OA10596A - Modulators of body weight corresponding nucleic acids and proteins and diagnostic and therapeutic uses thereof - Google Patents

Abstract

The present invention relates generally to the control of body weight of animals including mammals and humans, and more particularly to materials identified herein as modulators of weight, and to the diagnostic and therapeutic uses to which such modulators may be put. In its broadest aspect, the present invention relates to the elucidation and discovery of nucleotide sequences, and proteins putatively expressed by such nucleotides or degenerate variations thereof, that demonstrate the ability to participate in the control of mammalian body weight. The nucleotide sequences in object represent the genes corresponding to the murine and human OB gene, that have been postulated to play a critical role in the regulation of body weight and adiposity. Preliminary data, presented herein, suggests that the polypeptide product of the gene in question functions as a hormone. The present invention further provides nucleic acid molecules for use as molecular probes, or as primers for polymerase chain reaction (PCR) amplification, i.e., synthetic or natural oligonucleotides. In further aspects, the present invention provides a cloning vector, which comprises the nucleic acids of the invention; and a bacterial, insect, or a mammalian expression vector, which comprises the nucleic acid molecules of the invention, operatively associated with an expression control sequence. Accordingly, the invention further relates to a bacterial or a mammalian cell transfected or transformed with an appropriate expression vector, and correspondingly, to the use of the above-mentioned constructs in the preparation of the modulators of the invention. Also provided are antibodies to the OB polypeptide. Moreover, a method for modulating body weight of a mammal is provided. In specific examples, genes encoding two isoforms of both the murine and human OB polypeptides are provided.

Description

1 010596

MODULATORS OF BODY VVEIGUT, CORRESPOND Es G NUCLEICACIDS AND PROTEINS, AND DIAGNOSTIC AND THERAPEUTIC USES

THEREOF

TECHNICAL FIELD OF THE INVENTION 5 The présent invention relates geneully to the control of body weight of mammalsincluding animais and humans, and more particularly to materials identified herein asmodulators of weight, and to the diagnostic and therapeutic uses to which suchmodulators may be put.

BACKGROUND ORJEHE INVENTION 10 Obesity, defined as an excess of body fat relative to lean body mass, is associatedwith important psychological and medical morbidities, the latter inclüdinghypertension, elevated blood lipids, and Type II or non-insulin-dependent diabètesmelitis (NIDDM). There are 6-10 million individuals with NIDDM in the U.S., including 18% of the population of 65 years of âge [Harris et al., Int. J. Obes.; /

15 11:275-283 (1987)]. Approximately 45% of males and 70% of females with NIDDM are obese, and their diabètes is substantially improved or eliminated by weightréduction [Harris, Diabètes Care, 14(3):639-648 (1991)]. As described below, bothobesity and NIDDM are strongly heritable, though the predisposing genes hâve notbeen identified. The molecular genetic basis of these metabolically related disorders 20 is an important, poorly understood problem.

The assimilation, storage, and utilization of nutrient energy constitute a complexhomeostatic System central to survival of metazoa. Among land-dwelling mammals,storage in adipose tissue of large quantities of metabolic fuel as triglycérides is crucialfor surviving periods of food deprivation. The need to maintain a fixed level of 25 energy stores without continuai alterations in the size and shape of the organism requires the achievement of a balance between energy intake and expenditure.

However, the molecular mechanisms that regulate energy balance remain to be elucidated. The isolation of molécules that transduce nutritional information and 010596 control energy balance will be critical to an understanding of the régulation of bodyweight in health and disease.

An individuars level of adiposity is, to a large extern, genetically determined.Examination of the concordance rates of body weight and adiposity amongst mono- 5 and dizygous twins or adoptées and their biological parents hâve suggested that theheritability of obesity (0.4-0.8) exceeds that of many other traits commonly thoughtto hâve a substantial genetic component, such as schizophrenia, alcoholism, andatherosclerosis [Stunkard et al., N. Engl. J. Med.., 322:1483-1487 (1990)]. Familialsimilarities in rates of energy expenditure hâve also been reported [Bogardus et al., 10 Diabètes, 35:1-5 (1986)]. Genetic analysis-in geographically delimited populationshas suggested that a relatively small number of genes may account for the 30-50%of variance in body composition [Moll et al., Am. J. Hum. Genet., 49:1243-1255(1991)]. However, none of the genes responsible for obesity in the generalpopulation hâve been genetically mapped to a definite chromosomal location. 15 Rodent models of obesity include seven apparently single-gene mutations. The mostintensively studied mouse obesity mutations are the ob (obese) and db(diabètes) genes. When présent on the same genetic strain background, ob and dbresuit in indistinguishable metabolic and behavioral phenotypes, suggesting that thesegenes may function in the same physiologie pathway [Coleman et al., Diabetologia, 20 14:141-148 (1978)]. Mice homozygous for either mutation are hyperphagic and hypometabolic, leading to an obese phenotype that is notable at one month of âge.The weight of these animais tends to stabilize at 60-70 g (compared with 30-35 g incontrol mice). ob and db animais manifest a myriad of other hormonal and metabolicchanges that hâve made it difficult to identify the primary defect attributable to the 25 mutation [Bray et al., Am. J. Clin. Nutr., 50:891-902 (1989)],

Each of the rodent obesity models is accompanied by alterations in carbohydratemetabolism resembling those in Type II diabètes in man. In some cases, the severityof the diabètes dépends in part on the background mouse strain [Leiter, 010596 3

Endocrinology, 124:912-922 (1989)]. For both ob and db, congenic C57BL/Ks micedevelop a severe diabètes with ultimate β cell necrosis and islet atrophy, resulting ina relative insulinopenia. Conversely, congenic C57BL/6J ob and db mice develop atransient insulin-resistant diabètes that is eventually compensated by β cellhypertrophy resembling human Type II diabètes.

The phenotype of ob and db mice resembles human obesity in ways other than thedevelopment of diabètes - the mutant mice eat more and expend less energy than dolean Controls (as do obese humans). This phenotype is also quite similar to that seenin animais with lésions of the ventromedial hypothalamus, which suggests that bothmutations may interfère with the ability to properly integrate or respond to nutritionalinformation within the central nervous System. Support for this hypothesis cornesfrom the results of parabiosis experiments [Coleman, Diabetologia, 9:294-298 (1973)]that suggest ob mice are déficient in a circulating satiety factor and that db mice arerésistant to the effects of the ob factor (possibly due to an ob receptor defect). Theseexperiments hâve led to the conclusion that obesity in these mutant mice may resuitfrom, different defects in an afferent loop and/or intégrative center of the postulated s feedback mechanism that Controls body composition.

Using molecular and classical genetic markers, the ob and db genes hâve beenmapped to proximal chromosome 6 and midchromosome 4, respectively [Bahary etal., Proc. Nat. Acad. Sci. USA, 87:8642-8646 (1990); Friedman et al., Genomics,11:1054-1062 (1991)]. In both cases, the mutations map to régions of the mousegenome that are syntenic with human, suggesting that, if there are human homologsof ob and db, they are likely to map, respectively, to human chromosomes 7q and lp.Defects in the db gene may resuit in obesity in other mammalian species: in geneticcrosses between Zucker fa/fa rats and Brown Norway +/+ rats, the fa mutation (ratchromosome 5) is flanked by the same loci that flank db in mouse [Truett et al.,Proc. Natl. Acad. Sci. USA, 88:7806-7809 (1991)]. 010596 4

Because of the myriad factors that seem to impact body weight, it has not beenpossible to predict which factors and, more particularly, which homeostaticmechanisms, are primarily determinative of body weight. Thus, the principalproblem underlying the présent invention is to provide modulators of body weightwhich allow the control of adiposity and fat content of mammals.

SUMMARY OF THE INVENTION

According to the présent invention the problem of control of adiposity and fat contentof animais, particularly mammals, has been solved through the provision of obesity(OB) polypeptides and nucleic acid molécules coding for these polypeptides asdisclosed herein. The présent inventien-provides, for the first time, isolatedpolypeptides useful for modulation, i.e., control and régulation, of body weight andadiposity as well as nucleic acid sequences encoding such polypeptides which not onlyallow for recombinant production of the OB polypeptides but are themselves usefulin modulation of body weight.

Obesity (OB) polypeptides of the présent invention hâve about 145 to about 167amino acids, are capable of modulating body weight in an animal, particularly amammal, and include allelic variants or analogs, including fragments, thereof havingthe same biological activity. The polypeptides can be prepared by recombinant orChemical synthetic methods. Presently preferred OB polypeptides include thosehaving the amino acid sequence of SEQID NOS: 2, 4, 5 or 6, or allelic variants oranalogs, including fragments, thereof.

Immunogenic fragments of OB polypeptides of the invention include: Val-Pro-Ile-Gln-Lys-Val-Gln-Asp-Asp-Thr-Lys-Thr-Leu-Ile-Lys-Thr (SEQ ID NO: 18); Leu-His-Pro-Ile-Leu-Ser-Leu-Ser-Lys-Met-Asp-Gln-Thr-Leu-Ala (SEQ ID NO: 19); Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Leu-Gln-Lys-Pro-Glu-Ser-Leu-Asp (SEQ IDNO : 20) ; and Ser- Arg-Leu-Gln-Gly-Ser-Leu-Gln- Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro-Glu-Cys (SEQ ID NO: 21). 010596

Human OB polypeptide analogs include those having the human amino acid sequencesof SEQ ID NOS: 4 and 6, wherein one or more of amino acids 53, 56, 71, 85, 89,92, 95, 98, 110, 118, 121, 122, 126, 127, 128, 129, 132, 139, 157, 159, 163, and166 (according to the numbering of SEQ ID NO: 4) is substituted with another amino 5 acid such as the divergent amino acid of the mouse OB polypeptide as set out in SEQID NO: 2, or an alanine. Such analogs also include those wherein: (a) the serineresidue at position 53 is substituted with glycine, alanine, valine, cysteine,méthionine, or threonine; (b) the serine residue at position 98 is substituted withglycine, alanine, valine, cysteine, méthionine, or threonine; and (c) the arginine 10 residue at position number 92 is substituted with asparagine, lysine, histidine,glutamine, glutamic acid, aspartic acid, serine-, threonine, méthionine, or cysteine.An OB polypeptide analog according to the invention preferably has 83 percent orgreater amino acid sequence homology to the human OB polypeptide amino acidsequence set out in SEQ ID NO: 2, 4, 5 or 6. 15 Additional human OB polypeptide analogs according to the invention hâve the aminoacid sequence of SEQ ID NOS: 4 and 6 and hâve: (a) one or more aspartic acidresidues substituted with glutamic acid; (b) one or more isoleucine residues substitutedwith leucine; (c) one or more glycine or valine residues substituted with alanine;.(d)one or more arginine residues substituted with histidine; (e) one or more tyrosine or 20 phenylalanine residues substituted with tryptophan; (f) one or more of residues 121through 128 (according to the numbering of SEQ ID NO:4) substituted with glycineor alanine; and (g) one or more residues at positions 54 through 60 or 118 through166 (according to the number of SEQ ID NO: 4) substituted with lysine, glutamicacid, cysteine, or proline. 25 Presently preferred human OB polypeptide truncated analogs according to theinvention include those wherein (according to the numbering of SEQ ID NO: 4): (a)one or more residues at positions 121 to 128 are deleted; (b) residues 1-116 aredeleted; (c) residues 1-21 and 54 to 167 are deleted; (d) residues 1-60 and 117 to 167are deleted; (e) residues 1-60 are deleted; (f) résides 1-53 are deleted; and, (g) an 6 010596 analog of subpart (a) wherein residues 1-21 are deleted. OB polypeptides and ob polypeptide analogs of the invention which lack the 21 amino acid "signal" sequence (e.g., amino acids 1 through 21 of SEQID NO: 4)can hâve an N-terminal amino acid or amino acid sequence such as (1) méthionine, (2) a glycine-serine-histidine- 5 méthionine sequence (SEQ ID NO: 38), (3) a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO:98), (4) a leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (5) a glutamic acid-alanine-glutamic acid-alanine 10 sequence (SEQ ID NO: 27), (6) a leucine-glutamic acid-lysine-arginine sequence(SEQ ID NO: 28); (7) a methionine-glycine-seâne-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99), and (8) a glycine-serine-prolinesequence.

15 Dérivatives of an OB polypeptide according to the invention hâve one or moreChemical moieties attached thereto including water-soluble polymers such aspolyethylene glycol. Polyethylene glycol derivatized dérivatives can be mono-, di-,tri- or tetrapegylated e.g., N-terminal monopegylated. Preferred N-terminalmonopeglyated dérivatives of ob polypeptides of the invention include OB 20 polypeptides comprising the amino acid residues 22 through 167 of SEQ ID NO:4 orresidues 22 through 166 of SEQ ID NO: 6, optionally having a (pegylated)méthionine at position 21.

Isolated nucleic acid molécule provided by the présent invention encode an OBpolypeptide, allelic variant, or analog, including fragments, as described above. 25 Specifically provided are DNA molécules for use in securing expression of an OBpolypeptide having the biological activity of modulating body weight in a mammal,and selected from the group consisting of: (a) the DNA molécules set out in SEQ IDNOS: 1 and 3 or fragments thereof; (b) DNA molécules which hybridize to the DNAmolécules defined in (a) or hybridizable fragments thereof; and (c) DNA molécules 010596 that code on expression for the amino acid sequence encoded by any of the foregoingDNA molécules. Illustrative of such molécules is the human genomic DNA moléculeof SEQ ED NOS: 22 and 24.

Preferred DNA molécules according to the invention encode a polypeptide having anamino acid sequence as set out in: (a) SEQ ID NO: 2; (b) amino acids 22 through167 of SEQ ID NO: 2; (c) SEQ ED NO: 4; (d) amino acids 22 through 167 of SEQID NO: 4; (e) SEQ ID NO: 5; (f) amino acids 22 through 166 of SEQ ED NO: 5; and(g) SEQ ED NO: 6; and (h) amino acid 22 through 166 of SEQ ED NO: 6, as weU aspolypeptides which hâve an N-terminal amino acid or amino acid sequence aspreviously noted, IUustratively, a preferred DNÂ molécule has the sequence set outas the protein coding sequence of SEQ ID NO: 3 and particularly has the sequenceset out as the sequence encoding amino acids 22 through 167.

Detectably labeled nucleic acid molécules hybridizable to a DNA molécule of theinvention are also provided and include nucleic acid molécules hybridizable to a non-coding région of an OB nucleic acid, which non-coding région is selected from thegroup consisting of an intron, a 5 ' non-coding région, and a 3 ' non-coding région.The présent invention also provides oligonucleotide primers for amplifying humangenomic DNA encoding an ob polypeptide such as oligonucleotides set out in SEQID NOS: 29 through 32.

Vectors provided by the invention comprise a DNA molécule according to theinvention as described above and preferably hâve the form of an expression vectorwhich comprises the DNA molécule to operatively associated with an expressioncontrol sequence. Unicellular host cells of the invention are transformed ortransfected with a DNA molécules of the invention or with a vector as describedabove. Preferred host cells include bacteria, yeast, mammalian cells, plant cells,insect cells, and human cells in tissue culture. IUustratively, such host ceUs areselected from the group consisting of E. coli, Pseudomonas, Bacillus, Strepiomyces,yeast, CHO, Rl.l, B-W, L-M, COS 1. COS 7, BSC1, BSC40, BMT10, and Sf9 8 010596 cells. Presently preferred yeast hosts include Saccharomyces, Pichia, Candida,Hansenula and Torulopsis. Also provided are mammalian cells containing an obpolypeptide encoding DNA sequence and modified in viïro to permit higherexpression of ob polypeptide by means of a homologous recombinational eventconsisting of inserting an expression regulatory sequence in functional proximity tothe ob polypeptide encoding sequence. The expression regulatory sequence can bean ob polypeptide expression or not and can replace a mutant ob polypeptideregulatory sequence in the cell.

The présent invention provides methods for preparing an ob polypeptide comprising: (a) culturing a cell as described above undefTüïïditions that provide for expressionof the ob polypeptide; and (b) recovering the expressed ob polypeptide. Thisprocedure can also be accompanied by the steps of: (c) chromatographing thepolypeptide on a Ni-chelation column; and (d) purifying the polypeptide by gelfiltration. In a preferred embodiment, after step (c) and before step (d), the methodincludes chromatographing the ob polypeptide on a strong cation exchanger column.

The présent invention also provides labeled and unlabeled monoclonal and polyclonalantibodies spécifie for ob polypeptides of the invention and immortal cell Unes thatproduce a monoclonal antibody of the invention. Antibody préparation according tothe invention involves: (a) conjugating an ob polypeptide to a carrier protein; (b)immunizing a host animal with the OB polypeptide fragment-carrier protein conjugateof step (a) admixed with an adjuvant; and (c) obtaining antibody from the immunizedhost animal.

The invention provides methods for measuring the presence of an OB polypeptide ina sample, comprising: (a) contacting a sample suspected of containing an OBpolypeptide with an antibody (preferably bound to a soUd support) that specificallybinds to the OB.polypeptide under conditions which allow for the formation ofreaction complexes comprising the antibody and the OB polypeptide; and (b) detecting 010596 the formation of reaction complexes comprising the antibody and ob polypeptide inthe sample, wherein détection of the formation of reaction complexes indicates thepresence of OB polypeptide in the sample. Correspondingly provided are in vitromethods for evaluating the level of OB polypeptide in a biological sample comprising:(a) detecting the formation of reaction complexes in a biological sample according tothe method noted above; and (b) evaluating the amount of reaction complexes formed,which amount of reaction complexes corresponds to the level of OB polypeptide inthe biological sample. When detecting or diagnosing the presence of a diseaseassociated with elevated or decreased levels of OB polypeptide according to theinvention, an évaluation as above is made and the level detected is compaied to alevel of OB polypeptide présent in normal subjects or in the subject at an earlier time.An increase in the level of OB polypeptide as compared to normal or prior levelsindicates a disease associated with elevated levels of OB polypeptide and a decreasedlevel of OB polypeptide as compared to normal levels indicates a disease associatedwith decreased levels of OB polypeptide. Correspondingly provided are in vitromethods for monitoring therapeutic treatment of a disease associated with elevated ordecreased levels of OB polypeptide in a mammalian subject comprising evaluating,as describe above, the levels of OB polypeptide in a séries of biological samplesobtained at different time points from a mammalian subject undergoing suchtherapeutic treatment.

Pharmaceutical compositions according to the invention comprise an OB polypeptideas described above together with a pharmaceutically acceptable carrier and are usefulin therapeutic methods for reducing the body weight of an animal. Additionalpharmaceutical compositions of the invention for use in therapeutic methods forincreasing the body weight of an animal comprise an antagonist of an OB polypeptide,preferably selected from the group consisting of an antibody that binds to andneutralizes the activity of the OB polypeptide, à fragment of the ob polypeptide thatbinds to but does not activate the OB polypeptide receptor, and a small moléculeantagonist of the OB polypeptide. The présent invention also provides correspondingbody appearance improving cosmetic compositions for reducing or increasing the 10 0 1 0596 body weight of an individual, which compositions are useful in cosmetic processesfor improving the body appearance of an individual. Such cosmetic compositions areadministered to the individual in a dose amount sufficient to modulate the individual’sbody weight to a desired level.

Also addressed by the présent invention is the use of nucleic acid moles of theinvention, as well as antisense nucleic acid molécules hybridizable to a nucleic acidencoding an OB polypeptide according to the invention, for manufacture of amédicament for (e.g., gene therapy) modification body weight of an animal. Alsoprovided is the use of an OB polypeptide or antagonist according to the invention forthe manufacture of a médicament for modification of the body weight of an animal.Médicaments so developed can be employed for modification of the body weight ofa mammal in treating a disorder selected from the group consisting of diabètes, highblood pressure and high cholestérol and as part of combinative therapy with amédicament for treating such disorders. Such médicaments can be employed intherapeutic methods involving intravenous, intraarterial, intraperitoneal,intramuscular, subcutaneous, nasal, oral or pulmonary delivery Systems.

Data presented herein show that the establish that the OB polypeptides of theinvention in their form are secreted primarily from mammalian adipocytes and thatthe polypeptides function as hormones.

The Examples herein demonstrate that the OB polypeptide, altematively termed herein"leptin," circulâtes in mouse, rat, and human plasma. Leptin is absent in plasmafrom ob/ob mice, and is présent at ten-fold higher concentrations in plasma fromdb/db mice, and twenty-fold higher concentrations in fa/fa rats. Most significantly,daily injections of recombinant leptin dramatically reduces the body mass of ob/obmice, significantly affects the body weight of wild-type mice, and has no effect ondb/db mice. 11 010596

In a further aspect, the ob polypeptide from one species is biologically active inanother species. In particular, the human OB polypeptide is active in mice.

In a first instance, the modulators of the présent invention comprise nucleic acidmolécules, including recombinant DNA molécules (e.g., cDNA or a vector containingthe cDNA or isolated genomic DNA) or cloned genes (i.e., isolated genomic DNA),or degenerate variants thereof, which encode polypeptides themselves serving asmodulators of weight control as hereinafter defined, or conserved variants orfragments thereof, particularly such fragments lacking the signal peptide (altemativelyrefemed to herein as mature OB polypeptide), jvhich polypeptides possess amino acidsequences such as set forth in FIGURE IA through E (SEQ ID NO:2), FIGURE 3(SEQ ID NO:4), FIGURE 5 (SEQ ID NO:5) and FIGURE 6 (SEQ ID NO:6). Inspécifie embodiments, amino acid sequences for two variants of murine and humanob polypeptides are provided. Both polypeptides are found in a form with glutamine49 deleted, which may resuit from an mRNA splicing anomaly. The OB polypeptidesfrom various species may be highly homologous; as shown in Figure 4, murine andhuman OB polypeptides are greater than 80% homologous.

The nucleic acid molécules, recombinant DNA molécules, or cloned genes, may hâvethe nucléotide sequences or may be complementary to DNA coding sequences shownin FIGURE 1A through E (SEQ ID NO: 1) and FIGURE 2A and B (SEQ ID NO:3).In particular, such DNA molécules can be cDNA or genomic DNA isolated from thechromosome. Nucleic acid molécules of the invention may also correspond to 5' and3' flanking sequences of the DNA and intronic DNA sequences. Accordingly, theprésent invention also relates to the identification of a nucleic acid having a nucléotidesequence selected from the sequences of Figure 1A through E (SEQ ED NO: 1) andFigure 2A and B (SEQ ID NO:3) herein, and degenerate variants, allelic variations,and like cognate molécules. 12 01 0596 A nucleic acid molécule of the invention can be DNA or RNA, including syntheticvariants thereof having phosphate or phosphate analog, e.g., thiophosphate, bonds.Both single-stranded and double-stranded sequences are contemplated herein.

The présent invention further provides nucleic acid molécules for use as molecularprobes, or as primers for polymerase chain reaction (PCR) amplification, i.e.,synthetic or naturel oligonucleotides having a sequence corresponding to a portion ofthe sequences shown in Figure 1A through E (SEQ ED NO: 1), Figure 2A and B (SEQED NO:3) and Figure 20A through C (SEQ ED NOs:22 and 24); or the 5' and 3'flanking sequences of the coding sequences; or intronic sequences of the genomicDNA. In particular, the invention contemplâtes a nucleic acid molécule having atleast about 10 nucléotides, wherein a sequence of the nucleic acid moléculecorresponds to a nucléotide sequence of the same number of nucléotides in thenucléotide sequences of Figure 1A through E (SEQ ED NO: 1), Figure 2A and B (SEQED NO:3) and Figure 20A through C (SEQ ED NO:22), or a sequence complementaiythereto. More preferably, the nucleic acid sequence of the molécule has at least 15nucléotides. Most preferably, the nucleic acid sequence has at least 20 nucléotides.In an embodiment of the invention in which the oligonucleotide is a probe, theoligonucleotide is detectably labeled, e.g., with a radionuclide (such as 32P), or anenzyme.

