin Goofy Lion Gly His Gin Wave and 780 785 790 ACT CTT ATC CGC CAA GTT GTC GAG AAA GTG TTC GCC AAT GTG GGC AAG 2453 1250 Thr Lion Ile Arg Gin Wave That Goofy Lys Wave Phew That Assn wave Gly Lys 795 800 805 810 ACT ATC GGG cue AAA GTT GGA ACA ATG ATT GAG ATC CCC AGG GCA GTC 2501 1255 Thr Ile Gly Tyre Lys 815 Wave Gly Thr meth Ile 820 Goofy Ile Pro Arg That B25 That CTG GTG GTC NECK GAG THREAD GCG GAG CAG GTC GAA . TTC ! TTC TCC TTC GGA 2549 Lion Wave That Asp Goofy Ile That Goofy Gin That Goofy . Phew and Phe : Ser Phew Gly

и I

RO 118451 B

830 835 840 ACG AAC GAC CTG ACG 1260 CAG ATG ACC TTT GGG TAC AGC AGG GAT GAT GTG 2597 Thr Asn Asp Leu Thr Gin Met Thr Phe Gly Tyr Ser Arg Asp Asp Val 845 850 855 GGA AAG TTC ATT CCC GTT CAT CTT GCT CAG GGC ATC CTC CAA CAT GAC 2645 ¹²⁶⁵ Gly Lys Phe lle Pro Val His Leu Ala Gin Gly lle Leu Gin His Asp 860 865 870 CCC TTC GAG GTC CTG GAC CAG AGG GGA GTG GGC GAG CTG GTG AAG TTT 2693 1270 Pro Phe Glu Val Leu Asp Gin Arg Gly Val Gly Glu Leu Val Lys Phe 875 880 885 890 GCT ACA GAG AGG GGC CGC AAA GCT AGG CCI AAC TTG AAG GTG GGC ATT 2741 1275 Ala Thr Glu Arg Gly Arg Lys Ala Arg Pro Asn teu Lys Val Gly lle 895 900 905 ALL GGA GAA CAC GGT GGA GAG CCT TCG TCT GTG GCC TTC TTC GCG AAG 2789 Cys Gly Glu His Gly Gly Glu Pro Ser Ser Val Ala Phe Phe Ala Lys ¹²⁸⁰ 910 915 920 GCT GGG CTG GAT TTC TCT TGC TCC CCT TTC AGG GTT CCG ATT GCT 2837 Ala Gly Leu Asp Phe Val Ser Cys Ser Pro Phe Arg Val Pro lle Ala 1285 925 930 935 AGG CTA GCT GCA GCT CAG GTG CTT GTC TGAGGCTGCC TCCTCG 2880 Arg Leo Ala Ala Ala Gin Val your Val 1290 940 945

SEQ ID NO: 3

SEQUENCE LENGTH: 261o

SEQUENCE TYPE; nucleic acid

SEQUENCE DESCRIPTION:

RO 118451 B

GAATTCTCAA TCCTTTGCTC ATCGCAGCAT ATCAATGTTA ACACATAAAC TTTAGGAGGA 60

AGAAAACTT ATG GCA AAA TGG GTT TAT AAG TTC GAA GAA GGC AAT GCA TCT 111

Met Ala Lys Trp Val Tyr Lys Phe Glu Glu Gly Asn Ala Ser

1 5 10 ATG AGM AAC CTT CTT GGA GGC AAA GGC TGC AAC CTT GCA GAG ATG ACC 159 meth Arg Aan Lion Lion Gly Gly Lys Gly Cya. Assn Lion. That Glu: meth Thr 15 20 25 30 ATC TTA GGA ATG GCC ATT Approx CAG GGC TTT ACT GTA THAT THAT THAT GAA GTC 207 Xle Lion Gly meth Pro authorities Pro Gin Gly Phew Thr Wave Thr Thr Goofy That 35 40 45 TGT ACA GAG cue cue AAC AGT GGA AAA CAG ATC ACA CAG GAA ATT CAG 255 Cya Thr Goofy Tyre Tyre Aan Serum Gly Lya Gin authorities Thr Gin Goofy authorities Gin 50 55 60 NECK CAG ATT TTC GAA GTC ATC ACA TGG TTA GAG GAA CTG AAC GGC AAG 303 Aap Gin authorities Phew Goofy That authorities Thr Trp Lion Goofy Goofy Lion Assn Gly Lys £5 70 75 AAG TTC GGC GAC ACT GAA NECK GCC TTA TTA GTA TCT GTA CGT TCC GCG 351 Lys Phew Gly Aap Thr Goofy Aap Pro Lion Lion Wave Serum Wave Arg Serum That 80 85 90 GCC CGC GCA TCC ATG GCC GGT ATG ATG NECK acc ATC CTG AAC CTT GGT 399 That Arg That Serum meth Pro Gly meth meth Asp Thr authorities Lion Assn Lion Gly 95 100 105 110 TTA AAC GAC GTT GCA GTA GAG GGC TTT GCA AAG AAA ACG GGA AAT Approx 447 Lion Aan Asp Wave That Wave Goofy Gly Phew That Lys Lys Thr Gly Assn Pro 115 120 125 AGM TTT GCA DAD NECK TCT cue AGM AGM . TTT ATC : CAG - ATG DAD TCC GAC 495

Arg Phe Ala Tyr Asp Ser Tyr Arg Arg Phe Ile Gin Met Tyr Ser Aap

RO 118451 B

130

135

140

1340

GTA GTT ATG GAA GTT GCC AAG TCC HOW TTC GAG AAA ATC. ATC NECK GCG 543 Wave Wave meth Goofy Wave Pro Lys Serum His Phew Goofy Lys authorities authorities Asp. That 145 150 155 1345 ATG AAA GAA GAA AAG GGC GTT CaCl TTC NECK ACA GAC CTG ACT GCC NECK 591 meth Lys Goofy Goofy Lys Gly Wave His Phew Asp Thr Asp Lion Thr That Asp 160 165 170 1350 NECK TTA AAA GAG CTG GTC GAG AAG TTC AAA GTC GTT cue AAA GAG GTC 639 Asp Lion Lys Goofy Lion That Goofy Lys Phew Lys That Wave Tyre Lys Goofy That 175 180 185 190 ATG AAC GGC GAA GAG TTC Approx CAG GAG GCC AAG NECK CAG TTA ATG GGC 687 1355 meth Assn Gly Goofy Goofy Phew Pro Gin Goofy Pro Lys Asp Gin Lion meth Gly 195 two hundred 205 GTC GTT AAA GCA GTT TTC CGT TCC TGG GAC AAC CCT CGT GCA ATC GTA 735 1360 That Wave Lys That Wave Phew Arg Serum Trp Asp Assn Pro Arg That authorities Wave 210 215 220 cue CGC CGT ATG AAC NECK ATC CCT GGA GAC TGG GGT ACT GCA GTT AAC 783 1365 Tyr Arg Arg meth Assn Asp authorities Pro Gly Asp Trp Gly Thr That Wave Assn 225 230 235 GTT CAG acc ATG GTA TTT GGT AAC AAG GGC GAG acc AGC GGT ACA GGC 831 Wave Gin Thr meth Wave Phew Gly Assn Lys Gly Goofy Thr Serum Gly Thr Gly 1370 240 245 250 GTT GCC TTC ACA CGT AAC Approx TCC ACA GGT GAA AAA GGC ATC cue GGT 879 Wave That Phew Thr Arg Assn Pro Serum Thr Gly Goofy Lys Gly authorities Tyre Gly 1375 255 260 265 270 GAG cue CTG ATC AAT GCA CAG GGC GAG GAC GTA . GTT GCA l GGT GTC CGC 927

