HU222186B1 - Cold resistant pyruvate ortophosphate dikinase, the dna coding it, the recombinante vector containing the dna, and the transformed plants - Google Patents

Abstract

FIELD OF THE INVENTION The present invention relates to a novel polypeptide having a cold tolerant pyruvate, orthophosphate dicinase ("PPDK") activity, and a cloned DNA encoding the polypeptide, as well as a recombinant vector containing DNA, which is suitable for rendering plants cold-resistant. ált

Description

The present invention relates to a novel polypeptide having cold-tolerant pyruvate, orthophosphate dinicase ("PPDK") activity, a cloned DNA encoding the polypeptide, and a recombinant vector containing DNA suitable for rendering plants cold-tolerant. The invention also relates to plants transformed with the DNA of the invention.

The present invention is advantageously applicable to the production of cold tolerant transgenic plants.

Under strong light, high temperature and low CO ₂ concentration, the photosynthetic capacity of C ₄ plants is very good. However, at low temperatures, this ability is greatly reduced, except for plants that have adapted to low temperatures. Although the PPDK (EC 2.7.9.1, which ATP, pyruvate and transformation orthophosphate catalyzes AMP, phosphoenol pyruvate and pyrophosphate) one relative to the most important enzymes, the activity of the C ₄ -reakcióút other force is not sufficiently large current in leaf tissue photosynthesis rate of, Thus, it is one of the enzymes that determine the rate of CO ₂ uptake in C ₄ photosynthesis. Simultaneously with the discovery of the enzyme, it has also been shown that the enzyme is cold sensitive. In maize PPDK, the enzyme activity has an inflection point at 11.7 ° C. This temperature coincides with the temperature limit for maize growth. On this basis, it is assumed that one of the PPDK cold sensitivity of the reasons that reduce herbs _C4 photosynthesis rate at a low temperature. Thus, by increasing the cold tolerance of PPDK, the temperature limit for maize growth can be lowered. Flaveria brownii is a plant belonging to the Compositae family, which is classified as intermediate C3 / C4 and it is known that PPDK derived from it is not inactivated by incubation at significantly low temperature, i.e. 0 ° C. [Bumell JN: "A Comparative Study of the Cold Sensitivity of Pyruvate, Pi Dikinase in Flaveria Species." Plant Cell Physiol. 31: 295-297 (1991)].

By cloning the PPDK gene of the cold tolerant Flaveria browniei and transforming it with a plant, it is expected that the plant will be conferred cold tolerance.

Accordingly, one object of the present invention is to provide a novel polypeptide having cold-tolerant PPDK activity, a cloned DNA encoding it, and a recombinant vector containing DNA useful for rendering plants cold-tolerant. Another object of the present invention is to provide plants that have been transformed with the DNA of the invention.

Extensive research has been conducted to successfully clone the entire PPDK gene, determine its nucleotide sequence and the amino acid sequence encoded therein, and identify the region responsible for the cold tolerance in the PPDK gene by carrying out the present invention.

Accordingly, the present invention provides a polypeptide having cold-tolerant PPDK activity having an amino acid sequence equal to 1/6 of the C-terminal region of polypeptide (1) or (2), with the exception that at least one amino acid residue in said 1/6 region is substituted by another amino acid residue, where:

(1) a PPDK having the same amino acid sequence in SEQ ID NO: 1-4. and (2) a polypeptide having at least 50% amino acid sequence homology to the amino acid sequence of (1) and having cold-tolerant PPDK activity.

The invention further provides a cloned DNA encoding a polypeptide having cold-tolerant PPDK activity of the invention. The present invention further provides a recombinant vector comprising the DNA of the invention which is capable of expressing a polypeptide having cold tolerant PPDK activity in a suitable host. The invention also relates to plants transformed with the DNA of the invention.

In the development of the present invention, a gene encoding a cold tolerant PPDK was cloned and sequenced. We also identified the region responsible for the cold stability of the gene. As stated above, when a plant having a cold-sensitive PPDK is transformed with a gene of the invention, the plant containing the cold-sensitive PPDK can be transformed into a cold-tolerant PPDK. Further, by replacing the corresponding region of the cold-sensitive PPDK with the aforementioned cold-tolerant region, the cold-sensitive PPDK can be converted to a cold-tolerant PPDK. This will allow the plant to be cultivated in a cold climate where it has not been possible to grow. It is therefore expected that the present invention will greatly contribute to the development of agriculture.

BRIEF DESCRIPTION OF THE DRAWINGS The accompanying drawings are briefly described below.

Figure 1 is a schematic diagram of the construction of an expression vector. The vector comprises an embodiment of the PPDK gene of the invention.

Figure 2 shows the time course of enzyme activity during incubation of Flaveria brown, Flaveria bidentis and maize PPDK at 0 ° C. All three enzymes were expressed in Escherichia coli.

Figure 3 is a schematic diagram of the construction of an expression vector comprising an embodiment of the PPDK gene of the invention.

In the development of the present invention, the cold-tolerant Flaveria brown PPDK was cloned, its nucleotide sequence and the derived amino acid sequence encoded. The nucleotide sequence is shown in SEQ ID NO: 5 in the amino acid sequence. As described in detail in the following examples, this sequence was determined by the following steps: complete

HU 222 186 Bl

RNA extraction from leaves of Flaveria brown; cDNA library construction using the conventional method; plaque hybridization with a probe designed to detect the Flaveria brownii PPDK gene and the maize PPDK gene, which show a high degree of homology to each other; selection and cloning of positive clones; sequencing of the gene by the dideoxy method. The sequence has a high degree of homology to the PPDK gene from Flaveria bidentis of the same genus and is relatively homologous to the maize PPDK gene. Furthermore, the derived amino acid sequences of the N-terminal region and the intermediate regions are identical to the corresponding sequence of Flaveria brown PPDK, an enzyme isolated directly from the green leaf of this plant. It is therefore obvious that the cloned gene is the PPDK gene of Flaveria brownii. The PPDK gene of Flaveria brown was sequenced by plaque hybridization using maize cDNA as a probe; positive clones were further cloned; the gene was sequenced by the dideoxy method.

The amino acid sequence set forth in SEQ ID NO: 5 is a new 40 amino acid sequence different from the Flaveria bidentis PPDK amino acid sequence of the same genus and about 180 amino acids from the maize PPDK amino acid sequence. Thus, although the amino acid sequence of Flaveria brown PPDK under ID No. 5 has a high degree of homology to the same genus Flaveria bidentis PPDK, Flaveria bidentis PPDK is cold-sensitive and Flaveria brown PPDK is cold-sensitive. Thus, a small difference in the amino acid sequence causes a significant difference in the properties of the two enzymes. The present invention relates to a cloned PPDK gene encoding an amino acid sequence. As mentioned above, this amino acid sequence is novel and has a significant property of cold tolerance. The gene of the invention is not only the gene encoded by the nucleotide sequence set forth in SEQ ID NO: 5, but any gene of the invention having the nucleotide sequence encoding this amino acid sequence.

An attempt was made to identify the region of the cold tolerance region of the Flaveria brownii PPDK gene set forth in SEQ ID NO: 5. Thus, as detailed in the examples below, the Flaveria brown PPDK gene was cleaved into three regions of approximately the same size by restriction enzymes; each region was replaced with the corresponding region of the maize PPDK gene to obtain chimeric PPDK genes; it was determined whether the PPDKs encoded by the resulting chimeras were cold tolerant or not. As a result, we confirmed that the cold tolerance region is located in the last 1/3 region of the Flaveria brownii PPDK gene. Further, this last 1/3 region was cleaved with restriction enzymes into two more regions of approximately the same size, and similarly determined which of the two was responsible for cold tolerance. As a result, the cold tolerance peptide region was found to be encoded by a region 3 'to the ATroI site of the Flaveria brown PPDK gene set forth in SEQ ID NO: 5. Thus, it has been found that the cold tolerance function can be localized within the amino acid sequence between amino acid 832 (arginine) and amino acid 955 (valine), which is part of the amino acid sequence set forth in SEQ ID NO: 5. (The amino acid sequence between amino acids 832 and 955 will hereinafter be referred to as the "cold tolerance sequence".) Thus, it has been demonstrated that the cold tolerance region of the PPDK is located 1/6 of the entire gene from the C-terminus. On the other hand, SEQ ID NO: 1 is the nucleotide sequence of the gene encoding Flaveria bidentis PPDK and the derived amino acid sequence encoded by it, and SEQ ID NO: 2 is the nucleotide sequence of the maize PPDK coding sequence and the amino acid sequence of Biochemistry 263: 118080-1183 (1988)]. 3 is the nucleotide sequence of the gene encoding PPDK from Bacteriodes symbiosus and the derived amino acid sequence encoded by it (Biochemistry 29: 10757-10765 (1988)). 4 is the nucleotide sequence of the gene encoding PPDK from Entamoeba histolytica and the derived amino acid sequence encoded by it (Molecular Parasitology 62: 153-156 (1993)). As described above, it has been demonstrated in the practice of the present invention that the cold-tolerant region of the PPDK is located in 1/6 of the entire region from the C-terminus, thus making it possible to produce cold-tolerant PPDK by At least one amino acid change in the 1/6 region of the amino acid sequences set forth in SEQ ID NOs: 3 or 4 from the C-terminus. The term "cold tolerant" as used herein, means that, after incubation at 0 ° C for 20 minutes, the activity of the enzyme does not fall below 60% of its original activity.

As mentioned above, since the region of amino acid sequence SEQ ID NO: 5 from arginine 832 to valine 955 determines cold tolerance, cold-sensitive PPDKs whose amino acid sequence is set to SEQ ID NO: 1-4 , can be converted to cold-tolerant PPDK by replacing the corresponding regions of the cold-sensitive PPDK with the arginine 832 to valine 955 of the amino acid sequence set forth in SEQ ID NO: 5. This recognition is very important as it can be used to convert any desired cold-sensitive PPDK to cold-tolerant PPDK. Not only can PPDK be made cold-tolerant by the method described in the examples below, in which the corresponding region of cold-sensitive PPDK was replaced by the cold-tolerant sequence of Flaveria brownii PPDK to produce a chimeric gene, by altering the appropriate region of the PPDK gene by directed mutagenesis so that it is identical to the PPDK cold tolerance sequence of Flaveria brown. Therefore, the invention provides any polypeptide having PPDK activity

Leaning DNA is the DNA containing the cold stability sequence described above. In particular, the PPDK in which the 869 amino acid sequence of SEQ ID NO: 1 was replaced with proline, and the PPDK in which the 885 amino acid sequence of SEQ ID NO: 1 was replaced with leucine and 952 amino acid by valine, were found to be cold.

Not only PPDKs having the sequence set forth in SEQ ID NOs 1-4 can be borrowed, but all those having at least 50% homology to the one shown in Figures 1-4. SEQ ID NO. Preferably, the cold-tolerant PPDK encoding gene has a nucleotide sequence of at least 48.5% homology to the Flaveria brown PPDK gene, more preferably at least 90%.

It is well known in the art that there are cases in which the physiological activity of a physiologically active peptide is retained even if the amino acid sequence of the peptide is slightly modified, i.e., when one or two amino acids of the amino acid sequence are replaced or deleted, or two amino acids are inserted into the sequence. Therefore, the present invention provides polypeptides having substantially the same amino acid sequence as set forth in SEQ ID NO: 5, except that they contain modifications that retain cold-tolerant PPDK activity. Thus, the present invention provides polypeptides having substantially the same amino acid sequence as set forth in SEQ ID NO: 5, with the exception that one or more amino acids are inserted, deleted or replaced and have cold-tolerant PPDK activity. Similarly, the invention relates to DNAs having a nucleotide sequence substantially identical to that set forth in SEQ ID NO: 5, except that one or more nucleotides are inserted, deleted or replaced and encode a polypeptide having cold-tolerant PPD activity. .

Modification of the DNA sequence and thereby insertion, deletion or replacement of amino acids in the amino acid sequence encoded by it is accomplished by site-specific mutagenesis, which is well known in the art. [E.g. Nucleic Acid Research, 10, No. 20, 6487-6500 (1982)]. As used herein, "one or more amino acids" refers to the number of amino acids that can be inserted, deleted or substituted by directed mutagenesis.

Site-specific mutagenesis can be accomplished, for example, using synthetic primer oligonucleotides which are complementary to single-stranded phage DNA, except for the desired mutation, as described below. Using the above synthetic oligonucleotide as a primer, the phage produces a complementary strand and the resulting double-stranded DNA is transformed into host bacterial cells. The transformed bacterial cell culture is plated on an agar plate where plaque is formed from each cell containing the phage. Theoretically, 50% of the colonies contain a phage containing single-stranded DNA carrying the mutation, and the remaining 50% contains the original sequence. The plaques thus obtained are then subjected to hybridization with a kinase-treated synthetic probe at a temperature where the probe hybridizes with DNA having the same sequence as the DNA carrying the desired mutation but not hybridizing with the original DNA sequence. complementary to the test. The hybridization plaques are then inoculated into culture medium, grown and the DNA is harvested.

In addition to site-directed mutagenesis, other methods exist to replace, delete, or insert amino acids without losing enzyme activity, such as treating the gene with a mutagen or removing a selected nucleotide by selectively cleaving the gene, pronounce or replace and then ligate the gene.

By transforming a plant with the PPDK gene of Flaveria brown or with a DNA encoding a polypeptide with PPDK activity containing the cold tolerance sequence, a cold tolerant plant can be obtained. Preferably, for example, the following plants may be transformed: maize, sugar cane, millet, forage grasses and sorghum.

Methods for transforming plants already exist, and the method utilizing Agrobacterium tumefaciens is particularly applicable. A method for transforming plants using Agrobacterium tumefaciens is well known in the art. With this method, both dicotyledons (e.g., Japanese Patent Application Laid-Open No. 4-330234) and monocotyledons (WO 94/00977) can be transformed. Alternatively, the DNA may be introduced into the plant's protoplasts by electroporation or a similar method well known in the art. The transformation can also be accomplished by binding the DNA to tungsten particles or the like and implanting the particles in the germ of the plant. The following examples will specifically describe the transformation methods mentioned.

The invention is further illustrated by the following examples, but is not to be construed as limiting.

Example 1

Cloning and sequencing of the Flaveria brown PPDK gene (1) Construction of a cDNA library and full-length cDNA cloning.

(i) Construction of the cDNA library

Total RNA isolates from green leaves of Flaveria brown (60 g) were prepared by the guanidine hydrochloride / phenol method. By this method, 26.5 mg of RNA was obtained after precipitation with lithium. Subsequently, 118.9 µg of poly (A) ⁺ RNA was obtained from 13.2 mg of RNA by a conventional method using a "01igo (dT) -Cellulose Type 7" column (commercially available).

HU 222 186 Β1 from Pharmacia). The cDNA library was prepared using the TimeSaver cDNA Synthesis kit (commercially available from Pharmacia), the Lambda-ZAPII vector (commercially available from STRATAGENE) and the Xgt10 cDNA cloning system (commercially available from AMERSHAM). DNA packaging reagent was used. Using an EcoRI / NotI linker oligonucleotide, a cDNA library was constructed in which the DNA fragments were inserted into the EcoRI site of the Lambda-ZAPU vector. The size of the prepared cDNA library was 415,000 pfu (plaque forming unit). XL1-Blue cells were used as host cells.

(ii) Preparation of hybridization assay

A DNA fragment from F. browniei RNA was amplified by reverse transcription PCR (polymerase chain reaction) using the following primers: 5'-GACGGCTAAAAAGAGGGT sequence primer (this is Flaveria bidentis bigD and maize). and the R-primer of the sequence TATCGAGAAACCTTCTATAC, which is a part of the complementary strand sequence of the Flaveria bidentis PPDK gene. The amplified DNA fragment was inserted into pCRII vector (commercially available from INVITROGEN). Using the resulting vector as a template and using the above primers, the DNA was amplified and the PCR product electrophoresed, and the DNA was recovered from the gel "SUPREC-01" (commercially available from TAKARA SHUZO) ). This operation yielded a 428 bp DNA fragment starting 24 bp 3 'to the N-terminus of the mature protein. This fragment was labeled with ³² P isotopes using a "Multiprime DNA" labeling system (commercially available from AMERSHAM) to prepare the probe.