In further aspects, the présent invention provides a cloning vector, which comprisesthe nucleic acids of the invention that encode the ob polypeptide; and a bacterial,insect, or a mammalian expression vector, which comprises the nucleic acidmolécules of the invention encoding the ob polypeptide, operatively associated withan expression control sequence. Accordingly, the invention further relates to a hostcell, such as a bacterial cell, yeast cell, insect cell, or a mammalian cell, transfectedor transformed with an appropriate expression vector, and correspondingly, to the useof the above mentioned constructs in the préparation of the modulators of theinvention. 13 010596

In yet a further aspect, the présent invention relates to antibodies that bind to the obpolypeptide. Such antibodies may be generated against the full-length polypeptide,or antigenic fragments thereof. In one aspect, such antibodies inhibit the functional(/.e., body weight and fat composition modulating) activity of the ob polypeptide.In another aspect, antibodies can be used to détermine the level of circulating obpolypeptide in plasma or sérum. In yet a further aspect, region-specific antibodies,particularly monoclonal antibodies, can be used as probes of OB polypeptidestructure.

Ail of the foregoing materials are to be considered herein as modulators of bodyweight and fat composition, and as such, may be used in a variety of contexts.Specifically, the invention contemplâtes both diagnostic and therapeutic applications,as well as certain agricultural applications, ail contingent upon the use of themodulators defined herein, including both nucleic acid molécules and peptides.Moreover, the modulation of body weight cames spécifie therapeutic implications andbenefits, in that conditions where either obesity or, conversely, cachexia representundesired bodily conditions, can be remedied by the administration of one or moreof the modulators of the présent invention.

Thus, a method for modulating body weight of a mammal is proposed that comprisescontrolling the expression of the protein encoded by a nucleic acid having a nucléotidesequence selected from the sequence of Figure IA through E (SEQ ED NO:1), thesequence of Figure 2A and B (SEQ ID NO:3) and degenerate and allelic variantsthereof. Such control may be effected by the introduction of the nucléotides inquestion by gene therapy into fat cells of the patient or host to control or reduceobesity. Conversely, the préparation and administration of antagonists to thenucléotides, such as anti-sense molécules, would be indicated and pursued in theinstance where conditions involving excessive weight loss, such as anorexia nervosa,cancer, or AIDS are présent and under treatment. Such constructs would beintroduced in a similar fashion to the nucléotides, directly into fat cells to effect suchchanges. 14 01 0596

Correspondingly, the proteins defined by Figures IA through E, 3, 5, and 6 (SEQ EDNO:1, SEQ ED NO:4, SEQ ID NO:5, and SEQ ED NO:6), conserved variants, activefragments thereof, and cognate small molécules could be formulated for directadministration for therapeutic purposes, to effect réduction or control of excessivebody fat or weight gain. Correspondingly, antibodies and other antagonists to thestated protein materials, such as fragments thereof, could be prepared and similarlyadministered to achieve the converse effect. Accordingly, the invention isadvantageously directed to a pharmaceutical composition comprising an OBpolypeptide of the invention, or altematively an antagonist thereof, in an admixturewith a pharmaceutically acceptable carrier or excipient.

In addition, the OB polypeptide of the invention may be administered for its cosmeticeffects, e.g., to improve body appearance by reducing fat deposits. The OBpolypeptide can be used independently or in conjunction with other cosmeticstrategies, e.g., surgery, for its cosmetic effects.

The diagnostic uses of the présent nucléotides and corresponding peptides extend tothe use of the nucleic acids to identify further mutations of allelic variations thereof,so as to develop a répertoire of active nucléotide materials useful in both diagnosticand therapeutic applications. In particular, both homozygous and heterozygousmutations of the nucléotides in question could be identified that would be postulatedto more precisely quantitate the condition of patients, to détermine the at-riskpotential of individuals with regard to obesity. Specifîcally, heterozygous mutationsare presently viewed as associated with mild to moderate obesity, while homozygousmutations would be associated with a more pronounced and severe obese condition.Corresponding DNA testing could then be conducted utilizing the aforementionedascertained materials as benchmarks, to facilitate an accurate long term prognosis forparticular tendencies, so as to be able to prescribe changes in either dietary or otherPersonal habits, or direct therapeutic intervention, to avert such conditions. 15 010596

The diagnostic utility of the présent invention extends to methods for measuring thepresence and extent of the modulators of the invention in cellular samples orbiological extracts (or samples) taken from test subjects, so that both the nucleic acids(genomic DNA or mRNA) and/or the levels of protein in such test samples could beascertained. Given that the increased activity of the nucleoti.de and presence of theresulting protein reflect the capability of the subject to inhibit obesity, the physicianreviewing such results in an obese subject would détermine that a factor other thandysfunction with respect to the presence and activity of the nucléotides of the présentinvention is a cause of the obese condition. Conversely, depressed levels of thenucléotide and/or the expressed protein would suggest that such levels must beincreased to treat such obese condition, and an appropriate therapeutic regimen couldthen be implemented.

Further, the nucléotides discovered and presented in Figures IA through E and 2Aand B represent cDNA which, as stated briefly above, is useful in the measurementof corresponding RNA. Likewise, recombinant protein material corresponding to thepolypeptides of Figures IA through E and 3 may be prepared and appropriatelylabeled, for use, for example, in radioimmunoassays, for example, for the purposeof measuring fat and/or plasma levels of the OB protein, or for detecting the presenceand level of a receptor for OB on tissues, such as the hypothalamus.

Yet further, the présent invention contemplâtes not only the identification of thenucléotides and corresponding proteins presented herein, but the élucidation of thereceptor to such materials. In such context, the polypeptides of Figures 1A throughE, 3, 5, and/or 6 could be prepared and utilized to screen an appropriate expressionlibrary to isolate active receptors. The receptor could thereafter be cloned, and thereceptor alone or in conjunction with the ligand could thereafter be utilized to screenfor small molécules that may possess like activity to the modulators herein.

Yet further, the présent invention relates to pharmaceutical compositions that includecertain of the modulators hereof, preferably the polypeptides whose sequences are 16 01 0596 presented in SEQ ED NO:2, SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, theirantibodies, corresponding small molécule agonists or antagonists thereof, or activefragments prepared in formulations for a variety of modes of administration, wheresuch therapy is appropriate. Such formulations would include pharmaceuticallyacceptable carriers, or other adjuvants as needed, and would be prepared in effectivedosage ranges to be determined by the clinician or the physician in each instance.

Accordingly, it is a principal object of the présent invention to provide modulatorsof body weight as defined herein in purified form, that exhibit certain characteristicsand activities associated with control and variation of adiposity and fat content ofmammals.

It is a further object of the présent invention to provide methods for the détection andmeasurement of the modulators of weight control as set foith herein, as a means ofthe effective diagnosis and monitoring of pathological conditions wherein the variationin level of such modulators is or may be a characterizing feature.

It is a still further object of the présent invention to provide a method and associatedassay System for the screening of substances, such as dmgs, agents and the like, thatare potentially effective to either mimic or inhibit the activity of the modulators of theinvention in mammals.

It is a still further object of the présent invention to provide a method for thetreatment of mammals to control body weight and fat content in mammals, and/or totreat certain of the pathological conditions of which abnormal dépréssion or élévationof body weight is a characterizing feature.

It is a still further object of the présent invention to prépare genetic constructs for usein genetic therapeutic protocols and/or pharmaceutical compositions for comparabletherapeutic methods, which comprise or are based upon one or more of the 17 β10596 modulators, binding partners, or agents that may control their production, or that maymimic or antagonizè their activities.

Other objects and advantages will become apparent to those skilled in the art from areview of the ensuing description which proceeds with référencé to the followingillustrative drawings.

BRIEF DESCRIPTION OF ΊΉΕ DRAWINGS FIGURE 1 (A through E) depicts the nucleic acid sequence (SEQ ED NO:1) anddeduced amino acid sequence (SEQ ED NO:2) derived for the murine OB cDNA. A39 base pair 5' leader was followed by a predicted 167 amino acid open readingframe and an approximately 3.7 kb 3' untranslated sequence. (In previously filedapplication Serial No. 08/347,563 filed November 30, 1994 and Serial No.08/438,431, filed May 10, 1995, an additional 58-base 5' non-coding sequence wasdetermined subsequently, to be a cloning artifact. This artifact has no bearing on thecoding région, the 39 base 5' non-coding région presently depicted in FIGURE 1, or3' non-coding région of the gene.) A total of about 2500 base pairs of the 3'untranslated sequence is shown. Analysis of the predicted protein sequence byobservation and using the SigSeq computer program indicates the presence of a signalsequence (underlined). Microheterogeneity of the cDNA was noted in thatapproximately 70% of the cDNAs had a glutamine codon at codon 49 and 30% didnot (see FIGURES 5 and 6, infrd). This amino acid is underlined, as is the argininecodon that is mutated in C57BL/6J ob/ob mice (IJ mice). FIGURE 2 (A and B) depicts the nucleic acid sequence (SEQ ID NO:3) derived forthe human OB cDNA. The nucléotides are numbered from 1 to 701 with a start siteat nucléotide 46 and a termination at nucléotide 550. FIGURE 3 depicts the full deduced amino acid sequence (SEQ ED NO:4) derived forthe human OB gene corresponding to the nucleic acid sequence of FIGURE 2A and 18 010596 B. The amino acids are numbered from 1 to 167. A signal sequence cleavage siteis located after amino acid 21 (Ala) so that the mature protein extends from aminoacid 22 (Val) to amino acid 167 (Cys). FIGURE 4 depicts the comparison between the murine (SEQ ID NO:2) and human(SEQ ID NO:4) deduced amino acid sequences. The sequence of the human OSdeduced amino acid sequence was highly homologous to that of mouse. Conservativechanges are noted by a dash, and non-conservative changes by an asterisk. Thevariable glutamine codon is underlined, as is the position of the nonsense mutationin C57BL/6J ob/ob (IJ) mice. Overall, there is 83% identity at the amino acid level,although only eight substitutions were found between the valine at codon 22(immediately downstream of the signal sequence overage) and the cysteine at position117. FIGURE 5 depicts the full length amino acid sequence (SEQ ID NO:5) derived forthe murine OB gene as shown in FIGURE 3, but lacking glutamine at position 49.The amino acids are numbered.from 1 to 166. A signal sequence cleavage site islocated after amino acid 21 (Ala) (and thus, before the glutamine 49 délétion) so thatthe mature protein extends from amino acid 22 (Val) to amino acid 166 (Cys). FIGURE 6 depicts the full deduced amino acid sequence (SEQ ID NO:6) derived forthe human OB gene as shown in FIGURE 4, but lacking glutamine at position 49.The amino acids are numbered from 1 to 166. A signal sequence cleavage site islocated after amino acid 21 (Ala) (and thus, before the glutamine 49 délétion) so thatthe mature protein extends from amino acid 22 (Val) to amino acid 166 (Cys). FIGURE 7. (A) Physical map of the location of ob in the murine chromosome, andthe YAC and PI cloning maps. "M and N" corresponds to MuR and Notl restrictionsites. The numbers correspond to individual animais that were recombinant in therégion of ob of the 1606 meioses that were scored. Met, Pax 4, D6Rck39, D6Rckl3,and Cpa refer to locations in the région of ob that bind to the DNA probes. YACs 19 01 0596 were isolated using D6Rckl3 and Pax-4 as probes, and the ends were recovered usingvectorette PCR and/or plasmid end rescue and used in tum to isolate new YACs. (B)The resulting YAC contig. One of the YACs in this contig, Y902A0925, waschimeric. Each of the probes used to génotype the recombinant animais is indicatedin parenthèses. (6) Corresponds to YAC 107; (5) corresponds to M16(+) (orM16(pLUS)); (4) corresponds to ûz/u(+); (3) corresponds to ûûd(pICL); (2)corresponds to 53(pICL); and (1) corresponds to 53(+). (C) The PI contig ofbactériophage PI clones isolated with selected YAC end probes. The ob gene wasisolated in a PI clone isolated using the distal end of YAC YB6S2F12 (end (4))(altematively termed herein ûz/ü(+)). FIGURE 8 présents a photograph of an ethidium bromide stain of 192 independentisolâtes of the fourth exon trapping experiment that were PCR amplified andcharacterized. FIGURE 9 is a photograph of an ethidium bromide stain of PCR-amplified clonessuspected of carrying ob. Each of the 7 clones that did not carry the artifact wasreamplified using PCR and electrophoresed on a 1 % agarose gel in TBE and stainedwith ethidium bromide. The size markers (far left unnumbered lane) are thecommercially available "1 kB ladder". Lane 1 -- clone 1D12, containing an "HTVsequence." Lane 2 — clone 1F1, a novel clone outside of the ob région. Lane 3 -clone 1H3. Lane 4 - clone 2B2, which is the identical to 1F1. Lane 5 -- clone 2G7,which contains an ob exon. Lane 6 -- clone 2G11, which is identical to 1FI. Lane7 — clone 2H1, which does not contain an insert. FIGURE 10 présents the sequence of the 2G7 clone (SEQ ED NO:7), which includesan exon coding for a part of the OB gene. The primer sequences used to amplify thisexon are boxed in the figure (SEQ ID NOS:8 and 9).

FIGURE 11 (A) Reverse transcription-PCR analysis of mRNA from differenttissues of the same mouse with the 2G7 primers and actin primers. The RT-PCR 20 010596 reactions were performed using 100 ng of total RNA reverse transcribed with oligodT as a primer for first strand cDNA synthesis. PCR amplification was performedfor 35 cycles with 94° dénaturation for Γ; 55° hybridization for Γ; and 72°Cextensions for 2’ with a Γ second autoextension per cycle. RT-PCR products wereresolved in a 2% low melting point agarose gel run in lx ΊΒΕ buffer. (B) Northernblot of mRNA from different organs of the mouse using PCR labeled 2G7 as a probe.Ten /xg of total RNA from each of the tissues was electrophoresed on an agarose gelwith formaldéhyde. The probe was hybridized at 65 °C in Rapid Hybe (Amershaxn).Autoradiographic signais were apparent after 1 hour of exposure; the experimentshown was the resuit of a 24 hour exposure. FIGURE 12 (A) An ethidium bromide stain from an RT-PCR reaction on fat cell(white adipose tissue) RNA from each of the mouse strains listed. Total RNA (100ng) for each sample was reverse transcribed using oligo dT and reverse transcriptase,and the resulting single-stranded cDNA was PCR amplified with the 2G7 primers(lower bands) or actin primers (upper bands). Both the 2G7 and actin primers wereincluded in the same PCR reaction. The products were run on a 1 % agarose TBEgel. (B) Northern analysis corresponding to (A). Ten pg of fat cell (white adiposetissue) RNA from each of the strains indicated were run out and probed with the PCRlabeled 2G7 probe as in Figure 11B, above. An approximately 20-fold increase inthe level of 2G7 mRNA was apparent in white fat RNA from the C57BL/6J oblob(13) strain relative to lean littermates. In both the RT-PCR and Northern experimentsthere was no détectable signal in 2G7 RNA from the SM/Ckc-'/obv (2J) miceeven after a 2 week exposure. A 24 hour autoradiographic exposure is shown. Thesame filter was hybridized to an actin probe (bottom portion of the panel). FIGURE 13 is a Northern analysis of additional 2J animais and control animais thatconfirms the absence of the ob mRNA from 2J animais. The Northern analysis wasperformed as in Figures 11 and 12. In this case, the control RNA was ap2, a fatspécifie transcript. There is no significance to the varying density of the ap2 bands. 21 C10596 FIGURE 14 compares the DNA sequence of the C57BL76J (normal) and theC57BL/6J ob/ob (IJ) mice in the région of the point mutation that leads tointroduction of a prématuré stop codon (nonsense mutation) in the mutant straincDNA. The ob/ob mice had a C-*T mutation that changed an arginine residue atposition 105. This base change is shown as the output from the automated DNAsequencer. RT-PCR was performed using white fat RNA from both strains (+/+and ob/ob) using primera from the 5' and 3' untranslated régions. The PCR reactionproducts were gel purified and directly sequenced manually and using an AppliedBiosystems, Inc. 373A automated sequencer with primera along both strands of thecoding sequence. FIGURE 15 (A) Southern blot of genomic DNA from each of the mouse strainslisted. Approximately 5 jxg of DNA (derived from genomic DNA prepared fromliver, kidney or spleen) was restriction digested with the restriction enzyme indicated.The DNA was then electrophoresed in a 1 % agarose TBE gel and probed with PCRlabeled 2G7. Restriction digestion with Bg/Π revealed an increase in the size of anapproximately 9 kB (the largest) BgZH fragment in SM/Ckc- +^0^/0^ (2J) DNA.RFLPs were not détectable with any other restriction enzymes. Preliminaryrestriction mapping of genomic DNA indicated that the polymorphie Bg/Π site isabout 7 kB upstream of the transcription start site. Noné of the other enzymes testedextend past the mRNA start site. (B) Ségrégation of a ΒξΐΒ. polymoiphism in theSM/Ckc-+^0^/0^ strain. Six obese and five lean progeny from the samegénération of the coisogenic SM/Ckc-+DacotfJ/oti11 (2J) colony were genotyped byscoring the BgZII polymoiphism as shown in (A). Ail of the phenotypically obeseanimais were homozygous for the larger allele of the polymorphie BgBl fragment.The DNA in the "control" lane was prepared from an unrelated SM/Ckc-+Dic+/+mouse, bred separately from the SM/Ckc-/ob21 colony. FIGURE 16 is a Southern blot of EcoRI digested genomic DNA from the specieslisted, using an OB cDNA as a probe (r.e., a zoo blot). Hybridization signais weredétectable in every vertebrate sample, even after a moderate stringency hybridization. 22 010596

The cat DNA in this experiment was slightly degraded. The restricted DNA was run on a 1 % agajose TBE gel, and transferred to an imobilon membrane for probing.