Glu Tyr Leu Ile Asn Ala Gin Gly Glu Asp Val Val Ala Gly Val Arg

1380

RO 118451 B

275

280

285

ACA Approx CAG CCT ATC acc CAG TTA GAG. AAC NECK ATG CCT GAC TGC cue 975 1385 Thr Pro Gin Pro Ile Thr Gin Lion Goofy. Assn Asp meth Pro Asp Cys Tyre 290 295 300 AAG CAG TTC ATG NECK CTG GCC ATG AAG CTG GAG AAA HOW TTC CGT GAC 1023 Lys Gin Phew meth Asp Lion That meth Lys Lion Goofy Lys His Phew Arg Asp 1390 305 310 315 ATG CAG NECK ATG GAG TTC ACA ATC GAG GAA GGT AAA TTA cue TTC TTA 1071 meth Gin Asp meth Goofy Phew Thr Ile Goofy Goofy Gly Lys Lion Tyre Phew Lion 1395 320 325 330 CAG ACA CGT AAC GGC AAG AGM ACA GTC GCC GTC GTC CTT CAG ATT GCC 1119 Gin Thr Arg Assn Gly Lys Arg Thr That Pro That That Lion Gin Ile That 1400 335 340 345 350 TGC NECK TTA GTA GAC GAA GGC ATG ATC ACA GAG GAA GAG GTC GTT GTA 1167 Cya Asp Lion Wave Asp Goofy Gly meth Ile Thr Goofy Goofy Goofy That Wave Wave 355 360 365 1405 AGM ATC GAA GCA AAA TCT CTT NECK CAG TTA CTT CaCl GCC acc TTC AAC 1215 Arg Ile Goofy That Lys Serum Lion Asp Gin Lion Lion His Pro Thr Phew Assn 370 375 380 1410 GCC GTC GTC TTA AAG GCC GGC GAA GTA ATC GGT TCC GTC CTT GCC GCA 1263 Pro That That Lion Lys That Gly Goofy Wave Ile Gly Serum That Lion Pro That 385 390 395 1415 TCT CCT GGC GCA GCA GCA GGT AAA GTA cue TTC acc GTC NECK GAG GTC 1311 Serum Pro Gly That That That Gly Lys Wave Tyre Phew Thr That Asp Goofy That 400 405 410 AAG GTC GCC CaCl GAG AAG GGT GAG AGM GTT ATC CTT GTT CGT CTT GAG 1359 1420 Lys That That His Goofy Lys Gly Goofy Arg Wave Ile Lion Wave Arg Lion Goofy

RO 118451 B

415 420 425 430 ACA. TCT GCC GAA NECK ATC GAA GGT. ATG । HOW GCA i GCC < GAA GGT. ATC CTG 1407 Thr Serum Pro Goofy Asp Ile Goofy Gly: meth His. Alas; Ala < Goofy Gly Ile Lion 1425 435 440 445 ACA GTG CGC GGC GGT ATG ACA AGC HOW GCA GCC GTA GTT GCA CGT GGT 1455 Thr Wave Arg Gly Gly meth Thr Serum His That That Wave Wave That Arg Gly 1430 450 455 460 ATG GGA ACA TGC TGC GTA TCC GGA TGC GGT GAG ATC AAG ATC AAC GAA 1503 meth Gly Thr Cys Cys Wave Serum Gly Cys Gly Goofy Ile Lys Ile Assn Goofy 1435 465 470 475 GAA GTC AAG ACA TTC GAA CTT GGC GGA CaCl ACA TTT GCA GAG GGA NECK 1551 G1U That Lys Thr Phew Goofy Lion Gly Gly His Thr Phew That Goofy Gly Asp 480 485 490 1440 cue ATC TCC TTA NECK GGT TCC ACA GGT AAG ATT cue AAG GGC GAC ATC 1599 Tyre Ile Serum Lion Asp Gly Serum Thr Gly Lys Ile Tyre Lys Gly Asp Ile 495 500 505 510 1445 GAG ACT CAG GAA CGT TCC GTA AGC GGA AGC TTC GAG CGT ATC ATG GTA 1647 Goofy Thr Gin Goofy Arg Serum Wave Serum Gly Serum Phew Goofy Arg Ile meth Wave 515 520 525 1450 TGG GTC GAC AAG TTC AGM ACA TTA AAG GTT CGT ACA AAT GCC GAC ACA 1695 Trp That Asp Lys Phew Arg Thr Lion Lys Wave Arg Thr Assn That Asp Thr 530 535 540 GCC GAA NECK AGM CTC AAT GCC GTT AAA CTG GGT GCA GAG GGC : ATC GGT 1743 1455 Pro Goofy Asp Thr Lion Assn That Wave Lys Lion Gly That Goofy and Gly lle Gly 545 550 555 CTT TGC CGT ACA GAG HOW ATG TTC TTC GAG f GCT GAC : AGJ L ATC ATG AAG 1791 1460 Lion Cys Arg Thr Goofy His meth Phew Phew : Goofy take to Asp ' Spring [lle s Met Lys

RO 118451 B

1465 560 565 570 ATC AGM AAG ATG ATC CTT TCC NECK TCA GTG GAA GCA. AGM GAA GAG GTC 1839 Ile Arg Lys meth Ile Lion Serum Asp Serum Wave G1U Alas; Arg Goofy Goofy. That 575 580 585 590 1470 CTG AAC GAA TTA ATC GCC TTC CAG AAG GGC NECK TTC. AAG GTC ATG cue 1887 Lion Assn Goofy Lion Ile Pro Phew Gin Lys Gly Asp Phew Lys That meth Tyre 595 600 605 1475 AAA GTC CTG GAA GGC AGG CCA ATG ACG GTT CGC cue CTG NECK GCC GCC 1935 Lys That Lion Goofy Gly Arg Pro meth Thr Wave Arg Tyre Lion Asp Pro Pro 610 615 620 1480 CTG HOW GAG TTC GTT CCT HOW ACA GAA GAG GAG CAG GTC GAA CTG GTC 1983 Lion His Goofy Phew Wave Pro His Thr Goofy Goofy Goofy Gin That Goofy Lion That 625 630 635 AAG AAC ATG GGC CTT ACT TTA GCA GAA GTA AAA GCA AAA GTT GAC GAA 2031 1485 Lys Assn meth Gly Lion Thr Lion That Goofy Wave Lys That Lys Wave Asp Goofy 640 645 650 TTA CaCl GAG TTC AAC Approx ATG ATG GGC HOW CGT GGC TGC CGT CTT GCA 2079 1490 Lion His Goofy Phew Assn Pro meth meth Gly His Arg Gly Cys Arg Lion That 655 660 665 670 GTT acc DAD GCC GAA ATT GCA AAG ATG CAG ACA AGM GCC GTT ATG GAA 2127 1495 Wave Thr Tyre Pro Goofy Ile That Lys meth Gin Thr Arg That Wave meth Goofy 675 680 685 GTC GTC ATC GAA GTG AAG GAA GAG ACA GGA ATC NECK ATT GTT CCT GAG 2175 1500 That That Ile Goofy Wave Lys Goofy Goofy Thr Gly Xle Asp Ile Wave Pro Goofy 690 695 700 ATC ATG ATT GCC TTA GTT GGC GAG AAG AAA . GAG ) CTT AAG and TTC ; GTT ¹ AAG 2223