(iii) Cloning of the full length cDNA of Flaveria brown

The cDNA library was screened by plaque hybridization using the above DNA fragment as a probe. The hybridization filter was "Hybond N ⁺ " (commercially available from AMERSHAM), hybridization was carried out in 6 χ SSC buffer containing 5 χ of Denhalt solution in the presence of 0.1% SDS and 100 pg / ml of denatured salmonhere DNA at 65 ° C. overnight. Wash was performed with 2xSSC containing 0.1% SDS for 5 minutes at room temperature; With 2xSSC containing 0.1% SDS at room temperature for 90 minutes and then with 1χ SSC containing 0.1% SDS at 68 ° C for 90 minutes. 28 independent positive clones were obtained. From these, 21 plaques showing a strong signal were selected and screened again. The new screening was done in the same way as the first one, except that the second wash was 60 minutes. As a result, independent positive plaques from a single phage were obtained from 6 clones. The size of the inserted DNA fragments was checked by PCR using the R-primer described above, the "M13PrimerM4" primer (GTTTTCCCAGTCACGAC, commercially available from TAKARA SHUZO) and the "M13PrimerRV" commercially available from CAGGGACACAG ) while the phage served as a temple. As a result, two clones containing full-length DNA were obtained. The inserted DNA fragments were then subcloned into the plasmid vector pBluescript IISK (-) (commercially available from STRATAGENE) by in vivo cleavage. The recombinant plasmids obtained by cloning were named p411 and p631.

The PCR described above revealed that the library prepared as described above contained sufficiently long inserts and was thus suitable for cDNA screening. Thus, for the isolation of Flaveria brown mRNA, it is desirable to employ the method described above and simultaneously obtain large amounts of mRNA by simultaneously working with large amounts of RNA as described above.

Furthermore, since the cDNA library described above contains a number of sufficiently long inserts, full-length cDNA screening was readily accomplished by constructing a probe using a primer that hybridizes to a region immediately adjacent to the processing region of the desired protein gene.

(2) Determination of the complete nucleotide sequence of the cDNA and comparison with the derived amino acid sequence

In order to determine the complete nucleotide sequence of the inserted cDNA fragment of p631, deletion mutants were constructed. Deletion mutants were prepared using the "Deletion Kit for Kilo-Sequence" (commercially available from TAKARA SHUZO for sequencing of long fragments). However, the exonuclease-III catalyzed reaction was stopped by transferring the reaction mixture into "Mung Bean" nuclease buffer which was kept at 65 ° C. Nucleotide sequence determination was performed with a plasmid purified with the "Qiagen Plasmid Mini" reagent kit (commercially available from Diagen), the Taq DyeDeoxy Terminator Cycle sequencing kit (commercially available from ABI), and an Applied Biosystems 373A DNA. (commercially available from ABI). Both chains were sequenced except for some of their chains. Based on the determined nucleotide sequence, the amino acid sequence was determined. The determined nucleotide sequence and the amino acid sequence are set forth in SEQ ID NO: 5.

It should be noted that in preparing deletion clones for sequencing the isolated cDNA, it was important to preheat the "Mung Bean" nuclease buffer to 65 ° C, because the reaction could not be stopped simply by transferring the reaction mixture to the "Mung Bean" nuclease buffer. Furthermore, since the boundary between the vector and the insert is approx. The 600-900 bp sequence could not be determined by deleting a sequence from the insert only at the 5'-end.

EN 222 186 Bl, it was necessary to carry out the deletion from both ends.

On the other hand, the Flaveria brownowxA PPDK was purified directly and the amino acid sequence of the N-terminal region, the C-terminal region and the intermediate regions were determined. The PPDK was purified as follows. The green leaves were homogenized in triple volume digestion buffer. After centrifugation, ammonium sulfate was added to the supernatant to 30% saturation, and the precipitated proteins were removed. Additional ammonium sulfate was added to the solution up to 70% saturation, and the precipitated proteins were recovered. The recovered proteins were loaded on a Sephadex G25 (commercially available from Pharmacia) column to remove salts. The resulting sample was loaded on a DEAE-Sepharose (commercially available from Pharmacia) column and the bound proteins were eluted with an increasing KCl gradient from 50 to 400 mM. Fractions showing PPDK activity were pooled and ammonium sulfate was added to the solution to 70% saturation and desalted with G25. The resulting sample was further purified on a hydroxyapatite column. Bound proteins were eluted with phosphate buffer with an increasing phosphate gradient from 10 mM to 40 mM. Fractions showing PPDK activity were pooled and ammonium sulfate was added to the solution to 70% saturation and desalted with G25. The resulting sample was subjected to SDS-PAGE (polyacrylamide gel electrophoresis) and the PPDK band was excised from the gel. The protein was recovered by electroelution. During this procedure, approx. 5-10 nmol of purified PPDK sample was obtained. The PPDK thus purified showed a single band as analyzed by SDS-PAGE.

The amino acid sequences of the N-terminal region, the C-terminal region and the intermediate regions of the thus obtained purified PPDK were then determined. The amino acid sequence of the N-terminal region was determined by transferring the protein to a PVDF membrane and determining the sequence using a gas phase amino acid sequencer. The amino acid sequence of the C-terminal region was determined by digesting the purified PPDK with carboxypeptidase-Y and the amino acid sequence was determined from the relationship between the ratio of liberated amino acids and the digestion time. The amino acid sequence of the intermediate regions was determined by determining the N-terminal amino acid sequences of the peptides produced by proteinase digestion. The details of this method are as follows. First, just as in the determination of the amino acid sequence of the N-terminal region, PPDK partially purified from the green leaves of Flaveria brown was prepared and then subjected to standard SDS-PAGE. The gel was stained with Coomassie Brilliant Blue R250 and the PPDK band was excised. The excised gel was equilibrated in equilibration buffer (125 mM TrisHCl pH 6.8, 1 mM EDTA, 0.1% SDS) and resuspended in SDS-polyacrylamide gel and run. This was done by adding a cover solution (125 mM Tris-HCl pH 6.8, 1 mM EDTA, 0.1% SDS, 0.01% BPB, 20% glycerol) and an enzyme solution (125 mM TrisHCl pH 6.8). , 1 mM EDTA, 0.1% SDS, 0.01% BPB,

10% glycerol, lysine endopeptidase 1-5 pg or V8 protease 0.01-0.1 pg) was added to the gel along with the equilibrated gel. After being electrophoresed for a while, the concentrated gel was digested (the voltage was turned off and the gel was left to stand for 45 minutes). The electrophoresis was then resumed, and the separated proteins were transferred to a PVDF membrane as in the determination of the N-terminal sequence, and the amino acid sequence of the digested fragments from their N-terminus was determined using a gas-phase amino acid sequencer.

Specific sequences for the N-terminal region, the C-terminal region, and the intermediate regions are as follows: N-terminal sequence: Asn Pro Val Ser Pro Pro Val (72-78)

C-terminal sequence: Leu - Alá Alá * - Val Val (948-955)

Intermediate sequence (1): Lys Leu Tyr Glu Phe Leu Val

Asn Alá Gin Gly - Asp Val Val Alá (349-365) Intermediate sequence (2): Gin Leu Leu Alá Pro Pro

Alá Met Ser Asn Alá Leu - Thr (592-605) Intermediate sequence (3): Leu Thr Alá Asp Thr Gly

Met Ser Lys Asp Glu Ile Tyr Ser Arg Ile Glu (721-738)

Intermediate Sequence (4): Al --- Ser Phe Gly Thr

Asn Asp Leu Cys Gin Met Val Phe Gly - Ser (844-862).

In the amino acid sequences described above, it means glutamine that could not be detected by the analyzer used, and means that the result of the analysis is uncertain. The numbers in parentheses represent the amino acid sequences of the corresponding regions of the amino acid sequence set forth in SEQ ID NO: 5. Although the intermediate sequence (2) and (4) differ from the amino acid sequence set forth in SEQ ID NO: 5, it is believed that this is due to an error in the amino acid sequencer. As is well known in the art, amino acid sequencing equipment makes a lot of mistakes, while DNA sequencing equipment does not make mistakes.

Because the amino acid sequence shown in SEQ ID NO: 5 shows good agreement with the partial amino acid sequences determined directly from the purified PPDK described above, it is confirmed that the amino acid sequence shown in SEQ ID NO: 5 is the amino acid sequence of PPDK. The amino acid sequence set forth in SEQ ID NO: 5 was compared with the amino acid sequences of known PPDKs in Flaveria bidentis and maize. As a result, it was found that Flaveria bidentis had 40 and maize ca. 180 amino acids are the difference in the region corresponding to the mature protein. Furthermore, based on the results described above, it is believed that the amino acid sequence 1 to 71 of the amino acid sequence shown in SEQ ID NO: 5 does not exist in the mature protein, but only a transit peptide region that passes through the membranes. cleaved. Table 1 shows the differences in amino acid sequences between the mature proteins of Flaveria brown and Flaveria bidentis.

HU 222 186 Bl

Table 1

Brownii Bidentis Amino acid numbers and amino acids that are different 5 Phe 6 Ser 10 Pro 11 Leu 15 Asn 16 Arg 28 Thr 29 Asn 40 Pro 41 Ser 41 Ala 42 Ser 48 Arg 47 Leu 49 Arg 48 Thr 50 Lys 49 Pro 52 Ser 50 Ala 57 Ile 55 Pro 61 Thr 59 Ser 62 Gly 60 Ser 66 Leu 64 Pro 81 Thr 79 Ala 92 Asn 90 Arg 97 Lys 95 Arg 114 Ala 112 Ser 140 Lys 138 Ser 150 Leu 148 Ser 154 Gin 152 asp 170 Ala 168 Pro 201 asp 199 Ala 205 Ala 203 Gly 263 Ala 261 With 265 Gin 263 Lys 323 Cys 321 Ser 356 With 354 Ile 374 With 372 Gly 382 Glu 380 asp 385 Arg 383 Lys 392 With 390 Glu 396 Arg 394 Gly 465 Asn 463 asp 490 With 488 Cys 564 With 562 Ile 583 Ser 581 Thr 605 Thr 603 Ile 672 Ala 670 With 723 Thr 721 Ala 724 Ala 722 With 730 Lys 728 Ala

Brownii Bidentis Amino acid numbers and amino acids that are different 736 Arg 734 Lys 739 Lys 737 Asn 777 Asn 775 Thr 803 Gly 801 Ser 818 Leu 816 With 838 asp 836 Glu 841 Ala 839 Gly 845 Glu 843 asp 871 Pro 869 Gin 875 Ser 873 Ala 887 Leu 885 Ile 954 With 952 Ile

Example 2

Cultivation of Flaveria brown PPDK in E. coli and measurement of cold tolerance

In order to confirm that a cold-tolerant enzyme was indeed produced from the cDNA of Flaveria brown isolated as described above, it was expressed as E. coli as follows:

Restriction sites were constructed in the DNA as described below to remove the transit peptide and to ligate the DNA into an expression vector: thus, plasmid p631 was digested with SacI and then recycled to give plasmid p631Sac. (which is identical to p631, except that the 3 'region of the ohacl site was pronounced). PCR was performed using plasmid p631 Sac as a template. For this, two primers were used: one, the EcoRV cleavage site primer 4 (sequence GATATCAATCCGGTGTCTCCTCC), based on the sequence adjacent to the process region, and the M13RV primer commercially available from commercially available T vector sequence. The amplified fragment was cloned into the pCRII vector. The region containing the N-terminal fragment was excised with EcoRV and SacI. Three DNA fragments were ligated: the DNA fragment thus excised, the Sac6 / HindIII fragment from p631 (containing the remaining region of the PPDK cDNA), and a fragment obtained by Plasmid pKK233-2 was digested with / Vcol, the ends blunted with Klenow fragment and digested with / fmdIII (Figure 1). The plasmid thus obtained was transformed into E. coli MV1184 and the resulting strain was used for our expression experiments, 1 ml of culture was diluted with 9 ml of fresh LB medium containing 50 mg / ml ampicillin and the resulting culture was maintained for 3 hours. And shaken. IPTG was then added to a concentration of 5 mM, followed by another

We continued to breed bi. Cells were harvested by centrifugation. The cells were resuspended in 0.5 ml of breaking buffer (50 mM HEPES-KOH pH 7.5, 10 mM MgSO _4, 1 mM EDTA, 5 mM DTT), and then lysozyme was added to a final concentration of approx. To 0.5 mg / ml. The suspension was allowed to stand on ice for 5 minutes and sonicated using a Model UCD-130T sonicator (commercially available from COSMOBIO) for a total of 5 minutes in total, liberating the enzyme. The resulting suspension is centrifuged for 10 minutes in a microcentrifuge and the supernatant was applied to a Sephadex G25 column equilibrated in column buffer (50 mM HEPES-KOH, pH 7.0, mM _MgSO4, 2 mM EDTA, 10 mM DTT) to remove low molecular weight materials. The resulting solution was allowed to stand at 25 ° C for at least 30 minutes to ensure that a tetramer was formed, which was then used to measure activity.

PPDKs derived from Flaveria brown, Flaveria bidentis, and maize cDNAs produced in E. coli cells by SDS-PAGE showed essentially the same motility as plant-derived enzymes. Although the expected molecular weights of the mature enzymes, knowing the appropriate cDNAs, are approx. the same apparent molecular weights observed on SDS-PAGE differ significantly. We have shown that this is due to differences in amino acid composition and not to protein deletion or other post-translational modifications, such as binding of sugar chains to protein. The cold tolerance of each PPDK produced in E. coli was the same as that of the corresponding enzyme from each plant. Thus, the cold tolerance of Flaveria brown PPDK does not require any plant-specific additional factor or post-translational transformation, and it is expected that the cDNA can be introduced and expressed in maize to produce cold 15 tolerant PPDK. Figure 2 shows the relationship between the duration of the enzyme incubation at 0 ° C and the relative PPDK activity.

The method described above serves to produce active PPDK in E. coli. In this method, the cDNA from which the transit peptide coding region was removed was inserted into an expression vector. It was therefore important to precisely align the sites to be cleaved with those corresponding to the N-terminus of the plant-derived enzyme.