The fîlter was hybridized at 65 °C and washed in 2X SSC/0.2% SDS at 65°C twice

for twenty minutes and exposed for 3 days using Kodak (Rochester, N. Y.) X-OMAT film. FIGURE 17 présents the expression cloning région of vector pET-15b (Novagen)(SEQIDNOS.: 11 and 12). FIGURE 18 présents analysis of the eluate from a His-binding resin (Ni) column fora recombinant mature murine ob fusion to a His-tag (A) and mature human OB fusionto a His-tag (B). Bacteria were transformed with vectors pETM9 and pETH14,respectively. Upon induction with 1 mM EPTG at optimal conditions, the transformedbacteria were able to produce 100-300 /xg/ml of OB fusion protein, primarily in theinclusion bodies. The inclusion bodies were solubilized with 6M guanidine-HCl orurea, and fusion protein (présent in the lysis supematant) was loaded on the His-binding resin (Ni) column in 10 ml of lx binding buffer with urea. The column waseluted stepwise with 5 ml aliquots of 20 /xM, 60 /xM, and 300 μΜ imidazole, andfinally with strip buffer. The aliquots were analyzed for the presence of OBpolypeptide fusion on a 15% acrylamide gel. Each lane contains the équivalent of100 μΐ of bacterial extract. FIGURE 19 (A) In vitro translation of OB RNA. A human OB cDNA wassubcloned into the pGEM vector. The plasraid was linearized and plus strand RNAwas synthesized using Sp6 polymerase. The in vitro synthesized RNA was translatedin the presence or absence of canine pancreatic microsomal membranes. Anapproximately 18 kD primary translation product was seen after in vitro translation.The addition of microsomal membranes to the reaction led to the appearance of asecond translation product about 2 kD smaller than the primary translation product.The size of the translation product of interleukin-la RNA, which lacks an encodedsignal sequence, was unchanged by the addition of microsomal membranes. These 23 €10596 data indicated the presence of a functional signal sequence. (B) In vitro translationin the presence or absence of protéinase K. Protease treatment resulted in complétéproteolysis of the 18 kD primary translation product, while the 16 kD processed formwas unaffected. Permeabilization of the microsome with 0.1% TRITON-XIOOrendered the processed form protease sensitive. These results indicate that theproduct had translated into the lumen of the microsome. FIGURE 20 (A through E) The sequence of the human OB gene (SEQ ED NOs:22and 24). (F) A schematic diagram of the murine OB gene. (G) A schematic diagramof the human OB gene. In both (F) and (G), the start and stop codons are underlined.There is no evidence of a first intron homologous to the mouse first intron in thehuman gene, but its existence cannot be excluded. FIGURE 21 présents a schematic drawing of one of the cloning strategies employedto achieve recombinant expression of OB in Pichia yeast. (A) Expression vector ofOB with an α-mating factor signal sequence. (B) Schematic drawing of the structureof the recombinant fusion protein, including the amino acid sequence (SEQ DDNO:26) showing the Xhol site and putative KEX-2 and STE-13 cleavage sites, andthe N-terminal surplus amino acids présent after KEX-2 cleavage (SEQ DD NO:27).(C) An alternative strategy for producing mature OB involves preparing a constructwith an amino acid sequence corresponding to a Xhol cleavage site and a KEX-2cleavage site immediately upstream of the mature ob polypeptide sequence (SEQ IDNO:28). FIGURE 22 Alternative expression strategy in Pichia. (A) Expression vector of anOB fusion with a His-tag adopted from the pET expression System under control ofthe α-mating factor signal sequence (SEQ DD NO:33). (B) Schematic drawing of thestructure of the recombinant OB fusion protein containing a His-tag, which includesthe α-mating factor signal sequence, putative KEX-2 and STE-13 cleavage sites, theHis-tag, and a thrombin cleavage site, which would yield OB with three surplus N-terminal amino acid residues. 24 0 1 0596 FIGURE 23 (A) PAGE analysis of expression of murine OB (both themicroheterogenous forms, i.e., containing and missing Gin 49) in transformed pichiayeast. The expected band of approximately 16 kD is visible in the transformed yeastculture fluid (second and third lanes), but not in culture fluid from non-transformedyeast (first lane). (B) PAGE analysis of partially purified recombinant OBpolypeptide on carboxymethyl cellulose, a weak cation exchanger. A band of about16 kD is very visible in fractions 3 and 4 from the column, which was eluted with250 mM NaCl. Lane 1 — loaded sample; lane 2 -- flow through; lanes 3-5 --fractions eluted with 250 mM NaCl. FIGURE 24 shows that the OB protein circulâtes in mouse plasma. (A)Immunoprécipitations from mouse blood. 0.5 ml of mouse plasma was pre-clearedwith unconjugated sepharose and incubated ovemight with immunopurified anti-OBantibodies conjugated to sepharose 4B beads. The immunoprecipitate was separatedon a 15 % SDS-PAGE gel, transferred and Western blotted with an anti-OB antibody.The protein migrated with a molecular weight of approximately 16 kD, to the sameposition as the mature mouse ob protein expressed in yeast. The protein was absentin plasma from C57BL/6J ob/ob mice and increased ten-fold in plasma fromC57BLBZKS db/db mice relative to wild type mice. db mice hâve been suggested tooverproduce the OB protein, secondary to résistance to its effects. (B) Increasedlevels of OB in fatty rats. The fatty rat is obese as a resuit of a récessive mutationon rat chromosome 5. Genetic data has suggested a defect in the same gene mutatedin db mice. Plasma from fatty rats and lean littermates was immunoprecipitated andrun on Western blots. A twenty-fold increase in the circulating level of OB is seenin the mutant animais. (C). Quantitation of the OB protein in mouse plasma.Increasing amounts of the recombinant mouse protein were added to 100 λ of plasmafrom ob mice and immunoprecipitated. The signal intensity on Western blots wascompared to that from 100 λ of plasma from wild-type mice. A linear increase in signal intensity was seen with increasing amounts of recombinant proteindemonstrating that the immunoprécipitations were performed under conditions ofantibody excess,, Similar signais were seen in the wild-type plasma sample and the 25 010596 sample with 2 ng of recombinant protein indicating the circulating lével in mouseplasma is approximately 20 ng/ml. (D) OB protein in adipose tissue extracts.Cytoplasmic extracts of mouse adipose tissue were prepared from db and wild-typemice. Western blots showed increased levels of the 16 kD protein in extractsprepared from db mice. FIGURE 25 shows that the OB protein circulâtes at variable levels in human plasma. (A) Western blots of human plasma. Plasma samples were obtained from six leanvolunteers. Immunoprécipitation and Western blotting revealed the preSence of animmunoreactive 16 kD protein, identical in size to a recombinant 146 amino acidhuman protein expressed in yeast. Variable levels of the protein were seen in eachof the six samples. (B) An ELISA (Enzyme Linked Immunoassay) for human ob.Microtiter plates were coated with immunopurified anti-human OB antibodies.Known amounts of recombinant protein were added to the plates and detected usingimmunopurified biotinylated anti-ob antibodies. Absorbance at 414 nm was plottedagainst known concentrations ôf OB to yield a standard curve. The resulting standardcurve showed that the assay was capable of detecting 1 ng/ml or more of the humanOB protein. (C) Quantitation of the OB protein in human plasma. An ELISAimmunoassay was performed using 100 λ of plasma from the six lean volunteers andthe standards used in panel B. Levels of the OB protein ranging from 2 ng/ml inHP 1 to 15 ng/ml in HP6 were seen. These data correlated with the Western blot datain panel A. FIGURE 26 shows that the OB protein forms inter- or intramolecular disulphidebonds. (A) Western blots under reducing and non-reducing conditions. The Westernblots of mouse and human plasma were repeated with and without the addition ofreducing agents to the sample buffer. When β-mercaptoethanol is omitted from thesample buffer, immunoprecipitates from db plasma migrate with an apparentmolecular mass of 16 kD and 32 kD. Addition of β-mercaptoethanol to the bufferleads to the disappearance of the 32 kD moiety (see Figure 24). This resuit isrecapitulated when the mouse protein is expressed in the yeast, Pichia postons. In 26 01 0596 this case, the mouse OB protein migrâtes to the position of a dimer. Under reducingconditions the purified recombinant mouse protein migrâtes with an apparentmolecular weight of 16 kD, indicating that the 32 kD molecular form is the resuit ofone or two intermolecular disuphide bonds. The human protein expressed m vivo andin Pichia posions migrâtes with a molecular mass of 16 kD under both reducing andnon-reducing conditions (data not shown). (B) The human protein expressed in yeastcontains an intramolecular disulphide bond. Secreted proteins generally assume theircorrect conformation when expressed in the Pichia posions expression System. The146 amino acid mature human protein was expressed in Pichia posions and purifiedfrom the yeast media by a two-step purification protocol involving IMAC and gelfiltration. The purified recombinant protein was subjected to mass spectrometrybefore and after cyanogen bromide cleavage. Cyanogen bromide cleaves at thecarboxy terminus of méthionine residues. The molecular mass of the recombinantyeast protein was 16,024+3 Da (calculated molecular mass = 16,024 Da).Cyanogen bromide cleaves after the three methionines in the protein sequence atamino acids 75, 89, and 157. The cyanogen bromide fragment with measured mass 8435.6 Da corresponds to amino acids 90-157 and 158-167 joined by a disulphidelinkage between cys-117 and cys-167 (calculated molecular mass = 8434.5 Da).N.D. = note detected. FIGURE 27 depicts the préparation of the bioactive recombinant protein. Thenucléotide sequence corresponding to the 145 amino acid mature mouse OB proteinwas cloned into the pET 15b expression vector. This pET vector inserts apolyhistidine tract (His-tag) upstream of the cloned sequence which allows efficientpurification using Immobilized Métal Affinity Chromatography (IMAC). Therecombinant bacterial protein initially partitioned in the insoluble membrane fractionafter bacterial lysis. The membrane fraction was solubilized using guanidiumhydrochloride and loaded onto an IMAC column. The protein was eluted stepwisewith increasing concentrations of imidazole as shown. The eluted protein wasrefolded and treated with thrombin to remove the His-tag, as described below. Thefinal yield of soluble protein was 45 ng/ml of bacterial culture. 27 0 1 0596 FIGURE 28 shows the biologie effects of the OB protein. Time course of foodintake (panels A-C) and body weight (panels D-F). Groups of ten animais receivedeither dailv intraperitoneal injections of the OB protein at a dose of 5 mg/kg/day(solid squares), daily injections of PBS (solid circles) or no treatment (solid triangles).The treatment groups included C57B1/6J ob/ob mice (panels A and D), C57B1/Ksdb/db mice (panels B and E) and CBA/J+/ + mice (panels C and F). The foodintake of the mice was measured daily and the body weight was recorded at three tofour day intervals as indicated. (The scale of the body weight in grams is differentfor the wild-type mice vs. the ob and db mice.) The food intake of the ob micereceiving protein was reduced after the ftrst injection and stabilized after the fouithday at a level approximately 40% of that seen in the sham injected group (p.< .001).The body weight of these animais decreased an average of 1.3 grams/day andstabilized after three weeks to a level approximately 60% of the starting weight (p<.0001). No effect of the protein was demonstrable in db mice. Small but significanteffects on body weight were observed in CBA/J mice at two early time points (p <.02). The standard error of each measure is depicted by a bar and the statisticalsignificance of these results is shown in Table 1.

FIGURE 29 shows the results of pair feeding of ob mice. (A) A group of fourC57B1/6J oblob mice were fed an amount of food equal to that consumed by thegroup of ob mice receiving recombinant protein. The weight loss for both groupswas calculated after five, eight, and twelve days. The food-restricted mice lost(hatched bar) less weight than the ob mice receiving protein (solid bar) (p< .02).This resuit indicates that the weight-reducing effect of the OB protein is the resuit ofeffects on both food intake and energy expenditure. (B) Photograph of a treated obmouse. Shown are two C57B1/6J ob/ob mice. The mouse on the left received PBSand weighed 65 grams, which was the starting weight. The mouse on the rightreceived daily injections of the recombinant OB protein. The starting weight of thisanimal was also 65 grams, and the weight after three weeks of protein treatment was38 grams. (C) Livers from treated and untreated ob mice. Shown are livers fromtreated and untreated C57B1/6J ob/ob mice. The liver from the mouse receiving PBS 28 01 0596 had the gross appearance of a fatty liver and weighed 5.04 grams. The liver fromthe mouse receiving the recombinant ob protein had a normal appearance andweighed 2.23 grams.

Figure 30 shows the in situ hybridization of ob to adipose tissue. Sense and antisenseob RNA was labeled in vitro using Sp6 and T7 polymerase and digoxigenin. Thelabeled RNAs were hybridized to parafftn embedded sections of adipose tissue fromepididymal fat pads of eight week old C57B1/Ks mice (labeled wild-type) andC57B1/Ks db/db mice (labeled db}. In the figure, the lipid droplets appear asunstained vacuoles within cells. The cytoplasm is a thin rim at the periphery of thecells and is indistinguishable from the cell membrane. Hybridization to ail theadipocytes in the ficld was detected in the wild-type sections only using the antisenseprobe and greatly increased levels were seen in the tissue sections from the db/dbanimais. FIGURE 31 shows that OB RNA is expressed in adipocytes in vivo and in vitro.Total RNA (10 micrograms) from several different sources was electophoresed onblotted and hybridized to an ob probe. Firstly, différences in cell buoyancy aftercollagénase digestion was used to purify adipocytes. OB RNA was présent only inthe adipocyte fraction, Lane S indicates the stromovascular fraction and A indicatesthe adipocyte fraction. In addition, OB RNA was not expressed in theundifferentiated 3T3-442 preadipocyte cells lane U. Differentiated adipocytes fromthese cell Unes expressed clearly détectable levels of OB mRNA (lane D). FIGURE 32 shows that OB RNA is expressed in ail adipose tissue depots. AU of theadipose tissue depots tested expressed ob RNA. The inguinal fat pad expressedsomewhat lower RNA levels, although there was variabüity in the level of signais indifferent experiments. (Figure 31 A) Lanes (1) epididymal (2) inguinal (3) abdominal(4) parametrial fat pads. Brown fat also expressed a low level of OB RNA. (Figure31B) The level of OB expression in brown fat was unchanged in animais housed at 29 Cl 0596 4°C for one week whïle the abundance of the brown fat spécifie UCP RNA, knownto be cold inducible, increased five-fold. FIGURE 33 depicts the expression of OB RNA in db/db and gold thioglucose treatedmice. Total RNA from the parametrial fat pads of gold thioglucose (GTG) and db/dbtreated mice was eleccrophoresed and Northern blotted. GTG administered as a singledose is known to cause obesity by inducing spécifie hypothalamic lésions. (A) Onemonth old CBA female mice were treated with GTG (.2 mg/g), with a resultingincrease of >20 g in treated animais relative to control animais (<5 g). (B)

Hybridization of an OB probe to RNA from db/db and GTG treated mice revealed atwenty-fold increase in the abundance of ob RNA relative to control RNA (actin orGAPDH ). FIGURE 34 represents a Northern blot analysis of human RNA. Northern blotscontaining 10 mg of total RNA from human adipose tissue (FAT, panel A) and 2 mgof polyA+ RNA from other human tissues (panel B) were hybridized to human obor human β-actin probes as indicated. An intense signal at approximately 4.5 kb wasseen with the adipose tissue total RNA. Hybridization to ±e polyA+ RNA revealeddétectable signais in heart (HE) and placenta (PL), whereas OB RNA was notdetected in brain (BR), lung (LU), liver (LI), skeletal muscle (SM), kidney (Kl), andpancréas (PA). In each case, the length of the autoradiographic exposure is indicated.Of note, the genesis of the lower molecular bands seen in placental RNA (e.g.,altemate splicing, RNA dégradation) is not known. FIGURE 35 represents YAC contig containing the human OB gene and 8microsatellite markers. The YAC-based STS-content map of the région ofchromosome 7 containing the human OB gene is depicted, as deduced bySEGMAP/Version 3.29 [Green et al,, PCR Methods Applic., 1:77-90 (1991)]. The19 uniquely-ordered STSs (see Table 3) are listed along the top. The 8 microsatellite-specific STSs are indicated with stars (see Table 4). Also indicated are the STSscorresponding to the Pax4 and OB genes as well as the predicted positions of the 30 01 CK96 centromere (CEN) and 7q telomere (TEL) relative to the contig. Each of the 43Y AC clones is depicted by a horizontal bar, with its name given to the left andestimated YAC size (in kb, measured by pulsed-field gel electrophoresis) providedin parenthesis. The presence of an STS in a YAC is indicated by a darkened circleat the appropriate position. When an STS corresponds to the insert end of a YAC,a square is placed around the corresponding circle, both along the top (near the STSname) and at the end of the YAC from which it was derived. For the 5 YACs at thebottom (below the horizontal dashed line), 1 or more STS(s) expected to be présent(based on the established STS order) was not detected (as assessed by.testing theindividual YACs with the corresponding STS-specific PCR assay(s) at least twice),and these are depicted as open circles at the appropriate positions. Most of the YACswere isolated from a human-hamster hybrid cell-derived library [Green et al.,Genomics, 25:170-183 (1995)], with their original names as indicated. The remainingYACs were isolated from total human genomic libraries, and their original librarylocations are provided in Table 3. Boxes are placed around the names of the 3 YACs(yWSS691, yWSS999, and yWSS2935) that were found by FISH analysis to map to7q31.3. The contig is displayed in its ‘uncomputed’ form, where YAC sizes are notused to estimate clone overlaps or STS spacing, and ail of the STSs are thereforèspaced in an équidistant fashion. In the ‘computed’ form, where YAC sizes are usedto estimate the relative distance separating each pair of adjacent STSs as well as theextern of clone overlaps, the total YAC contig appears to span just over 2 Mb.

DETAILED DESCRIPTION

The présent invention relates to the élucidation and discovery of a protein, termedherein ob polypeptide or leptin, nucleic acids encoding the protein, includingdegenerate variations thereof, e.g., that incoiporate optimal codons for expression ina particular expression System, which protein demonstrates the ability to participatein the control of mammalian body weight. The nucleic acids in object represent thecoding sequences corresponding to the murine and human OB polypeptide, which ispostulated to play a critical rôle in the régulation of body weight and adiposity. Data 3i 01 0596 presented herein indicate that the polypeptide product of a nuceic acid of the inventionis secreted by the cells that express it, and that the polypeptide fonctions as ahormone. Additional experimental data demonstrate that the OB polypeptide is veryeffective in treating obesity in mice carrying a mutation of the ob gene. In addition, 5 high bolus doses or moderate continuous doses of OB polypeptide effect weightréduction in normal (wild-type) mice.

In addition, the Examples herein demonstrate that the OB polypeptide, altemativelytermed herein "leptin,” circulâtes in mouse, rat, and human plasma. Leptin is absentin plasma from ob/ob mice, and is présent at ten-fold higher concentrations in plasma 10 from db/db mice, and twenty-fold higher concentrations in fa/fa rats. Mostsignificantly, daily injections of recombinant leptin dramatically reduce the body massof oblob mice, significantly affects the body weight of wild-type mice, and has noeffect on db/db mice.

In a further aspect, the OB polypeptide from one species is biologically active in 15 another species. In particular, the human OB polypeptide is active in mice.

In its primary aspect, the présent invention is directed to the identification ofmaterials that function as modulators of mammalian body weight. In particular, theinvention concems the isolation, purification and sequèncing of certain nucleic acidsthat correspond to the OB gene or its coding région in both mice and humans, as well 20 as the corresponding polypeptides expressed by these nucleic acids. The inventionthus comprises the discovery of nucleic acids having the nucléotide sequences setforth in FIGURE IA through E (SEQ ID NO:1) and FIGURE 2A and B (SEQ IDNO:3), and to degenerate variants, alleles and fragments thereof, ail possessing theactivity of modulating body weight and adiposity. The correspondence of the présent 25 nucleic acids to the OB gene portends their significant impact on conditions such asobesity as well as other maladies and dysfunctions where abnormalities in bodyweight are a contributory factor. The invention extends to the proteins expressed bythe nucleic acids of the invention, and particularly to those proteins set forth in 32 G105Ô6 FIGURE IA through E (SEQ ID NO:2). FIGURE 3 (SEQ ID NO:4), FIGURE 5(SEQ ID NO:5), and FIGURE 6 (SEQ ED NO:6), as well as to conserved variants,active fragments, and cognate small molécules.

As discussed earlier. the weight control modulator peptides or their binding partnersor other ligands or agents exhibiting either mimicry or antagonism to them or controlover their production, may be prepared in pharmaceutical compositions, with asuitable carrier and at a strength effective for administration by various means to apatient experiencing abnormal fluctuations in body weight or adiposity, either aloneor as part of an adverse medical condition such as cancer or AIDS, for the treatmentthereof. A variety of administrative techniques may be utilized, among them oraladministration, nasal and other forms of transmucosal administration, parentéraltechniques such as subcutaneous, intravenous and intraperitoneal injections,catheterizations and the Hke. Average quantities of the récognition factors or theirsubunits may vary and in particular should be based upon the recommendations andprescription of a qualified physician or veterinarian.

In accordance with the above, an assay system for screening potential drugs effectiveto mimic or antagonize the activity of the weight modulator may be prepared. Theweight modulator may be introduced into a test system, and the prospective dmg mayalso be introduced into the resulting cell culture, and the culture thereafter examinedto observe any changes in the activity of the cells, due either to the addition of theprospective drug alone, or due to the effect of added quantities of the known weightmodulator.

As stated earlier, the molecular cloning of the OB gene described herein has led tothe identification of a class of materials that function on the molecular level tomodulate mammalian body weight. The discovery of the modulators of the inventionhas important implications for the diagnosis and treatment of nutritional disordersincîuding, but not limited to, obesity, weight loss associated with cancer and thetreatment of diseases associated with obesity such as hypertension, heart disease, and 33

ÜÎC59G

Type Π diabètes. In addition, there are potential agricultural uses for the geneproduct in cases where one might wish to modulate the body weight of domesticanimais. Finally, to the extern that one or more of the modulators of the inventionare secreted molécules, they can be used biochemically to isolate their receptor usingthe technology of expression cloning. The discussion that follows with spécifieréférencé to the OB gene bears general applicability to the class of modulators thatcomprise a part of the présent invention, and is therefore to be accorded such latitudeand scope of interprétation.

As noted above, the functional activity of the OB polypeptide can be evaluatedtransgenically. In this respect, a transgenic mouse model can be used. The ob genecan be used in complémentation studies employing transgenic mice. Transgenicvectors, including viral vectors, or cosmid clones (or phage clones) corresponding tothe wild type locus of candidate gene, can be constructed using the isolated ob gene.Cosmids may be introduced into transgenic mice using published procedures[Jaenisch, Science, 240:1468-1474 (1988)]. The constructs are introduced intofertilized eggs derived from an intercross between Fl progeny of a C57BL/6J oblobX DBA intercross. These crosses require the use of C57BL/6J oblob. ovariantransplants to generate the Fl animais. DBA72J mice are used as the counterstrainbecause they hâve a nonagouti coat color which is important when using the ovariantransplants. Génotype at the ob loci in cosmid transgenic animais can be determinedby typing animais with tightly linked RFLPs or microsatellites which flank themutation and which are polymorphie between the progenitor strains.Complémentation will be demonstrated when a particular construct renders agenetically obese F2 animal (as scored by RFLP analysis) lean and nondiabetic.Under these circumstances, final proof of complémentation will require that the oblobor dbldb animal carrying the transgene be mated to the oblob or dbldb ovariantransplants. In this cross, ail N2 animais which do not carry the transgene will be obese and insulin resistant/diabetic, while those that do carry the transgene will belean and hâve normal glucose and insulin concentrations in plasma. In a geneticsense, the transgene acts as a suppressor mutation. 34 01CSS6

Altematively, OB genes can be tested by examining their phenotypic effects whenexpressed in antisense orientation in wild-type animais. In this approach, expressionof the wild-type allele is suppressed, which leads to a mutant phenotype. RNARNAduplex formation (antisense-sense) prevents normal handling of mRNA, resulting in 5 partial or complété élimination of wild-type gene effect. This technique has beenused to inhibit TK synthesis in tissue culture and to produce phenotypes of theKruppel mutation in Drosophila, and the Shiverer mutation in mice Izant et al., Cell,36:1007-1015 (1984); Green et al.,Annu. Rev. Biochem., 55:569-597 (1986); Katsukiet al., Science, 241:593-595 (1988). An important advantage of this approach is that 10 only a small portion of the gene need be expressed for effective inhibition ofexpression of the entire cognate mRNA. The antisense transgene will be placedunder control of its own promoter or another promoter expressed in the correct celltype, and placed upstream of the SV40 polyA site. This transgene will be used tomake transgenic mice. Transgenic mice will also be mated ovarian transplants to test 15 whether ob hétérozygotes are more sensitive to the effects of the antisense construct.

In the long term, the élucidation of the biochemical function of the OB gene product(the OB polypeptide or protein) is useful for identifying small molécule agonists andantagonists that affect its activity.

Various terms used throughout this spécification shall hâve the définitions set out 20 herein, for example, below.

The term "body weight modulator", "modulator", "modulators", and any variants notspecifically listed, may be used herein interchangeably, and as used throughout theprésent application and claims refers in one instance to both nucléotides and toproteinaceous material, the latter including both single or multiple proteins. More 25 specifically, the aforementioned terms extend to the nucléotides and to the DNAhaving the sequences described herein and presented in Figure IA through E (SEQID NO:1), and Figure 2A and B (SEQ ED NO:3). Likewise, the proteins having the 35 Ü1G596 amino acid sequence data described herein and presented in Figure IA through E(SEQ ED NO:2), and Figure 3 (SEQ ED NO:4) are likewise contemplated, as are theprofile of activities set forth with respect to ail materials both herein and in thedaims. Accordingly, nucléotides displaying substantially équivalent or alteredactivity are likewise contemplated, including substantially homologous analogs andallelic variations. Likewise, proteins displaying substantially équivalent or alteredactivity. including proteins modified deliberately, as for example, by site-directedmutagenesis, or accidentally through mutations in hosts that produce the modulatorsare likewise contemplated. A composition comprising "A" (where "A" is a single protein, DNA molécule,vector, recombinant host cell, etc.) is substantially free of "B" (where "B" comprisesone or more contaminating proteins, DNA molécules, vectors, etc., but excludingracemic forms of A) when at least about 75% by weight of the proteins, DNA,vectors (depending on the category of species to which A and B belong) in thecomposition is "A". Preferably, "A" comprises at least about 90% by weight of theA+B species in the composition, most preferably at least about 99% by weight. Itis also preferred that a composition, which is substantially free of contamination,contain only a single molecular weight species having the activity or characteristic ofthe species of interest.

The OB Polypeptides

The terms "protein," which refers to the naturally occurring polypeptide, and"polypeptide" are used herein interchangeably with respect to the ob gene product andvariants thereof. The term "mature protein" or "mature polypeptide" particularlyrefers to the OB gene product with the signal sequence (or a fusion protein partner)removed.

As noted above, in spécifie embodiments ob polypeptides of the invention includethose having the amino acid sequences set forth herein e.g., SEQ ED NOS: 2, 4, 5,6, etc., including the ob polypeptide modified with conservative amino acid 36 01 0596 substitutions, as well as biologically active fragments, analogs, and dérivativesthereof. The term "biologically active," is used herein to refer to a spécifie effect ofthe polypeptide, including but not limited to spécifie binding, e.g., to a receptor,antibody, or other récognition molécule; activation of signal transduction pathwayson a molecular level; and/or induction (or inhibition by antagonists) of physiologicaleffects mediated by the native ob polypeptide in vivo. OB polypeptides, includingfragments, analogs, and dérivatives, can be prepared synthetically, e.g., using thewell known techniques of solid phase or solution phase peptide synthesis. Preferably,solid phase synthetic techniques are employed. Altematively, OB polypeptides of theinvention can be prepared using well known genetic engineering techniques, asdescribed infra. In yet another embodiment, the OB polypeptide can be purified,e.g., by immunoaffinity purification, from a biological fluid, such as but not limitedto plasma, sérum, or urine, preferably human plasma, sérum, or urine, and morepreferably from a subject who overexpresses the polypeptide, such as an obese personsuffering from a mutation in the OB receptor or from obesity related to a mutationcorresponding to "fatty."

Fragments of the OB Polypeptide

In a particular embodiment, the présent invention contemplâtes that naturallyoccurring fragments of the OB polypeptide may be important. The peptide sequenceincludes a number of sites that are frequently the target for proteolytic cleavage, e.g.,arginine residues. It is possible that the full length polypeptide may be cleaved at oneor more such sites to form biologically active fragments. Such biologically activefragments may either agonize or antagonize the functional activity of the OBpolypeptide to reduce body weight.