lle Met lle Pro Leu Val Gly Glu Lys Lys Glu Leu Lys Phe Val Lys

RO 118451 B

705 710 715 GAC GTA GTT GTG GAA GTA GCT GAG CAG i GTT AAG AAA GAG AAA GGT TCC 2271 Asp Wave Wave Wave Glu Wave Ala Glu Gin' Val Lys Lys Glu Lys Gly Ser 720 725 730 NECK ATG CAG TAC CAC ATC GGT ACC ATG ATC GAA ATT CCT CGT GCA GCT 2319 Asp Met Gin Tyr His lle Gly Thr Met lle Glu lle Pro Arg Ala Ala 735 740 745 750 CTC ACA GCA GAT GCC ATC GCT GAG GAA GCA GAG TTC TTC TCC TTC GGT 2367 Lion Thr Ala Asp Ala lle Alas Glu Glu Ala Glu Phe Phe Ser Phe Gly 755 760 765 ACA AAC GAC TTA ACA CAG ATG ACA TTC GGC TTC TCC CGT GAC GAC GCC 2415 Thr Asn Asp Leu Thr Gin Met Thr Phe Gly Phe Ser Arg Asp Asp Ala 770 775 780 GGC AAG TTC CTG GAT TCC SHUT TAT AAAA GCA AAA ATT TAT GAG TCC GAT 2463 Gly Lys Phe Leu Asp Ser Tyr Tyr Lys Ala Lys lle Tyr Glu Ser Asp 785 790 795 Approx TTC GCA AGM CTT GAC CAG ACA GGC GTT GGC CAG TTA GTA GAG ATG 2511 Pro Phe Ala Arg Leu Asp Gin Thr Gly Val Gly Gin Leu Val Glu Met 800 805 810 GCA GTT AAG AAA GGC CGT CAG ACA CGT CCG GGC CTT AAG TGC GGC ATC 2559 That Wave Lys Lys Gly Arg Gin Thr Arg Pro Gly Leu Lys Cys Gly lle 815 820 825 830 TGC GGC GAG CAC GGC GAG ATC CTT CTT CCG TAGAGTTCTG CCACAAAGTA 2609 Cys Gly Glu His Gly Glu lle Leo Leo . Pro

835 840

1505

1510

1515

1520

1525

1530

1535

1540

2610

RO 118451 B

SEQ ID NO: 4

SEQUEL LENGTH: 2722

SEQUENCE TYPE: nut eic acid

SEQUENCE DESCRIPTION:

GAACTATTTA AGGAATTTGT AAGAATTTAG AGTTCATTCA GATAATA ATG CAA AGA Met Gin Arg 56 1 GTA TAI GCT TTC GAA GAT GGT GAT GGA ACC AAC AAG . AAA CTC CTT GGA 104 Val Tyr Ala Phe Glu Asp Gly Asp Gly Thr Asn Lys Lys Leu Leu Gly ⁵ 10 15 GGA AAG GGA GCT GGA CTT TGC ACA ATG ACA AAA ATT GGA CTT CCA GTT 152 Gly Lys Gly Ala Gly Leu Cys Thr Met Thr Lys Ile Gly Leo Pro Val 20 25 30 CCA CAA GGA TTT GTT ATT ACA ACT GAA ATG TOT AAA 35 CAA TTC ATT GCT two hundred Pro Gin Gly Phe Val Xle Thr Thr Glu Met cys Lys Gin Phe Xle Ala 40 45 AAT GGA AAC AAA ATG CCA GAA GGA TTA ATG GAA GAA 50 GTT AAA AAA GAA 248 Asn Gly Asn Lys Met Pro Glu Gly Leu Met Glu Glu Val Lys Lys Glu 55 60 TAT CAA TTA GTT GAA AAG AAA TCA GGA AAA OTC TTT 65 GGA GGA GAA GAA 296 Tyr Gin Leu Val Glu Lys Lys Ser Gly Lys Val Phe Gly Gly Glu Glu 70 75 AAT CCA CTT CTT GTT TCA GTC AGA TCA GGA GCT GCT 80 ATG TCT ATG CCA 344 Asn Pro Leu Leu Val Ser Val Arg Ser Gly Ala Ala Met Serum Met Pro 85 90 95 GGT ATG ATG GAT ACT ATT CTT AAT CTT GGA CTT AAT GAT AAA ACT GTT 392

Gly Met Met Asp Thr Ile Leu Asn Leu Gly Leu Asn Asp Lys Thr Val

RO 118451 B

100 105 110 115 GTT GTC CTT GTC AAA VAT. ACC j MC j hAT । GAA. AGM TTT · 3CA TAT 1 NECK ¹ TCA 440 1590 Wave That Lion That Lys Lion Thr; inn; Aan' Goofy Arg Phe Ala Tyr Aap Serum 120 125 130 cue AGM AGM TTT GTT TCC CTC TTC GGA AAG ATT GTC CTT j hAT GTC TGT 488 1595 Tyre Arg Arg Phew Wave Serum Lion Phew Gly Lya authorities That Leo; inn That Cys 135 140 145 NECK GAA GTT DAD NECK AAG ACT CTT GAA AAC AAA AAA GTT GAA AAG GGA 536 Asp Goofy Wave Tyre Aap Lys Thr Lion Goofy Aan Lya Lys Wave Goofy Lya Gly 1600 150 155 160 GTT AAA TTA NECK ACT GAA TTA NECK GTC AAT NECK ATG AAA GAA CTT GCA 584 Wave Lys Lion Aap Thr Goofy Lion Aap That Assn Aap meth Lya Goofy Lion That 1605 165 170 175 CAA GTC TTC ATT AAA AAG ACT GAA GAA TTC ACT AAA CAA Approx TTC Approx 632 Gin Wave Phew authorities Lys Lya Thr Goofy Goofy Phew Thr Lys Gin Pro Phew Pro 1610 180 185 190 195 GTT NECK Approx DAD GTC CAA TTA GAA TTT GCC ATT TGT GTC GTA TTC AGM 680 Wave Aap Pro Tyre That Gin Lion Goofy Phew That authorities Cys That Wave Phew Arg two hundred 205 210 1615 TCA TGG ATG GGA AAG AGM GTC GTT NECK cue AGM AGM GAA TTC AAG ATT 728 Serum Trp meth Gly Lya Arg That Wave Aap Tyr Arg Arg Goofy Phew Lys authorities 215 220 225 1620 ACT Approx GAA CAA GTC NECK GGA ACT GTC GTT TCA . GTT GTT TCT ATG and GTT 776 Thr Pro Goofy Gin That Aap Gly Thr That Wave Sex Wave Wave Serum meth Wave 230 235 240 1625 DAD GGT AAT ATG GGT AAT NECK TCA . GTC ¹ HERE * GGl ’ GTT TGT TTC ! needles AGM 824 Tyre Gly Assn meth Gly Assn Aap Serum That . Thr Glj r Wave . Cya Phe Thi : Arg