(F. brownii) The amount of enzyme produced in E. coli Used primer MITAKKRVFTF ... - 2 MIPVSPPPVTTTKKRVFTF ... + 3 MINPVSPPVTTTKKRVFTF ... ++ 4 NPVSPPVTTTKKRVFTF ... (the enzyme from the leaf) (F. bidentis) MITAKKRVFTF ... ++ MIPVSPPPVTTAKKRVFTF ... - TAKKRVFTF ... (the enzyme from the leaf) (Maize) MATKKRVFTF ... ++ TTKKRVFTF ... (the enzyme from the leaf)

More specifically, while an attempt was made to express Flaveria brown cDNA, the expression of PPDKs from 45 maize and Flaveria bidentis was at a level using the maize site in both cases. Thus, during expression of Flaveria brown cDNA, DNA was first cleaved at this site using primer 2, and an attempt was made to express the cDNA after constructing the expression vector containing the cDNA. However, PPDK was not produced at all. Subsequently, an expression vector was constructed based on the sequence of the N-terminal region of the leaf-derived enzyme using primer 3, in which the inserted cDNA also contains an additional sequence encoding an enzyme extended by N-terminal amino acids. Expression was made using this expression vector. As a result, 60 PPDKs were produced. However, even with this expression vector, the amount of enzyme produced was small, so that the amount of enzyme recovered was not sufficient to measure its activity. Thus, another expression vector was constructed using primer 4, in which the inserted cDNA also contains an additional sequence encoding an N-terminally-extended enzyme. Expression was made using this expression vector. As a result, a large amount of PPDK was produced, which proved to be cold tolerant55. The nucleotide sequences of primers 2 and 3 were as follows:

Primer 2: CGGTGTCTCCTCCGGATATCACGGCTAAAAAGAG

Primer 3: TTGATATCCCGGTTGTCTCCTCCGGTA

HU 222 186 Β1

Example 3

Identification of the cold tolerance region a

Flaveria browniei in the PPDK gene (1) Chimeras produced from Flaveria brownie and Flaveria bidentis

Expression vectors were recombined in a manner known per se using restriction enzymes. This was done by replacing the EcoRAIHindIII fragment of pKK with the corresponding fragment of pKK-bidentis (the latter plasmid was obtained by inserting the Flaveria bidentis cDNA into pKK 223-2, as was the case with pKK-brown). ) to give plasmid pKK-ΟΙ 1. On the other hand, the Eco RI / HindIII fragment of pKK-bidentis was replaced with the corresponding fragment of pKK-brown to give plasmid pKK-100. Similarly, the NdeI / HindIII fragments were exchanged to give plasmids pKK-001 and pKK-110. Furthermore, the Xhol / Hindlll fragment of pKK-110 was replaced with the corresponding fragment ρΚΚ, -bidentis, and the κΚΚ-1101 fragment of pKK-bidentis was replaced by the corresponding fragment of p ap AZ-Brown, pKK-1110. . The Xhol / HindIII fragments were linked by PCR (linker or "linking" PCR method) to allow further, more accurate recombination. A primer complementary to the common nucleotide sequence of the Xhol / HindIII fragment in brown and bidentis, the linker F-linker: GCAGAGATGATGTTGGCAAG, and the linker-R primer: CTTGCCAACATCATCTCTGC. The first PCR was performed using the Xhol / HindIII fragment cloned into the brown or bidentis pBluescriptSK (-) vector and using the link-F / RV or M4 / link-R primer combinations. The resulting fragments (4 types in total) were purified by gel excision. A second PCR was performed using M4 / RV primers as a template using a mixture of the first half of Brownian fragment and the second half of bidentis fragment, or a mixture of the first half of bidentis fragment and the second half of Brownian fragment. The amplified linked fragments were digested with XhoI and HindIII and the resulting fragments were replaced with the corresponding region of pKK-bidentis, thereby obtaining pKKlinkO1 and pKK-link10. Another pair of chimeric genes were constructed utilizing the PsIII site between the recombinant PCR recombination site and the / zWIII site. This was done by inserting the XhoI / PstI fragment of pKK-linklO and the PstI / HindIII fragment of pKK-bidentis into the XhoI / HindIII site of pKK-bidentis, resulting in pKKlink10. Similarly, the XhoI / PstI fragment of pKK-bidentis and the PstI / HindIII fragment of pKK-brown were inserted into the XhoI / HindIII site of pKK-bidentis, resulting in pKK-linkl10.

The 40 sites where the amino acid residues of the mature PPDK proteins of Flaveria bidentis and Flaveria brown differ are mainly located in the N- and C-terminal regions, and not much in the central region, i.e. the active site. The cDNAs were thus divided into three regions, the first, middle, and back regions utilizing the κ coRI and the Nde sites which are commonly found in both genes, and the chimeric genes were mutually interchanged. By checking these chimeric genes, the region responsible for cold tolerance was determined. As a result, the protein was found to have cold tolerance if it contained the back 1/3 region of Flaveria brown cDNA. In contrast, if the protein contained the back 1/3 region of Flaveria bidentis, it was cold sensitive. The posterior 1/3 region was then cleaved into XIII by restriction enzyme and the fragments were sequentially replaced with the corresponding regions of pKK-bidentis and the cold tolerance checked. The result was that a region 3 'to the Xhol site (i.e., 1/6 region from the C-terminal) was necessary and sufficient to provide cold tolerance. Then, a chimeric gene containing the back 1/6 region (the Xhol / HindIII fragment containing the 7 amino acid substitutions) was prepared by linkage PCR, and the amplified gene was inserted into pKK bidentis, which was then measured for cold tolerance. We also found that the chimeric enzyme encoded in pKK-link 10 with the most back region containing 4 substitutions proved to be cold-tolerant, while the pKKlinkO 1 encoded enzyme containing the upstream half of the back region with three substitutions he was cold sensitive. Subsequently, recombination in the posterior region was performed with the restriction enzyme Pstl to produce chimeric genes with two amino acid substitutions per gene and to check the cold tolerance of the resulting genes. Thus, it can be accepted that two or more regions are associated with cold tolerance.

(2) Chimera of maize and Flaveria browniifo

PCR using the PPDK-F primer (CTCACTGTTCGAAGAGAAGC) and the m / V helper primer containing the AWel site (CATATGCTCTGTCCGGCATAATC), as well as the maize PPDK cDNA as a template, was performed using PCR to amplify, vector. This fragment was excised from pCR11, Sad and Neel. This fragment, the Sacl / Smal fragment of pKK-PPDK (vector fragment), and a fragment obtained by digestion of the cDNA of Flaveria brown PPDK were blunt-ended and then digested with M / I. - linked by three fragment coupling reactions (Figure 3) to give pKK-mz / bro / AWe). PCR was performed with the PPDK-F primer, the mATIII primer (CTCGAGGGATCTCAATCATTG, complementary strand) and maize PPDK as template. The resulting fragment was cloned into pCRII and the insert was excised from pCRII with 5ac and XhoI. The excised fragment was ligated with the SaclXhol fragment (vector fragment) of pKK-mz / bro / We) to give pKK-mz / bro (A750).

The chimeric enzyme containing the C-terminal 1/3 region of the Brown PPDK in maize PPDK (the NdeI / HindIII fragment) and the chimeric enzyme containing the C-terminal brown PPDK in maize PPDK

HU 222 186 Bl

It contained 1/6 regions (the Xhol / HindIII fragment) and showed the same degree of cold tolerance as Brown PPDK. Thus, since maize PPDK, whose amino acid sequence is significantly different from that of F. brownney PPDK, can be made cold-tolerant, it is believed that PPDKs of various plants can also be made cold-tolerant by the back 1/3 region or the C-terminal 1 / 6 regions. Because the maize so prepared / F. Brownian chimeric PPDK contains the maizePPDK transit peptide in its original form, so if a transformed plant would not be able to transport cold tolerant PPDK containing the Flaveria brannii transit peptide to its chloroplasts, the problem could be overcome by transferring this chimeric gene to F. .

(3) Point mutant clone

The amino acids of the XhoI / HindIII fragment of pKK-brown were individually changed from brown to bidentis. Similarly, the amino acids of the XhoI / HindIII fragment of pKK-bidentis were changed from bidentis to brown. Mutations were generated by cloning the XhoI / HindIII phage fragments of the F. Browniani and F. bidentis PPDK cDNAs into pBluescriptIISK (-) and replacing the nucleotides by the Kunkel method using the commercially available T ) and the Mutan-K reagent kit (commercially available from TAKARA SHUZO). The sequences of the primers used to generate the mutations are listed in Table 2. Once the mutated nucleotide sequence was confirmed by DNA sequencing, these fragments were inserted into the XhoI / HindIII site of pKK-bidentis.

Table 2

The primers used to make point mutant clones

Mutation from F. brownii to F. bidentis 836DE 5'GCAATCTCTTCAGCAATC 839AG 5'GCTTCTTTTCCAATCTCATC 843ED 5'CGAAAAGAAATCGGCTTC 869PQ 5'GAAAGATAAATCTGCAAAAACTTG 873SA 5'GCCTTGAGCAAGATAAATC 885LI 5'TTCTGGTCAATAACCTCAATG 952VI 5'GCTTAAACAATGACTTGTGC Mutation from F. bidentis to F. brownii 836ED 5'CCAATCTCATCAGCTATTAAAG 839GA 5'GCTTCTTTTGCAATCTCTTC 843DE 5'CGAAAAGAACTCAGCTTC 869QP 5'CAAGATAAATCGGCAAAAACTTG 873AS 5'GAATGCCTTGAGAAAGATAAATC 885IL 5'CTTTCTGGTCAAGAACCTCAAATG 952IV 5 'GCTTAAACAACGACTTGTGC

Each of the enzymes in which an amino acid was replaced by substituting an XIII / HindIII region of pKK-1110 for the corresponding bidentis type, differing in F. brownney and F. bidentis, exhibited cold tolerance. Therefore, it is believed that several substitutions are needed at one time for cold tolerance, since cold tolerance is not abolished by changing only one amino acid. Subsequently, enzymes were prepared by replacing an amino acid by substituting the corresponding brown type in the XhoI / HindIII region of pKKbidentis with the corresponding brown type and checking that the enzymes were cold-tolerant. Therefore, the enzyme activity was measured after incubation at 0 ° C for 20 minutes. In this process, the 869Gln-Pro mutant proved to be cold tolerant (60-70% of the original activity was retained after incubation in cold). In the case of 885Ile- »Leu and 952Ile-> Val mutants, the decrease in activity at low temperature was slightly reduced. In view of these results and the results relating to the pKK-linkllO chimeric enzyme according to (1), it is believed that coexistence of these mutations is required to achieve cold tolerance. From these results, it was concluded that three amino acids, 869Pro, 885Leu and 952Val, are related to cold tolerance. However, there are some of these amino acid residues associated with Brownian cold tolerance, namely 869Pro and 885Leu, which are also of the brown PPDK type. Therefore, cold tolerance is not necessarily achieved because these amino acids are of the brown type, but it is believed that these amino acids provide complete cold tolerance in the amino acid sequence of brownitb or bidentis derived PPDK. Therefore, in cases where we intend to confer cold tolerance to PPDK from other species whose amino acid sequence is significantly different from Brownian and bidentate, it is preferable not to make point mutations but to construct a chimeric gene incorporating the region responsible for cold tolerance. maize PPDK.

Example 4

Transformation of maize by Flaveria brownii

PPDK gene

In accordance with the method of Gordon-Kamm WJ et al. (The Plant Cell 2: 603-618 (1990)) or Kohl MG et al. (Bio / Technology 11: 194-200 (1993)), gold or tungsten particles are coated with pKK clock. and the overlaid particles are implanted into immature maize embryos or suspended cultured cells. The transformed cells are selected from the transformed cells, the calli obtained from the transformed cells are cultured according to the conventional method, and the tissue is regenerated from the tissues. Not only the particle gun method, but also the electroporation method (Rhodes C.A. et al., Science 240: 204-207 (1988)), the PEG method (Armstrong C.L. et al.

Plant Cell Reports 9: 335-339 (1990)], tissue electroporation method (D'Halluin K. et al., The Plant Cell 4, 1495-1505 (1992)), Agrobacterium method [Hiei Y. and Komari T. WO 9400977], and the like., The plants thus obtained are seeded and germinated to produce plants.

PPDK was isolated from plant leaves and tested for cold tolerance. For both transformed and untransformed plants, the effect of temperature on photosynthesis is monitored. Transformation stability is assured by propagating maize plants that undergo rapid photosynthesis for many generations at low temperatures and measuring the rate of photosynthesis at various temperatures and the cold tolerance of PPDKs isolated from plants.

Example 5

Transformation of Flaveria bidentis into Flaveria brown

PPDK gene

An intermediate vector containing the full-length cDNA shown in SEQ ID NO: 5 and a reporter gene were inserted into the disrupted Tipplasmid of Agrobacterium tumefaciens. This can be accomplished using the method described in Draper et al., "Laboratory Manual for Genetic Transformation and Gene Expression - A Laboratory Manual," ed. Draper, Blacwell Scientific Publications (ISBN 0-632-02172-1). Alternatively, the leaf tissue or callus of Flaveria bidentis is infected with the aforementioned Agrobacterium tumefaciens. This can be done by co-culturing the tissue or callus with Agrobacterium tumefaciensse. Infected cells are selected for drug resistance. From the selected calli, whole plants are regenerated according to a method known per se. Seeds obtained from the plants thus obtained are germinated and plants grown therefrom. PPDK was isolated from le15 cells of the resulting plants and tested for cold tolerance. For both transformed and untransformed plants, the effect of temperature on the rate of photosynthesis is investigated. Transformation stability is assured by propagating maize 20 plants that undergo rapid photosynthesis at low temperatures for many generations, while measuring the rate of photosynthesis at various temperatures and the cold tolerance of PPDKs isolated from plants.

SEQUENCE LIST

DETAILS OF SEQ ID NO: 1:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 2915

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 1:

CGATCTCCTT CTGCTATTGC TGATATCTCA ATTTCACAGG TGAAGAAGG ATG ATG AGT 5 8 Me t Me t Ser 1

TCG Ser TTG Leu 5 TCT GTT GAA GGT ATG CTT CTC AAG TCA GCC CGT GAG TCG TGC Cys 106 Ser Va 1 Glu Gly Me t 10 Leu Leu Lys Ser Al a 15 Arg Glu Ser TTA CCG GCG AGA GTG AAG CAA CGG CGA AAC GGT DAM CTC CGG CGA TTG 154 Leu 20 Pro Al a Arg With Lys 25 Gin Arg Arg Asn Gly 30 asp Leu Arg Arg Leu 35 AAC CAC CAC CGT CAA TCG TCG TTT GTC CGG TGT TTA ACT CCG GCG AGA 202 Asn Hi s Hi s Arg Gin 40 Ser Ser Phe Va 1 Arg 45 Cy s Leu Thr Pro Al a 50 Arg GTT AGC AGA CCA GAG TTG CGC AGC AGT GGC TTA ACT CCG CCG CGA GCA 250 With Ser Arg Pro 55 Glu Leu Arg Ser Ser 60 Gly Leu Thr Pro Pro 65 Arg Al a GTT CTT AAT CCG GTG TCT CCT CCG GTG ACG ACG GCT AAA AAG AGG GTT 298 With Leu Asn 70 Pro Va 1 Ser Pro Pro 75 With Thr Thr Al a Lys 80 Ly s Arg Va 1 TTC ACT TTT GGT AAA GGA AGA AGT GAA GGC AAC AGG GAC ATG AAA TCC 346 Phe Thr 85 Phe Gly Ly s Gly Arg 90 Ser Glu Gly As n Arg 95 asp Me t Ly s Ser