Analogs of the OB Polypeptide

The présent invention specifically contemplâtes préparation of analogs of the OBpeptide, which are characterized by being capable of a biological activity of OBpolypeptide, e.g., of binding to a spécifie binding partner of ob peptide, such as theOB receptor. In one embodiment, the analog agonizes OB activity, i.e., it functions 37 0 1 0596 similarly to the ob peptide. Preferably. an OB agonist is more effective than thenative protein. For example, an OB agonist anaiog may bind to the OB receptor withhigher affmity, or demonstrate a longer half-life in vivo, or both. Nevertheless, OBpeptide agonist analogs that are less effective than the native protein are alsocontemplated. In another embodiment, the anaiog antagonizes OB activity. Forexample, an OB anaiog that binds to the OB receptor but does not induce signaltransduction can competitively inhibit binding of native OB to the receptor, thusdecreasing OB activity in vivo. Such an OB antagonist anaiog may also demonstratedifferent properties from ob peptide, e.g., longer (or shorter) half-life in vivo, greater(or lesser) binding affmity for the OB receptor, or both.

In one embodiment, an anaiog of OB peptide is the OB peptide modified bysubstitution of amino acids at positions on the polypeptide that are not essential forstructure or function. For example, since it is known that human OB peptide isbiologically active in mouse, substitution of divergent amino acid residues in thehuman sequence as compared to the murine amino acid sequence will likely yielduseful analogs of OB peptide. For example, the serine residue at position 53 orposition 98, or both (in the unprocessed peptide sequence depicted in Figure 4) fromhuman may be substituted, e.g., with glycine, alanine, valine, cysteine, méthionine,or threonine. Similarly, the arginine residue at position number 92 (Figure 4) maybe substituted, e.g., with asparagine, lysine, histidine, glutamine, glutamic acid,aspartic acid, serine, threonine, méthionine, or cysteine. Referring still to Figure 4,other amino acids in the human OB peptide that appear to be capable of substitutionare histidine at position 118, tryptophan at position 121, alanine at position 122,glutamic acid at position 126, threonine at position 127, leucine at position 128,glycine at position 132, glycine at position 139, tryptophan at position 159, andglycine at position 166. In another embodiment, it may be possible to substitute oneor more of residues 121 to 128 (as depicted in Figure 4), e.g., with glycines oralanines, or substituting some of the residues with the exceptions of serine as position123, or leucine at position 125. 38 010596

In another embodiment, an analog of the OB polypeptide, preferably the human OBpolypeptide, is a truncated form of the polypeptide. For example, it has already beendemonstrated that the glutamine at residue 49 is not essential, and can be deleted fromthe peptide. Similarly, it may be possible to delete some or ail of the divergentamino acid residues at positions 121-128. In addition, the invention contemplâtesproviding an OB analog having the minimum amino acid sequence necessary for abiological activity. This can be readily determined, e.g., by testing the activity offragments of OB for the ability to bind to OB-specific antibodies, inhibit the activityof the native OB polypeptide, or agonize the activity of the native OB peptide. In oneembodiment, the invention provides a truncated OB polypeptide consisting of the loopstructure formed by the disulfide bond that forms between cysteine residues 117 and167 (as depicted in Figure 4). In another embodiment, the truncated analogcorresponds to the amino acids from residue 22 (which follows the putative signalpeptide cleavage site) to 53 (the amino acid residue immediately preceding a flexibleloop région detected with limited proteolysis followed by mass spectrométrie analysisof the OB polypeptide; see Cohen et al., Protein Science, 4:1088 (1995). In anotherembodiment, the truncated analog corresponds to amino acids from residue 61 (theresidue immediately following the flexible loop région as detected with the limitedproteolysis/mass spec. analysis of the OB polypeptide) to amino acid residue 116 (theresidue immediately preceding the first cysteine residue). In yet another embodiment,the truncated analog corresponds to amino acids from residue 61 to amino acidresidue 167.

Furthermore, one or more of the residues of the putative flexible loop at residuesnumber 54 to 60 are substituted. For example, one or more of the residues may besubstituted with lysine, glutamic acid, or cysteine (preferably lysine) for cross linking,e.g., to a polymer, since flexible loop structures are preferred sites for derivatizationof a protein. Alternatively, the residues at the flexible loop positions may besubstituted with amino acid residues that are more résistant to proteolysis but thatretain a flexible structure, e.g., one or more pralines. In yet another embodiment, 39 010596 substitutions with amino acid residues that can be further derivatized to make themmore résistant to dégradation, e.g., proteolysis, is contemplated.

It will be appreciated by one of ordinary skill in the art that the foregoing fragmentsizes are approximate. and that from one to about five amino acids can be includedor deleted from each or both ends, or from the interior of the polypeptide orfragments thereof, of the recited truncated analogs, with the exception that in thedisulfide bonded loop analogs, the cysteine residues must be maintained.

It has been found that murine OB peptide contains 50% α-helical content, and thatthe human OB polypeptide contains about 60% α-helical content, as detected bycircular dichroism of the recombinant peptides under nearly physiological conditions.Accordingly, in another embodiment, amino acid residues can be substituted withresidues to form analogs of OB polypeptide that demonstrate enhanced propensity forforming, or which form more stable, α-helix structures. For example, a-helixstructure would be preferred if Glu, Ala, Leu, His, Trp are introduced as substitutesfor amino acid residues found in the native OB polypeptide. Preferably, conservativeamino acid substitutions are employed, e.g., substituting aspartic acid at residue(s)29, 30, 44, 61, 76, 100, and/or 106 (as depicted in Figure 4) with glutamic acid(s)(Glu); substituting isoleucine(s) with leucine; substituting glycine or valine, or anydivergent amino acid, with alanine (e.g., serine at position 53 of the human OBpolypeptide with alanine), substituting arginine or lysine with histidine, andsubstituting tyrosine and/or phenylalanine with tryptophan. Increasing the degree, ormore importantly, the stability of a-helix structure may yield an OB analog withgreater activity, increased binding affinity, or longer· half-life. In a spécifieembodiment, the hélix forming potential of the portion of the OB peptidecorresponding to amino acid residues 22 through 53 is increased. In anotherembodiment, the helix-forming potential or stability of the amino acid residues 61-116is increased. In yet another embodiment, the hélix forming potential of the disulfideloop structure corresponding to amino acids 117 to 167 is increased. Alsocontemplated are OB analogs containing enhanced α-helical potential or stability in 40 C1 0596 more than one of the foregoing domains. In a further embodiment, truncated OBpolypeptide analogs are generated that incorporate structure-forming, e.g., helix-forming, amino acid residues to compensate for the greater propensity of polypeptidefragments to lack stable structure.

Analogs, such as fragments, may be produced, for example, by pepsin digestion ofweight modulator peptide material. Other analogs, such as muteins, can be producedby standard site-directed mutagenesis of weight modulator peptide coding sequences.Analogs exhibiting "weight modulator activity" such as small molécules, whetherfunctioning as promoters or inhibitors, may be identified by known in vivo and/or invitro assays.

Small Molécule Analogs and Pepridomimetics of 03 PolypeptideThe structure of the ob polypeptide, preferably human OB polypeptide, can beanalyzed by various methods known in the art. The protein sequence can becharacterized by a hydrophilicity analysis [e.g., Hopp et al., Proc. Natl. Acad. Sci.USA, 78:3824 (1981)]. A hydrophilicity profile can be used to identify thehydrophobie and hydrophilic régions of the OB polypeptide, which may indicaterégions buried in the interior of the folded polypeptide, and régions accessible on theexterior of the polypeptide. In addition, secondary structural analysis [e.g., Chou etal, Biochem., 13:222 (1974)] can also be done, to identify régions of OB polypeptidethat assume spécifie secondary structures. Manipulation of the predicted ordetermined structure, including secondary structure prédiction, can be accomplishedusing computer software programs available in the art.

By providing an abundant source of recombinant OB polypeptide, the présentinvention enables quantitative structural détermination of the polypeptide. Inparticular, enough material is provided for nuclear magnetic résonance (NMR),infrared (IR), Raman, and ultraviolet (UV), especially circular dichroism (CD),spectroscopic analysis. In particular NMR provides very powerful structural analysisof molécules in solution, which more closely approximates their native environment 4i CJ0596 [Marion e: cl., Biochim. Biophys. Res. Comm., 113:967-974 (1983); Bar er al., J.Magn. Reson.. 65:355-360 (1985); Kimura et al., Proc. Nail. Acad. Sel. USA,77:1681-1685 (1980)]. Other methods of structural analysis can also be employed.These include but are not limited to X-ray crystallography [Engstom, Biochem. Exp.5/o/., 11:7-13 (1974)].

In yet a further embodiment, an analog of OB polypeptide can be tested to déterminewhether it cross-reacts with an antibody spécifie for native OB polypeptide, orspécifie fragments thereof. The degree of cross-reactivity provides information aboutstructural homology or similarity of proteins, or about the accessibility of régionscorresponding to portions of the polypeptide that were used to generate fragment-specific antibodies.

Screening for OB Analogs

Various screening techniques are known in the art for screening for analogs ofpolypeptides. Various libraries of Chemicals are available. Accordingly, the présentinvention contemplâtes screening such libraries, e. g., libraries of synthetic compoundsgenerated over years of research, libraries of natural compounds, and combinatoriallibraries, as described in greater detail, infra, for analogs of OB polypeptide. In oneembodiment, the invention contemplâtes screening such libraries for compounds thatbind to anti-OB polypeptide antibodies, preferably anti-human ob polypeptideantibodies. In another aspect, once the OB receptor is identified (see infra'), anyscreening technique known in the art can be used to screen for OB receptor agonistsor antagonists. The présent invention contemplâtes screens for small molécule ligandsor ligand analogs and mimics, as well as screens for natural ligands that bind to andagonize or antagonize activate OB receptor in vivo.

Knowledge of the primary sequence of the receptor, and the similarity of thatsequence with proteins of known function, can provide an initial due as to theagonists or antagonists of the protein. Identification and screening of antagonists isfurther facilitated by determining structural features of the protein, e.g., using X-raycrystallography, neutron diffraction, nuclear magnetic résonance spectrometry, and 42 CÎC596 other techniques for structure détermination. These techniques provide for therationaJ design or identification of agonists and antagonists.

Another approach uses recombinant bacteriophage.to produce large libraries. Usingthe "phage method" [Scott et al., Science, 249:386-390 (1990); Cwirla et al., Proc.Natl. Acad. Sci. USA, 87:6378-6382 (1990); Devlin et al., Science, 249:404-406(1990)], very large libraries can be constructed (ΙΟ6-108 Chemical entities). A secondapproach uses primarily Chemical methods, of which the Geysen method [Geysen etal., Molecular Immunology, 23:709-715 (1986); Geysen et al., J. ImmunologieMethod, 102:259-274 (1987)] and the recent method of Fodor et al., Science,251:767-773 (1991) are examples. Furka et al. 14th International Congress ofBiochemistry, Volume 5, Abstract FR:013 (1988); Furka, Int. J. Peptide ProteinRes., 2>7·Λ&amp;Ί-49?> (1991)]; Houghton (U.S. Patent No. 4,631,211, issued December1986); and Rutter et al. (U.S. Patent No. 5,010,175, issued April 23, 1991) describemethods to produce a mixture of peptides that can be tested as agonists or antagonists.

In another aspect, synthetic libraries [Needels et al., Proc. Natl. Acad. Sci. USA,90:10700-10704 (1993); Lam et al., International Patent Publication No. WO92/00252, each of which is incorporated herein by référencé in its entirety], and thelike can be used to screen for OB receptor ligands according to the présent invention.With such libraries, receptor antagonists can be detected using cells that express thereceptor without actually cloning the OB receptor.

Altematively, assays for binding of soluble ligand to cells that express recombinantforms of the OB receptor ligand binding domain can be performed. The solubleligands can- be provided readily as recombinant or synthetic OB polypeptide.

The screening can be performed with recombinant cells that express the OB receptor,or altematively, using purified receptor protein, e.g., produced recombinantly, asdescribed above.' For example, the ability of labeled, soluble or solubilized OB v Cl 0596 receptor, that includes the ligand-binding portion of the molécule, to bind Ligand canbe used to screen libraries, as described in the foregoing references. Dérivatives of OB Polypeptides

Generally, the présent protein (herein the term "protein" is used to include"polypeptide," unless otherwise indicated) may be derivatized by the attachment ofone or more Chemical moieties to the protein moiety. The chemically modifieddérivatives may be further formulated for intraarterial, intraperitoneal, intramuscular,subcutaneous, intravenous, oral, nasal, rectal, bucal, sublingual, pulmonary, topical,transdermal, or other routes of administration. Chemical modification of biologicallyactive proteins has been found to provide additional advantages under certaincircumstances, such as increasing the stability and circulation time of the therapeuticprotein and decreasing immunogenicity. See U.S. Patent No. 4,179,337, Davis etal., issued December 18, 1979. For a review, see Abuchowski et al., "SolublePolymer-Enzyme Adducts", in Enzymes as Drugs, pp. 367-383, Holcenberg andRoberts, eds., Wiley-Interscience, New York, NY, (1981). A review articledescribing protein modification and fusion proteins is Francis, Focus on GrowthFactors, 3:4-10 (1992).

Chemical Moieties For Derivatization

The Chemical moieties suitable for derivatization may be selected from among watersoluble polymers. The polymer selected should be water soluble so that the proteinto which it is attached does not precipitate in an aqueous environment, such as aphysiological environment. Preferably, for therapeutic use of the end-productpréparation, the polymer will be pharmaceutically acceptable. One skilled in the artwill be able to select the desired polymer based on such considérations as whether thepolymer/protein conjugate will be used therapeutically, and if so, the desired dosage,circulation time, résistance to proteolysis, and other considérations. For the présentproteins and peptides, these may be ascertained using the assays provided herein. 44

Polymer Molécules

The water soluble polymer may be selected from the group consisting of, forexample, polyethylene glycol. copolymers of ethylene glycol/propylene glycol,carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1, 3-dioxolane, poly-1,3,6-trioxane, ethylene/maleic anhydride copolymer,polyaminoacids (either homopolymers or random copolymers), and dextran orpoly(n-vinvl pyrrolidone)polyethylene glycol, propropylene glycol homopolymers,polypropylene oxide/ethylene oxide co-polymers, polyoxyethylated polyols andpolyvinyl alcohol. Polyethylene glycol propionaldenhyde may provide advantages inmanufacturing due to its stability in water.

The polymer may be of any molecular weight, and may be branched or unbranched.For polyethylene glycol, the preferred molecular weight is between about 2kDa andabout lOOkDa (the term "about" indicating that in préparations of polyethylene glycol,some molécules will weigh more, some less, than the stated molecular weight) forease in handling and manufacturing. Other sizes may be used, depending on thedesired therapeutic profile (e.g., the duration of sustained release desired, the effects,if any on biological activity, the ease in handling, the degree or lack of antigenicityand other known effects of the polyethylene glycol to a therapeutic protein or analog).

Polymer/Proiein Ratio

The number of polymer molécules so attached may vary, and one skilled in the artwill be able to ascertain the effect on function. One may mono-derivatize, or mayprovide for a di-, tri-, tetra- or some combination of derivatization, with the same ordifferent Chemical moieties (e.g., polymers, such as different weights of polyethyleneglycols). The proportion of polymer molécules to protein (or peptide) molécules willvary, as will their concentrations in the reaction mixture. In general, the optimumratio (in terms of efficiency of reaction in that there is no excess unreacted proteinor polymer) will be determined by factors such as the desired degree of derivatization(e.g., mono, di-, tri-, etc.), the molecular weight of the polymer selected, whetherthe polymer is branched or unbranched, and the reaction conditions. 45 C10596

Attachaient of the Chemical Moiery to the ProteinThe polyethylene glycol molécules (or other Chemical moieties) should be attaçhedto the protein with considération of effects on functional or antigenic domains of theprotein. Tnere are a number of attachment methods available to those skilled in theart, e.g., EP 0 401 384 herein incorporâtes by référencé (coupling PEG to G-CSF).See also Malik et al., Exp. Hematol., 20:1028-1035 (1992) (reporting pegylation ofGM-CSF using tresvl chloride). For example, polyethylene glycol may be covalentlybound through amino acid residues via a reactive group, such as a free amino orcarboxyl group. Reactive groups are those to which an activated polyethylene glycolmolécule may be bound. The amino acid residues having a free amino group mayinclude lysine residues and the N-terminal amino acid residues, those having a freecarboxyl group may include aspartic acid residues glutamic acid residues and theC-terminal amino acid residue. Sulfhydry groups may also be used as a reactivegroup for attaching the polyethylene glycol molecule(s). Preferred for therapeuticpurposes is attachment at an amino group, such as attachment at the N-terminus orlysine group. Attachment at residues important for receptor binding should beavoided if receptor binding is desired. N-terminally Chemically Modified Proteins.

One may specifically desire N-terminally chemically modified protein. Usingpolyethylene glycol as an illustration of the présent compositions, one may selectfrom a variety of polyethylene glycol molécules (by molecular weight, branching,etc.), the proportion of polyethylene glycol molécules to protein (or peptide)molécules in the reaction mix, the type of pegylation reaction to be performed, andthe method of obtaining the selected N-terminally pegylated protein. The method ofobtaining the N-terminally pegylated préparation (i.e., separating this moiety fromother monopegylated moieties if necessary) may be by purification of theN-terminally pegylated material from a population of pegylated protein molécules.Sélective N-terminal Chemical modification may be accomplished by reductivealkylation which exploits differential reactivity of different types of primary amino 46 CÎG596 groups (lysine versus the N-terminus) available for derivatization in a particularprotein. Under the appropriate reaction conditions, substantially sélectivederivatization of the protein at the N-terminus with a carbonyl group containingpolymer is achieved. For example, one may selectively N-terminally pegylate theprotein by performing the reaction at a pH which allows one to take advantage of thepK, différences between the e-amino groups of the lysine residues and that of the a-amino group of the N-terminal residue of the protein. By such sélectivederivatization attachment of a water soluble polymer to a protein is controlled: theconjugation with the polymer takes place predominantly at the N-terminus of theprotein and no significant modification of other reactive groups, such as the lysineside chain amino groups, occurs. Using reductive alkylation, the water solublepolymer may be of the type described above, and should hâve a single reactivealdéhyde for coupling to the protein. Polyethylene glycol propionaldéhyde, containinga single reactive aldéhyde, may be used.

Nucleic Acids Associated With OB PolypeptideAs noted above, the présent invention is directed to nucleic acids encoding obpolypeptides, as well as associated genomic non-coding sequences 5', 3', and intronicto the OB gene. Thus, in accordance with the présent invention there may beemployed conventional molecular biology, microbiology, and recombinant DNAtechniques within the skill of the art. Such techniques are explained fully in theliterature. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Monual,Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NewYork (1989); Glover ed., DNA Cloning: A Practical Approach, Volumes I and Π,MRL Press, Ltd., Oxford, U.K. (1985); Gait ed., OligonucleotideSynthesis, OxfordUniversity Press (1984); Hames et al., eds., Nucleic Acid Hybridization, Springer-Verlag (1985); Hames et al., eds. Transcription And Translation, Oxford UniversityPress (1984)]; Freshney ed., Animal Cell Culture, Oxford University Press (1986)];ImmobiUzed Cells And Enzymes, IRL Press (1986)]; Perbal, A Practical Guide ToMolecular Cloning, Wiley, New York (1984). Of particular relevance to the présentinvention are strategies for isolating, cloning, sequencing, analyzing, and 47 C10596 characterizing a gene or nucleic acid based on the well known polymerase Chainreaction (PCR) techniques. A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functionsas an autonomous unit of DNA réplication in vivo, i.e., capable of réplication underits own control. A "vector" is a replicon, such as a plasmid, phage or cosmid, to which another DNAsegment may be attached so as to bring about the réplication of the attached segment. A "cassette" refers to a segment of DNA that can be inserted into a vector at spécifierestriction sites. The segment of DNA encodes a polypeptide of interest, and thecassette and restriction sites are designed to ensure insertion of the cassette in theproper reading frame for transcription and translation. "Heterologous" DNA refers to DNA not naturally located in the cell, or in achromosomal site of the cell. Preferably, the heterologous DNA includes a geneforeign to the cell. A cell has been "transfected" by exogenous or heterologous DNA when such DNAhas been introduced inside the cell. A cell has been "transformed" by exogenous orheterologous DNA when the transfected DNA effects a phenotypic change.Preferably, the transforming DNA should be integrated (covalently linked) intochromosomal DNA making up the genome of the cell. A "clone" is a population of cells derived from a single cell or common ancestor bymitosis. A "nucleic acid molécule" refers to the phosphate ester polymeric form ofribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molécules") or 48 C1G596 deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, ordeoxycytidine; "DNA molécules") in either single-stranded form, or a double-srrandedhélix. Double-stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.The term nucleic acid molécule, and in particular DNA or RNA molécule, refers onlyto the primary and secondary structure of the molécule, and does not limit it to anyparticular tertiary or quatemary forms. Thus, this term includes double-strandedDNA found, inter alia, in linear or circular DNA molécules (e.g., restrictionfragments), plasmids, and chromosomes. In discussing the structure of particulardouble-stranded DNA molécules, sequences may be described herein according to thenormal convention of giving only the sequence in the 5' to 3' direction along thenontranscribed strand of DNA (/. e., the strand having a sequence homologous to themRNA). A "recombinant DNA molécule" is a DNA molécule that has undergone amolecular biological manipulation. A nucleic acid molécule is "hybridizable" to another nucleic acid molécule, such asa cDNA, genomic DNA, or RNA, when a single-stranded form of the nucleic acidmolécule can anneal to the other nucleic acid molécule under the appropriateconditions of température .and solution ionic strength (see Sambrook et al., 1989,supra). The conditions of température and ionic strength détermine the "stringency"of the hybridization. For preliminary screening for homologous nucleic acids, lowstringency hybridization conditions, corresponding to a Tm of 55°C, can be used,e.g., 5x SSC, 0.1% SDS, 0.25% milk, and no formamide; or 30% formamide, 5xSSC, 0.5% SDS). Moderate stringency hybridization conditions correspond to ahigher Tm, e.g., 40% formamide, with 5x or 6x SCC. High stringency hybridizationconditions correspond to the highest Tm, e.g., 50% formamide, 5x or 6x SCC.Hybridization requires that the two nucleic acids contain complementary sequences,although depending on the stringency of the hybridization, mismatches between basesare possible. The appropriate stringency for hybridizing nucleic acids dépends on thelength of the nucleic acids and the degree of complémentation, variables well knownin the art. The greater the degîee of similarity or homology between two nucléotidesequences, the greater the value of Tm for hybrids of nucleic acids having those 49 CIC’596 sequences. The relative stability (corresponding to higher TJ of nucleic acid hybridizations decreases in the following order: RNA:RNA, DNA:RNA, DNA:DNA. For hvbrids of greater than 100 nucléotides in length, équations forcalculating Τ3 hâve been derived (see Sambrook et al., 19S9, supra, 9.50-0.51). Forhybridization with shorter nucleic acids, i.e., oligonucleotides, the position ofmismatches becomes more important, and the length of the oligonucleotide déterminesits specificity (see Sambrook et al., 1989, supra, 11.7-11.8). Preferably a minimumlength for a hybridizable nucleic acid is at least about 10 nucléotides; more preferablyat least about 15 nucléotides; most preferably the length is at least about 20nucléotides. "Homologous recombination" refers to the insertion of a foreign DNA sequence ofa vector in a chromosome. Preferably, the vector targets a spécifie chromosomal sitefor homologous recombination. For spécifie homologous recombination, the vectorwill contain sufficiently long régions of homology to sequences of the chromosometo allow complementary binding and incorporation of the vector into the chromosome.Longer régions of homology, and greater degrees of sequence similarity, mayincrease the efficiency of homologous recombination. A DNA "coding sequence" is a double-stranded DNA sequence which is transcribedand translated into a polypeptide in a cell in vitro or in vivo when placed under thecontrol of appropriate regulatory sequences. The boundaries of the coding séquenceare determined by a start codon at the 5' (amino) terminus and a translation stopcodon at the 3' (carboxyl) terminus. A coding sequence can include, but is notlimited to, prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNAsequences from eukaryotic (e.g., mammalian) DNA, and even synthetic DNAsequences. If the coding sequence is intended for expression in a eukaryotic cell, apolyadenylation signal and transcription termination sequence will usually be located3' to the coding sequence. 50 010596

Isolation of OB Coding and FlanJang SequencesThe nucleic acids contemplated by the présent invention extend as indicated, to othernucleic acids that code on expression for peptides such as those set forth in FIGUREIA through D (SEQ ID NO:2), FIGURE 3 (SEQ ED NO:4), FIGURE 5 (SEQ EDNO:5), and FIGURE 6 (SEQ ED NO:6) herein. Accordingly, while spécifie DNAhas been isolated and sequenced in relation to the ob gene, any animal cell potentiallycan serve as the nucleic acid source for the molecular cloning of a gene encoding thepeptides of the invention. The DNA may be obtained by standard procedures knownin the art from cloned DNA (e.g., a DNA "library"), by Chemical synthesis, bycDNA cloning, or by the cloning of genomic DNA, or fragments thereof, purifiedfrom the desired cell (See, for example, Sambrook étal., 1989, supra\ Glover, 1985,supra). Clones derived from genomic DNA may contain regulatory and intronicDNA régions in addition to coding régions; clones derived from cDNA will notcontain intron sequences. Whatever the source, the gene should be molecularlycloned into a suitable vector for propagation of the gene.