RO 118451 B

1630 245 250 255 THROAT i CCA GGA AGM GGA GAA AAT ATG TTC TTC GGA GAA TAT CTT AAG AAT 872 Asp Pro Gly Thr Gly Glu Asn Met Phe Phe Gly Glu Tyr Leu Lys Asn 260 265 270 275 ¹⁶³⁵ GCA CAA GGA GAA THROAT GTT GTT GCT GGT ATT AGA ACA CCA CAA ATT ATT 920 That Gin Gly Glu Asp Wave Wave Ala Gly Ile Arg Thr Pro Gin Ile Ile 280 285 290 1640 TCA AAG ATG GCA GAA GAT CGA GAT CTT CCA GGT TGC TAT GAA CAA CTT 968 Serum Lys Met Ala Glu Asp Arg Asp Leu Pro Gly Cys Tyr Glu Gin Leu 295 300 305 CTT 1645 NECK ATT AGA AAG AAA TTA GAA GGA TAT TTC CAT GAA GTA CAA GAC 1016 Lion Asp Ile Arg Lys Lys Leo Glu Gly Tyr Phe His Glu Val Gin Asp 4 310 315 320 TTT GAA TTC ACT ATT GAA AGA AAG AAA CTT TAC ATG CTC CAA ACT AGA 1064 j ¹⁶⁵⁰ n. Glu Phe Thr Ile Glu Arg Lys Lys Leu Tyr Met Leu Gin Thr Arg 325 330 335 AAT GGA AAG ATG AAT GCA ACT GCT ACT GTC AGA ACA GGA GTT GAT ATG 1112 1655 Gly Lys Met Asn Ala Thr Ala Thr Val Arg Thr Gly Val Asp Met 340 345 350 355 и GTT GAA GAA GGA CTT ATT ACA AAA GAA CAA GCC ATT ATG AGA ATT GCA 1160 Wave Glu Glu Gly Leo Ile Thr Lys Glu Gin Ala Ile Met Arg Ile Ala 1660 360 365 370 Approx CAA TCA GTT NECK CAA TTA CTT CAT AAG AAT ATG CCA GCT AAT TAT 1208 Pro Gin Ser Val Asp Gin Leo Leu His Lys Asn Met Pro Ala Asn Tyr 1665 375 380 385 GCA GAA GCT CCA TTA GTT AAA GGA CTT CCA GCA TCA CCA GGA GCT GCT 1256 That Glu Ala Pro Leo Val Lys Gly Leu Pro Ala Ser Pro Gly Ala Ala

RO 118451 B

390 395

ACA GGA GCT GTT GTT TTT GAT GCC GAT GAT GCA GTT GAA CAA GCT AAA 1304 Thr Gly That Wave Wave Phew ASp That Asp Asp That Wave Goofy Gin That Lys 405 410 415 1675 GGA AAG AAA GTT CTT CTT CTT AGM GAA GAA ACT AAA Approx GAA NECK ATT 1352 Gly Lys Lys Wave Lion Lion Lion Arg Goofy Goofy Thr Lys Pro Goofy Asp authorities 420 HOW GGA TTC TTT GTT 425 GTC GAA GGT ATT TTA 430 acc TGC AGM GGA GGA 435 AAA 1400 1680 His Gly Phew Phew Wave That Goofy Gly authorities Lion Thr Cys Arg Gly Gly Lys 440 445 450 ACA TCA CaCl GCA GTC GTC GTT GTC AGM GGT ATG GGT AAA Approx TGT GTT 1448 1685 Thr Serum His That That Wave Wave That Arg Gly meth Gly Lys Pro Cys Wave 455 460 465 TCA GGA GTC GAA GGA ATT AAA GTT NECK GTT GTC AAG AAA ATT GTC AAG 1496 1690 Serum Gly That Goofy Gly authorities Lys Wave Asp Wave That Lys Lys authorities That Lys 470 475 480 ATT authorities GGA Gly AGC Serum CTT Lion GAA Goofy GTT Wave HOW His GAA Goofy GGA THROAT Gly Asp ATT authorities TTA Lion ACT Thr ATT authorities NECK Asp GGA Gly 1544 1695 485 490 495 TCA ACT GGA TGT GTC DAD AAG GGA GAA GTT Approx TTA GAA GAA Approx CAA 1592 Serum Thr Gly Cys Wave Tyre Lys Gly Goofy Wave Pro Lion Goofy Goofy Pro Gin 1700 500 505 510 515 GTT GGA TCA GGA DAD TTC GGA acc ATC TTA AAA TGG GCC AAT GAA ATT 1640 Wave Gly Serum Gly Tyre Phe Gly Thr authorities Lion Lys Trp That Assn Goofy authorities 1705 520 525 530 AAA AAG ATT GGA GTT TTT GTC GTC GGA NECK CTT Approx . TCA . GTC GTC AAG 1688 Lys Lys authorities Gly Wave Phew That That Gly Asp Lion Pro Serum That That Lys 1710

RO 118451 B

535 540 545 AAA GCC CTT GAA TTT GGA GCT GAA GGT ATT GGA CTT ¹ TGC AGA ACT GAA 1736 Lys Ala Leo Glu Phe Gly Ala Glu Gly Xle Gly Leu Cys Arg Thr Glu 550 555 560 CGT ATG TTC AAT GCA GTT GAA AGM CTT CCA ATT GTT GTC AAG ATG ATT 1784 Arg Net Phe Asn Ala Val Glu Arg Leo Pro Ile Val Val Lys Met Ile 565 570 575 CIT TCA AAT ACC CTT GAA GAA AGM AAG AAA TAT CTT AAT GAA CTT ATG 1832 Leo Ser Asn Thr Leu Glu Glu Arg Lys Lys Tyr Leu Asn Glu Leu Met 5Θ0 585 590 595 CCA CTT CAA AAA CAA GAT TTC ATT GGA TTA TTG AAG ACT ATG AAT GGA 1880 Pro Leo Gin Lys Gin Asp Phe Ile Gly Leu Leu Lys Thr Met Asn Gly 600 605 610 CTT CCA GTC ACT GTC AGM CTT CTT GAT CCA CCA TTA CAT GAA TTC CTC 1928 Leo Pro Wave Thr Wave Arg Leo Leo Asp Pro Leo His Glu Phe Leo 615 620 625 CCA ACT CTT GAA GAG TTA ATG AGM GAA ATC TTT GAA ATG AAA CTT TCA 1976 Pro Thr Leo Glu Glu Leo Met Arg Glu Ile Phe Glu Met Lys Leu ser 630 635 640 GGT AAG ACT GAA GGA CTT GCA GAA AAA GAA GTT GTT CTT AAG AAA GTT 2024 Gly Lya Thr Glu Gly Leu Ala Glu Lys Glu Val Val Leo Lys Lys Val 645 650 655 AAA GAA CTT ATG GAA GTT AAT CCA ATG ATT GGA CAC AGA GGA ATT AGA 2072 Lys Glu Leo Met Glu Val Asn Pro Met Ile Gly His ; Arg Gly Ile Arg 660 665 670 675 CTT GGA ACT ACT AAT CCA GAA _{ATT TAT ATG} L ATT AGA GCA TTC 2120