HU 222 186 BI

TTG TTG GGA GGA AAA GGA GCA AAT CTT GCT GAG ATG TCA Ser AGC Ser ATT Ile GGT Gly 115 394 Leu 100 Leu Gly Gly Lys Gly 105 Al a Asn Leu Alá G1 u Me t 110 CTA TCA GTT CCT CCT GGG CTC ACT ATT TCA ACT GAA GCA TGT GAG GAA 442 Leu Ser With Mrs. Pro Gly Leu Thr Ile Ser Thr Glu Al a Cy s Glu Glu 120 125 130 TAT CAA CAA AAT GGA AAG AGC CTA CCT CCA GGT TTG TGG DAM GAG ATT 490 Tyr Gin Gin Asn Gly Ly s Ser Leu Pro Pro Gly Leu Trp As p Glu Ile 135 140 145 TCA GAA GGC TTA DAM TAT GTC CAG AAA GAG ATG TCT GCA TCT CTC GGT 538 Ser Glu Gly Leu asp Tyr Va 1 G1 n Ly s Glu Me t Ser Al a Ser Leu Gly 150 155 160 GAC CCG TCT AAA CCT CTC CTC CTT TCC GTC CGT TCG GGT GCT GCC OVER THE 586 asp Pro Ser Ly s Pro Leu Leu Leu Ser With Arg Ser Gly Al a below Ile 165 170 175 TCT ATG CCT GGT ATG ATG GAC ACT GTA TTG AAT CTC GGG CTT AAT DAM 634 Ser Me t Pro Gly Me t Me t As p Thr Va 1 Leu Asn Leu Gly Leu As n asp 180 185 190 195 GAG GTC GTA GCT GGT CTA GCT GGC AAA AGT GGA GCA CGG TTT GCC TAT 682 Glu With With Al a Gly Leu Al a Gly Lys Ser Gly Al a Arg Phe Al a Tyr 200 205 210 GAC TCG TAT AGA AGG TTT CTC DAM ATG TTT GGC AAC GTT GTA ATG GGT 730 asp Ser Tyr Arg Arg Phe Leu As p Me t Phe Gly Asn Va 1 Va 1 Me t Gly 215 220 225 ATC CCG CAT TCA TTA TTT GAC GAA AAG TTA GAG CAG ATG AAA GCT GAA 778 Ile Pro Hi s Ser Leu Phe As p Glu Lys Leu Glu Gin Me t Lys below Glu 230 235 240 AAA GGG ATT CAT CTC GAC ACC DAM CTC ACT GCT GCT DAM CTT AAA DAM 826 Ly s Gly Ile Hi s Leu asp Thr As p Leu Thr Al a Al a As p Leu Ly s asp 245 250 255 CTT GTT GAG AAA TAC AAG AAC GTG TAT GTG GAA GCA AAG GGC GAA AAG 874 Leu With Glu Lys Tyr Lys Asn Va 1 Tyr With G1 u Al a Ly s Gly Glu Lys 260 265 270 275 TTT CCC ACA DAM CCA AAG AAA CAG CTA GAG TTA GCA GTG AAT GCT GTT 922 Phe Pro Thr asp Pro Lys Ly s Gin Leu Glu Leu Al a With Asn Al a Va 1 280 285 290 TTT DAM TCT TGG GAC AGC CCA AGG GCC AAT AAG TAC AGA AGT ATT AAC 970 Phe As p Ser Trp asp Ser Pro Arg Al a Asn Ly s Tyr Arg Ser Ile Asn 295 300 305 CAG OVER THE ACT GGA TTA AAG GGG ACT GCA GTT AAC ATT CAA AGC ATG GTG 1018 Gin Ile Thr Gly Leu Lys Gly Thr Al a With Asn Ile Gin Ser Me t Va 1 310 315 320 TTT GGC AAC ATG GGA AAC ACT TCA GGA ACT GGT GTT CTT TTC ACT AGG 1066 Phe Gly Asn Me t Gly Asn Thr Ser Gly Thr Gly With Leu Phe Thr Arg 325 330 335

HU 222 186 Bl

AAC Asn 340 CCA Pro AGC Ser ACC Thr GGT GAG AAG AAG CTA TAC GGG GAG TTT TTA Leu ATC Ile AAT Asn 355 1114 Gly Glu 345 Lys Ly s Leu Tyr Gly 350 Glu Phe GCT CAG GGA GAG DAM GTT GTT GCT GGG ATC AGA ACA CCA GAA DAM TTG 1162 Al a Gin Gly Glu asp With With Al a Gly Ile Arg Thr Pro Glu As p Leu 360 365 370 GGG ACC ATG GAG ACT TGC ATG CCT DAM GCA TAC AAA GAG CTT GTG GAG 1210 Gly Thr Me t Glu Thr Cy s Me t Pro As p below Tyr Lys Glu Leu With Glu 375 380 385 AAC TGC GAG ATC TTA GAG GGA CAC TAC AAA DAM ATG ATG DAM ATT GAA 1258 Asn Cy s Glu Ile Leu Glu Gly Hi s Tyr Lys As p Me t Me t As p Ile Glu 390 395 400 TTC ACA GTT CAA GAA AAC AGG CTT TGG ATG TTG CAA TGC CGA ACA GGG 1306 Phe Thr With Gin G1 u Asn Arg Le u Trp Me t Le u Gin Cy s Arg Thr Gly 405 410 415 AAA CGT ACT GGT AAA GGT GCA GTG AGA ATT GCA GTA DAM ATG GTG AAC 1354 Lys Arg Thr Gly Lys Gly below With Arg Ile Al a Va 1 As p Me t Va 1 Asn 420 425 430 435 GAA GGG CTA ATT DAM ACT AGA ACA GCA ATT AAG AGG GTT GAG ACT CAA 1402 Glu Gly Leu Ile As p Thr Arg Thr Al a Ile Ly s Arg With Glu Thr Gin 440 445 450 CAT CTA DAM CAG CTT CTT CAT CCA CAG TTT GAG DAM CCG TCT GCT TAC 1450 Hi s Leu asp Gin Le u Leu Hi s Pro Gin Phe Glu asp Pro Ser Al a Tyr 455 460 465 AAA AGC CAT GTG GTA GCA ACC GGT TTG CCA GCA TCC CCC GGG GCA GCT 1498 Ly s Ser Hi s With With Al a Thr Gly Leu Pro Al a Ser Pro Gly Al a Al a 470 475 480 GTG GGA CAG GTT TGT TTT AGT GCA GAG DAM GCA GAA ACA TGG CAT GCA 1546 With Gly Gin Va 1 Cy s Phe Ser below Glu As p Al a Glu Thr Trp Hi s Al a 485 490 495 CAA GGA AAG AGT GCT ATC TTG GTA AGG ACC GAA ACA AGC CCA GAA DAM 1594 Gin Gly Lys Ser Al a Ile Leu With Arg Thr Glu Thr Ser Pro Glu asp 500 505 510 515 GTT GGT GGT ATG CAT GCA GCA GCT GGA ATC TTA ACC GCT AGA GGA GGC 1642 With Gly Gly Me t Hi s Al a Al a Al a Gly Ile Leu Thr Al a Arg Gly Gly 520 525 530 ATG ACA TCA CAT GCA GCG GTG GTG GCT CGC GGA TGG GGC AAA TGT TGT 1690 Me t Thr Ser Hi s Al a Al a With Va 1 Al a Arg Gly Trp Gly Ly s Cy s Cy s 535 540 545 GTT TCC GGT TGT GCT DAM ATT CGT GTG AAC DAM DAM ATG AAG ATT TTT 1738 With Ser G1 y Cy s Al a asp Ile Arg With Asn As p asp Me t Ly s Ile Phe 550 555 560 ACG ATT GGC GAC CGT GTG ATT AAA GAA GGC GAC TGG CTT TCT CTT AAT 1786 Thr Ile Gly As p Arg Va 1 Ile Ly s Glu Gly As p Trp Leu Ser Leu Asn 565 570 575

HU 222 186 Β1

GGT Gly 580 ACA Thr ACT Thr GGT Gly GAA GTC ATA TTG GGT AAA CAG CTA CTG GCT CCA CCT 1834 Glu With 585 Ile Leu Gly Ly s Gin 590 Leu Leu Al a Pro Pro 595 GCA ATG AGC AAT GAC TTA GAA OVER THE TTC ATG TCA TGG GCT DAM CAA GCA 1882 Al a Me t Ser Asn As p 600 Leu Glu Ile Phe Me t 605 Ser Trp Al a asp Gin 610 Al a AGG CGT CTC AAG GTT ATG GCA AAT GCA GAC ACA CCT AAT DAM GCA TTA 1930 Arg Arg Leu Ly s 615 With Me t Al a As n Al, 620 asp Thr Pro Asn asp 625 Al a Leu ACA GCC AGA AAC AAT GGT GCA CAA GGG ATC GGG CTC TGT AGA ACT GAA 1978 Thr Al a Arg 630 Asn As n Gly Al a Gin 635 Gly Ile Gly Leu Cys 640 Arg Thr Glu CAT ATG TTT TTC GCT TCT DAM GAG AGG ATC AAA GCT GTA AGA AAG ATG 2026 Hi s Me t 645 Phe Phe Al a Ser As p 650 Glu Arg Ile Ly s Al, 655 Va 1 Arg Ly s Me t ATC ATG GCG GTC ACT CCA GAA CAA AGA AAA GTG GCT CTA DAM CTC TTA 2074 Ile 660 Me t Al a With Thr Pro 665 Glu Gin Arg Lys Va 1,670 Al a Leu As p Leu Leu 675 CTC CCA TAC CAA AGA TCC DAM TTT GAG GGC ATT TTC CGA GCA ATG DAM 2122 Leu Pro Tyr Gin Arg 680 Ser As p Phe Glu Gly 685 Ile Phe Arg Al a Me t 690 As p GGA CTT CCT GTA ACT ATC CGC CTT CTA GAC CCT CCA CTT CAT GAG TTT 2170 Gly Leu Pro With 695 Thr Ile Arg Leu Leu 700 asp Pro Pro Leu Hi s 705 Glu Phe TTA CCC GAA GGT DAM CTA GAA CAC OVER THE GTG AAC GAA CTT GCA GTC GAC 2218 Leu Pro Glu 710 Gly As p Leu Glu Hi s 715 Ile With Asn Glu Leu 720 Al a With asp ACA GGC ATG AGT GCA DAM GAA ATC TAT TCA AAA ATC GAA AAT CTA TCT 2266 Thr Gly 725 Me t Ser Al a As p Glu 730 Ile Tyr Ser Ly s I le 735 Glu Asn Leu Ser GAA GTG AAC CCT ATG CTT GGT TTC CGT GGT TGC AGA TTA GGG ATT TCA 2314 Glu 740 Va 1 Asn Pro Me t Leu 745 Gly Phe Arg Gly Cys 750 Arg Leu Gly I le Ser 755 TAC CCC GAG CTA ACA GAA ATG CAA GTT CGT GCG ATC TTT CAA GCT GCA 2362 Tyr Pro Glu Leu Thr 760 Glu Me t Gin Va 1 Arg 765 Al a I le Phe Gin Al, 770 Al a GTG TCT ATG ACC AAT CAG GGG GTG ACT GTA OVER THE CCA GAG ATC ATG GTT 2410 With Ser Me t Thr 775 As n Gin Gly With Thr 780 With 11 e Pro Glu Ile 785 Me t Va 1 CCG TTA GTG GGG ACA CCT CAG GAA TTA CGT CAT CAA ATC AGT GTA ATT 2458 Pro Leu With 790 Gly Thr Pro Gin G1 u 795 Leu Arg Hi s Gin Ile 800 Ser With Ile CGT GGA GTA GCT GCA AAT GTG TTT GCT GAA ATG GGG GTG ACA TTG GAA 2506 Arg Gly 805 With Al a Al a Asn With 810 Phe Al a Glu Me t Gly 815 With Thr Leu Glu

HU 222 186 Bl

TAT Tyr 820 AAA Ly s GTG GGA ACG ATG Me t 825 ATT Ile GAG Glu ATT Ile CCT CGA GCT GCT Al a TTA Leu OVER THE Ile GCT Al, 835 2554 With Gly Thr Pro Arg 830 Al a GAA GAG ATT GGA AAA GAA GCT DAM TTC TTT TCG TTT GGA ACC AAT DAM 2602 Glu Glu Ile Gly Ly s Glu Al a As p Phe Phe Ser Phe Gly Thr Asn As p 840 845 850 CTG ACC CAG ATG ACA TTT GGG TAC AGC AGA DAM DAM GTT GGC AAG TTT 2650 Leu Thr Gin Me t Thr Phe Gly Tyr Ser Arg As p asp With Gly Lys Phe 855 860 865 TTG CAG ATT TAT CTT GCT CAA GGC ATT CTG CAG CAT DAM CCA TTT GAG 2698 Leu Gin Ile Tyr Leu Al a Gin Gly Ile Leu Gin Hi s As p Pro Phe Glu 870 875 880 GTT ATT GAC CAG AAA GGG GTG GGT CAG TTG ATT AAG ATG GCT ACG GAG 2746 With Ile asp Gin Ly s Gly With Gly Gin Leu Ile Lys Me t Al a Thr Glu 885 890 895 AAA GGT CGT GCA GCA AAT CCT AAC TTA AAG GTT GGG OVER THE TGT GGG GAG 2794 Lys Gly Arg Al a Al a Asn Pro Asn Leu Lys Va 1 Gly Ile Cy s Gly Glu 900 905 910 915 CAT GGT GGG GAG CCT TCT TCT GTT GCA TTT TTT DAM GGA GTT GGA CTA 2842 Hi s Gly Gly Glu Pro Ser Ser Va 1 Al a Phe Phe asp Gly Va 1 Gly Leu 920 925 930 DAM TAT GTG TCG TGC TCT CCA TTT AGG GTT CCT ATC GCA AGG TTG GCC 2890 asp Tyr With Ser Cys Ser Pro Phe Arg Va 1 Pro Ile Al a Arg Leu Al a 935 940 945 GCT GCA CAA GTC ATT GTT TAAGCTT 2915 Al a Al a Gin With He With

950

DETAILS OF SEQ ID NO: 2:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 2880

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 2:

CGGCGCAGTA GGGGATCGGA AGG ATG GCG GCA TCG GTT TCC AGG GCC ATC TGC 5 3

Met Alá Alá Ser Val Ser Arg Alá Ile Cys

5 10

GTA CAG AAG CCG GGC TCA AAA TGC ACC AGG GAC AGG GAA GCG ACC TCC With Gin Lys Pro Gly 15 Ser Lys Cys Thr Arg 20 As p Arg Glu Al a Thr 25 Ser TTC GCC CGC CGA TCG GTC GCA GCG CCG AGG ccc CCG CAC GCC AAA GCC Phe Al a Arg Arg 30 Ser With Al a Al a Pro 35 Arg Pro Pro Hi s Al a 40 Lys Al a CGC CGG CGT CAT CCG CTC CGA CTC CGG CGC GGG ACG GGG CCA CAT TGC Arg Arg Arg 45 Hi s Pro Leu Arg Leu 50 Arg Arg Gly Thr Gly 55 Pro Hi s Cys TCG CCG CTG AGG GCC GTC GTT GAC GCC GCG CCG OVER THE CAG ACG ACC AAA Ser Pro 60 Leu Arg Al a Va 1 Va 1 65 As p below Al a Pro Ile 70 Gin Thr Thr Lys

HU 222 186 Bl

AAG Ly s 75 AGG Arg GTG With TTC Phe CAC Hi s TTC GGC AAG GGC AAG AGC Ser 85 GAG GGC AAC AAG ACC Thr 90 293 Phe 80 Gly Lys Gly Ly s Glu Gly Asn Ly s ATG AAG GAA CTG CTG GGC GGC AAG GGC GCG AAC CTG GCG GAG ATG GCG 341 Me t Lys Glu Leu Leu 95 Gly Gly Ly s Gly Al a 100 Asn Leu Al a Glu Me t 105 Ala AGC ATC GGG CTG TCG GTG CCG CCA GGG TTC ACG GTG TCG ACG GAG GCG 389 Ser Ile Gly Leu 110 Ser With Pro Pro Gly 115 Phe Thr With Ser Thr 120 Glu Al a TGC CAG CAG TAC CAG GAC GCC GGG TGC GCC CTC CCC GCG GGG CTC TGG 437 Cys Gin Gin 125 Tyr Gin As p Ala Gly 130 Cys Al a Le u Pro Ala 135 Gly Leu Trp GCC GAG ATC GTC GAC GGC CTG CAG TGG GTG GAG GAG TAC ATG GGC GCC 485 Al a Glu 140 Ile With As p Gly Leu 145 Gin Trp With Glu Glu 150 Tyr Me t Gly Al a ACC CTG GGC DAM CCG CAG CGC CCG CTC CTG CTC TCC GTC CGC TCC GGC 533 Thr 155 Le u Gly asp Pro Gin 160 Arg Pro Leu Leu Leu 165 Ser Va 1 Arg Ser Gly 170 GCC GCC GTG TCC ATG CCC GGC ATG ATG GAC ACG GTG CTC AAC CTG GGG 581 Ala Al a With Ser Me t 175 Pro Gly Me t Me t asp 180 Thr With Leu Asn Leu 185 G1 y CTC AAC GAC GAA GTG GCC GCC GGG CTG GCG GCC AAG AGC GGG GAG CGC 629 Leu As n asp Glu 190 With Al a Ala Gly Leu 195 Al a Al a Ly s Ser Gly 200 Glu Arg TTC GCC TAC GAC TCC TTC CGC CGC TTC CTC GAC ATG TTC GGC AAC GTC 677 Phe Ala Tyr 205 asp Ser Phe Arg Arg 210 Phe Leu asp Me t Phe 215 Gly Asn With GTC ATG GAC ATC CCC CGC TCA CTG TTC GAA GAG AAG CTT GAG CAC ATG 725 With Me t 220 asp Ile Pro Arg Ser 225 Leu Phe Glu Glu Lys 230 Leu G1 u Hi s Me t AAG GAA TCC AAG GGG CTG AAG AAC GAC ACC GAC CTC ACG GCC TCT GAC 773 Lys 235 Glu Ser Ly s Gly Leu 240 Lys Asn asp Thr asp 245 Leu Thr Al a Ser As p 250 CTC AAA GAG CTC GTG GGT CAG TAC AAG GAG GTC TAC CTC TCA GCC AAG 821 Leu Lys Glu Leu With 255 Gly Gin Tyr Lys Glu 260 Va 1 Tyr Leu Ser Al a 265 Ly s GGA GAG CCA TTC CCC TCA GAC CCC AAG AAG CAG CTG GAG CTA GCA GTG 869 Gly Glu Pro Phe 270 Pro Ser asp Pro Ly s 275 Lys Gin Leu Glu Leu 280 Al a Va 1 CTG GCT GTG TTC AAC TCG TGG GAG AGC CCC AGG GCC AAG AAG TAC AGG 917 Leu Al a Va. 1 285 Phe Asn Ser Trp G1 u 290 Ser Pro Arg Al a Ly s 295 Ly s Tyr Arg AGC ATC AAC CAG ATC ACT GGC CTC AGG GGC ACC GCC GTG AAC GTG CAG 965 Ser Ile 300 Asn Gin Ile Thr Gly 305 Leu Arg Gly Thr Al a 310 Va 1 Asn Va 1 Gin