In the molecular cloning of the gene from genomic DNA, the genomic DNA can beamplified using primers selected from the cDNA sequences. Altematively, DNAfragments are generated, some of which will encode the desired gene. The DNA maybe cleaved at spécifie sites using various restriction enzymes. One may also useDNase in the presence of manganèse to fragment the DNA, or the DNA can bephysically sheared, as for example, by sonication. The linear DNA fragments canthen be separated according to size by standard techniques, including but not limitedto, agarose and polyacrylamide gel electrophoresis and column chromatography.

Once the DNA fragments are generated, identification of the spécifie DNA fragmentcontaining the desired ob or od-like gene may be accomplished in a number of ways.For example, if an amount of a portion of a ob or ofr-like gene or its spécifie RNA,or a fragment thereof, is available and can be purified and labeled, the generatedDNA fragments may be screened by nucleic acid hybridization to a labeled probe[Benton et al., Science, 196:180 (1977); Grunstein et al., Proc. Natl. Acad. Sci. 51 010596 USA, 72:3961 (1975)]. The présent invention provides such nucleic acid probes,which can be conveniently prepared from the spécifie sequences disclosed herein,e.g., a hybridizable probe having a nucléotide sequence corresponding to at least a10, and preferably a 15, nucléotide fragment of the sequences depicted in Figure IAthrough E (SEQ ED NO:1) or Figure 2A and B (SEQ ED NO:3). Preferably, afragment is selected that is highly unique to the modulator peptides of the invention.Those DNA fragments with substantial homology to the probe will hybridize. Asnoted above, the greater the degree of homology, the more stringent the hybridizationconditions that can be used. In one embodiment, low stringency hybridizationconditions are used to identify a homologous modulator peptide. However, in apreferred aspect, and as demonstfated experimentally herein, a nucleic acid encodinga modulator peptide of the invention will hybridize to a nucleic acid having anucléotide sequence such as depicted in Figure IA through E (SEQ ED NO:1) orFigure 2A and B (SEQ ED NO:3), or a hybridizable fragment thereof, undermoderately stringent conditions; more preferably, it will hybridize under highstringency conditions.

Altematively, the presence of the gene may be detected by assays based on thephysical, Chemical, or immunological properties of i.ts expressed product. Forexample, cDNA clones, or DNA clones which hybrid-select the proper mRNAs, canbe selected which produce a protein that, e.g., has similar or identical electrophoreticmigration, isoelectric focusing behavior, proteolytic digestion maps, tyrosinephosphatase activity or antigenic properties as known for the présent modulatorpeptides. For example, the antibodies of the instant invention can conveniently beused to screen for homologs of modulator peptides from other sources. A gene encoding a modulator peptide of the invention can also be identified bymRNA sélection, i.e., by nucleic acid hybridization followed by in vitro translation.In this procedure, fragments are used to isolate complementary mRNAs byhybridization. Such DNA fragments may represent available, purified modulatorDNA. Immunoprécipitation analysis or functional assays (e.g., tyrosine phosphatase 52 0 1 0 5 9 6 activity) of the in vitro translation products of the products of the isolated mRNAsidentifies the mRNA and, therefore, the complementary DNA fragments, that containthe desired sequences. In addition, spécifie mRNAs may be selected by adsorptionof polysomes isolated from cells to immobilized antibodies specifically directed 5 against a modulator peptide. A radiolabeled modulator peptide cDNA can be synthesized using the selected mRNA(from the adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA maythen be used as a probe to identify homologous modulator peptide DNA fragmentsfrom among other genomic DNA fragments. 10 As mentioned above, a DNA sequence encoding weight modulator peptides asdisclosed herein can be prepared synthetically rather than cloned. The DNA sequencecan be designed with the appropriate codons for the weight modulator peptide aminoacid sequences. In general, one will select preferred codons for the intended host ifthe sequence will be used for expression. The complété sequence is assembled from 15 overlapping oligonucleotides prepared by standard methods and assembled into a'complété coding sequence. See, e.g., Edge, Nature, 292:756 (1981); Nambair et al.,Science, 223:1299 (1984); Jay et al., J. Biol. Chem., 259:6311 (1984).

Synthetic DNA sequences allow convenient construction of genes which will expressweight modulator analogs, as described above. Altematively, DNA encoding analogs 20 can be made by site-directed mutagenesis of native OB genes or cDNAs, and analogscan be made directly using conventional polypeptide synthesis. A general method for site-specific incorporation of unnatural amino acids intoproteins is described in Noren et al, Science, 244:182-188 (1989). This method maybe used to create analogs of the ob polypeptide with unnatural amino acids. 53 010596

Non-coding Nucleic Acids

The présent invention extends to the préparation of antisense nucléotides andribozymes that may be used to interfère with the expression of the weight modulatorproteins at the translational level. This approach utilizes antisense nucleic acid andribozymes to block translation of a spécifie mRNA, either by masking that mRNAwith an antisense nucleic acid or cleaving it with a ribozyme. .Antisense nucleic acids are DNA or RNA molécules that are complementary to atleast a portion of a spécifie mRNA molécule [See Weintraub, Sci. Am., 262:40-46(1990); Marcus-Sekura, Anal. Biochem., 172:289-295 (1988)]. In the cell, theyhybridize to that mRNA, forming a double-stranded molécule. The cell does nottranslate an mRNA complexed in this double-stranded form. Therefore, antisensenucleic acids interfère with the expression of mRNA into protein. Oligomers of aboutfifteen nucléotides and molécules that hybridize to the AUG initiation codon will beparticularly efficient, since they are easy to synthesize and are likely to pose fewerproblems than larger molécules when introducing them into weight modulator peptide-producing cells. Antisense methods hâve been used to inhibit the expression of manygenes in vitro [(Marcus-Sekura, 1988 supra·, Hambor et al., J. Exp. Med.,168:1237-1245 (1988)].

Ribozymes are RNA molécules possessing the ability to specifically cleave othersingle-stranded RNA molécules in a mariner somewhat analogous to DNA restrictionendonucleases. Ribozymes were discovered from the observation that certain mRNAshâve the ability to excise their own introns. By modifying the nucléotide sequenceof these RNAs, researchers hâve been able to engineer molécules that recognizespécifie nucléotide sequences in an RNA molécule and cleave it [Cech, J. Am. Med.Assoc., 260:3030-3034 (1988)]. Because they are sequence-specific, only mRNAswith particular sequences are inactivated.

Investigators hâve identified two types of ribozymes, Tetrahymena-type and"hammerhead"-type. Terrahymena-type ribozymes recognize four-base sequences, 54 010596 while "hammerhead"-type recognize eleven- to eighteen-base sequences. The longerthe récognition sequence, the more lxkely it is to occur exclusively in the targetmRNA species. Therefore, hammerhead-type ribozymes are préférable toTeirahymena-Vftz ribozymes for inactivating a spécifie mRNA species, and eighteenbase récognition sequences are préférable to shorter récognition sequences.

The DNA sequences described herein may thus be used to préparé antisensemolécules against and ribozymes that cleave mRNAs for weight modulator proteinsand their ligands, thus inhibiting expression of the ob gene, and leading to increasedweight gain and adiposity.

In another embodiment, short oligonucleotides complementary to the coding andcomplementary strands of the OB nucleic acid, or to non-coding régions of the OBgene 5', 3', or internai (intronic) to the coding région are provided by the présentinvention. Such nucleic acids are useful as probes, either as directly labeledoligonucleotide probes, or as primers for the polymerase chain reaction, forevaluating the presence of mutations in the ob gene, or the level of expression of OBmRNA. Preferably, the non-coding nucleic acids of the invention are from thehuman OB gene.

In a spécifie embodiment, the non-coding nucleic acids provide for homologousrecombination for intégration of an amplifîable gene and/or other regulatorysequences in proximity to the OB gene, e.g., to provide for higher levels ofexpression of the OB polypeptide, or to overcome a mutation in the ob generegulatory sequences that prevent proper levels of expression of the OB polypeptide(See International Patent Publication WO 91/06666, published May 16, 1991 bySkoultchi; International Patent Publication No. WO 91/09955, published July 11,1991 by Chappel; see also International Patent Publication No. WO 90/14092,published November 29, 1990, by Kucherlapati and Campbell). 55 010596

Production of OB Polypeptide: Expression and SvnthesisTranscriptional and translational control sequences are DNA regulatory sequences,such as promoters, enhancers, terminators, and the like, that provide for theexpression of a coding sequence in a host cell. In eukaryotic cells. polyadenylationsignais are control sequences. A coding sequence is "under the control" of transcriptional and translational controlsequences in a cell when RNA polymerase transcribes the coding sequence intomRNA, which is then trans-RNA spliced and translated into the protein encoded bythe coding sequence. A "signal sequence" is included at the beginning of the coding sequence of a proteinto be expressed on the surface of a cell. This sequence encodes a signal peptide, N-terminal to the mature polypeptide, that directs the host cell to translocate thepolypeptide. The term "translocation signal sequence" is also used herein to refer tothis sort of signal sequence. Translocation signal sequences can be found associatedwith a variety of proteins native to eukaryotes and prokaryotes, and are oftenfunctional in both types of organisms. A DNA sequence is "operatively linked" to an expression control sequence when theexpression control sequence Controls and régulâtes the transcription and translationof that DNA sequence. The term "operatively linked" includes having an appropriatestart signal (e.g., ATG) in front of the DNA sequence to be expressed andmaintaining the correct reading frame to permit expression of the DNA sequenceunder the control of the expression control sequence and production of the desiredproduct encoded by the DNA sequence. If a gene that one desires to insert into arecombinant DNA molécule does not contain an appropriate start signal, such a startsignal can be inserted upstream (5') of and in reading frame with the gene. A "promoter sequence" is a DNA regulatory région capable of binding RNApolymerase in a cell and initiating transcription of a downstream (3' direction) coding 56 010596 sequence. For purposes of defining the présent invention, the promoter sequence isbounded at its 3' terminus by the transcription initiation site and extends upstream (5'direction) to include the minimum number of bases or éléments necessary to initiatetranscription at levels détectable above background. Within the promoter sequencewill be found a transcription initiation site (conveniently defined for example, bymapiping with nuclease SI), as well as protein binding domains (consensus sequences)responsable for the binding of RNA polymerase.

Another feature of this invention is the expression of the DNA sequences disclosedherein. As is well known in the art, DNA sequences may be expressed byoperatively linking them to an expression control sequence in an appropriateexpression vector and employing that expression vector to transform an appropriateunicellular host.

Such operative linking of a DNA sequence of this invention to an expression controlsequence, of course, includes, if not already part of the DNA sequence, the provisionof an initiation codon, ATG, in the correct reading frame upstream of the DNAsequence. A wide variety of host/expression vector combinations may be employed inexpressing the DNA sequences of this invention. Useful expression vectors, forexample, may consist of segments of chromosomal, non-chromosomal and syntheticDNA sequences. Suitable vectors include dérivatives of SV40 and known bacterialplasmids, e.g., E. coli plasmids col El, pCRl, pBR322, pMB9, pUC or pUC plasmiddérivatives, e.g., pGEX vectors, pET vectors, pmal-c, pFLAG, etc., and theirdérivatives, plasmids such as RP4; phage DNAs, e.g., the numerous dérivatives ofphage λ, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single-stranded phage DNA; yeast plasmids such as the 2μ plasmid or dérivatives thereof;vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells;vectors derived from combinations of plasmids and phage DNAs, such as plasmidsthat hâve been modifîed to employ phage DNA or other expression control sequences; 57 010596 and the like. In a preferred embodiment, expression of ob is achieved inmethylotrophic yeast, e.g., Pichia pastoris yeast (see, e.g., International PatentPublication No. WO 90/03431, published 5 April 1990, by Brierley et al.\International Patent Publication No. WO 90/10697, published 20 September 1990, by 5 Siegel et al.}. In a spécifie embodiment, infra, an expression vector is engineeredfor expression of ob under control of the α-mating factor signal sequence,

Any of a wide variety of expression control sequences -- sequences that control theexpression of a DNA sequence operatively linked to it - may be used in these vectorsto express the DNA sequences of this invention. Such useful expression control

10 sequences include, for example, the early or late promoters of SV40, CMV, vaccinia,polyoma or adenovirus, the lac System, the trp System, the TAC System, the TRCSystem, the LTR System, the major operator and promoter régions of phage λ, thecontrol régions of fd coat protein, the promoter for 3-phosphoglycerate kinase orother glycolytic enzymes, the promoters of acid phosphatase (e.g., Pho5), the AOX 15 1 promoter of methylotrophic yeast, the promoters of the yeast α-mating factors, and other sequences known to control the expression of genes of prokaryotic or eukaryoticcells or their viruses, and various combinations thereof. A wide variety of unicellular host cells are also useful in expressing the DNAsequences of this invention. These hosts may include well known eukaryotic and 20 prokaryotic hosts, such as strains of E. coli, Pseudomonas, Bacillus, Streptontyces·,fungi such as yeasts (Saccharomyces, and methylotrophic yeast such as Pichia,Candida, Hansenula, and Torulopsis}', and animal cells, such as CHO, Rl.l, B-W andLM cells, African Green Monkey kidney cells (e.g., COS 1, COS 7, BSC1, BSC40,and BMT10), insect cells (e.g., Sf9), and human cells and plant cells in tissue 25 culture.

It will be understood that not ail vectors, expression control sequences and hosts willfunction equally well to express the DNA sequences of this invention. Neither willail hosts function equally well with the same expression System. However, one 58 0 1 0596 skilled in the art will be able to select the proper vectors, expression controlsequences, and hosts without undue expérimentation to accomplish the desiredexpression without departing from the scope of this invention. For example, inselecting a vector, the host must be considered because the vector must function init. The vector’s copy number, the ability to control that copy number, and theexpression of any other proteins encoded by the vector, such as antibiotic markers,will also be considered.

In selecting an expression control sequence, a variety of factors will normally beconsidered. These include, for example, the relative strength of the System, itscontrollability, and its compatibility with the particular DNA sequence or gene to beexpressed, particularly as regards potential secondary structures. Suitable unicellularhosts will be selected by considération of, e.g., their compatibility with the chosenvector, their sécrétion characteristics, their ability to fold proteins correctly, and theirfermentation requirements, as well as the toxicity to the host of the product encodedby the DNA sequences to be expressed, and the ease of purification of the expressionproducts.

Considering these and other factors, a person skilled in the art will be able toconstruct a variety of vector/expression control sequence/host combinations that willexpress the DNA sequences of this invention on fermentation or in large scale animalculture.

In a spécifie embodiment, an OB fusion protein can be expressed. An OB fusionprotein comprises at least a functionally active portion of a non-OB protein joined viaa peptide bond to at least a functionally active portion of an OB polypeptide. Thenon-ob sequences can be amino- or carboxy-terminal to the OB sequences. Morepreferably, for stable expression of a proteolytically inactive OB fusion protein, theportion of the non-OB fusion protein is joined via a peptide bond to the amino-terminus of the OB protein. A recombinant DNA molécule encoding such a fusionprotein comprises a sequence encoding at least a functionally active portion of a non- 59 C1C5S6 OB protein joined in-frame to the OB coding sequence, and preferably encodes acleavage site for a spécifie protease, e.g., thrombin or Factor Xa, preferably at theOB-non-OB juncture. In a spécifie embodiment, the fusion protein is expressed inEscherichia coli or in P. pastoris.

In a spécifie embodiment, infra, vectors were prepared to express the murine andhuman ob genes, with and without the codon for gln-49, in bacterial expressionSystems and yeast (Pichia) expression Systems as fusion proteins. The ob gene isprepared with an endonuclease cleavage site, e.g., using PCR and novel primers. Itis désirable to confirm sequences generated by PCR, since the probability of includinga point mutation is greater with this technique. A plasmid containing a histidine tag(His-tag) and a proteolytic cleavage site is used. The presence of the histidine makespossible the sélective isolation of recombinant proteins on a Ni-chelation column, orby affmity purification. The proteolytic cleavage site, in a spécifie embodiment,infra, a thrombin cleavage site, is engineered so that treatment with the protease,e.g., thrombin, will release the full-length mature (i.e., lacking a signal sequence) OBpolypeptide.

In another aspect, the pGEX vector [Smith et al., Gene 67:31-40 (1988)] can be used.This vector fuses the schistosoma japonicum glutathionine S-transferase cDNA to thesequence of interest. Bacterial proteins are harvested and recombinant proteins canbe quickly purified on a reduced glutathione affmity column. The GST carrier cansubsequently be cleaved from fusion proteins by digestion with site-specific proteases.After cleavage, the carrier and uncleaved fusion protein can be removed byabsorption on glutathione agarose. Difficulty with the System occasionally ariseswhen the encoded protein is insoluble in aqueous solutions.

Expression of recombinant proteins in bacterial Systems may resuit in incorrectfolding of the expressed protein, requiring refolding. The recombinant protein canbe refolded prior to or after cleavage to form a functionally active OB polypeptide.The OB polypeptide may be refolded by the steps of (i) incubating the protein in a 60 010596 denaturing buffer that contains a reducing agent, and then (ii) tncubating the proteinin a buffer that contains an oxidizing agent, and preferably also contains a proteinstabilizing agent or a chaotropic agent, or both. Suitable redox (reducing/oxidizing)agent pairs include, but are not limited to, reduced glutathione/glutathione disulfide,cystine/cysteine, cystamine/cysteamine, and 2-mercaptoethanol/2-hydroxyethyldisulfide. In a particular aspect, the fusion protein can be solubilizedin a dénaturant, such as urea, prior to exchange into the reducing buffer. In preferredembodiment, the protein is also purified, e.g., by ion exchange or Ni-chelationchromatography, prior to exchange into the reducing buffer. Denaturing agentsinclude but are not limited to urea and guanidine-HCl. The recombinant protein isthen diluted about at least 10-fold, more preferably about 100-fold, into an oxidizingbuffer that contains an oxidizing agent, such as but not limited to 0.1 M Tris-HCl,pH 8.0, 1 mM EDTA, 0.15 M NaCl, 0.3 M oxidized glutathione. The fusion proteinis then incubated for about 1 to about 24 hours, preferably about 2 to about 16 hours,at room température in the oxidizing buffer. The oxidizing buffer may comprise aprotein stabilizing agent, e.g., a sugar, an alcohol, or ammonium sulfate. Theoxidizing buffer may further comprises a chaotropic agent at low concentration, todestabilize incorrect intermolecular interactions and thus promote proper folding.Suitable chaotropic agents include but are not limited to a detergent, a polyol, L-arginine, guanidine-HCl and polyethylene glycol (PEG). It is important to use a lowenough concentration of the chaotropic agent to avoid denaturing the protein. Therefolded protein can be concentrated by at least about 10-fold, more preferably by theamount it was diluted into the oxidizing buffer.

Bacterial fermentation processes can also resuit in a recombinant protein préparationthat contains unacceptable levels of endotoxins. Therefore, the inventioncontemplâtes removal of such endotoxins, e.g., by using endotoxin-specific antibodiesor other endotoxin binding molécules. The presence of endotoxins can be determinedby standard techniques, such as by employing E-TOXATE Reagents (Sigma, St.Louis, Missouri), or with bioassays. 61 010596

In addition to the spécifie example, the présent inventors contemplate use ofbaculovirus, mammalian, and yeast expression Systems to express the ob protein. Forexample, in baculovirus expression Systems, both non-fusion transfer vectors, suchas but not limited to pVL941 (SomHl cloning site; Summers), pVL1393 (BamHl,Smal, Xbal, EcoBA, zVorl, XmaAU, £g/H, and Pstl cloning site; Invitrogen), pVL1392(BgZII, Pstl. Notl, XmaHL, EcoBl, Xbal, Smal, and BamHl cloning site; Summersand Invitrogen), and pBlueBûcIH (BamHl, Bg[U, Pstl, Ncol, and HindGL cloning site,with blue/white recombinant screening possible; Invitrogen), and fusion transfervectors, such as but not limited to pAc700 (BamUl and Kpril cloning site, in whichthe ΒατηΗΙ récognition site begins with the initiation codon; Summers), pAc701 and II—·**· pAc702 (same as pAc700, with different reading frames), pAc360 (BûmHl cloningsite 36 base pairs downstream of a polyhedrin initiation codon; Invitrogen(195)), andpBlueBacHisA, B, C (three different reading frames, with BamHA, BglU, Pstl, Ncol,and Hindm cloning site, an N-terminal peptide for ProBond purification, andblue/white recombinant screening of plaques; Invitrogen (220)).