Leu Gly Thr Thr Asn Pro Glu Ile Tyr Glu Met Gin Ile Arg Ala Phe

RO 118451 B

680 685 690 TTA GAA GTC ACT CGT GAA GTT ATT AAG GAA GGA ATT. AAC NECK HOW CGA 2168 Lion Goofy That Thr Arg Goofy Wave authorities Lys Goofy Gly Ile. Assn Asp Hls. Arg 1755 695 700 705 GAA ATT ATG ATT Approx AAT GTT ACA GAA GTT AAT GAA CTT ATT AAC TTA 2216 Goofy authorities meth authorities Pro Assn Wave Thr Goofy Wave Assn Goofy Lion authorities Assn Lion 1760 710 715 720 AGM AAG AAT GTT CTT GAA Approx GTT HOW GAA GAA GTT GAA AAG AAA DAD 2264 Arg Lys 725 Assn Wave Lion Goofy Pro 730 Wave His G1U Goofy Wave 735 Goofy Lys Lys Tyre 1765 GGT ATT AAA GTA Approx TTC TCG DAD GGT ACT ATG GTT GAA ALL GTT AGM 2312 Gly authorities Lys Wave Pro Phew Serum Tyre Gly Thr meth Wave Goofy Cys Wave Arg 740 745 750 755 1770 GCA GCA TTA ACA GTC NECK AAG ATT GTC ACA GAA GTC TCA TTC TTC TCA 2360 That That Lion Thr That Asp Lys authorities That Thr Goofy That Serum Phew Phew Serum 760 765 770 1775 TTC GGA ACT AAT NECK CTT ACA CAA GGA ACA TTC TCA cue TCA CGT GAA 2408 Phew Gly Thr Assn Asp Lion Thr Gin Gly Thr Phew Serum Tyre Serum Arg Goofy NECK TCA GAA 775 AAC AAA TTC ATT Approx 780 AAA DAD GTT GAA CTT 785 AAG ATT CTT 2456 1780 Asp Serum Goofy Assn Lys Phew authorities Pro Lys Tyre Wave Goofy Lion Lys authorities Lion 790 795 800 Approx GTC AAT Approx TTT GAA ATT CTT NECK AGM Approx GGT GTT GGA GAA GTT 2504 1785 Pro That Assn Pro Phew Goofy authorities Lion Asp Arg Pro Gly Wave Gly Goofy Wave 805 810 815 ATG AGM ATT GTC GTT ACT AAA GGA AGM CAA . ACA AGM Approx . GAA . TTA . CTT 2552 1790 meth Arg authorities That Wave Thr Lys Gly Arg Gin Thr Arg Pro 'GlU . Lion Lion

RO 118451 B

820 825 830 835 GTT GGT ATT TGT GGA GAA CaCl GGG GGG GAA Approx TCA TCA ATT GAA TGG 2600 Wave Gly authorities Cys Gly 840 Goofy His Gly Gly Goofy 845 Pro Serum Serum authorities Glu Trp 850 TGC CaCl ATG ATT GGA TTG AAC TAT GTT TCA TGT TCT TCA cue AGM ATT 2648 Cys His meth authorities 855 Gly Lion Assn Tyr Val 860 Serum Cys Serum Serum Tyr Arg Ile 865 Approx GTT GTC AGM ATT GTC GTC GCT CAA GCC CAA ATT AGM HOW CCA AGM 2696 Pro Wave That Arg authorities That That Alas Gin That Gin authorities Arg His Pro Arg

870 875 880

GAA AAT TAAATTAACT TTTTTGGTTT 2722

Glu Asn

885

SEQ ID NOs 5

SEQUENCE LENGTH: 318o SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION:

CTGAAATTCC CGTAATCTAT CATCATTTAC ACCACAAATC GATTCACATC CTCACCGAAT

AGAAATCAAA TATCATTTAC TCCATTCCAC GATCTCCTTT TGCTATTGCT GATACCTCAA

TTTCCGAGOT GAAGGCGGAC G ATG AGT TCG TTG TTT CTT GAA GTC ATG CCT meth Serum Serum Lion Phew Wave Goofy Gly meth Pro 1 5 10 CTG AAG TCA GCC AAT GAG TCG TGC TTA GCC GCG AGC CTG AAG CAA CGG Lion Lys Serum That Assn Goofy Serum Cys Lion Pro That Serum Wave Lys Gin Arg 15 20 25 CGA acc GGT NECK CTC AGG CGA TTG AAC CaCl CaCl CGT CAA GCC GCG TTT

120

171

219

267

RO 118451 B

Arg Thr Gly Asp Leu Arg Arg Leu Asn His His Arg Gin Pro Ala Phe 1835 30 35 40 GTC wave CGG GGG ATT TGC CGT CGG AAG TTG ACT GGA GTT AGC AGA ATA GAG Arg Gly lle Cys Arg Arg Lys Leu Ser Gly Val Ser Arg lle Glu 45 50 55 315 1840 TTG Lion CGC ACC GOT GOT TTA ACT CTG CCA CGA GCG GTG CTT AAT CCG GTG Arg Thr Gly Gly Leu Thr Leu Pro Arg Ala Val Leu Asn pro Val 60 65 70 363 1845 TCT Serum 75 CCT CCG GTA ACG ACG ACT AAA AAG AGG GTT TTC ACT TTT GGT AAA Pro Pro Val Thr Thr Thr Lys Lys Arg Val Phe Thr Phe Gly Lys 80 85 90 411 1850 GGA Gly AAC AGT GAA GGC AAC AAG GAC ATG AAA TCC TTG TTG GGA GGA AAA Asn Ser Glu Gly Asn Lys Asp Met Lys Ser Leu Leu Gly Gly Lys 95 100 105 459 GGT Gly GCA AAT CTT GCA GAG ATG GCA AGC ATT GGC CTA TCA GTT CCT CCT Ala Asn Leu Ala Glu Met Ala Ser lle Gly Leu Ser Val Pro Pro 110 115 120 507 1855 GGG Gly CTC ACT ATT TCA ACT GAA GCA TOT GAG GAA TAT CAA CAA AAT GGA Leu Thr lle Ser Thr Glu Ala Cys Glu Glu Tyr Gin Gin Asn Gly 125 130 135 555 1860 AAA AAA CTG CCT CCA GOT TTA TGG GAT GAG ATT CTG GAA GGC TTA CAG 603 Lys Lys Leu Pro Pro Gly Leu Trp Asp Glu lle Leu Glu Gly Leu Gin 140 145 150 1865 DAD GTC CAG AAA GAG ATG TCT GCA TCT CTC GGT GAC CCG TCT AAA GCT 651 Tyre 155 Val Gin Lys Glu Met Ser Ala Ser Leu Gly Asp Pro Ser Lys Ala 160 165 170 1870 CTC : CTC CTT TCC GTC COT TCG GGT GCT GCC ATA TCG ATG CCT GGT ATG 699