HU 222 186 Β1

TGC ATG GTG With TTC Phe GGC AAC ATG Gly Asn Met 320 GGG Gly AAC ACT TCT GGC ACC GGC GTG CTC Leu 330 1013 Cys 315 Me t Asn Thr Ser 325 Gly Thr Gly With TTC ACC AGG AAC CCC AAC ACC GGA GAG AAG AAG CTG TAT GGC GAG TTC 1061 Phe Thr Arg Asn Pro Asn Thr Gly Glu Lys Ly s Leu Tyr Gly Glu Phe 335 340 345 CTG GTG AAC GCT CAG GGT GAG DAM GTG GTT GCC GGA OVER THE AGA ACC CCA 1109 Leu With Asn Al a Gin Gly Glu asp With Va 1 Al a Gly Ile Arg Thr Pro 350 355 360 GAG GAC CTT GAC GCC ATG AAG AAC CTC ATG CCA CAG GCC TAC GAC GAG 1157 Glu As p Leu As p Al a Me t Ly s Asn Leu Me t Pro Gin Al a Tyr asp Glu 365 370 375 CTT GTT GAG AAC TGC AAC ATC CTG GAG AGC CAC TAC AAG GAA ATG CAG 1205 Leu With Glu Asn Cy s Asn Ile Leu Glu Ser Hi s Tyr Ly s Glu Me t Gin 380 385 390 DAM ATC GAG TTC ACT GTC CAG GAA AAC AGG CTG TGG ATG TTG CAG TGC 1253 As p Ile Glu Phe Thr With Gin Glu Asn Arg Leu Trp Me t Leu Gin Cys 395 400 405 410 AGG ACA GGG AAA CGT ACG GGC AAA AGT GCC GTG AAG ATC GCC GTG GAC 1301 Arg Thr Gly Ly s Arg Thr Gly Ly s Ser below With Ly s Ile Al a With asp 415 420 425 ATG GTT AAC GAG GGC CTT GTT GAG CCC CGC TCA GCG ATC AAG ATG GTA 1349 Me t With Asn Glu Gly Leu With Glu Pro Arg Ser Al a Ile Ly s Me t Va 1 430 435 440 GAG CCA GGC CAC CTG GAC CAG CTT CTT CAT CCT CAG TTT GAG AAC CCG 1397 Glu Pro Gly Hi s Leu As p Gin Leu Leu Hi s Pro Gin Phe Glu Asn Pro 445 450 455 TCG GCG TAC AAG DAM CAA GTC ATT GCC ACT GGT CTG CCA GCC TCA CCT 1445 Ser Al a Tyr Lys As p Gin Va 1 Ile Al a Thr Gly Leu Pro Al a Ser Pro 460 465 470 GGG GCT GCT GTG GGC CAG GTT GTG TTC ACT GCT GAA DAM GCT GAA GCA 1493 Gly Al a Al a With Gly Gin With With Phe Thr Al a Glu asp Al a Glu Al a 475 480 485 490 TGG CAT TCC CAA GGG AAA GCT GCT ATT CTG GTA AGG GCG GAG ACC AGC 1541 Trp Hi s Ser Gin Gly Lys Al a Al a Ile Leu With Arg below Glu Thr Ser 495 500 505 CCT GAG GAC GTT GGT GGC ATG CAC GCT GCT GTG GGG ATT CTT ACA GAG 1589 Pro Glu asp With Gly Gly Me t Hi s Al a Al a Va 1 Gly Ile Leu Thr Glu 510 515 520 AGG GGT GGC ATG ACT TCC CAC GCT GCT GTG GTC GCA CGT TGG TGG GGG 1637 Arg Gly Gly Me t Thr Ser Hi s Al a Al a With With Al a Arg Trp Trp Gly 525 530 535 AAA TGC TGC GTC TCG GGA TGC TCA GGC ATT CGC GTA AAC DAM GCG GAG 1685 Lys Cy s Cy s With Ser G1 y Cys Ser Gly Ile Arg With Asn As p Al a Glu 540 545 550

HU 222 186 Bl

AAG CTC GTG ACG ATC GGA Gly 560 AGC Ser CAT Hi s GTG With CTG CGC GAA GGT GAG TGG CTG 1733 Lys 555 Leu Va 1 Thr Ile Leu Arg 565 Glu Gly Glu Trp Leu 570 TCG CTG AAT GGG TCG ACT GGT GAG GTG ATC CTT GGG AAG CAG CCG CTT 1781 Ser Leu Asn Gly Ser 575 Thr Gly Glu With Ile 580 Leu Gly Ly s Gin Pro 585 Leu TCC CCA CCA GCC CTT AGT GGT DAM CTG GGA ACT TTC ATG GCC TGG GTG 1829 Ser Pro Pro Al, 590 Leu Ser Gly As p Leu 595 Gly Thr Phe Me t Al a 600 Trp With DAM DAM GTT AGA AAG CTC AAG GTC CTG GCT AAC GCC DAM ACC CCT DAM 1877 asp asp With 605 Arg Ly s Leu Ly s Va 1,610 Leu Al a As n Al a As p 615 Thr Pro asp DAM GCA TTG ACT GCG CGA AAC AAT GGG GCA CAA GGA ATT GGA TTA TGC 1925 asp Al, 620 Leu Thr Al a Arg Asn 625 Asn Gly Al a Gin Gly 630 Ile Gly Leu Cy s CGG ACA GAG CAC ATG TTC TTT GCT TCA GAC GAG AGG ATT AAG GCT GTC 1973 Arg 635 Thr Glu Hi s Me t Phe 640 Phe Al a Ser As p Glu 645 Arg Ile Ly s Al a Va 1,650 AGG CAG ATG ATT ATG GCT CCC ACG CTT GAG CTG AGG CAG CAG GCG CTC 2021 Arg Gin Me t Ile Me t 655 Al a Pro Thr Leu Glu 660 Leu Arg Gin Gl n Al, 665 Leu GAC CGT CTC TTG ACG TAT CAG AGG TCT GAC TTC GAA GGC ATT TTC CGT 2069 asp Arg Leu Leu 670 Thr Tyr Gin Arg Ser 675 As p Phe Glu Gly Ile 680 Phe Arg GCT ATG DAM GGA CTC CCG GTG ACC ATC CGA CTC CTG GAC CAT CCT TCT 2117 Al a Me t asp 685 Gly Leu Pro With Thr 690 Ile Arg Le u Leu asp 695 Hi s Pro Ser TAC GAG TTC CTT CCA GAA GGG AAC ATC GAG GAC ATT GTA AGT GAA TTA 2165 Tyr Glu 700 Phe Leu Pro Glu Gl y 705 Asn I 1 e Glu As p Ile 710 With Ser Glu Leu TGT GCT GAG ACG GGA GCC AAC CAG GAG DAM GCC CTC GCG CGA ATT GAA 2213 Cys 715 Al a Glu Thr Gly below 720 Asn Gin Glu As p Al, 725 Leu below Arg Ile Glu 730 AAG CTT TCA GAA GTA AAC CCG ATG CTT GGC TTC CGT GGG TGC AGG CTT 2261 Ly s Leu Ser Glu With 735 Asn Pro Me t Leu Gly 740 Phe Arg Gly Cys Arg 745 Leu GGT OVER THE TCG TAC CCT GAA TTG ACA GAG ATG CAA GCC CGG GCC ATT TTT 2309 Gly Ile Ser Tyr 750 Pro Glu Leu Thr Glu 755 Me t Gin below Arg Al, 760 Ile Phe GAA GCT GCT OVER THE GCA ATG ACC AAC CAG GGT GTT CAA GTG TTC CCA GAG 2357 Glu Al a Al at 765 Ile Al a Me t Thr Asn 770 Gin Gly Va 1 Gin Va 1,775 Phe Pro Glu OVER THE ATG GTT CCT CTT GTT GGA ACA CCA CAG GAA CTG GGG CAT CAA GTG 2405 Ile Me t 780 With Pro Le u With Gly 785 Thr Pro Gin Glu Leu 790 Gly Hi s Gin Va 1

HU 222 186 BI

ACT CTT ATC CGC Arg CAA GTT GCT GAG AAA Lys GTG With TTC Phe 805 GCC Al a AAT Asn GTG With GGC Gly AAG Ly s 810 2453 Thr 795 Leu Ile Gin Va 1,800 Al a Glu ACT ATC GGG TAC AAA GTT GGA ACA ATG ATT GAG ATC CCC AGG GCA GCT 2501 Thr Ile Gly Tyr Ly s With Gly Thr Me t Ile Glu Ile Pro Arg Al a Al a 815 820 825 CTG GTG GCT DAM GAG OVER THE GCG GAG CAG GCT GAA TTC TTC TCC TTC GGA 2549 Leu Va 1 Al a asp Glu Ile Al a Glu Gin Al a Glu Phe Phe Ser Phe Gly 830 835 840 ACG AAC GAC CTG ACG CAG ATG ACC TTT GGG TAC AGC AGG DAM DAM GTG 2597 Thr As n As p Leu Thr Gin Me t Thr Phe Gly Tyr Ser Arg asp As p With 845 850 855 GGA AAG TTC ATT CCC GTT CAT CTT GCT CAG GGC ATC CTC CAA CAT GAC 2645 Gly Ly s Phe Ile Pro Va 1 Hi s Leu Al a Gin Gly Ile Leu Gin Hi s asp 860 865 870 CCC TTC GAG GTC CTG GAC CAG AGG GGA GTG GGC GAG CTG GTG AAG TTT 2693 Pro Phe Glu With Leu As p Gin Arg Gly With Gly Glu Leu With Ly s Phe 875 880 885 890 GCT ACA GAG AGG GGC CGC AAA GCT AGG CCT AAC TTG AAG GTG GGC ATT 2741 Al a Thr G1 u Arg Gly Arg Ly s Al a Arg Pro Asn Leu Lys With Gly Ile 895 900 905 TGT GGA GAA CAC GGT GGA GAG CCT TCG TCT GTG GCC TTC TTC GCG AAG 2789 Cys Gly Glu Hi s Gly Gly Glu Pro Ser Ser With Al a Phe Phe Al a Ly s 910 915 920 GCT GGG CTG DAM TTC GTT TCT TGC TCC CCT TTC AGG GTT CCG ATT GCT 2837 Al a Gly Leu asp Phe With Ser Cy s Ser Pro Phe Arg With Pro Ile Al a 925 930 935 AGG CTA GCT GCA GCT CAG GTG CTT GTC TGAGGCTGCC TCCTCG 2880 Arg Leu Al a Al a Al a Gin With Leu With

940 945

DETAILS OF SEQ ID NO: 3:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 2610

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 3:

GAATTCTCAA TCCTTTGCTC ATCGCAGCAT ATCAATGTTA ACACATAAAC TTTAGGAGGA 60 AGAAAACTT ATG GCA AAA TGG GTT TAT AAG TTC GAA GAA GGC AAT GCA TCT 11 1

Met Alá Lys Trp Val Tyr Lys Phe Glu Glu Gly Asn Alá Ser 1 5 10

ATG Me t 15 AGA AAC CTT CTT Leu GGA GGC AAA GGC TGC Cys AAC CTT GCA GAG ATG ACC Arg Asn Leu Gly Gly 20 Ly s Gly Asn 25 Leu Al a Glu Me t Thr 30 ATC TTA GGA ATG CCG ATT CCA CAG GGC TTT ACT GTA ACA ACA GAA GCT Ile Leu Gly Me t Pro Ile Pro Gin Gly Phe Thr With Thr Thr Glu Al a 35 40 45

HU 222 186 Bl

TGT ACA GAG Glu TAC Tyr 50 TAC AAC AGT GGA AAA CAG ATC ACA Thr CAG Gin GAA ATT CAG Gin 255 Cy s Thr Tyr Asn Ser Gly Lys 55 Gin Ile Glu 60 Ile DAM CAG ATT TTC GAA GCT ATC ACA TGG TTA GAG GAA CTG AAC GGC AAG 303 As p Gin Ile 65 Phe Glu Al a I le Thr 70 Trp Leu Glu Glu Leu 75 Asn Gly Ly s AAG TTC GGC GAC ACT GAA DAM CCG TTA TTA GTA TCT GTA CGT TCC GCG 351 Ly s Phe 80 Gly asp Thr Glu asp 85 Pro Leu Leu Va 1 Ser 90 With Arg Ser Al a GCC CGC GCA TCC ATG CCG GGT ATG ATG DAM ACC ATC CTG AAC CTT GGT 399 Al a Arg Al a Ser Me t Pro 100 Gly Me t Me t As p Thr 105 Ile Leu As n Leu Gly 110 TTA AAC GAC GTT GCA GTA GAG GGC TTT GCA AAG AAA ACG GGA AAT CCA 447 Leu Asn asp With Al With Glu Gly Phe Al at 120 Ly s Ly s Thr G1 y Asn 125 Pro AGA TTT GCA TAT DAM TCT TAC AGA AGA TTT ATC CAG ATG TAT TCC GAC 495 Arg Phe Al a Tyr 130 As p Ser Tyr Arg Arg 135 Phe Ile Gin Me t Tyr 140 Ser asp GTA GTT ATG GAA GTT CCG AAG TCC CAT TTC GAG AAA ATC ATC DAM GCG 543 With With Me t 145 Glu With Pro Ly s That's 150 Hi s Phe Glu Ly s Ile 155 Ile asp Al a ATG AAA GAA GAA AAG GGC GTT CAC TTC DAM ACA GAC CTG ACT GCC DAM 591 Me t Lys 160 Glu Glu Lys Gly With 165 Hi s Phe asp Thr As p 170 Leu Thr Al a As p DAM TTA AAA GAG CTG GCT GAG AAG TTC AAA GCT GTT TAC AAA GAG GCT 639 asp 175 Leu Lys Glu Le u below 180 Glu Lys Phe Ly s Al a 185 With Tyr Ly s Glu Al a 190 ATG AAC GGC GAA GAG TTC CCA CAG GAG CCG AAG DAM CAG TTA ATG GGC 687 Me t Asn Gly Glu Glu 195 Phe Pro Gin Glu Pro 200 Ly s asp Gin Leu Me 205 Gly GCT GTT AAA GCA GTT TTC CGT TCC TGG GAC AAC CCT CGT GCA ATC GTA 735 Al a Va 1 Lys Al, 210 Va 1 Phe Arg Ser Trp 215 asp As n Pro Arg Al a 220 Ile With TAC CGC CGT ATG AAC DAM ATC CCT GGA GAC TGG GGT ACT GCA GTT AAC 783 Tyr Arg Arg 225 Me t Asn As p Ile Pro 230 Gly As p Trp Gly Thr 235 Al a With Asn GTT CAG ACC ATG GTA TTT GGT AAC AAG GGC GAG ACC AGC GGT ACA GGC 831 With Gin 240 Thr Me t With Phe G1 y 245 As n Lys Gly Glu Thr 250 Ser G1 y Thr Gly GTT GCC TTC ACA CGT AAC CCA TCC ACA GGT GAA AAA GGC ATC TAC GGT 879 With 255 Al a Phe Thr Arg Asn 260 Pro Ser Thr Gly Glu 265 Lys Gly 11 e Tyr Gly 270 GAG TAC CTG ATC AAT GCA CAG GGC GAG GAC GTA GTT GCA GGT GTC CGC 927 Glu Tyr Leu Ile As n Al a Gin Gly Glu asp With With Al a Gly With Arg