Mammalian expression vectors contemplated for use in the invention include vectorswith inducible promoters, such as the dihydrofolate reductase (DHFR) promoter, e.g.,any expression vector with a DHFR expression vector, or a DT/FR/methotrexate co-amplification vector, such as pED (Pstl, Sali, Sbal, Smal, and FcoRI cloning site,with the vector expressing both the cloned gene and DHFR·, see Kaufman, CurrentProtocols in Molecular Biology, 16.12 (1991). Altematively, a glutaminesynthetase/methionine sulfoximine co-amplification vector, such as pEE14 (HindBA,Xbal, Smal, Sbal, EcoRÎ, and BcÎl cloning site, in which the vector expressesglutamine synthase and the cloned gene; Celltech). In another embodiment, a vectorthat directs episomal expression under control of Epstein Barr Virus (EBV) can beused, such as pREP4 (BomHl, Sfil, Xhol, Notl, Nhel, Hinâm, Nhel, PvuU, and Kprilcloning site, constitutive RSV-LTR promoter, hygromycin selectable marker;Invitrogen), pCEP4 (BomHl, Sfil, Xhol, Notl, Nhel, Hinâm, Nhel, PvuU, and Kprùcloning site, constitutive hCMV immédiate early gene, hygromycin selectable marker;Invitrogen), pMEP4 (Kpnl, Pvul, Nhel, Hinâm, Notl, Xhol, Sfil, BamUl cloning 62 01 0596 site, inducible methallothionein Ha gene promoter, hygromycin selectable marker:Invitrogen), pREP8 (BamHI, Xhol, Notl, Hindm, Nhel, and Kpnl cloning site, RSV-LTR promoter, histidinol selectable marker; Invitrogen), pREP9 (Kpnl, Nhel,Hindm, Notl, Xhol. Sfîl, and BamHI cloning site, RSV-LTR promoter, G418selectable marker; Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycinselectable marker, N-terminal peptide purifiable via ProBond resin and cleaved byenterokinase; Invitrogen). Selectable mammalian expression vectors for use in theinvention include pRc/CMV (Hindm, BstXI, Notl, Sbal, and/lpûl cloning site, G418sélection; Invitrogen), pRc/RSV (Hindm, Spel, BstXI, Notl, Xbal cloning site, G418sélection; Invitrogen), and others. Vaccinîa virus mammalian expression vectors (see,Kaufman, 1991, supra) for use according to the invention include but are not limitedto pSCll (Smal cloning site, TK- and β-gal sélection), pMJ601 (SaR, Smal, AjR,Narl, BspNm, BamHI, Apal, Nhel, SacH, Kpnl, and Hindm cloning site; TK- andβ-gal sélection), and pTKgptFIS (Eco RI, Pstl, SaR, Accl, HindH, Sbal, BamHI, andHpa cloning site, TK or XPRT sélection). .

Yeast expression Systems can also be used according to the invention to express OBpolypeptide. For example, the non-fusion pYES2 vector (Xbal, Sphl, Shol, Notl,GstXl, EcoPl, BstXI, BamHI, Sacl, Kpnl, and Hindm cloning sit; Invitrogen) or thefusion pYESHisA, B, C (JM, Sphl, Shol, Notl, BstXI, EcoBl, BamHI, Sacl, Kpnl,and Hindm cloning site, N-terminal peptide purified with ProBond resin and cleavedwith enterokinase; Invitrogen), to mention just two, can be employed according to theinvention.

It is further intended that body weight modulator peptide analogs may be preparedfrom nucléotide sequences derived within the scope of the présent invention.

In addition to recombinant expression of OB polypeptide, the présent invention envisions and fully enables préparation of OB polypeptide, or fragments thereof, using the well known.and highly developed techniques of solid phase peptide synthesis. The invention contemplâtes using both the popular Boc and Fmoc, as well 63 0 1 0 5 9 6 as other protecting group strategies, for preparing ob polypeptide or fragmentsthereof. Various techniques for refolding and oxidizing the cysteine side chains toform a disulnde bond are also well-known in the an.

Antibodies to the OB Polypeptide

According to the invention, OB polypeptide produced recombinantly or by Chemicalsynthesis, and fragments or other dérivatives or analogs thereof, including fusionproteins, may be used as an immunogen to generate antibodies that recognize the OBpolypeptide. Such antibodies include but are not limited to polyclonal, monoclonal,chimeric, single chain, Fab fragments, and an«Fab expression library. A molécule is "antigenic" when it is capable of specifically interacting with an antigenrécognition molécule of the immune System, such as an immunoglobulin (antibody)or T cell antigen receptor. An antigenic polypeptide contains at least about 5, andpreferably at least about 10, amino acids. An antigenic portiôiPôf a molécule can bethat portion that is immunodominant for antibody or T cell receptor récognition, orit can be a portion used to generate an antibody to the molécule by conjugating theantigenic portion to a carrier molécule for immunization. A molécule that is antigenicneed not be itself immunogenic, i.e., capable of eliciting an immune response withouta carrier.

An "antibody" is any immunoglobulin, including antibodies and fragments thereof,that binds a spécifie epitope. The term encompasses polyclonal, monoclonal, andchimeric antibodies, the last mentioned described in further detail in U. S. Patent Nos.4,816,397 and 4,816,567, as well as antigen binding portions of antibodies, includingFab, F(ab’)2 and F(v) (including single chain antibodies). Accordingly, the phrase"antibody molécule" in its various grammatical forms as used herein contemplâtesboth an intact immunoglobulin molécule and an immunologically active portion of animmunoglobulin molécule containing the antibody combining site. Am "antibodycombining site" is that structural portion of an antibody molécule comprised of heavyand light chain variable and hypervariable régions that specifically binds antigen. 64 010596

Exemplary antibody molécules are intact immunoglobulin molécules, substantiallyintact immunoglobulin molécules and those portions of an immunoglobulin moléculethat contains the paratope, including those portions known in the art as Fab, Fab’,F(ab'): and F(.v), which portions are preferred for use in the therapeutic methodsdescribed herein.

Fab and F(ab'); portions of antibody molécules are prepared by the proteolyticreaction of papain and pepsin, respectively, on substantially intact antibody moléculesby methods that are well-known. See for example, U.S. Patent No. 4,342,566 toTheofilopolous et al. Fab’ antibody molécule portions are also well-known and areproduced from F(ab’); portions followed bynreduction o? the disulfide bonds linkingthe two heavy chain portions as with mercaptoethanol, and followed by alkylation ofthe resulting protein mercaptan with a reagent such as iodoacetamide. An antibodycontaining intact antibody molécules is preferred herein.

The phrase "monoclonal antibody" in its various grammatical forms refers to anantibody having only one species of antibody combining site capable ofimmunoreacting with a particular antigen. A monoclonal antibody thus typicallydisplays a single binding affinity for any antigen with which it immunoreacts. Amonoclonal antibody may therefore contain an antibody molécule having a pluralityof antibody combining sites, each immunospecific for a different antigen; e.g., abispecific (chimeric) monoclonal antibody.

The term "adjuvant" refers to a compound or mixture that enhances the immuneresponse to an antigen. An adjuvant can serve as a tissue depot that slowly releasesthe antigen and also as a lymphoid System activator that non-specifically enhances theimmune response [Hood et al., in îmmunology, p. 384, Second Ed.,Benjamin/Cummings, Menlo Park, California (1984)]. Often, a primary challengewith an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral orcellular immune response. Adjuvants include, but are not limited to, complétéFreund’s adjuvant, incomplète Freund’s adjuvant, saponin, minerai gels such as 65 010596 aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols,polyanions, peptides, oil or hydrocarbon émulsions, keyhole limpet hemocyanins,dinitrophènol. and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Freferably, the adjuvant is pharmaceuticallyacceptable.

Various procedures known in the art may be used for the production of polyclonalantibodies to OB polypeptide, or fragment, dérivative or analog thereof. For theproduction of antibody, various host animais can be immunized by injection with theOB polypeptide, or a dérivative (e.g., fragment or fusion protein) thereof, includîngbut not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, the OBpolypeptide or fragment thereof can be conjugated to an immunogenic carrier, e.g.,bovine sérum albumin (BSA) or keyhole limpet hemocyanin (KLH). Variousadjuvants may be used to increase the immunological response, depending on the hostspecies, including but not limited to Freund’s (complété and incomplète), minerai gelssuch as aluminum hydroxide, surface active substances such as lysolecithin, pluronic...polyols, zpolyanions, peptides, oil émulsions, keyhole limpet hemocyanins,dinitrophènol, and potentially useful human adjuvants such as BCG (bacille Calmette·Guérin) and Corynebacterium parvum..

For préparation of monoclonal antibodies directed toward the OB polypeptide, orfragment, analog, or dérivative thereof, any technique that provides for the productionof antibody molécules by continuous cell Unes in culture may be used. These includebut are not limited to the hybridoma technique originaUy developed by Kohler et al.,Nature, 256:495-497 (1975), as well as the trioma technique, the human B-ceUhybridoma technique [Kozbor et al., Immunology Today, 4:72 (1983)], and the EBV-hybridoma technique to produce human monoclonal antibodies [Cole et al., inMonoclonal Antibodies and Cancer Therapy,^. 77-96, Alan R. Liss, Inc., (1985)].Immortal, antibody-producing cell Unes can be created by techniques other thanfusion, such as direct transformation of B lymphocytes with oncogenic DNA, ortransfection with Epstein-Barr virus. See, e.g., M. Schreier et al., "Hybridoma 66 010596

Techniques" (1980): Hammerling et al., "Monoclonal Antibodies And T-cellHybridomas" (1981); Kennett et al., "Monoclonal Antibodies" (1980); see also U.S.Patent Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,451,570; 4,466,917;4.472,500; 4.491,632; and 4,493,890.

In an additional embodiment of the invention, monoclonal antibodies can be producedin germ-free animais utilizing recent technology (PCT/US90/02545). According tothe invention, human antibodies may be used and can be obtained by using humanhybridomas [Cote et al., Proc. Nail. Acad. Sel. USA, 80:2026-2030 (1983)] or bytransforming human B cells with EBV virus in vitro (Cole et al., 1985, supra}. Infact, according to the invention, techniques developed for the production of "chimericantibodies" [Morrison et al., J. Bacteriol., 159-870 (1984); Neuberger crû/., Afarwre,312:604-608 (1984); Takeda et al., Nature, 314:452-454 (1985)] by splicing thegenes from a mouse antibody molécule spécifie for an ob polypeptide together withgenes from a human antibody molécule of appropriate biological activity can be used;such antibodies are within the scope of this invention. Such human or humanizedchimeric antibodies are preferred for use in therapy of human diseases or disorders(described infra), since the human or humanized antibodies are much less likely thanxenogenic antibodies to induce an immune response, in particular an allergieresponse, themselves.

According to the invention, techniques described for the production of single chainantibodies (U.S. Patent 4,946,778) can be adapted to produce OB polypeptide-specificsingle chain antibodies. An additional embodiment of the invention utilizes thetechniques described for the construction of Fab expression libraries [Huse et al.,Science, 246:1275-1281 (1989)] to allow rapid and easy identification of monoclonalFab fragments with the desired specificity for an ob polypeptide, or its dérivatives,or analogs.

Antibody fragments which contain the idiotype of the antibody molécule can begenerated by known techniques. For example, such fragments include but are not 67 0 1 0 596

Limited to: the F(ab’); fragment which can be produced by pepsin digestion of the antibody molécule; the Fab’ fragments which can be generated by reducing the disulfide bridges of the F(ab’), fragment, and the Fab fragments which can be generated by treating the antibody molécule with papain and a reducing agent.

In the production of antibodies, screening for the desired antibody can beaccompLished by techniques known in the art, e.g., radioimmunoassay, ELISA(enzyme-linked immunosorbent assay), "sandwich" immunoassays,immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays,in situ immunoassays (using colloïdal gold, enzyme or radioisotope labels, forexample), Western blots, précipitation reactions, agglutination assays (e.g., gelagglutination assays, hémagglutination assays), complément fixation assays,immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.In one embodiment, antibody binding is detected by detecting a label on the primaryantibody. In another embodiment, the primary antibody is detected by detectingbinding of a secondary antibody or reagent to the primary antibody. In a furtherembodiment, the secondary antibody is labeled. Many means are known in the artfor detecting binding in an immunoassay and are within the scope of the présentinvention. For example, to select antibodies which recognize a spécifie epitope of anOB polypeptide, one may assay generated hybridomas for a product which binds toan OB polypeptide fragment containing such epitope. For sélection of an antibodyspécifie to an OB polypeptide from a particular species of animal, one can select onthe basis of positive binding with OB polypeptide expressed by or isolated from cellsof that species of animal.

The foregoing antibodies can be used in methods known in the art relating to the localization and activity of the OB polypeptide, e.g., for Western blotting, imaging OB polypeptide in situ, measuring Ievels thereof in appropriate physiological samples, etc. 68 0 1 0596

In a spécifie embodiment, antibodies thaï agonize or antagonize the activity of OBpolypeptide can be generated. Such antibodies can be tested using the assaysdescribed infra for identifying ligands.

In a spécifie embodiment, antibodies are developed by immunizing rabbits withsynthetic peptides predicted by the protein sequence or with recombinant proteinsmade using bacterial expression vectors. The choice of synthetic peptides is madeafter careful analysis of the predicted protein structure, as described above. Inparticular, peptide sequences between putative cleavage sites are chosen. Syntheticpeptides are conjugated to a carrier such as ΚΙΉ hemocyanin or BSA usingcarbodiimide and used in Freunds adjuvant tolmmunize*rabbits. In order to préparérecombinant protein, the pGEX vector can be used to express the polypeptide (Smithei al., 1988, supra}. Altematively, one can use only hydrophilic domains to generatethe fusion protein. The expressed protein will be prepared in quantity and used toimmunize rabbits in Freunds adjuvant.

In anothér spécifie embodiment, recombinant OB polypeptide is used to immunizechickens, and the chicken anti-OB antibodies are recovered from egg yolk, e.g., byaffinity purification on an OB-column. Preferably, chickens used in immunizationare kept under spécifie pathogen free (SPF) conditions.

In another embodiment, antibodies against leptin are generated in ob/ob mice, whichlack circulating OB protein, and thus are expected to be capable of generating an anti-OB polypeptide response since they will not be tolerized to the polypeptide, and wild-type mice. Spleen cells from both groups of mice can be fused with myeloma cellsto préparé hybridomas for monoclonal antibodies.

In yet another embodiment, recombinant OB polypeptide is used to immunize rabbits,and the polyclonal antibodies are immunopurified prior to further use. The purifiedantibodies are particularly useful for semi-quantitative assays, particularly fordetecting the presence of circulating OB polypeptide in sérum or plasma. 69 01 0596

Panels of monoclonal antibodies produced against modulator peptides can be screenedfor various properties; i.e., isotype, epitope, affinity, etc. Of particular interest aremonoclonal antibodies that neutralize the activity of the modulator peptides. Suchmonoclonals can be readily identified in activity assays for the weight modulators.High afftnity antibodies are also useful when immunoaffînity purification of native orrecombinant modulator is possible.

Preferably, the anti-modulator antibody used in the diagnostic and therapeuticmethods of this invention is an affinity-purified polyclonal antibody. Morepreferably, the antibody is a monoclonal antibody (mAb). In addition, it is préférablefor the anti-modulator antibody molécules used herein be in the form of Fab, Fab’,F(ab’)2 or F(v) portions of whole antibody molécules.

Diagnostic Implications

The présent invention also relates to a variety of diagnostic applications, includinginethods for detecting the presence of conditions and/or stimuli that impact upon «Τ'··; abnormalities in body weight or adiposity, by référencé to their ability to elicit theactivities which are mediated by the présent weight modulators. As mentionedearlier, the weight modulator peptides can be used to produce antibodies tothemselves by a variety of known techniques, and such antibodies could then beisolated and utilized as in tests for the presence of particular transcriptional activityin suspect target cells. altematively, the nucleic acids of the invention can beemployed in diagnosis.

Antibody-based Diagnostics

As suggested earlier, a diagnostic method useful in the présent invention comprisesexamining a cellular sample or medium by means of an assay including an effectiveamount of an antagonist to a modulator protein, such as an anti-modulator antibody,preferably an affmity-purified polyclonal antibody, and more preferably a mAb. Inaddition, it is préférable for the anti-modulator antibody molécules used herein be inthe form of Fab, Fab’, F(ab’)2 or F(v) portions or whole antibody molécules. As 70 0 1 0596 previously discussed, patients capable of benefiting from this method include thosesuffering from cancer, AIDS, obesity or other conditions where abnormal bodyweight is a characteristic or factor. Methods for isolating the modulator and inducinganti-modulator antibodies and for determining and optimizing the ability of anti-modulator antibodies to assist in the examination of the target cells are ail well-knownin the art.

Also, antibodies including both polyclonal and monoclonal antibodies, and drugs thatmodulate the production or activity of the weight control modulators and otherrécognition factors and/or their subunits mayjpossess certain diagnostic applicationsand may for example, be utilized for the puipose of detecting and/or measuringconditions where abnormalities in body weight are or may be likely to develop. Forexample, the modulator peptides or their active fragments may be used to produceboth polyclonal and monoclonal antibodies to themselves in a variety of cellularmedia, by known techniques, such as the hybridoma technique;Utilizing, for example, fused mouse spleen lymphocytes and myeloma cells. These techniques are described / in detail below. Likewise, small molécules that mimic or antagonize the activity(ies)of the receptor récognition factors of the invention may be discovered or synthesized,and may be used in diagnostic and/or therapeutic protocols.

The presence of weight modulators in cells can be ascertained by the usualimmunological procedures applicable to such déterminations. A number of usefulprocedures are known. Three such procedures which are especially useful utilizeeither the receptor récognition factor labeled with a détectable label, antibody Ab,labeled with a détectable label, or antibody Ab2 labeled with a détectable label. Theprocedures may be summarized by the following équations wherein the asteriskindicates that the particle is labeled, and "WM" stands for the weight modulator: A. WM* + Ab, = WM*Ab, B. WM + Ab*, = WMAb,* C. WM + Ab, + Ab2* = Ab,WMAb2* 7i 0Î05S6

The procedures and their application are ail familiar to those skilled in the art andaccordingly may be utilized within the scope of the présent invention. The"compétitive" procedure, Procedure A, is described in U.S. Patent Nos. 3,654,090and 3,850.752. Procedure B is représentative of well known compétitive assaytechniques. Procedure C, the "sandwich" procedure, is described in U.S. Patent Nos.RE 31,006 and 4,016,043. Still other procedures are known such as the "doubleantibody", or "DASP" procedure.

In each instance, the weight modulators form complexes with one or moreantibody(ies) or binding partners and one member of the complex is labeled with adétectable label. The fact that a complex has formed and, if desired, the amountthereof, can be determined by known methods applicable to the détection of labels.

It will be seen from the above, that a characteristic property of Abj is that it willreact with Ab,. This is because Ab,, raised in one mammalian species, has been usedin another species as an antigen to raise the antibody, Ab,. For example, Ab2 may^be raised in goats using rabbit antibodies as antigens. Ab, therefore would be •TV.·· anti-rabbit antibody raised in goats. For purposes of this description and daims, Ab,will be referred to as a primary or anti-weight modulator antibody, and Ab2 will bereferred to as a secondary or anti-Ab, antibody.

The labels most commonly employed for these studies are radioactive éléments,enzymes, Chemicals which fluoresce when exposed to ultraviolet light, and others. A number of fluorescent materials are known and can be utilized as labels. Theseinclude, for example, fluorescein, rhodamine and auramine. A particular detectingmaterial is anti-rabbit antibody prepared in goats and conjugated with fluoresceinthrough an isothiocyanate.

The weight modulators or their binding partners can also be labeled with a radioactiveelement or with an enzyme. The radioactive label can be detected by any of the 72 0 1 059 6 currenily available counting procedures. The preferred isotope may be selected from3H, 14C, 3:P, 33S, 36C1, 3lCr, 37Co, î8Co, 39Fe, *Ύ, ,Z5I, 131I, and 1S6Re.

Enzyme labels are likewise useful, and can be detected by any of the presentlyutilized colorimétrie, spectrophotometric, fluorospectrophotometric, amperometric orgasometric techniques. The enzyme is conjugated to the selected particle by reactionwith bridging molécules such as carbodiimides, dîisocyanates, glutaraldehyde and thelike. Many enzymes which can be used in these procedures are known and can beutilized. The preferred are peroxidase, β-glucuronidase, B-D-glucosidase,β-D-galactosidase, urease, glucose oxidaseplus peroxidase and alkaline phosphatase.U.S. Patent Nos. 3,654,090; 3,850,752; and 4,016,043 are referred to by way ofexample for their disclosure of altemate labeling material and methods.

In a further embodiment of this invention, test kits suitable for use by a medicalspecialist may be prepared to détermine the presence or absence of predeterminedtranscriptional activity or predetermined transcriptional activity capability in suspectedtarget cells. In accordance with the testing techniques discussed above, one class pfsuch kits will contain at least the labeled weight modulator or its binding partner, forinstance an antibody spécifie thereto, and directions, of course, depending upon themethod selected, e.g., "compétitive," "sandwich," "DASP" and the like. The kitsmay also contain peripheral reagents such as buffers, stabilizers, etc.

Accordingly, a test kit may be prepared for the démonstration of the presence orcapability of cells for predetermined transcriptional activity, comprising: (a) a predetermined amount of at least one labeled immunochemically reactivecomponent obtained by the direct or indirect attachment of the présent weightmodulator or a spécifie binding partner thereto, to a détectable label; (b) other reagents; and (c) directions for use of said kit. 73 010596

More specifically, the diagnostic test kit may comprise: (a) a known amount of the weight modulator as described above (or a bindingpartner) generally bound to a solid phase to form an immunosorbent, or in thealternative, bound to a suitable tag, or plural such end products, etc. (or their bindingpartners) one of each; (b) if necessary, other reagents; and (c) directions for use of said test kit.

In a further variation, the test kit may be prepared and used for the purposes statedabove, which opérâtes according to a predetermined protocol (e.g. "compétitive,""sandwich," "double antibody," etc.), and comprises: (a) a labeled component which has been obtained by coupling the weightmodulator to a détectable label; (b) one or more additional immunochemical reagents of which at least onereagent is a ligand or an immobilized ligand, which ligand iyelected from the groupconsisting of: (i) a ligand capable of binding with the labeled component (a); (ii) a ligand capable of binding with a binding partner of the labeledcomponent (a); (iii) a ligand capable of binding with at least one of the component(s) tobe determined; and (iv) a ligand capable of binding with at least one of the binding partnersof at least one of the component(s) to be determined; and (c) directions for the performance of a protocol for the détection and/ordétermination of one or more components of an immunochemical reaction betweenthe weight modulator and a spécifie binding partner thereto.

Nucleic Acid-based Diagnostics

As demonstrated in the examples, infra, nucleic acids of the invention can be usedto detect defects associated with defects in the OB polypeptide that resuit in obesephenotypes. For example, nucleic acid probes (e.g., in Northern analysis or RT-PCR 74 0 Î0596 analysis) can be used to détermine whether an obese phenotype is associated with lackof expression of OB mRNA, or expression of non-functional OB mRNA, e.g., as indb/db mice (where the deficiency results from lack of an OB receptor) or where amutation yields a non-transcribed mRNA. Moreover, the nucleic acid-baseddiagnostic techniques of the invention can be used in conjunction with antibody-basedtechniques to further develop a molecular understanding of obese or anorexiephenotypes.

The human cDNA clones that hâve recently been isolated hâve been sequenced aspresented herein. This facilitâtes the détermination of the complété sequence of the

'"«MU human gene (see Figure 20A through C; SEQ ED NO: 22). DNA sequences from theintrons of the human OB gene hâve been obtained (Figure 20), and these hâve beenused to prépare PCR primers to PCR amplify the coding sequence of the OB genefrom human genomic DNA so as to identify mutations or allelic variants of the OBgene, ail in accordance with protocols described in detail earlier herein. SpécifiePCR primers for amplifying human genomic OB are described in a spécifie Example,infra, .

The current hypothesis is that heterozygous mutations in the ob gene will beassociated with mild/moderate obesity while homozygous mutations would beassociated with several DNA sequence-based diagnostic tests for obesity. If this istrue, it would allow the ascertainment of people at risk for the development of obesityand make possible the application of drug treatment and/or lifestyle changes beforean increased body weight is fully developed.