RO 118451 B

1875 Lion Lion Lion Serum Wave Arg Serum Gly. That That authorities Serum Met Pro Gly: meth 175 180 185 ATG GAC ACT GTA TTG AAT CTC GGG CTT AAT NECK GAG GTC GTA NECK GGT 747 1880 meth Asp Thr Wave Lion Assn Lion Gly Lion Assn Asp Goofy Wave Wave Asp Gly 190 195 two hundred CTA GTC GCC AAA AGT GGA GTC CGC TTT GCC DAD GAC TCG DAD AGG AGG 795 1885 Lion That That Lys Serum Gly That Arg Phew That Tyre Asp Serum Tyr Arg Arg 205 210 215 TTT CTA NECK ATG TTT GGC AAC GTT GTA ATG GGT ATC Approx HOW TCG TTA 843 Phew Lion Asp meth Phew Gly Assn Wave Wave meth Gly authorities Pro His Serum Lion 1890 220 225 230 TTT NECK GAA AAG TTA GAG CAG ATG AAA GTC GAA AAA GGG ATT HOW CTC 891 Phew Asp Goofy Lys Lion Goofy Gin meth Lys That Goofy Lys Gly authorities His Lion 1895 235 240 245 250 GAC ACT NECK CTC ACT GTC GTC NECK CTT AAA NECK CTT GTC GAG CAA cue 939 Asp Thr Asp Lion Thr That That Asp Lion Lys Asp Lion That Goofy Gin Tyre 1900 255 260 265 AAG AAC GTG DAD GTG GAA GCA AAG GGC GAA AAG TTT CCC ACA NECK Approx 987 Lys Assn Wave Tyre Wave Goofy That Lys Gly Goofy Lys Phew Pro Thr Asp Pro 1905 270 275 280 AAG AAA CAG CTA GAG TTA GCA GTG AAT GCG GTT TTT NECK TCT TGG GAC 1035 Lys Lys Gin Lion Goofy Lion That Wave Assn That Wave Phew Asp Serum Trp Asp 285 290 295 1910 AGC Approx AGG GCC AAT AAG cue AGG AGT ATT AAC : CAG THREAD . ACT GGG - TTA 1083 Serum Pro Arg That Assn Lys Tyre Arg Serum authorities Assn . Gin authorities Thr Gly ' Leo 300 305 310 1915 AAG GGG acc GCG GTT AAC ATT CAA . TGC : ATG GTG ! _TTT 'GGC ! AAC ATG GGG 1131

RO 118451 B

Lys Gly Thr. That Wave. Assn lle Gin < Cys Met 1 ral Phe < yes Asn Met Gly 315 320 325 330 AAC ACT TCA GGA acc GGT GTT 1 CTT' ttc ACT J 1 AAC । Approx AGC; ACT GGT 1179 1920 Assn Thr Serum Gly Thr Gly Wave Lion Phe ¹ Thr J Arg; Assn Pro Serum Thr Gly 335 340 345 GAG AAG AAG CTG DAD GGG GAG TTT TTA GTC AAT GTC CAG GGA GAG NECK 1227 Goofy Lys Lys Lion Tyre Gly Goofy Phew Lion Wave; Assn. That Gin Gly Qlu Asp 1925 350 355 360 GTT GTT GTC GGG ATC AGM ACA Approx GAA NECK TTG GTG acc ATG GAG ACT 1275 Wave Wave That Gly Ile Arg Thr Pro Goofy Asp Lion Wave Thr meth Goofy Thr 1930 365 370 375 TGC ATG CCT GAA GCA cue AGM GAG CTT GTG GAG AAC TGT GTG ATT TTA 1323 Cys meth Pro Goofy That Tyr Arg Goofy Lion Wave Goofy Assn Cys Wave Ile Lion 380 385 390 1935 GAG AGM CaCl cue AAA NECK ATG ATG NECK ATT GAA TTC ACA GTT CAA GAA 1371 Goofy Arg His Tyre Lys Asp meth meth Asp Ile Goofy Phew Thr Wave Gin Goofy 395 400 405 410 1940 AAC AGM CTT TGG ATG CTG CAA TGC CGA ACA GGG AAA CGT ACT GGG AAA 1419 Assn Arg Lion Trp meth Lion Gin Cys Arg Thr Gly Lys Arg Thr Gly Lys 415 420 425 1945 GGT GCG GTG AGM ATT GCA GTA NECK ATG GTG AAC GAA . GGG и CTA ATT > THROAT 1467 Gly That Wave Arg Ile That Wave Asp meth Wave Assn Goofy Gly ' Leo Ile t Asp 430 435 440 ACT AGM ACA GCA ATT AAG AGG GTT GAG ACT CAA . HOW ’ CTA GAT CaCl ) CTT 1515 1950 Thr Arg Thr That Ile Lys Arg Wave Goofy . Thr Gin and His Let and Asp > Leo Gin 445 450 455

CTT CAT CCA CAG TTT GAG AAT CCG TCT GCT TAC AAA AGC CAT GTG GTA 1563

1955

RO 118451 B

Leo His 460 Pro Gin Phe Glu Asn Pro Ser Ala Tyr Lys Ser His Val Val 465 470 1960 GCA acc GGT TTG Approx GCA TCC CCT GGG 1 SCA GCC GTG GGG CAG GTT ( STG 1611 That Thr Gly Lion Pro That Serum Pro Gly J Me That wave Gly Gin wave ITal 475 480 485 490 1965 TTC AGC GCA GAG NECK GTC GAA ACA TGG HOW GCA CAA GGA AAG AGT GTC 1659 Phew Serum That Goofy Asp That Goofy Thr Trp His That Gin Gly Lys Serum. That 495 500 505 1970 ATC TTG GTA AGG ACT GAA ACA AGC Approx GAA NECK GTT GGT GGT ATG HOW 1707 authorities Lion Wave Arg Thr Goofy Thr Serum Pro Goofy Asp Wave Gly Gly meth His 510 515 520 GCA GCA GTC GGA ATC TTA acc GTC AGM GGA GGA ATG ACA TCA HOW GCA 1755 1975 That That That Gly authorities Lion Thr That Arg Gly Gly meth Thr Serum His That 525 530 535 GCA GTG GTG GTC CGC GGA TGG GGC AAA TGT TGT GTT TCT GGT TGT GTC 1803 1980 That Wave Wave That Arg Gly Trp Gly Lys Cys cys Wave Serum Gly Cys That 540 545 550 NECK ATT CGT GTG AAC NECK NECK ATG AAG GTT TTT ACG THREAD . GGT GAC CGT 1851 1985 Asp 555 authorities Arg Wave Assn Asp 560 Asp meth Lys Wave Phew 565 Thr authorities Gly Asp Arg 570 GTG ATT AAA GAA GGT GAC TGG CTT TCA CTT ' AAT GGT TC» l ACT ¹ GGC GAA 1899 Wave authorities Lys Goofy Gly Asp Trp Lion Serum Lion and Asn . Gly Sex : Thr Gly Goofy 1990 575 580 585 GTC THREAD TTG GGT AAA CAG CTA . CTG GCT that" L CCI * GCA ATG AGC : AAT NECK 1947 Wave authorities Lion Gly Lys Gin Lion . Lion take to Prc > Prc > Alas i Met : You are : Asn and Asp 1995 590 595 600 TTA GAA . ACA . TTC ATG TCA l TGG and GC1 ' NECK CAA GCA AGC } CGT CTC AAG GTT 1995