275 280 285

HU 222 186 Bl

ACA CCA CAG CCT ATC ACC CAG TTA GAG AAC GAT ATG CCT GAC TGC TAC Tyr 975 Thr Pro Gin Pro 290 Ile Thr Gin Leu Glu 295 Asn As p Me t Pro asp 300 Cys AAG CAG TTC ATG DAM CTG GCC ATG AAG CTG GAG AAA CAT TTC CGT GAC 1023 Lys Gin Phe Me t asp Leu Ala Me t Lys Leu Glu Lys Hi s Phe Arg asp 305 310 315 ATG CAG DAM ATG GAG TTC ACA ATC GAG GAA GGT AAA TTA TAC TTC TTA 1071 Me t Gin As p Me t Glu Phe Thr Ile Glu Glu Gly Ly s Leu Tyr Phe Leu 320 325 330 CAG ACA CGT AAC GGC AAG AGA ACA GCT CCG GCT GCT CTT CAG ATT GCC 1119 Gin Thr Arg Asn Gly Ly s Arg Thr Al a Pro Al a Al a Leu Gin I 1 e Ala 335 340 345 350 TGC DAM TTA GTA GAC GAA GGC ATG ATC ACA GAG GAA GAG GCT GTT GTA 1167 Cys asp Leu With asp Glu Gly Me t Ile Thr Glu Glu Glu Al a With With 355 360 365 AGA ATC GAA GCA AAA TCT CTT DAM CAG TTA CTT CAC CCG ACC TTC AAC 1215 Arg Ile Glu Ala Ly s Ser Leu As p Gin Leu Leu Hi s Pro Thr Phe Asn 370 375 380 CCG GCT GCT TTA AAG GCC GGC GAA GTA ATC GGT TCC GCT CTT CCG GCA 1263 Pro Al a Ala Leu Ly s Al a Gly Glu With Ile Gly Ser Al a Leu Pro Al a 385 390 395 TCT CCT GGC GCA GCA GCA GGT AAA GTA TAC TTC ACC GCT DAM GAG GCT 1311 Ser Pro Gly Al a Al a Al a Gly Ly s Va 1 Tyr Phe Thr Al a As p Glu Al a 400 405 410 AAG GCT GCC CAC GAG AAG GGT GAG AGA GTT ATC CTT GTT CGT CTT GAG 1359 Lys Al a Al a Hi s Glu Lys Gly Glu Arg With Ile Leu With Arg Leu Glu 415 420 425 430 ACA TCT CCG GAA DAM ATC GAA GGT ATG CAT GCA GCC GAA GGT ATC CTG 1407 Thr Ser Pro Glu As p I le Glu Gly Me t Hi s Al a Al a Glu Gly Ile Leu 435 440 445 ACA GTG CGC GGC GGT ATG ACA AGC CAT GCA GCC GTA GTT GCA CGT GGT 1455 Thr Va 1 Arg Gly Gly Me t Thr Ser Hi s Al a Al a With Va 1 Al a Arg Gly 450 455 460 ATG GGA ACA TGC TGC GTA TCC GGA TGC GGT GAG ATC AAG ATC AAC GAA 1503 Me t Gly Thr Cy s Cy s With Ser Gly Cys Gly Glu Ile Ly s Ile Asn Glu 465 470 475 GAA GCT AAG ACA TTC GAA CTT GGC GGA CAC ACA TTT GCA GAG GGA DAM 1551 Glu Al a Ly s Thr Phe Glu Leu Gly Gly Hi s Thr Phe Al a Glu Gly asp 480 485 490 TAC ATC TCC TTA DAM GGT TCC ACA GGT AAG ATT TAC AAG GGC GAC ATC 1599 Tyr Ile Ser Leu As p Gly Ser Thr Gly Ly s Ile Tyr Ly s Gly asp Ile 495 500 505 510 GAG ACT CAG GAA CGT TCC GTA AGC GGA AGC TTC GAG CGT ATC ATG GTA 1647 Glu Thr Gin Glu Arg Ser With Ser Gly Ser Phe Glu Arg I 1 e Me t Va 1 515 520 525

HU 222 186 Β1

TGG GCT GAC AAG Ly s 530 TTC Phe AGA ACA TTA Leu AAG GTT CGT ACA AAT GCC GAC ACA 1695 Trp Under Asp Arg Thr Ly s 535 With Arg Thr Asn below 540 asp Thr CCG GAA GAT ACA CTC AAT GCC GTT AAA CTG GGT GCA GAG GGC ATC GGT 1743 Pro Glu Asp Thr Leu Asn Al a With Ly s Leu Gly Al a Glu Gly Ile Gly 545 550 555 CTT TGC CGT ACA GAG CAT ATG TTC TTC GAG GCT GAC AGA ATC ATG AAG 1791 Leu Cys Arg Thr Glu Hi s Me t Phe Phe Glu Al a asp Arg Ile Me t Ly s 560 565 570 ATC AGA AAG ATG ATC CTT TCC DAM TCA GTG GAA GCA AGA GAA GAG GCT 1839 Ile Arg Lys Me t I 1 e Leu Ser asp Ser Va 1 Glu Al a Arg Glu G1 u Al a 575 580 585 590 CTG AAC GAA TTA ATC CCG TTC CAG AAG GGC DAM TTC AAG GCT ATG TAC 1887 Leu Asn Glu Leu Ile Pro Phe Gin Lys Gly As p Phe Lys Al a Me t Tyr 595 600 605 AAA GCT CTG GAA GGC AGG CCA ATG ACG GTT CGC TAC CTG DAM CCG CCG 1935 Ly s Down Leu Glu Gly Arg Pro Me t Thr With Arg Tyr Leu As p Pro Pro 610 615 620 CTG CAT GAG TTC GTT CCT CAT ACA GAA GAG GAG CAG GCT GAA CTG GCT 1983 Leu His Glu Phe Va 1 Pro Hi s Thr Glu Glu Glu Gin Al a Glu Leu Al a 625 630 635 AAG AAC ATG GGC CTT ACT TTA GCA GAA GTA AAA GCA AAA GTT GAC GAA 2031 Lys Asn Met Gly Leu Thr Leu below Glu Va 1 Ly s Al a Ly s With As p Glu 640 645 650 TTA CAC GAG TTC AAC CCA ATG ATG GGC CAT CGT GGC TGC CGT CTT GCA 2079 Leu His Glu Phe Asn Pro Me t Me t Gly Hi s Arg Gly Cys Arg Leu Al a 655 660 665 670 GTT ACC TAT CCG GAA ATT GCA AAG ATG CAG ACA AGA GCC GTT ATG GAA 2127 With Thr Tyr Pro Glu Ile Al a Ly s Me t Gin Thr Arg Al a With Me t Glu 675 680 685 GCT GCT ATC GAA GTG AAG GAA GAG ACA GGA ATC DAM ATT GTT CCT GAG 2175 Al a Down Ile Glu Va 1 Lys Glu G1 u Thr Gly Ile As p Ile With Pro Glu 690 695 700 ATC ATG ATT CCG TTA GTT GGC GAG AAG AAA GAG CTT AAG TTC GTT AAG 2223 Ile Me t ile Pro Leu With Gly G1 u Ly s Lys G1 u Leu Ly s Phe Va 1 Lys 705 710 715 GAC GTA GTT GTG GAA GTA GCT GAG CAG GTT AAG AAA GAG AAA GGT TCC 2271 asp Val Val With Glu With Al a Glu Gin With Ly s Ly s Glu Ly s Gly Ser 720 725 730 DAM ATG CAG TAC CAC ATC GGT ACC ATG ATC GAA ATT CCT CGT GCA GCT 2319 asp Me t Gin Tyr Hi s Ile Gly Thr Me t Ile Glu Ile Pro Arg Al a Al a 735 740 745 750 CTC ACA GCA DAM GCC ATC GCT GAG GAA GCA GAG TTC TTC TCC TTC GGT 2367 Leu Thr Alá As p Al a Ile Al a Glu Glu Al a Glu Phe Phe Ser Phe Gly 755 760 765

HU 222 186 Bl

2415

ACA Thr AAC GAC TTA ACA CAG ATG Me t ACA TTC GGC TTC TCC CGT GAC Arg Asp 780 GAC asp GCC below Asn Asp Leu 770 Thr Gin Thr Phe 775 Gly Phe Ser GGC AAG TTC CTG DAM TCC TAC TAT AAA GCA AAA ATT TAT GAG TCC DAM Gly Lys Phe Leu As p Ser Tyr Tyr Ly s below Lys I le Tyr Glu Ser asp 785 790 795 CCA TTC GCA AGA CTT GAC CAG ACA GGC GTT GGC CAG TTA GTA GAG ATG Pro Phe Alá Arg Leu As p Gin Thr Gly With Gly Gin Leu Val Glu Me t 800 805 810 GCA GTT AAG AAA GGC CGT CAG ACA CGT CCG GGC CTT AAG TGC GGC ATC Al a Val Lys Lys Gly Arg Gin Thr Arg Pro Gly Leu Lys Cys Gly Ile 815 820 825 830 TGC GGC GAG CAC GGC GAG ATC CTT CTT CCG TAGAGTTCTG CCACAAAGTA Cy s Gly Glu Hi s Gly Glu Ile Leu Leu Pro 835 840

2463

2511

2559

2609

G

DETAILS OF SEQ ID NO: 4:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 2722

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 4:

GAACTATTTA AGGAATTTGT AAGAATTTAG AGTTCATTCA GATAATA ATG CAA AG Gin Arg

2610

GTA TAT GCT TTC GAA DAM GGT DAM GGA ACC AAC AAG AAA CTC CTT GGA With Tyr 5 Al a Phe Glu asp Gly 10 As p G1 y Thr As n Ly s 15 Ly s Leu Leu Gly GGA AAG GGA GCT GGA CTT TGC ACA ATG ACA AAA ATT GGA CTT CCA GTT Gly 20 Ly s Gly Al a Gly Leu 25 Cys Thr Me t Thr Ly s 30 Ile Gly Leu Pro With 35 CCA CAA GGA TTT GTT ATT ACA ACT GAA ATG TGT AAA CAA TTC ATT GCT Pro Gin G1 y Phe With 40 Ile Thr Thr Glu Me t 45 Cy s Lys Gin Phe Ile 50 Al a AAT GGA AAC AAA ATG CCA GAA GGA TTA ATG GAA GAA GTT AAA AAA GAA Asn Gly Asn Lys 55 Me t Pro Glu Gly Leu 60 Me t Glu Glu Va 1 Ly s 65 Lys Glu TAT CAA TTA GTT GAA AAG AAA TCA GGA AAA GTC TTT GGA GGA GAA GAA Tyr Gin Leu 70 With Glu Lys Lys Ser 75 Gly Lys With Phe Gly 80 Gly Glu Glu AAT CCA CTT CTT GTT TCA GTC AGA TCA GGA GCT GCT ATG TCT ATG CCA Asn Pro 85 Leu Leu Va 1 Ser With 90 Arg Ser Gly Al a Al a Me t Ser Me t Pro GGT ATG ATG DAM ACT ATT CTT AAT CTT GGA CTT AAT DAM AAA ACT GTT Gly 100 Me t Me t asp Thr I le 105 Leu As n Leu Gly Leu 110 Asn asp Ly s Thr With 115

104

152

200

248

296

344

392

HU 222 186 Bl

GTT GCT CTT GCT Al a AAA Ly s 120 TTA ACC AAC AAT GAA AGA TTT GCA TAT GAT TCA 440 With Al a Leu Leu Thr Asn Asn Glu 125 Arg Phe Al a Tyr asp 130 Ser TAC AGA AGA TTT GTT TCC CTC TTC GGA AAG ATT GCT CTT AAT GCT TGT 488 Tyr Arg Arg Phe Va 1 Ser Leu Phe Gly Ly s Ile Al a Leu Asn below Cys 135 140 145 DAM GAA GTT TAT DAM AAG ACT CTT GAA AAC AAA AAA GTT GAA AAG GGA 536 asp Glu Va 1 Tyr As p Lys Thr Leu Glu Asn Ly s Ly s Va 1 Glu Lys Gly 150 155 160 GTT AAA TTA DAM ACT GAA TTA GAT GCT AAT DAM ATG AAA GAA CTT GCA 584 With Ly s Leu asp Thr Glu Leu Asp Alá Asn asp Me t Ly s Glu Leu Al a 165 170 175 CAA GTC TTC ATT AAA AAG ACT GAA GAA TTC ACT AAA CAA CCA TTC CCA 632 Gin With Phe I le Ly s Lys Thr Glu Glu Phe Thr Lys Gin Pro Phe Pro 180 185 190 195 GTT DAM CCA TAT GCT CAA TTA GAA TTT GCC ATT TGT GCT GTA TTC AGA 680 With As p Pro Tyr Al a Gin Leu Glu Phe Al a 11 e Cy s Al a With Phe Arg 200 205 210 TCA TGG ATG GGA AAG AGA GCT GTT GAT TAC AGA AGA GAA TTC AAG ATT 728 Ser Trp Me t Gly Ly s Arg Al a Val Asp Tyr Arg Arg Glu Phe Lys Ile 215 220 225 ACT CCA GAA CAA GCT DAM GGA ACT GCT GTT TCA GTT GTT TCT ATG GTT 776 Thr Pro Glu Gin Al a As p Gly Thr Alá With Ser With With Ser Me t With 230 235 240 TAT GGT AAT ATG GGT AAT DAM TCA GCT ACT GGT GTT TGT TTC ACT AGA 824 Tyr Gly Asn Me t Gly Asn As p Ser Ala Thr Gly With Cys Phe Thr Arg 245 250 255 DAM CCA GGA ACA GGA GAA AAT ATG TTC TTC GGA GAA TAT CTT AAG AAT 872 asp Pro Gly Thr Gly Glu Asn Me t Phe Phe G1 y Glu Tyr Leu Lys Asn 260 265 270 275 GCA CAA GGA GAA DAM GTT GTT GCT GGT ATT AGA ACA CCA CAA ATT ATT 920 Al a Gin Gly Glu As p With With Down Gly Ile Arg Thr Pro Gin Ile Ile 280 285 290 TCA AAG ATG GCA GAA DAM CGA GAT CTT CCA GGT TGC TAT GAA CAA CTT 968 Ser Ly s Me t Al a Glu asp Arg Asp Leu Pro Gly Cys Tyr Glu Gin Leu 295 300 305 CTT DAM ATT AGA AAG AAA TTA GAA GGA TAT TTC CAT GAA GTA CAA GAC 1016 Leu As p Ile Arg Ly s Ly s Leu Glu Gly Tyr Phe Hi s G1 u With Gin As p 310 315 320 TTT GAA TTC ACT ATT GAA AGA AAG AAA CTT TAC ATG CTC CAA ACT AGA 1064 Phe Glu Phe Thr Ile Glu Arg Lys Lys Leu Tyr Me t Leu Gin Thr Arg 325 330 335 AAT GGA AAG ATG AAT GCA ACT GCT ACT GTC AGA ACA GGA GTT DAM ATG 1112 Asn Gly Ly s Me t As n Al a Thr Al Thr With Arg Thr Gly Va 1 asp Me t 340 345 350 355