Alternatively, the presence of microsatellites that segregate with mutant forms ofhuman OB can be used for diagnosis. Various PCR primers, including those basedon the nucléotide sequence provided in Figure 20A through C, can be used in thisrespect. 75 010596

The OB gene may also be useful diagnostically for measurements of its encoded RNAand protein in nutritional disorders. It will be of importance to know, in a particularnutritional disorder. whether OB RNA and/or its encoded protein is unregulated ordownregulated. Thus. if an obese person bas increased levels of OB, it would appearthat the problem is downstream of OB, while if OB is reduced, it would appear thatinappropriately low levels of OB may be cause of obesity (whether or not the defectis in the OB gene). Conversely, if a cancer or AIDS patient who lost weight hadelevated levels of OB, it may be concluded that inappropriately high expression of OBis responsable for the weight loss. rr··.

The cloned human cDNA will be of use for the measurement of the levels of humanOB RNA. In addition, recombinant human protein will be prepared and used todevelop immunoassays to enable measurement of the fat and perhaps plasma levelsof the OB protein.

Therapeutic Implications /

The polypeptides, nucleic acids, and antibodies of the invention hâve significanttherapeutic potential. Preferably, a therapeutically effective amount of such an agentis administered in a phaimaceutically acceptable carrier, diluent, or excipient.

The phrase "pharmaceutically acceptable" refers to molecular entities andcompositions that are physiologically tolerable and do not typically produce anallergie or similarly untoward reaction, such as gastric upset, dizziness and the like,when administered to a human. Preferably, as used herein, the term"pharmaceutically acceptable" means approved by a regulatory agency of the fédéralor a state govemment or listed in the U. S. Pharmacopeia or other generallyrecognized pharmacopeia for use in animais, and more particularly in humans. Theterm "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which thecompound is administered. Such pharmaceutical carriers can be stérile liquids, suchas water and oils, including those of petroleum, animal, vegetable or synthetic origin,such as peanut oïl, soybean oil, minerai oil, sesame oil and the like. Water or

I „ 010596 /6 solution saline solutions and aqueous dextrose and glycerol solutions are preferablyemployed as carriers, particularly for injectable solutions. Suitable pharmaceuticalcarriers are described in Martin, Remington’s Pharmaceutical Sciences, 18th Ed.,Mack Publishing Co., Easton, PA, (1990). 5 The phrase "therapeutically effective amount" is used herein to mean an amountsufficient to reduce by at least about 15%, preferably by at least 50%, morepreferably by at least 90 %, and most preferably prevent, a clinically significant déficitin the activity, fonction and response of the host. Altematively, a therapeuticallyeffective amount is sufficient to cause arrfffiprovement in a clinically significant 10 condition in the host.

Administration of recombinant OB polypeptide results in weight loss, in particular,a decrease in fat tissue. OB polypeptide can be prepared using standard bacterialand/or mammalian expression vectors, synthetically, or püfîfied from plasma orsérum, ail as stated in detail earlier herein. Altematively, increased expression oî 15 native OB polypeptide may be induce by homologous recombination techniques, 0'described supra. Réduction of OB polypeptide activity (by developing antagonists, inhibitors, use ofneutralizing antibodies, or antisense molécules) should resuit in weight gain as mightbe désirable for the treatment of the weight loss associated with cancer, AIDS or 20 anorexia nervosa. Modulation of OB activity can be usefol for reducing body weight(by increasing its activity) or increasing body weight (by decreasing its activity).

Polypeptide-based Therapeutic Treatment

In the simplest analysis, the OB gene détermines body weight in mammals, inparticular, mice and man. The OB gene product, and, correspondingly, cognate 25 molécules, appear to be part of a signaling pathway by which adipose tissuecommunicates with the brain and the other organs. It is believed that the OBpolypeptide is itself a signaling molécule, i.e., a hormone. 77 010596

The OB polypeptide, or functionally active fragment thereof, or an antagonist thereof,can be administered orally or parenterally, preferably parenterally. Becauseinetabolic homeostasis is a continuons process, controlled release administration ofob polypeptide is preferred. For example, the polypeptide may be administered usingintravenous infusion, an implantable osmotic pump, a transdermal patch, liposomes,or other modes of administration. In one embodiment, a pump may be used [Langeret al., eds., Medical Applications of Controlled Release, CRC Près., Boca Raton,Florida (1974); Sefton, CRC Crit. Ref. Biomed. Eng., 14:201 (1987); Buchwald etal., Surgery, 88:507 (1980); Saudek et al., N. Engl. J. Med., 321:574 (1989)]. Inanother embodiment, polymeric materials can be used [Langer, 1974, supra; Sefton,1987, supra; Smolen et al., eds., Controlled Drug Bioavailability, Drug ProductDesign and Performance, Wiley, New York (1984); Ranger et al., J. Macromol.Sci. Rev. Macromol. Chem., 23:61 (1983); see also Levy et al., Science, 228:190(1985); During et al., Ann. Neurol., 25:351 (1989); Howard et al., J. Neurosurg.,71:105 (1989)]. In yet another embodiment, a controlled release System can beplaced in proximity of the therapeutic target, i.e., the brain, thus requiring only.afraction of the systemic dose [see, e.g., Goodson, in Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984)]. Other controlled release Systemsare discussed in the review by Langer, Science, 249:1527-1533 (1990). In anotherembodiment, the therapeutic compound can be delivered in a vesicle, in particular aliposome [see Langer, 1990 supra); Treat et al., in Liposomes in the Therapy ofInfectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York,pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)

In a further aspect, recombinant cells that hâve been transformed with the OB geneand that express high levels of the polypeptide can be transplanted in a subject in needof ob polypeptide. Preferably autologous cells transformed with OB are transplantedto avoid rejection; altematively, technology is available to shield non-autologous cellsthat produce soluble factors within a polymer matrix that prevents immunerécognition and rejection. 78 01 0596

The OB polypeptide can be delivered by intravenous, intraarterial, intraperitoneal,intramuscular. or subcutaneous routes of administration. Altematively, the OBpolypeptide, properly formulated, can be administered by nasal or oral administration. A constant supply of OB can be ensured by providing a therapeutically effective dose 5 (z'.e., a dose effective to induce metabolic changes in a subject) at the necessary intervals, e.g., daily, every 12 hours, etc. These parameters will dépend on theseverity of the disease condition being treated, other actions, such as dietmodification, that are implemented, the weight, âge, and sex of the subject, and othercriteria, which can be readily determined according to standard good medical 10 practice by those of skill in the art. '•nifri I...

Pharmaceutical Compositions

In yet another aspect of the présent invention, provided are pharmaceuticalcompositions of the above. Such pharmaceutical compositions may be foradministration for injection, or for oral, pulmonary, nasal or other forms of 15 administration. In general, comprehended by the invention are pharmaceuticalcompositions comprising effective amounts of protein or dérivative products of theinvention together with pharmaceutically acceptable diluents, preservatives,solubilizers, emulsifiers, adjuvants and/or carriers. Such compositions includediluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic 20 strength; additives such as détergents and solubilizing agents (e.g., Tween 80,Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite),preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose,mannitol); incorporation of the material into particulate préparations of polymericcompounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. 25 Hylauronic acid may also be used. Such compositions may influence the physicalState, stability, rate of in vivo release, and rate of in vivo clearance of the présentproteins and dérivatives. See, e.g., Martin, Remington’s Pharmaceutical Sciences,18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712 whichare herein incorporated by référencé. The compositions may be prepared in liquid 30 form, or may be in dried powder, such as lyophilized form. 79 0105 S 6

Oral Delivery

Contemplated for use herein are oral solid dosage forms, which are describedgenerally in Martin, Remingion's Pharmaceutical Sciences, 18th Ed. (1990 MackPublishing Co. Easton PA 18042) at Chapter 89, which is herein incorporated byréférencé. Solid dosage forms include tablets, capsules, pills, troches or lozenges,cachets or pellets. Also, liposomal or proteinoid encapsulation may be used toformulate the présent compositions (as, for example, proteinoid microspheres reportedin U.S. Patent No. 4,925,673). Liposomal encapsulation may be used and theliposomes may be derivatized with various polymers (E.g., U.S. Patent No.5,013,556). A description of possible sohHTFosage forms for the therapeutic is givenby Marshall, in Modem Pharmaceutics, Chapter 10, Banker and Rhodes ed., (1979),herein incorporated by référencé. In general, the formulation will include the protein(or chemically modified protein), and inert ingrédients which allow for protectionagainst the stomach environment, and release of the biologically active material in theintestine.

Also specifically contemplated are oral dosage forms of the above derivatizedproteins. Protein may be chemically modified so that oral delivery of the dérivativeis efficacious. Generally, the Chemical modification contemplated is the attachmentof at least one moiety to the protein (or peptide) molécule itself, where said moietypermits (a) inhibition of proteolysis; and (b) uptake into the blood stream from thestomach or intestine. Also desired is the increase in overall stability of the protein andincrease in circulation time in the body. Examples of such moieties include:polyethylene glycol, copolymers of ethylene glycol and propylene glycol,carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone andpolyproline. Abuchowski et al., 1981, supra\ Newmark et al., J. Appl. Biochem.,4:185-189 (1982). Other polymers that could be used are poly-l,3-dioxolane andpoly-l,3,6-tioxocane. Preferred for pharmaceutical usage, as indicated above, arepolyethylene glycol moieties. 80 010590

For the protein (or dérivative) the location of release may be the stomach, the smàllintestine (the duodénum, the jejunem, or the ileum), or the large intestine. One skilledin the art has available formulations which will not dissolve in the stomach, yet willrelease the material in the duodénum or elsewhere in the intestine. Preferably, therelease will avoid the deleterious effects of the stomach environment, either byprotection of the protein (or dérivative) or by release of the biologically activematerial beyond the stomach environment, such as in the intestine.

To ensure full gastric résistance, a coating imperméable to at least pH 5.0 is essential.Examples of the more common inert ingrédients that are used as enteric coatings arecellulose acetate trimellitate (CAT), hydroxypropylmethylceliulose phthalate(HPMCP), HPMCP 50, HPMCP 55, petyvinyl acetate phthalate (PVAP), EudragitL30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S, andShellac. These coatings may be used as mixed films. A coating or mixture of coatings can also be used on tablets, which are not intendedfor protection against the stomach. This can include sugar coatings, or coatingswhich make the tablet easier to swallow. Capsules may consist of a hard shell (suchas gelatin) for delivery of dry therapeutic i.e. powder; for liquid forms, a soft gelatinshell may be used. The shell material of cachets could be thick starch or other ediblepaper. For pills, lozenges, molded tablets or tablet triturâtes, moist massingtechniques can be used.

The therapeutic can be included in the formulation as fine multiparticulates in theform of granules or pellets of particle size about 1mm. The formulation of thematerial for capsule administration could also be as a powder, lightly compressedplugs or even as tablets. The therapeutic could be prepared by compression.

Colorants and flavoring agents may ail be included. For example, the protein (ordérivative) may be formulated (such as by liposome or microsphere encapsulation)

81 01059G and then further contained within an edible product, such as a refrigerated beveragecontaining colorants and fiavoring agents.

One may dilute or increase the volume of the therapeutic with an inert material.These diluents could include carbohydrates, especially mannitol, α-lactose, anhydrouslactose, cellulose, sucrose, modified dextrans and starch. Certain inorganic salts maybe also be used as fillers including calcium triphosphate, magnésium carbonate andsodium chloride. Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicell.

Disintegrants may be included in the formula&amp;on of the-therapeutic into a solid dosageform. Materials used as disintegrants include but are not limited to starch includingthe commercial désintégrant based on starch, Explotab. Sodium starch glycolate,Amberlite, sodium carboxymethylcellulose, ultramylopectin, sodium alginate, gelatin,orange peel, acid carboxymethyl cellulose, natural sponge and bentonite may ail beused. Another form of the disintegrants are the insoluble cationic exchange resins.Powdered gums may be used as disintegrants and as binders and these can includê-powdered gums such as agar, Karaya or tragacanth. Alginic acid and its sodium saitare also useful as disintegrants.

Binders may be used to hold the therapeutic agent together to form a hard tablet andinclude materials from natural products such as acacia, tragacanth, starch and gelatin.Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethylcellulose (CMC). Polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose(HPMC) could both be used in alcoholic solutions to granulate the therapeutic.

An antifrictional agent may be included in the formulation of the therapeutic toprevent sticking during the formulation process. Lubricants may be used as a layerbetween the therapeutic and the die wall, and these can include but are not limited to:stearic acid including its magnésium and calcium salts, polytetrafluoroethylene(PTFE), liquid paraffin, vegetable oils and waxes. Soluble lubricants may also be 82 01 0596 used such as sodium lauryl sulfate, magnésium lauryl sulfate, polyethylene glycol ofvarious molecular weights, and Carbowax 4000 and 6000.

Glidants that might improve the flow properties of the drug during formulation andto aid rearrangement during compression might be added. The glidants may include 5 starch, talc, pyrogenic silica and hydrated silicoaluminate.

To aid dissolution of the therapeutic into the aqueous environment, a surfactant mightbe added as a wetting agent. Surfactants may include anionic détergents such assodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate.Cationic détergents might be used and could include benzalkonium chloride or 10 benzethomium chloride. The list of potential nonionic détergents that could beincluded in the formulation as surfactants are lauromacrogol 400, polyoxyl 40stéarate, polyoxyethylene hydrogenated castor oil 10, 50 and 60, glycerolmonostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid ester, methylcellulose and carboxymethyl cellulose. These surfactants.^gyld be présent in the 15 formulation of the protein or dérivative either alone or as a mixture in differentratios.

Additives which potentially enhance uptake of the protein (or dérivative) are forinstance the fatty acids oleic acid, linoleic acid and linolenic acid.

Controlled release formulation may be désirable. The drug could be incorporated into 20 an inert matrix which permits release by either diffusion or leaching mechanisms i. e.,gums. Slowly degenerating matrices may also be incorporated into the formulation.Another form of a controlled release of this therapeutic is by a method based on theOros therapeutic System (Alza Corp.), i.e. the drug is enclosed in a semiperraeablemembrane which allows water to enter and push drug out through a single small 25 opening due to osmotic effects. S orne enteric coatings also hâve a delayed releaseeffect. 83 010593

Other coatings may be used for the formulation. These include a variety of sugarswhich could be applied in a coating pan. The therapeutic agent could also be givenin a film-coated tablet; the materials used in this instance are divided into 2 groups.The first are the nonenteric materials and include methyl cellulose, ethyl cellulose,hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose,hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose, providone and thepolyethylene glycols. The second group consists of the enteric materials that arecommonly esters of phthalic acid. A mix of materials might be used to provide the optimum film coating. Film coatingmay be carried out in a pan coater or in a fluiçlized bedjar by compression coating.

Pulmonary Delivery

Also contemplated herein is pulmonary delivery of the présent protein (or dérivativesthereof). The protein (or dérivative) is delivered to the lungs of a mammal whileinhaling and traverses across the lung épithélial lining to thôiblood-stream. Other reports of this include Adjei et al., Pharmaceutical Research, 7(6):565-569 (1990);s /

Adjei et al., International Journal of Pharmaceutics, 63:135-144 (1990) (leuprolide^acetate); Braquet et al., Journal of Cardiovascular Pharmacology,13(suppl. 5):143-146 (1989) (endothelin-1); Hubbard et al., Armais of InternaiMedicine, 3(3):206-212 (1989) (al- antitrypsin); Smith et al., J. Clin. Invest.,84:1145-1146 (1989) (al-protéinase); Oswein et al., "Aerosolization of Proteins",Proceedings of Symposium on Respiratory Drug Delivery II, Keystone, Colorado,(March 1990) (recombinant human growth hormone); Debs et al., J. Immunol.,140:3482-3488 (1988) and Platz et al., U.S. Patent No. 5,284,656 (granulocytecolony stimulating factor). Contemplated for use in the practice of this invention area wide range of mechanical devices designed for pulmonary delivery of therapeuticProducts, including but not limited to nebulizers, metered-dose inhalers, and powderinhalers, ail of which are familiar to those skilled in the art. 84 0 1 0596

Some spécifie examples of commercially available devices suitable for the practiceof this invention are the Ultravent nebulizer, manufactured by Mallinckrodt, Inc.,St. Louis, Missouri; the Acom Π nebulizer, manufactured by Marquest MedicalProducts, Englewood. Colorado; the Ventolin metered dose inhaler, manufactured byGlaxo Inc., Research Triangle Park, North Carolina; and the Spinhaler powderinhaler, manufactured by Fisons Corp., Bedford, Massachusetts. AU such devices require the use of formulations suitable for the dispensing of protein(or dérivative). TypicaUy, each formulation is spécifie to the type of device employedand may involve the use of an appropriate propellant material, in addition to the usualdUuents, adjuvants and/or carriers useful4n*therapy-.-^Also. the use of liposomes,microcapsules or microspheres, inclusion complexes, or other types of carriers iscontemplated. ChemicaUy modified protein may also be prepared in differentformulations depending on the type of Chemical modification or the type of deviceemployed.

Formulations suitable for use with a nebulizer, either jet or ultrasonic, will typicaUycomprise protein (or dérivative) dissolved in water at a concentration of about 0.1 ïô25 mg of biologicaUy active protein per ml of solution. The formulation may alsoinclude a buffer and a simple sugar (e.g., for protein stabilization and régulation ofosmotic pressure). The nebulizer formulation may also contain a surfactant, to reduceor prevent surface induced aggregation of the protein caused by atomization of thesolution in forming the aérosol.

Formulations for use with a metered-dose inhaler device will generally comprise afinely divided powder containing the protein (or dérivative) suspended in a propellantwith the aid of a surfactant. The propellant may be any conventional materialemployed for this purpose, such as a chlorofluorocarbon, a hydrochlorofluorocarbon,a hydrofluorocarbon, or a hydrocarbon, including trichlorofluoromethane,dichlorodifluoromethane, dichlorotetrafluoroethanol, and 1,1,1,2-tetrafluoroethane, 85 0 1 0596 or combinations thereof. Suitable surfactants include sorbitan trioleate and soyalecithin. Oleic acid may also be useful as a surfactant.

Formulations for dispensing from a powder inhaler device will comprise a fïnelydivided dry powder containing protein (or dérivative) and may also include a bulkingagent, such as lactose, sorbitol, sucrose, or mannitol in amounts which facilitatedispersai of the powder from the device, e.g., 50 to 90% by weight of theformulation. The protein (or dérivative) should most advantageously be prepared inparticulate form with an average particle size of less than 10 /xm (or microns), mostpreferably 0.5 to 5 /xm, for most effective delivery to the distal lung.

Nasal Delivery

Nasal delivery of the protein (or dérivative) is also contemplated. Nasal deliveryallows the passage of the protein to the blood stream directly after administering thetherapeutic product to the nose, without the necessity for déposition of the product inthe lung. Formulations for nasal delivery include those with déxtran or cyclodextran.

Methods of Treatment, Methods of Preparing a MédicamentIn yet another aspect of the présent invention, methods of treatment and manufactureof a médicament are provided. Conditions alleviated by or modulated by theadministration of the présent dérivatives are those indicated above.

Dosages

For ail of the above molécules, as further studies are conducted, information willemerge regarding appropriate dosage levels for treatment of various conditions invarious patients, and the ordinary skilled worker, considering the therapeutic context,âge and general health of the récipient, will be able to ascertain the proper dosage.Generally, for injection or infusion, dosage will be between 0.01 /xg of biologicallyactive protein/kg body weight, (calculating the mass of the protein alone, withoutChemical modification), and 10 mg/kg (based on the same). The dosing schedule mayvary, depending on the circulation half-life of the protein or dérivative used, whether 86 01052 δ the polypeptide is delivered by bolus dose or continuous infusion, and the formulationused.

Administration, with other compounds

For therapy associated with obesity, one may administer the présent protein (ordérivatives) in conjunction with one or more pharraaceutical compositions used fortreating other clinical complications of obesity, such as those used for treatment ofdiabètes (e.g., insulin), high blood pressure, high cholestérol, and other adverseconditions incident to obesity. Also, other appetite suppressants may be co-administered, e.g., amphétamines. Administration may be simultaneous (for example,administration of a mixture of the présent proteinjand insulin^or may be in seriatim.

Nucleic Acid-based Therapeutic TreatmentThe OB gene could be introduced into human fat cells to develop gene therapy forobesity. Such therapy would be expected to decrease body weight. Conversely,introduction of antisense constructs into human fat cells would reduce the levels ofactive OB polypeptide and would be predicted to increase body adiposity.

In one embodiment, a gene encoding an OB polypeptide is introduced in vivo in aviral vector. Such vectors include an attenuated or defective DNA virus, such as butnot limited to herpes simplex virus (HSV), papillomavirus, Epstein Barr virus (EBV),adenovirus, adeno-associated virus (AAV), and the like. Defective vinises, whichentirely or almost entirely lack viral genes, are preferred. Defective virus is notinfective after introduction into a cell. Use of defective viral vectors allows foradministration to cells in a spécifie, localized area, without concem that the vectorcan infect other cells. Thus, adipose tissue can be specifically targeted. Examplesof particular vectors include, but are not limited to, a defective herpes virus 1 (HSV1)vector [Kaplitt et al., Molec. Cell. Neurosci., 2:320-330 (1991)], an attenuatedadenovirus vector, such as the vector described by Stratford-Perricaudet et al., J.Clin. Investi, 90:626-630 (1992), and a defective adeno-associted virus vector 87 01 0596 (Samulski et al., J. Vtrol., 61:3096-3101 (1987); Samulski et al., J. Vtrol.,63:3822-3828 (1989)].

In another embodiment, the gene can be introduced in a retroviral vector, e.g., asdescribed in Anderson et ai, U.S. Patent No. 5,399,346; Mann et al., Cell, 33:153(1983); Temin et a!., U.S. Patent No. 4,650,764; Temin et al., U.S. Patent No.4,980,289; Markowitz et al., J. Virol., 62:1120 (1988); Temin et al., U.S. PatentNo. 5,124,263; International Patent Publication No. WO 95/07358, published March16, 1995, by Dougherty et al.·, and Kuo et al., Blood, 82:845 (1993).

Altematively, the vector can be introduced in vivo by lipofection. For the pastdecade, there has been increasing use of liposomes for encapsulation and transfectionof nucleic acids in vitro. Synthetic cationic lipids designed to limit the diffîculties anddangers encountered with liposome mediated transfection can be used to préparéliposomes for in vivo transfection of a gene encodîng a marker [Felgner et al., Proc.Natl. Acad. Sci. USA, 84:7413-7417 (1987); see Mackey et al., Proc. Natl. Acad.Sci. 'USA, 85:8027-8031 (1988)]. The use of cationic lipids may prompteencapsulation of negatively charged nucleic acids, and also promote fusion withnegatively charged cell membranes [Felgner et al., Science, 337:387-388 (1989)].The use of lipofection to introduce exogenous genes into spécifie organs in vivo hascertain practical advantages. Molecular targeting of liposomes to spécifie cellsrepresents one area of benefit. It is clear that directing transfection to particular celltypes would be particularly advantageous in a tissue with cellular heterogeneity, suchas the pancréas, liver, kidney, and brain. Lipids may be chemically coupled to othermolécules for the purpose of targeting (see Mackey et al., 1988, supra). Targetedpeptides, e.g., hormones or neurotransmitters, and proteins such as antibodies, ornon-peptide molécules could be coupled to liposomes chemically.

It is also possible to introduce the vector in vivo as a naked DNA plasmid. NakedDNA vectors for gene therapy can be introduced into the desired host cells bymethods known in the art, e.g., transfection, electroporation, microinjection, 88 0 1 0596 transduction, cell fusion, DEAE dextran, calcium phosphate précipitation, use of agene gun, or use of a DNA vector transporter (see, e.g., Wu et al., J. Biol. Chem.,267:963-961 (1992); Wu et al., J. Biol. Chem., 263:14621-14624 (1988); Hartmutet al., Canadian Patent Application No. 2,012,311, ftled March 15, 1990).