RO 118451 B

Lion Goofy Thr Phew meth Serum Trp That Asp Gin 4 Alas, Arg. Arg: Leo: Lys ¹ / al 605 610 615 2000 ATG GCA AAT GCA GAC ACA CCT AAT NECK GCA ¹ VAT. ACA GCC 4 AGM; AAC; AAT 2043 Net That Assn That Asp Thr Pro Assn Asp That Lion Thr Alas. Arg. Asn 4 Assn 620 625 630 2005 GGT GCA CAA GGG ATC GGA CTC TGT AGM ACT GAA HOW ATG TTT TTC GTC 2091 Gly That Gin Gly authorities Gly Lion Cys Arg Thr Goofy His meth Phew Phew That 635 640 645 650 TCT GAC GAG AGG ATC AAA GTC GTA AGM AAG ATG ATC ATG GCG GTC ACT 2139 2010 Serum Asp Goofy Arg authorities Lys That Wave Arg Lys meth authorities meth That Wave Thr 655 660 665 Approx GAA CAA AGM AAA GCG GTC CTA GAC CTC TTA CTC Approx cue CAA AGM 2187 2015 Pro G1U Gin Arg Lys That That Lion Asp Lion Lion Lion Pro Tyre Gin Arg 670 675 680 TCC NECK TTT GAG GGC ATT TTC CGA GCA ATG NECK GGA CTT CCT GTA ACA 2235 2020 Serum Asp Phew Goofy Gly authorities Phew Arg That meth Asp Gly Lion Pro Wave Thr 685 690 695 ATC CGC CTT CTA GAC CCT Approx CTT HOW GAG TTT CTA CCC GAA GGT NECK 2283 authorities Arg Lion Lion Asp Pro Pro Lion H1S Goofy Phew Lion Pro Goofy Gly Asp 2025 700 705 710 CTA GAA CaCl THREAD GTG AAT GAA CTT ACA GCG NECK ACA GGC ATG AGC AAA 2331 Lion Goofy His authorities Wave Assn Goofy Lion Thr That Asp Thr Gly meth Serum Lys 2030 715 720 725 730 NECK GAA ATC DAD TCA AGM ATC GAA . AAA . TTA TCC GAA . GTG and AAC CCT ATG 2379 Asp Goofy authorities Tyre Serum Arg authorities Goofy Lys Lion dry ' Dumb and Val Assn Pro meth 2035 735 740 745 1 αττ GGT TTC CGT GGT TGC CGA . TT? and GGG - ATT TCI l TAC CCC GAG ) CTA ACA 2427

RO 118451 B

2040 Lion Gly Phew Arg Gly Cys Arg Lion Gly Ile Serum ryr Pro Glu Leo Thr 750 755 760 GAA ATG CAA GTT CGT GCG ATC TTT CAA GTC GCA GTG TCT ATG AAC AAT 2475 Goofy meth Gin Wave Arg Ala Ile Phew Gin That That Wave Serum meth Assn Assn 2045 765 770 775 CAG GGG GTG ACT GTA ATA Approx GAG ATC ATG GTT GCC TTA GTC GGA ACA 2523 Gin Gly Wave Thr Wave lle Pro Goofy Ile meth Wave Pro Lion Wave Gly Thr 2050 780 785 790 CCT CAG GAA TTA CGG CAT CAA ATC GGC GTA ATT CGT GGT GTA GTC GCA 2571 Pro Gin Goofy Lion Arg His Gin Ile Gly Wave Ile Arg Gly Wave That That 2055 795 800 805 810 AAT GTT TTT GTC GAA ATG GGG CTG ACG TTG GAG DAD AAA GTG GGA ACG 2619 Assn Wave Phew That Glu Met Gly Lion Thr Lion Goofy Tyre Lys Wave Gly Thr 815 820 825 2060 ATG ATT GAG ATT CCT CGA GTC GTC TTG ATT GTC NECK GAG ATT GCA AAA 2667 meth Ile Goofy Ile Pro Arg That That Lion Ile That Asp Goofy Ile That Lys 830 835 840 2065 GAA GCC GAG TTC TTT TCG TTT GGA acc AAT NECK TTG acc CAG ATG ACA 2715 Goofy That Goofy Phew Phew sir Phew Gly Thr Assn Asp Lion Thr Gin meth Thr 845 850 855 2070 TTT GGG cue AGC AGA GAT NECK GTT GGC AAG TTT TTG GCC ATT DAD CTT 2763 Phew Gly Tyre Serum Arg Asp Asp Wave Gly Lys Phew Lion Pro Ile Tyre Lion 860 865 870 TCT CAA GGC ATT CTG CAG HOW NECK Approx TTT GAG GTT CTT GAC CAG AAA 2811 2075 Serum Gin Gly Ile Leo Gin His Asp Pro Phew Goofy Wave Lion Asp Gin Lys 875 880 885 890

GGG GTG GGT CAA TTG ATC AAG ATG GCC ACG GAG AAA GGT CGT GCA GCC 2859

RO 118451 B

Gly Wave Gly Gin Lion authorities Lys meth That Thr Goofy Lys Gly Arg That That 2080 895 900 905 AAT CCT AAC TTA AAG GTT GGG THREAD ALL GGG GAG HOW Goth GGA GAA CCT 2907 Assn Pro Assn Lion Lys Wave Gly authorities Cys Gly Goofy encore Gly Gly Goofy Pro 2085 910 915 920 TCT TCT GTT GCA TTT TTT GAC GGA GTT GGA CTA NECK thy OTG TCG TGC 2955 Serum Serum Wave That Phew Phew Asp Gly Wave Gly Lion Asp Tyre Wave Serum cys 2090 925 930 935 TCT Approx TTC AGG GTT CCT ATC GCA AGG TTG GCC GTC GCA CAA CTC GTT 3003 Serum Pro Phew Arg Wave Pro authorities That Arg Lion That That That Gin Wave Wave 940 945 950 2095

TAAGCTTTGA AAGGAGGATG GCTTATTTGC TTCATCTTTT CCGCCATCT3056

Wave ⁹⁵⁵ 2100

ΑΤΆΤΤΑΤΤΤΤ GGTTTCATCC TTATTOTAAT GCTGAAAATG AACGATGTTT AAACAAAACA 3116

ACCCATTATA TTTTGCTTTG OTATGCAATA ATCTACTTTT CAAACAAAAAA ΆΑΑΑΑΆΆΑΑΑ 3176

ΛΛΛΑ3180

2105

SEQ ID NO 6

LENGTH OF SEQUENCE: 18

SEQUENCE TYPE: Nucleic acid 2110

SEQUENCE DESCRIPTION:

GACGGCTAAA AAGAGGGT ₁₈

SECV OI NO: 7 2115

SEQUENCE LENGTH: 2o

SEQUENCE TYPE: nucleic acid

RO 118451 B

2120 SEQUENCE DESCRIPTION: TATCGAGAAA CCTTGTATAC $2 2125 2130 SEQ ID NO: 8 LENGTH OF SEQUENCE: 17 SEQUENCE TYPE®· nucleic acid SEQUENCE DESCRIPTION: GTTTTCCCAG TCACGAC 17 2135 SEQ IDNR: 9 LENGTH OF SEQUENCE: 17 SEQUENCE TYPE _x nucleic acid SEQUENCE DESCRIPTION: CAGGAAACAG CTATGAC 17 2140 2145 SEQ ID NO: lo SEQUENCE LENGTH : 23 SEQUENCE TYPE : nucleic acid SEQUENCE DESCRIPTION: GATATCAATC CGGTGTCTCC TCC 2. 3 2150 SEQ ID NO; 11 2155 SEQUENCE LENGTH: 34 SEQUENCE TYPE ; nucleic acid SEQUENCE DESCRIPTION: CGGTGTTCCC TCCGGATATC ACGGCTAAAA AGAG 34 2160 SEQ ID NO: 12 SEQUENCE LENGTH: 27 2165 SEQUENCE TYPE; nucleic acid SEQUENCE DESCRIPTION: TTGATATCCC GGTTGTCTCC TCCGGTA 27

RO 118451 B

SEQ ID NO; 13

SEQUENCE LENGTH: 2o SEQUENCE TYPE; nucleic acid SEQUENCE DESCRIPTION: GCAGAGATGA TGTTGGCAAG

SEQ ID NO: 14

SEQUENCE LENGTH: 2o SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION: CTTGCCAACA TCATCTCTGC

SEQ ID NO: LS

SEQUENCE LENGTH: 2o SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION;

CTCACTGTTC GAAGAGAAGC

SEQ ID NO: 16

SEQUENCE LENGTH ; 23 SEQUENCE TYPE ; nucleic acid SEQUENCE DESCRIPTION: CATATGCTCT GTCCGGCATA ATC

SEQ ID NO; 17

SEQUENCE LENGTH: 21 SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION;

CTCGAGGGAT CTCAATCATT G

SEQ ID NO: 18

SEQUENCE LENGTH; 18 SEQUENCE TYPE ; nucleic acid SEQUENCE DESCRIPTION:

2170

2o

2o

2o

2175

2180

2185

2190

2195

2200

2205

2210

RO 118451 B

2215 gcaatctstt cagcaatc 18 2220 SEQ ID NO; 19 SEQUENCE LENGTH: 2o SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION: GCTTCTTTTC CAATCTCATC 2o 2225 2230 SEQ ID NO: 2o LENGTH OF SEQUENCE: 18 SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION: CGAAAAAAA TCGGCTTC 18 2235 SEQ ID NO: 21 2240 SEQUENCE LENGTH: 24 SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION: GAAAGATAAA TCTGCAAAAA CTTG 24 2245 SEQ ID NO: 22 LENGTH OF SEQUENCE: 19 2250 SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION: GCCTTGAGCA AGATAAATC 19 2255 SEQ ID NO: 23 LENGTH OF SEQUENCE: 21 SEQUENCE TYPE: nucleic acid SEQUENCE DESCRIPTION: TTCTGGTCAA TAACCTCAAT G 21 2260 SEQ ID NO: 24 SEQUENCE LENGTH; 2o

RO 118451 B

SEQUENCE TYPE: nucleic acid

DcWRITING SEQUENCES®;

GCTTAAACAA TGACTTGTGC

3ECV ID NO: 25

SEQUENCE LENGTH _: 22

TYPE OF SEQUENCE: nucleic acid □WRITING OF THE SEQUENCE:

CCĂATCTCAT CAGCTATTAA ag

SEQ ID NO; 26

SEQUENCE LENGTH: 2o

SEQUENCE TYPE: nucleic acid

SEQUENCE DESCRIPTION;

GCTTCTTTTG CAATCTCTTC

SEQ ID NO: 27

LENGTH OF SEQUENCE: 18

SEQUENCE TYPE: nucleic acid

SEQUENCE DESCRIPTION»

CGAAAAAAGAC TCAGCTTC

SEQ ID NO; 28

SEQUENCE LENGTH; 2. 3

SEQUENCE TYPE; nucleic acid

SEQUENCE DESCRIPTION:

CAAGATAAAT CGGCAAAAC TTG

SEQ ID NO: 29

SEQUENCE LENGTH; 2. 3

SEQUENCE TYPE ; nucleic acid

SEQUENCE DESCRIPTION;

GAATGCCTTG AGAAAGATAA ATC

2265

2o

2270

2275

2280

2o

2285

2290

2295

2300

2305

2310

Claims (7)

RO 118451 B SEQ 1D NO; 3o SEQUENCE LENGTH; 24 2315 SEQUENCE TYPE; nucleic acid DESCRIBE THE SEQUENCE; CTTTCTGGTC AAGAACCTCA ÂATG 24 2320 SEQ ID NO; 31 SEQUENCE LENGTH; 2o 2325 SEQUENCE TYPE; nucleic acid SEQUENCE DESCRIPTION; GCTTAAACAA CGACTTGTGC 2o 2330 demand 1. Polypeptide with pyruvate orthophosphate dikinase activity, stable at low temperatures, characterized in that it contains the amino acid sequence from amino acid residue 832 to amino acid residue 955, of amino acid sequence no. 5, except that one 2335 or more amino acid residues are added, deleted or substituted, this conferring stability at low temperatures to the polypeptide. 2. Polypeptide according to claim 1, characterized in that the region of the pyruvate orthophosphate dikinase amino acid sequence corresponds to the amino acid sequence between amino acid residues 832 and 955 of amino acid sequence no. 5 is substituted with the sequence 2340 amino acid no. 5, except that one or more amino acids are added, deleted or substituted, thereby conferring low temperature stability to the polypeptide. 3. Polypeptide according to claim 1, characterized in that it has the same amino acid sequence as seq. no. 5, except that amino acid residue 869 is substituted with proline. 2345 4. Polypeptide according to claim 1, characterized in that it has the same amino acid sequence as seq. no. 5, except that amino acid residues 885 and 952 are substituted with leucine and valine, respectively. 5. Donated DNA, which encodes the polypeptide defined in claim 1, characterized in that it has the nucleotide sequence shown in seq. no. 5, except that one or 2350 more nucleotides are added, deleted or substituted. 6. Recombinant vector, containing the DNA defined in claim 5, characterized in that it has a structure shown in fig. 1 or 3 and which can express in the host cell, a polypeptide having pyruvate orthophosphate dikinase activity, stable at low temperatures. 7. Process of transformation of a Flaveria bidentis or corn plant, character- 2355 characterized in that it consists in the introduction, in their genome, of a DNA defined in claim 5, as a transforming agent, by means of the recombinant vector defined in claim 6. The president of the examination committee: chem. Haulica Mariela Examiner: biochem. Adina thought 9