HU 222 186 BI

GTT GAA GAA GGA CTT ATT ACA AAA GAA CAA GCC ATT ATG AGA Arg ATT Ile 370 GCA Al a 1160 Va 1 Glu Glu Gly Le u 360 Ile Thr Ly s Glu Gin Alá 365 Ile Me t CCA CAA TCA GTT DAM CAA TTA CTT CAT AAG AAT ATG CCA GCT AAT TAT 1208 Pro Gin Ser With asp Gin Leu Leu Hi s Ly s As n Me t Pro Al a Asn Tyr 375 380 385 GCA GAA GCT CCA TTA GTT AAA GGA CTT CCA GCA TCA CCA GGA GCT GCT 1256 Al a Glu Al a Pro Leu Va 1 Lys Gly Leu Pro Al a Ser Pro Gly Al a Al a 390 395 400 ACA GGA GCT GTT GTT TTT DAM GCC DAM DAM GCA GTT GAA CAA GCT AAA 1304 Thr Gly Al a With Va 1 Phe As p Al a asp As p Al a Va 1 Glu Gin Al a Lys 405 410 415 GGA AAG AAA GTT CTT CTT CTT AGA GAA GAA ACT AAA CCA GAA DAM ATT 1352 G1 y Ly s Ly s With Leu Leu Leu Arg Glu Glu Thr Ly s Pro Glu asp Ile 420 425 430 435 CAT GGA TTC TTT GTT GCT GAA GGT ATT TTA ACC TGC AGA GGA GGA AAA 1400 Hi s Gly Phe Phe With Al a Glu Gly Ile Leu Thr Cy s Arg Gly Gly Ly s 440 445 450 ACA TCA CAC GCA GCT GTC GTT GCT AGA GGT ATG GGT AAA CCA TGT GTT 1448 Thr Ser Hi s Al a Al a Va 1 With Al a Arg Gly Me t Gly Lys Pro Cy s Va 1 455 460 465 TCA GGA GCT GAA GGA ATT AAA GTT DAM GTT GCT AAG AAA ATT GCT AAG 1496 Ser Gly Al a Glu Gly Ile Ly s Va 1 asp With Al a Ly s Lys Ile Al a Lys 470 475 480 ATT GGA AGC CTT GAA GTT CAT GAA GGA DAM ATT TTA ACT ATT DAM GGA 1544 Ile Gly Ser Leu Glu With Hi s Glu Gly asp Ile Leu Thr Ile asp Gly 485 490 495 TCA ACT GGA TGT GTC TAT AAG GGA GAA GTT CCA TTA GAA GAA CCA CAA 1592 Ser Thr Gly Cys Va 1 Tyr Lys Gly Glu With Pro Leu Glu Glu Pro Gin 500 505 510 515 GTT GGA TCA GGA TAT TTC GGA ACC ATC TTA AAA TGG GCC AAT GAA ATT 1640 With Gly Ser Gly Tyr Phe Gly Thr Ile Leu Ly s Trp Al a Asn Glu Ile 520 525 530 AAA AAG ATT GGA GTT TTT GCT GCT GGA DAM CTT CCA TCA GCT GCT AAG 1688 Ly s Ly s Ile Gly Va 1 Phe Al a Al a Gly asp Leu Pro Ser Al a below Ly s 535 540 545 AAA GCC CTT GAA TTT GGA GCT GAA GGT ATT GGA CTT TGC AGA ACT GAA 1736 Ly s Al a Leu Glu Phe Gly Al a Glu Gly Ile Gly Leu Cys Arg Thr Glu 550 555 560 CGT ATG TTC AAT GCA GTT GAA AGA CTT CCA ATT GTT GTC AAG ATG ATT 1784 Arg Me t Phe Asn Al a With Glu Arg Leu Pro Ile With With Ly s Me t Ile 565 570 575 CTT TCA AAT ACC CTT GAA GAA AGA AAG AAA TAT CTT AAT GAA CTT ATG 1832 Leu Ser Asn Thr Leu Glu Glu Arg Ly s Lys Tyr Leu Asn Glu Leu Me t 580 585 590 595

HU 222 186 Bl

CCA CTT CAA AAA Ly s CAA GAT Gin Asp 600 TTC Phe ATT Ile GGA TTA TTG AAG ACT Thr ATG Me t AAT Asn 610 GGA Gly 1880 Pro Leu Gin Gly Leu 605 Leu Lys CTT CCA GTC ACT GTC AGA CTT CTT DAM CCA CCA TTA CAT GAA TTC CTC 1928 Leu Pro Va 1 Thr Va 1 Arg Leu Le u As p Pro Pro Leu Hi s Glu Phe Leu 615 620 625 CCA ACT CTT GAA GAG TTA ATG AGA GAA ATC TTT GAA ATG AAA CTT TCA 1976 Pro Thr Leu Glu Glu Leu Me t Arg Glu Ile Phe Glu Me t Ly s Leu Ser 630 635 640 GGT AAG ACT GAA GGA CTT GCA GAA AAA GAA GTT GTT CTT AAG AAA GTT 2024 Gly Ly s Thr Glu Gly Leu Al a Glu Lys Glu Va 1 Va 1 Leu Ly s Ly s Va 1 645 650 655 AAA GAA CTT ATG GAA GTT AAT CCA ATG ATT GGA CAC AGA GGA ATT AGA 2072 Ly s G1 u Leu Me t Glu With Asn Pro Me t Ile G1 y Hi s Arg Gly Ile Arg 660 665 670 675 CTT GGA ACT ACT AAT CCA GAA ATT TAT GAA ATG CAA ATT AGA GCA TTC 2120 Leu Gly Thr Thr As n Pro G1 u Ile Tyr Glu Me t Gin Ile Arg Al a Phe 680 685 690 TTA GAA GCT ACT CGT GAA GTT ATT AAG GAA GGA ATT AAC DAM CAT CGA 2168 Leu Glu Al a Thr Arg Glu With Ile Lys Glu Gly Ile Asn As p Hi s Arg 695 700 705 GAA ATT ATG ATT CCA AAT GTT ACA GAA GTT AAT GAA CTT ATT AAC TTA 2216 Glu Ile Me t Ile Pro Asn With Thr Glu With Asn Glu Leu Ile Asn Leu 710 715 720 AGA AAG AAT GTT CTT GAA CCA GTT CAT GAA GAA GTT GAA AAG AAA TAT 2264 Arg Ly s Asn With Leu Glu Pro With Hi s Glu Glu With Glu Lys Lys Tyr 725 730 735 GGT ATT AAA GTA CCA TTC TCG TAT GGT ACT ATG GTT GAA TGT GTT AGA 2312 Gly Ile Lys With Pro Phe Ser Tyr Gly Thr Me t With Glu Cys With Arg 740 745 750 755 GCA GCA TTA ACA GCT DAM AAG ATT GCT ACA GAA GCT TCA TTC TTC TCA 2360 Al a Al a Leu Thr Al a asp Ly s Ile Ala Thr Glu Al a Ser Phe Phe Ser 760 765 770 TTC GGA ACT AAT DAM CTT ACA CAA GGA ACA TTC TCA TAC TCA CGT GAA 2408 Phe Gly Thr Asn asp Leu Thr Gin Gly Thr Phe Ser Tyr Ser Arg Glu 775 780 785 DAM TCA GAA AAC AAA TTC ATT CCA AAA TAT GTT GAA CTT AAG ATT CTT 2456 asp Ser Glu Asn Ly s Phe Ile Pro Lys Tyr With Glu Leu Ly s Ile Leu 790 795 800 CCA GCT AAT CCA TTT GAA ATT CTT DAM AGA CCA GGT GTT GGA GAA GTT 2504 Pro Al a Asn Pro Phe Glu Ile Leu asp Arg Pro Gly With Gly Glu With 805 810 815 ATG AGA ATT GCT GTT ACT AAA GGA AGA CAA ACA AGA CCA GAA TTA CTT 2552 Me t Arg Ile Al a Va 1 Thr Ly s Gly Arg Gin Thr Arg Pro Glu Leu Leu 820 825 830 835

HU 222 186 Bl

GTT With GGT ATT TGT GGA GAA CAC GGA GGA GAA CCA TCA TCA ATT Ile GAA Glu 850 TGG Trp 2600 Gly Ile Cys Gly 840 Glu Hi s Gly Gly Glu 845 Pro Ser Ser TGC CAC ATG ATT GGA TTG AAC TAT GTT TCA TGT TCT TCA TAC AGA ATT 2648 Cys Hi Me t Ile Gly Leu Asn Tyr With Ser Cy s Ser Ser Tyr Arg Ile 855 860 865 CCA GTT GCT AGA ATT GCT GCT GCT CAA GCC CAA ATT AGA CAT CCA AGA 2696 Pro Va 1 Al a Arg Ile Al a below Al a Gin Al a G1 n Ile Arg Hi s Pro Arg 870 875 880 GAA AAT TAAATTAACT TTTTTGGTTT 2722

Glu Asn 885

DETAILS OF SEQ ID NO: 5: SEQUENCE FEATURES:

LENGTH: 3180

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 5:

CTGAAATTCC CGTAATCTAT CATCATTTAC ACCACAAATC GATTCACATC CTCACCGAAT AGAAATCAAA TATCATTTAC TCCATCTCAC GATCTCCTTT TGCTATTGCT GATACCTCAA 60 120 171 TTTCGCAGGT GAAGGCGGAC G ATG Me t AGT Ser TCG TTG TTT GTT With GAA Glu GGT Gly ATG CCT Ser Leu Phe 5 Me t Pro 10 1 CTG AAG TCA GCC AAT GAG TCG TGC TTA CCG GCG AGC GTG AAG CAA CGG 219 Leu Lys Ser Alá Asn Glu Ser 15 Cy s Leu Pro 20 Al a Ser Va 1 Ly s Gin 25 Arg CGA ACC GGT GAT CTC AGG CGA TTG AAC CAC CAC CGT CAA CCG GCG TTT 267 Arg Thr Gly Asp Leu Arg Arg 30 Leu Asn 35 Hi s Hi s Arg Gin Pro 40 Al a Phe GTC CGG GGG ATT TGC CGT CGG AAG TTG AGT GGA GTT AGC AGA OVER THE GAG 315 With Arg Gly Ile Cys Arg Arg 45 Lys 50 Leu Ser G1 y Va 1 Ser 55 Arg Ile Glu TTG CGC ACC GGT GGT TTA ACT CTG CCA CGA GCG GTG CTT AAT CCG GTG 363 Leu Arg Thr Gly Gly Leu Thr 60 65 Leu Pro Arg Al a With 70 Leu Asn Pro With TCT CCT CCG GTA ACG ACG ACT AAA AAG AGG GTT TTC ACT TTT GGT AAA 411 Ser 75 Pro Pro Val Thr Thr Thr 80 Ly s Lys Arg With 85 Phe Thr Phe Gly Ly s 90 GGA AAC AGT GAA GGC AAC AAG GAC ATG AAA TCC TTG TTG GGA GGA AAA 459 Gly Asn Ser Glu Gly Asn Lys 95 asp Me t Lys 100 Ser Leu Leu Gly Gly 105 Ly s GGT GCA AAT CTT GCA GAG ATG GCA AGC ATT GGC CTA TCA GTT CCT CCT 507 Gly Alá Asn Leu Alá Glu Me t 110 Al a Ser 115 Ile Gly Leu Ser With 120 Pro Pro GGG CTC ACT ATT TCA ACT GAA GCA TGT GAG GAA TAT CAA CAA AAT GGA 555 Gly Leu Thr Ile Ser Thr Glu 125 Al at 130 Cy s Glu Glu Tyr Gin 135 Gin Asn Gly

HU 222 186 Bl

AAA Ly s AAA Ly s 140 CTG Leu CCT Pro CCA Pro GGT Gly TTA Leu 145 TGG GAT GAG ATT CTG GAA GGC Gly TTA Leu CAG Gin 603 Trp Asp Glu I le Leu 150 Glu TAT GTC CAG AAA GAG ATG TCT GCA TCT CTC GGT GAC CCG TCT AAA GCT 651 Tyr With Gin Ly s G1 u Me t Ser Al a Ser Leu Gly asp Pro Ser Lys Al a 155 160 165 170 CTC CTC CTT TCC GTC CGT TCG GGT GCT GCC OVER THE TCG ATG CCT GGT ATG 699 Leu Leu Leu Ser With Arg Ser Gly Al a Al a Ile Ser Me t Mrs. Gly Me t 175 180 185 ATG GAC ACT GTA TTG AAT CTC GGG CTT AAT DAM GAG GTC GTA DAM GGT 747 Me t asp Thr With Leu Asn Leu Gly Leu Asn As p Glu With Va 1 asp Gly 190 195 200 CTA GCT GCC AAA AGT GGA GCT CGC TTT GCC TAT GAC TCG TAT AGG AGG 795 Leu Al a Al a Lys Ser Gly Al a Arg Phe Al a Tyr asp Ser Tyr Arg Arg 205 210 215 TTT CTA DAM ATG TTT GGC AAC GTT GTA ATG GGT ATC CCA CAT TCG TTA 843 Phe Leu asp Me t Phe Gly Asn With Va 1 Me t Gly Ile Pro Hi s Ser Leu 220 225 230 TTT DAM GAA AAG TTA GAG CAG ATG AAA GCT GAA AAA GGG ATT CAT CTC 891 Phe As p Glu Lys Le u Glu Gin Me t Ly s Al a Glu Lys Gly Ile Hi s Leu 235 240 245 250 GAC ACT DAM CTC ACT GCT GCT DAM CTT AAA DAM CTT GCT GAG CAA TAC 939 asp Thr asp Leu Thr Al a Al a As p Leu Lys As p Leu Al a Glu Gin Tyr 255 260 265 AAG AAC GTG TAT GTG GAA GCA AAG GGC GAA AAG TTT CCC ACA DAM CCA 987 Ly s Asn With Tyr With Glu Al a Ly s Gly Glu Lys Phe Pro Thr asp Pro 270 275 280 AAG AAA CAG CTA GAG TTA GCA GTG AAT GCG GTT TTT DAM TCT TGG GAC 1035 Lys Ly s Gin Leu Glu Leu Al a Va 1 As n Al a With Phe asp Ser Trp asp 285 290 295 AGC CCA AGG GCC AAT AAG TAC AGG AGT ATT AAC CAG OVER THE ACT GGG TTA 1083 Ser Pro Arg Al a As n Lys Tyr Arg Ser Ile Asn Gin Ile Thr Gly Leu 300 305 310 AAG GGG ACC GCG GTT AAC ATT CAA TGC ATG GTG TTT GGC AAC ATG GGG 1131 Lys Gly Thr Al a With Asn Ile Gin Cys Me t With Phe Gly Asn Me t Gly 315 320 325 330 AAC ACT TCA GGA ACC GGT GTT CTT TTC ACT AGG AAC CCA AGC ACT GGT 1179 Asn Thr Ser Gly Thr Gly With Leu Phe Thr Arg Asn Pro Ser Thr Gly 335 340 345 GAG AAG AAG CTG TAT GGG GAG TTT TTA GTC AAT GCT CAG GGA GAG DAM 1227 Glu Ly s Ly s Leu Tyr Gly Glu Phe Leu With Asn Al a Gin Gly Glu As p 350 355 360 GTT GTT GCT GGG ATC AGA ACA CCA GAA DAM TTG GTG ACC ATG GAG ACT 1275 With With Ala Gly Ile Arg Thr Pro Glu asp Leu With Thr Me t Glu Thr 365 370 375

HU 222 186 BI

TGC ATG CCT GAA GCA TAC AGA GAG CTT GTG GAG AAC TGT Cys GTG With ATT Ile TTA Leu 1323 Cys Met 380 Pro Glu Al a Tyr Arg 385 Glu Leu With Glu Asn 390 GAG AGA CAC TAC AAA DAM ATG ATG DAM ATT GAA TTC ACA GTT CAA GAA 1371 Glu Arg Hi s Tyr Ly s As p Me t Me t As p Ile Glu Phe Thr With Gin Glu 395 400 405 410 AAC AGA CTT TGG ATG CTG CAA TGC CGA ACA GGG AAA CGT ACT GGG AAA 1419 Asn Arg Leu Trp Me t Leu Gin Cy s Arg Thr Gly Ly s Arg Thr Gly Ly s 415 420 425 GGT GCG GTG AGA ATT GCA GTA DAM ATG GTG AAC GAA GGG CTA ATT DAM 1467 Gly Ala With Arg Ile Al a Va 1 As p Me t With Asn Glu Gly Le u Ile As p 430 435 440 ACT AGA ACA GCA ATT AAG AGG GTT GAG ACT CAA CAT CTA DAM CAG CTT 1515 Thr Arg Thr Al a Ile Ly s Arg With Glu Thr Gin Hi s Leu asp Gin Leu 445 450 455 CTT CAT CCA CAG TTT GAG AAT CCG TCT GCT TAC AAA AGC CAT GTG GTA 1563 Leu Hi s Pro Gin Phe Glu Asn Pro Ser Al a Tyr Ly s Ser Hi s With Va 1 460 465 470 GCA ACC GGT TTG CCA GCA TCC CCT GGG GCA GCC GTG GGG CAG GTT GTG 1611 Al Thr Gly Leu Pro Al a Ser Pro Gly Al a Al a With Gly Gin With With 475 480 485 490 TTC AGC GCA GAG DAM GCT GAA ACA TGG CAT GCA CAA GGA AAG AGT GCT 1659 Phe Ser Al a Glu As p Al a Glu Thr Trp Hi s Al a Gin Gly Ly s Ser below 495 500 505 ATC TTG GTA AGG ACT GAA ACA AGC CCA GAA DAM GTT GGT GGT ATG CAT 1707 Ile Leu With Arg Thr Glu Thr Ser Pro Glu As p With Gly Gly Me t Hi s 510 515 520 GCA GCA GCT GGA ATC TTA ACC GCT AGA GGA GGA ATG ACA TCA CAT GCA 1755 Ala Ala Al a Gly Ile Leu Thr Al a Arg Gly Gly Me t Thr Ser Hi s Al a 525 530 535 GCA GTG GTG GCT CGC GGA TGG GGC AAA TGT TGT GTT TCT GGT TGT GCT 1803 Ala Val Va 1 Al a Arg Gly Trp Gly Ly s Cy s Cy s With Ser Gly Cys Al a 540 545 550 GAT ATT CGT GTG AAC DAM DAM ATG AAG GTT TTT ACG OVER THE GGT GAC CGT 1851 Asp Ile Arg With Asn asp asp Me t Ly s With Phe Thr Ile Gly asp Arg 555 560 565 570 GTG ATT AAA GAA GGT GAC TGG CTT TCA CTT AAT GGT TCA ACT GGC GAA 1899 Val Ile Ly s Glu Gly asp Trp Leu Ser Leu As n Gly Ser Thr Gly Glu 575 580 585 GTC ATA TTG GGT AAA CAG CTA CTG GCT CCA CCT GCA ATG AGC AAT DAM 1947 Val Ile Leu Gly Lys Gin Leu Leu Al a Pro Pro Al a Me t Ser Asn asp 590 595 600 TTA GAA ACA TTC ATG TCA TGG GCT DAM CAA GCA AGG CGT CTC AAG GTT 1995 Leu Glu Thr Phe Me t Ser Trp below As p Gin Al a Arg Arg Leu Ly s Va 1 605 610 615

HU 222 186 Bl

ATG Me t GCA Al a 620 AAT Asn GCA Al a GAC ACA CCT AAT GAT GCA Asn Asp Alá TTA ACA GCC AGA AAC AAT 2043 asp Thr Pro 625 Leu Thr 630 Al a Arg Asn Asn GGT GCA CAA GGG ATC GGA CTC TGT AGA ACT GAA CAT ATG TTT TTC GCT 2091 Gl y Al a Gin Gly Ile Gly Leu Cy s Arg Thr Glu Hi s Me t Phe Phe below 635 640 645 650 TCT GAC GAG AGG ATC AAA GCT GTA AGA AAG ATG ATC ATG GCG GTC ACT 2139 Ser As p Glu Arg Ile Ly s Al a With Arg Lys Me t Ile Me t Al a With Thr 655 660 665 CCA GAA CAA AGA AAA GCG GCT CTA GAC CTC TTA CTC CCA TAC CAA AGA 2187 Pro Glu Gin Arg Ly s Al a Al a Leu As p Leu Leu Leu Pro Tyr Gin Arg 670 675 680 TCC DAM TTT GAG GGC ATT TTC CGA GCA ATG DAM GGA CTT CCT GTA ACA 2235 Ser As p Phe Glu Gly Ile Phe Arg Al a Me t asp Gly Leu Pro With Thr 685 690 695 ATC CGC CTT CTA GAC CCT CCA CTT CAT GAG TTT CTA CCC GAA GGT DAM 2283 Ile Arg Leu Leu As p Pro Pro Leu Hi s Glu Phe Leu Pro Glu Gly As p 700 705 710 CTA GAA CAC OVER THE GTG AAT GAA CTT ACA GCG DAM ACA GGC ATG AGC AAA 233 1 Leu Glu Hi s Ile Va 1 Asn Glu Leu Thr Al a As p Thr Gly Me t Ser Ly s 715 720 725 730 DAM GAA ATC TAT TCA AGA ATC GAA AAA TTA TCC GAA GTG AAC CCT ATG 2379 asp Glu I 1 e Tyr Ser Arg Ile Glu Lys Leu Ser Glu With Asn Pro Me t 735 740 745 CTT GGT TTC CGT GGT TGC CGA TTA GGG ATT TCA TAC CCC GAG CTA ACA 2427 Leu Gly Phe Arg Gly Cys Arg Leu Gly Ile Ser Tyr Pro Glu Leu Thr 750 755 760 GAA ATG CAA GTT CGT GCG ATC TTT CAA GCT GCA GTG TCT ATG AAC AAT 2475 Glu Me t Gin With Arg Al a Ile Phe Gin Al a Al a With Ser Me t Asn Asn 765 770 775 CAG GGG GTG ACT GTA OVER THE CCA GAG ATC ATG GTT CCG TTA GTC GGA ACA 2523 Gin Gly With Thr With Ile Pro Glu Ile Me t With Pro Leu Va 1 Gly Thr 780 785 790 CCT CAG GAA TTA CGG CAT CAA ATC GGC GTA ATT CGT GGT GTA GCT GCA 2571 Pro Gin Glu Leu Arg Hi s Gin Ile Gly With Ile Arg Gly Va 1 Al a Al a 795 800 805 810 AAT GTT TTT GCT GAA ATG GGG CTG ACG TTG GAG TAT AAA GTG GGA ACG 2619 Asn With Phe Al a Glu Me t Gly Leu Thr Leu Glu Tyr Lys With Gly Thr 815 820 825 ATG ATT GAG ATT CCT CGA GCT GCT TTG ATT GCT DAM GAG ATT GCA AAA 2667 Me t He Glu Ile Pro Arg Al a Al a Leu Ile Al a asp Glu Ile Al a Lys 830 835 840 GAA GCC GAG TTC TTT TCG TTT GGA ACC AAT DAM TTG ACC CAG ATG ACA 2715 Gl u Al a Glu Phe Phe Ser Phe Gly Thr Asn As p Leu Thr Gin Me t Thr 845 850 855

HU 222 186 Β1

TTT GGG TAC AGC Ser AGA GAT DAM asp 865 GTT GGC AAG TTT TTG CCG ATT TAT CTT 2763 Phe Gly 860 Tyr Arg asp With Gly Lys Phe Leu 870 Pro 11 e Tyr Leu TCT CAA GGC ATT CTG CAG CAT DAM CCA TTT GAG GTT CTT GAC CAG AAA 2811 Ser 875 Gin Gly 11 e Le u Gin 880 Hi s As p Pro Phe Glu 885 With Leu asp Gin Lys 890 GGG GTG GGT CAA TTG ATC AAG ATG GCC ACG GAG AAA GGT CGT GCA GCC 2859 Gly With Gly Gin Leu 895 I le Lys Me t Ala Thr 900 Glu Lys Gly Arg Al a 905 Al a AAT CCT AAC TTA AAG GTT GGG OVER THE TGT GGG GAG CAT GGT GGA GAA CCT 2907 Asn Pro Asn Leu 910 Ly s Va 1 Gly I le Cy s 915 Gly Glu Hi s Gly Gly 920 Glu Pro TCT TCT GTT GCA TTT TTT GAC GGA GTT GGA CTA DAM TAT GTG TCG TGC 2955 Ser Ser With 925 Al a Phe Phe asp Gly 930 Va 1 Gly Leu As p Tyr 935 Va 1 Ser Cy s TCT CCA TTC AGG GTT CCT ATC GCA AGG TTG GCC GCT GCA CAA GTC GTT 3003 Ser Pro 940 Phe Arg Va 1 Pro I le 945 Al a Arg Leu Al a Al a 950 Al a Gin With With GTT TAAGCTTTGA AAGGAGGATG GCTTATTTGC TTCATGTTTT CCGCCATTGT 3056

With

955

ATATTATTTT GGTTTCATCC TTATTGTAAT GGTGAAAATG AACGATGTTT AAACAAAACA 3116 ACCCATTATA TTTTGGTTTG GTATGCAATA ATCTACTTTT CAAACAAAAA AAAAAAAAAA 3176 AAAA 3180

DETAILS OF SEQ ID NO: 6:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 18

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 6:

GACGGCTAAA AAGAGGGT 18

DETAILS OF SEQ ID NO: 7:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 7:

TATCGAGAAA CCTTCTATAC 20

DETAILS OF SEQ ID NO: 8:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 17

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 8:

GTTTTCCCAG TCACGAC 17

DETAILS OF SEQ ID NO: 9:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 17

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 9:

CAGGAAACAG CTATGAC 17

HU 222 186 Bl

DETAILS OF SEQ ID NO: 10:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 23

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 10:

GATATCAATC CGGTGTCTCC TCC 23

All. SEQ ID NO:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 134

TYPE: nucleic acid

All. DESCRIPTION OF SEQ ID NO:

CGGTGTCTCC TCCGGATATC ACGGCTAAAA AGAG 34

DETAILS OF SEQ ID NO: 12:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 27

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 12:

TTGATATCCC GGTTGTCTCC TCCGGTA 27

DETAILS OF SEQ ID NO: 13:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 13:

GCAGAGATGA TGTTGGCAAG 20

DETAILS OF SEQ ID NO: 14:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 14:

CTTGCCAACA TCATCTCTGC 20

DETAILS OF SEQ ID NO: 15:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 15:

CTCACTGTTC GAAGAGAAGC 20

DETAILS OF SEQ ID NO: 16:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 23

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 16:

CATATGCTCT GTCCGGCATA ATC 23

DETAILS OF SEQ ID NO: 17:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 21

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 17:

CTCGAGGGAT CTCAATCATT G 21

DETAILS OF SEQ ID NO: 18 SEQUENCE FEATURES:

LENGTH: 18

TYPE: nucleic acid

HU 222 186 Β1

DESCRIPTION OF SEQ ID NO: 18:

GCAATCTCTT CAGCAATC 1 8

DETAILS OF SEQ ID NO: 19:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 19:

GCTTCTTTTC CAATCTCATC 20

DETAILS OF SEQ ID NO: 20:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 18

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 20:

CGAAAAGAAA TCGGCTTC 18

DETAILS OF SEQ ID NO: 21:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 24

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 21:

GAAAGATAAA TCTGCAAAAA CTTG 24

DETAILS OF SEQ ID NO: 22:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 19

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 22:

GCCTTGAGCA AGATAAATC 19

DETAILS OF SEQ ID NO: 23:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 21

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 23:

TTCTGGTCAA TAACCTCAAT G 21

DETAILS OF SEQ ID NO: 24:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 24:

GCTTAAACAA TGACTTGTGC 20

DETAILS OF SEQ ID NO: 25:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 22

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 25:

CCAATCTCAT CAGCTATTAA AG 22

DETAILS OF SEQ ID NO: 26:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 26:

GCTTCTTTTG CAATCTCTTC 20

HU 222 186 Bl

DETAILS OF SEQ ID NO: 27:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 18

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 27:

CGAAAAGAAC TCAGCTTC 1 8

DETAILS OF SEQ ID NO: 28:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 23

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 28:

CAAGATAAAT CGGCAAAAAC TTG 2 3

DETAILS OF SEQ ID NO: 29:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 23

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 29:

GAATGCCTTG AGAAAGATAA ATC 2 3

DETAILS OF SEQ ID NO: 30:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 24

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 30:

CTTTCTGGTC AAGAACCTCA AATG 24

DETAILS OF SEQ ID NO: 31:

CHARACTERISTICS OF THE SEQUENCE:

LENGTH: 20

TYPE: nucleic acid

DESCRIPTION OF SEQ ID NO: 31:

GCTTAAACAA CGACTTGTGC 20

Claims (10)

PATENT CLAIMS An isolated polypeptide having a cold-tolerant pyruvate, orthophosphate dinicase activity, comprising an amino acid sequence corresponding to 1/6 of the C-terminus of the amino acid sequence set forth in SEQ ID NO: 5 of the polypeptide of (1) or (2) below. wherein at least one amino acid in said region of the polypeptide of paragraph 1 or 2 is replaced by the corresponding amino acid sequence of SEQ ID NO: 5, wherein: (1) a pyruvate orthophosphate dinicase polypeptide having the same amino acid sequence in SEQ ID NOs: 1-4; any of the amino acid sequences set forth in SEQ ID NO; and (2) a polypeptide having at least 50% amino acid sequence homology with the amino acid sequence of the polypeptide of paragraph (1) having cold-tolerant PPDK activation. 2. An isolated polypeptide having the same amino acid sequence as set forth in SEQ ID NO: 5. 3. An isolated polypeptide having the amino acid sequence set forth in SEQ ID NO: 5 having between 832 and 955 amino acids having cold-tolerant pyruvate, orthophosphate dinicase activity. The isolated polypeptide of claim 1, wherein the region of the amino acid sequence of pyruvate, orthophosphate dinicase, corresponding to the amino acid sequence of amino acids 832 to 955 of SEQ ID NO: 5 is replaced by the amino acid sequence of SEQ ID NO: 5 Between amino acids 832 and 955. The isolated polypeptide of claim 1, wherein the amino acid sequence is the same as the amino acid sequence set forth in SEQ ID NO: 1, except that amino acid 869 is substituted with proline. HU 222186Β1 The isolated polypeptide of claim 1, wherein the amino acid sequence is the same as the amino acid sequence set forth in SEQ ID NO: 1, except that amino acid 885 is replaced by leucine and 952 amino acid by valine. 7. The cloned DNA of any one of claims 1-6. A polypeptide according to any one of claims 1 to 6. The cloned DNA of claim 7, having the nucleotide sequence of SEQ ID NO: 5. A recombinant vector comprising the DNA of claim 7 and capable of expressing in a host an polypeptide having cold-tolerant pyruvate, orthophosphate dinicase activity. A plant comprising the DNA of claim 7.