Agricultural Applications

The OB gene can also be isolated from domestic animais, and the corresponding OBpolypeptide obtained thereby. In a spécifie example, infra, the probe derived fromthe murine OB gene hybridizes to corresponding homologous coding sequences froma large number of species of animais. As discussed for human thérapies, recombinantproteins can also be prepared and adminisifi^i to donjpstic animais. Administrationof the polypeptide can be implemented to produce leaner food animais, such as beefcattle, swine, poultry, sheep, etc. Preferably, an autologous OB polypeptide isadministered, although the invention contemplâtes administration of anti-autologouspolypeptide as well. Since the OB polypeptide consists of approximately 160 aminoacid residues, it may not be highly immunogenic. Thus,administration of non-autologous polypeptide may not resuit in an immune response.

Altematively, the introduction of the cloned genes into transgenic domestic animaiswould allow one to potentially decrease body weight and adiposity by overexpressingan OB transgene. The simplest means of achieving this would be to target an OBtransgene to fat using its own or another fat spécifie promoter.

Conversely, increases in body fat might be désirable in other circumstances such asfor the development of Kobe beef or fatty liver to make foie gras. This could beaccomplished by targeting an antisense OB transgene to fat, or by using geneknockout technology. Alternatively, where an increase in body weight at percentageof fat is desired, an inhibitor or antagonist of the OB polypeptide can beadministered. Such inhibitors or antagonists include, but are not limited to,antibodies reactive with the polypeptide, and fragments of the polypeptide that bindbut do not activate the OB receptor, i.e., antagonists of the OB polypeptide. 89 010596

Cosmetic Implications

The OB polypeptide has significant value for cosmetic use, in addition to the healthbenefits. In particular, since the OB polypeptides of the invention, includingdérivatives and agonist analogs thereof, are useful for modulation of the rate andquantity of fat cell déposition in an animal, they are useful for reducing unsightly fattissue, e.g., fat deposits in the abdomen, hips, thighs, neck, and chin that do notnecessarily amount to an obese condition, but which nevertheless detract from anindividual’s appearance. The fat réduction effect is thought to be accomplished, inpart, by a réduction in appetite, i.e., a réduction in food intake, by an increase inbasal metabolism, or both. Thus, the présent OB polypeptide, or its dérivatives oragonist analogs, is useful for administrationjo a subject to effect cosmetic changesin fat tissue deposits, whether by modulating fat déposition, reducing appetite, orboth.

In addition, the présent compositions and methods may be used in conjunction withvarious procedures, such as cosmetic surgeries designçdL to alter the overallappearance of a body (e.g., liposuction or laser surgeries designed to reduce bodymass by aspirating or ablating fat tissue), exercise (especially running and weighttraining), low fat diet, hypnosis, biofeedback, as examples of the ways one mayattempt to decrease the percentage of fat tissue and improve the appearance of thebody.

Accordingly, the présent invention relates to a method for effecting cosmetic fat tissuemodulation in an individuàl comprising administering a fat modulating amount of anOB polypeptide, or dérivative or agonist analog thereof, to an individuàl who desirescosmetic fat tissue modulation to improve overall body appearance. In a particularaspect, the fat tissue modulation is a conséquence of appetite suppression. Preferably,the fat tissue modulation is a réduction in fat tissue.

In a further embodiment, the invention relates to a method for effecting cosmetic fattissue loss comprising combining a procedure for changing body appearance with 90

01 OS 9 G administration of a fat modulating amount of an OB polypeptide, or dérivative oragonist analog thereof, to an individual who desires cosmetic fat tissue modulation toimprove overall body appearance.

The OB Receptor 5 Development of small molécule agonists and antagonists of the OB factor will begreatly facilitated by the isolation of its receptor. This can be accomplished bypreparing active OB polypeptide and using it to screen an expression library usingstandard methodology. Receptor binding in the expression library can be tested byadministering recombinant polypeptide prepared using either bacterial or mammalian 10 expression vectors, and observing the -efifeets of^short term and continuousadministration of the recombinant polypeptide on the cells of the expression library,or by directly detecting binding of OB polypeptide to the cells.

As it is presently believed that the OB receptor is likely to be located in thehypothalamus and perhaps liver, preferably cDNA libraries from these tissues will be 15 constructed in standard expression cloning vectors. These çDNA clones would nextbe introduced into COS cells as pools and the resulting transformants would bescreened with active ligand to identify COS cells expressing the OB receptor.Positive clones can then be isolated so as to recover the cloned receptor. The clonedreceptor would be used in conjunction with the OB ligand (assuming it is a hormone) 20 to develop the necessary components for screening of small molécule modulators ofOB. * A particular assay System that is to be utilized in accordance with the présentinvention, is known as a receptor assay. In a receptor assay, the material to beassayed is appropriately labeled and then certain cellular test colonies are inoculated 25 with a quantity of both the labeled and unlabeled material after which binding studiesare conducted to détermine the extent to which the labeled material binds to the.cellreceptors. In this way, différences in affinity between materials can be ascertained. 9i 01 0596

Accordingly, a purified quantity of the weight modulator may be radiolabeled andcombined, for example, with antibodies or other inhibitors thereto, after whichbinding srudies would be carried out. Solutions would then be prepared that containvarious quantities of labeled and unlabeled uncombined weight modulator, and cellsamples would then be inoculated and thereafter incubated. The resulting cellmonolayers are then washed, solubilized and then counted in a gamma counter for alength of time sufficient to yield a standard error of <5%. These data are thensubjected to Scatchard analysis after which observations and conclusions regardingmaterial activity can be drawn. While the foregoing is exemplary, it illustrâtes themanner in which a receptor assay may be performed and utilized, in the instancewhere the cellular binding ability of""t&amp;fc assayeé material may serve as adistinguishing characteristic. In tum, a receptor assay will be particularly useful inthe identification of the spécifie receptors to the présent modulators, such as the dbreceptor. A further assay useful and contemplated in accordance withthe présent invention isknown as a "cis/trans” assay. Briefly, this assay employs two genetic constructs,1ôneof which is rypically a plasmid that continually expresses a particular receptor· ofinterest when transfected into an appropriate cell line, and the second of which is aplasmid that expresses a reporter such as luciferase, under the control of areceptor/ligand complex. Thus, for example, if it is desired to evaluate a compoundas a ligand for a particular receptor, one of the plasmids would be a construct thatresults in expression of the receptor in the chosen cell line, while the second plasmidwould possess a promoter linked to the luciferase gene in which the response elementto the particular receptor is inserted. If the compound under test is an agonist for thereceptor, the ligand will complex with the receptor, and the resulting complex willbind the response element and initiate transcription of the luciferase gene. Theresulting chemiluminescence is then measured photometrically, and dose responsecurves are obtained and compared to those of known ligands. The foregoing protocolis described in detail in U.S. Patent No. 4,981,784 and PCT International PublicationNo. WO 88/03168, for which purpose the artisan is referred. 92 010596

Once a recombinant which expresses the OB receptor gene sequence is identified, therecombinant OB receptor can be analyzed. This is achieved by assays based on thephysical or functional properties of the OB receptor, including radioactive labelingof the receptor followed by analysis by gel electrophoresis, immunoassay, ligandbinding, etc. Furthermore, antibodies to the ob receptor could be generated asdescribed above.

The structure of the OB receptor can be analyzed by various methods known in theart. Preferably, the structure of the various domains, particularly the OB bindingsite, is analyzed. Structural analysis can be performed by identifying sequence -*-40 similarity with other known proteins, particular hormone and protein receptors. Thedegree of similarity (or homology) can provide a basis for predicting structure andfunction of the OB receptor/^or a domain thereof. In a spécifie embodiment,sequence comparisons can be performed with sequences found in GenBank, using, forexample, the FASTA and FASTP programs [Pearson et al., Proc. Natl. Acad. Sri.USA, 85:2444-48 (1988)].

The protein sequence can be further characterized by a hydrophilicity analysis (e.g.,Hopp et al., 1981, supra). A hydrophilicity profile can be used to identify thehydrophobie and hydrophilic régions of the OB receptor protein, which may in tumindicate extracytoplasmic, membrane binding, and intracytoplasmic régions.

Secondary structural analysis (e.g., Chou et al., 1974, supra) can also be done, toidentify régions of the OB receptor that assume spécifie secondary structures.

Manipulation, translation, and secondary structure prédiction, as well as open readingframe prédiction and plotting, can also be accomplished using computer softwareprograms available in the art.

By providing an abundant source of recombinant OB polypeptide, and the opportunity to isolate the OB receptor (i'.e., the db gene product), the présent invention enables 93 010598 quantitative structural détermination of the active conformation of the OB polypeptideand the OB receptor, or domains thereof. In particular, enough material is providedfor nuclear magnetic résonance (NMR), infrared (IR), Ram an, and ultraviolet (UV),especîally circulai· dichroism (CD), spectroscopic analysis. In particular NMRprovides very powerful structural analysis of molécules in solution, which moreclosely approximates their native environment (Marion et al., 1983, supra·. Bar et al.,1985, supra-, Kimura et al., 1980, supra). Other methods of structural analysis canalso be employed. These include but are not limited to X-ray crystaliography(Engstom, 1974, supra).

More preferably, co-crystals of OB polypeptide andjDB receptor can be studied.Analysis of co-crystals provides detailed information about binding, which in tumallows for rational design of ligand agonists and antagonists. Computer modeling canalso be used, especially in connection with NMR or X-ray methods [Fletterick et al.,eds., Computer Graphics and Molecular Modeling, in Current Commurùcations inMolecular Biology, Cold Spring Harbor Laboratory, Cold Spring Haibor, New York(1986)].

Identification and isolation of a gene encoding an OB receptor of the inventionprovides for expression of the receptor in quantities greater than can be isolated fromnatural sources, or in indicator cells that are specially engineered to indicate theactivity of a receptor expressed after transfection or transformation of the cells.Accordingly, in addition to rational design of agonists and antagonists based on thestructure of the OB polypeptide, the présent invention contemplâtes an alternativemethod for identifying spécifie ligands of OB receptor using various screening assaysknown in the art.

The invention may be better understood by référencé to the following Examples,which are intended to be exemplary of the invention and not limiting therof. 94

EX AMPLE SECTION

Cl 0596

The following outlines the method used to identify the genetic material that isexemplary of the présent invention. This endeavor comprises four sequential steps:A) Genetic Mapping, B) Physical Mapping, C) Candidate Gene Isolation, and D) 5 Mutation détection. Following confirmation that the murine gene in object wasisolated (Step D), the homologous human gene was sought, and both the murine andhuman genes and putative proteins were characterized. The steps are summarized ingreater detail, below. A Genetic Mapping -wr-- 10 The ob mutation was segregated in genetic crosses, and standard linkage analysis wasused to position the mutation relative to RFLPs (restriction fragment lengthpolymorphisms). These data placed the OB gene in an ~ 5cM interval on proximalmouse chromosome 6. (5cM is a measurement of genetic distance corresponding to5 apparent genetic crossovers per 100 animais.) A total of 771 informative meioses 15 were generated and used in subséquent genetic mapping (Friedman et al., 1991,supra). The genetic loci that were mapped relative to OB were ail previoûslypublished. The two closest RFLPs described were defmed by probes derived fromthe carboxypeptidase and met oncogene genes.

The genetic resolution of the experiments described above was inadéquate to clone 20 ob, principally because none of the genetic markers were in tight linkage. In orderto identify the requisite tightly linked RFLPs, additional probes were isolated and thegenetic cross was expanded. A method known as chromosome microdissection wasused to isolate random pièces of DNA from proximal mouse chromosome 6 [Baharyet al.,Mammalian Gertome, 4:511-515 (1993)]. Individual cloned probes were tested 25 for tight linkage to ob. On the basis of these studies one probe, D6Rckl3, also termed psd3, was selected for further analysis owing to its genetic proximity to OB. 95 010590

This probe was used to génotype 835 ob progeny from interspecific andintersubspecific crosses, which indicated that D6Rckl3 is nonrecombinant in ail 835animais as reported in Bahary et al. In the course of physical mapping, a newpolymorphie marker was identified from a cosmid subclone derived from YAC 53A6.This new marker was positioned between D6Rckl3 and the OB gene and was usedto génotype the additional 771 informative meioses from intraspecific intercross andbackcross. A single animal #167 was identified to bear a recombination crossoverbetween ob and D6Rck39. These studies indicated that D6Rck39/D6RcK13 is —0.06cM from ob. An additional probe, Pax4, was identified that was .12 cM proximalto ob. Pax4 was recombinant in two animais; #111 and #420. Pax4 is a pseudogenethat was previously mapped to proximal mouse chronipsome 6 by Gruss and co-workers [Gruss et al., Genomics, 11:424-434 (1991)]. On this basis, it wasdetermined that the OB gene résides in the - 0.2cM interval between Pax4 andD6Rckl3. This led to efforts to clone the interposing DNA in an effort to isolateOB. K Physical Mapping ---

The cloning of the DNA in this interval made use of yeast artificial chromosomes(YACs), a relatively new cloning vector that allows the cloning of long stretches ofcontiguous DNA often more than one million base pairs in length.

Yeast artificial chromosomes were isolated using D6Rckl3 and Pax4. This wasaccomplished by preparing purified DNA probes and using them to isolate thecorresponding YACs. These YACs (#8, #16, #107 and #24) were isolated andinitially characterized, and on the basis of the resulting analyses it was concluded thatYAC 16 was the YAC that extended furthest distally, i.e., closest to ob. The key endof YAC #16 was then recovered, and it was determined that this end was doser toob than Pax4. This end was termed 16M(+). This conclusion was reached becauseit was shown that this probe was not recombinant in animal #420 (as was Pax4).This end was sequenced and used to develop a PCR assay. This PCR assay was usedto screen a YAC library. Four positive clones were isolated. Subséquent 96 01 0596 characterization of these YACs by end-rescuing, restriction mapping, puise field gelelectrophoresis, and Southern blots with the genetic crosses determined that two ofthese YACs, adu and aad, were critical for subséquent studies. YAC aad is a 550kB nonchimeric YAC which extended furthest distally. Therefore, the distal end ofthis YAC, ûûJ(pICL) was used to complété the physical map. YAC adu is 370 kbnonchimeric YAC and its distal end, adu(+}, was determined to be nonrecombinantin ail the ob progeny of the genetic crosses including animais #111 and #167,suggesting that the OB gene might résidé in this YAC. A PCR assay for these two ends, aad($lCld) and adu(+) was developed and used forisolating more YACs and PI clones to continue physical mapping. The important PIclones isolated by this effort included 498, 499, 500 (isolated using a probe derivedfrom 0dz?(pICL)) and 322, 323 and 324 (using a probe from odu(+)).

In the meantime, YACs isolated by D6Rckl3 (53A6, 25A8, 25A9, 25A10) werecharacterized. These studies determined that 53A6 extended furthest proximallytoward the aad YAC. The size of the gap between 53A6 and aad was determined,to be -70 kB. The key end of 53A6, 53(pICL) was then used to screen threeavailable YAC libraries and a PI library. A critical PI clone, 325, was isolated.This PI clone overlapped with the PI clones isolated by and(pICL) as describedabove, and therefore served to close the gap between 53(pICL) and ûûd(pICL). Asa resuit, the whole contig, containing YACs and PI clones, of -2.5 million basepairs in Iength, and spanning Pax4, 16M(+), ûdu(+), oûd(pICL), 53(pICL),D6Rck39 and D6Rckl3, was cloned. By carefully mapping the sites ofrecombination apparent in animal #111 and #167, it was concluded that OB wassituated in a 400 kB interval. To provide a working DNA source for isolating the OBgene, about 500 kB covering this nonrecombination région was isolated in a total of24 PI clones. These PI clones, including 322 and 323, which later were found tobe useful clones, were used for exon trapping. 97 01 05 3 6

The physical map of the portion of the chromosome carrying OB is shown in Figure7A. Figure 7B represents the YAC contig. Figure 7C represents the PI contig. Ç Isolation of Candidate Genes

The method used to isolate genes in this interval was exon trapping. This methodused a commercial vector to identify exon DNA (ne., coding sequences) by selectingfor functional splice acceptor and donor sequences in genomic DNA introduced intoa test construct. The DNA from these PI clones were grown and subcloned into theexon trapping vector. These clones were short inserts cloned into a Bluescript vector.Each clone was PCR amplified with PCR primers corresponding to plasmid sequencesthat flanked the insert. The PCR amplifiratian.was perfprmed directly on the bacteriathat carried the plasmid. The reactions were set up using a Biomek robot. The PCRproducts were electrophoresed on a 1 % agarose gel in TBE buffer that containedethidium bromide. The exon trapping technique was modified to eliminatecontaminating E. coli DNA from the PI clones, and to screen out the abundantartifactual exons, which exceeded 80-90% of the putative exons trapped. The exontrapping vector includes HTV sequences; a short segment of .these vector sequencescorresponds to this artifact. -¾.

The exon trapping experiment was performed using various PI clones. Exon trappingproducts were then amplified by PCR, selected, and sequenced. Sequences ofputative "exons" were compared with those in Genbank using the Blast computerprogram. About fifteen exons were selected for further examination by RT-PCR,Northern analysis, and zoo blot for the presence of corresponding RNA or conservedsequences. Seven of the fifteen putative exons, 325-2, 323-9, 322-5, D1-F7, 1H3,and 2G7, were found to encode an RNA transcript. 325-2 is a testis spécifie gene;323-8 and 323-9 are likely two exons from the same gene expressed mainly in brainand kidney. IH3 and 322-5 represent two low level brain transcripts. D1-F7 is anexon from a previously cloned gene, inosine monophosphaie dehydrogenase(IMPDH), which has ubiquitous expression pattern. None of these genes appearedto encode OB. 2G7, which is the OB exon, is discussed further below. 98 C1C536

After three unsuccessful efforts to exon trap the OB gene, another attempt was madeby pooling DNA from ail the Pis from the critical OB région. These included Pis:258, 259, 322, 323. 324, 325, 498, 499, 500, 653, 654 and others. Thereafter Pis258, 260. 322, 498 and 499 were subcloned into the exon trapping vector, andsubsequently several plates were prepared with bacterial clones, each of which carrieda putative exon. Approximately 192 clones representing putative OB candidates wereobtained. As noted above, a consistent artifact such that many of the isolâtescontained two trapped exons derived from the vector was observed. Thus, cloneswere identified both by their size and by the fact that hybridization of DNA probescorresponding to this artifact hybridized to the corresponding bands on a Southernblot of the gel. In this way, 185 out of 192 clones were excluded from furtherévaluation. Exclusion of the artifacts on the basis of size alone was not possible, asthis could hâve, in the end, led to exclusion of the exon corresponding to OB.

Thus, of the 192 exons, a total of seven exons were selected for further study.Templates for sequencing the seven exons were prepared, and sequencing wasperformed. The sequences for the seven exons were analyzed and it was found thatseven were identical and one was an apparent artifact. In particular, clone 1D12contained the "HTV sequence," Le., the artifact band. This left three exons forfurther analysis: 1F1, 2G7 and 1H3. 1F1 was eliminated because it mapped outsidethe critical région. PCR primers for both 1H3 and 2G7 were selected andsynthesized.

The sequence of the exon on 2G7 was.determined, and is shown in Figure 10 (SEQIDN0:7). PCR primers for 2G7 were selected and synthesized. The portions of thesequence corresponding to the PCR primers are underlined. The primers used were: 5' CCA GGG CAG GAA AAT GTG (Tm = 60.0°C) (SEQ ID NO:8) 3' CAT CCT GGA CTT TCT GGA TAG G (Tm = 60.0°C) (SEQ ID NO:9) 99 010596

These primers amplified genome DNA with PCR conditions as follows: 25-30 cyclesat 55°C annealing for 2', 72° extension for 2’, 94°C dénaturation for Γ in standardPCR buffer. These primers were also used to generate a labeled probe by including3:P-dCTP in the PCR reaction with a corresponding réduction in the amount of colddCTP. A RT-PCR was performed on a variety of tissue RNAs and it was concluded that 2G7was expressed exclusively in white fat among the tissues examined (Figure 11A).Thereafter, 32P-labeled 2G7 was hybridized to a Northern blot of tissue RNAs (Figure1 IB) and showed that its RNA was expressed at high level in fat tissue but was eithernot expressed or expressed at very low lewels-in alLother tissues (where the signaismay be the resuit of fat contaminating the tissue préparations). Ten μ° of total RNAfrom each of the tissues listed was electrophoresed on an agarose gel withformaldéhyde. The probe was hybridized to the blot at 65 °C in a standardhybridization buffer, Rapid Hybe (Amersham). The size of the RNA wasapproximately 4.9 kB. At this point 2G7 was considered tobe a viable candidategene for OB and was analyzed further. · D. Mutation Détection

In order to confirm that 2G7 encoded the OB gene, it was necessary to demonstratedifférences in the levels of RNA expression of the DNA sequence of this gene inmutant as compared to wild-type animais. Two separate mutations of the ob gene areavailable for study, C57BU6J ob/ob (1 J) and Ckc/Sraj oblob (2J). These will bereferred hereinafter as IJ and 2J, respectively. (Informai nomenclature is used torefer to the mouse strains studied. Throughout this spécification and in the drawings,it will be understood that C57BL/6J refers to C57BL/6J +/+; CKC/smj refers toSM/Ckc-+Daf-+/+; CKC/smj ob/ob refers to SM/Ckc- -VDac-obv /obr1}. RNA wasprepared from fat tissue that had been isolated from 1 J, 2J, and control animais.Total RNA for each sample was treated with DNase and then reverse transcribedusing oligo-dT as a primer and reverse transcriptase. The resulting single-strandedcDNA was then PCR amplified either with the 2G7 primers (conditions shown above) 100 01 0596 for the lower band or with commercially available actin primers for the upper band.The RT-PCR products were run on a 1% agarose TBE gel that was stained withethidium bromide (Figure 12A). Using RT-PCT it was found that while 2G7 mRNAwas expressed in IJ and ail the other control mice, it was completely missing in 2Jmouse. No signal was detected after 30 cycles of amplification. This experimentprovided direct evidence that 2G7 corresponded to an exon from the OB gene.

Since the 2J mutation is relatively recent and is maintained as a coisogenic strain, thisresuit was the first available evidence that indicated that 2G7 is an exon from the OBgene. The mutation is likely located in the promoter région which leads to totalabortion of mRNA syntnesis. The presenceof a signâfin 1J mouse in this RT-PCRexperiment suggested that IJ might carry a point mutation which does not resuit ina gross change in size of the RNA sample. In addition, 2G7 mRNA was absent,when tested by RT-PCR, from four additional 2J animais.

This resuit was confîrmed on a Northern blot (Figure 12B). Fat cell RNA wasprepared from each of the strains (C57B1/6J, 1 J, CKC/smj, and 2J). Ten /xg of theseRNAs were run out and blotted. The blot was probed with the 2G7 probe that wasPCR-labeled, by amplification of the material, i.e., band, in Figure 11 using 32P-dCTP in the PCR reaction. Actin is a control for the amount of RNA loaded. Theactin signal is fairly similar in ail of the simples. The OB signal is absent in brainbecause the mRNA is spécifie to fat cells.

The results of the Northern analysis confum that 2G7 spécifie RNA is absent in 2Jmice. The ob RNA is absent in the CKC/smj ob/ob mice because in this obesemutant strain the gene is disrupted such that no RNA is made. In addition, the levelof 2G7 RNA was increased ~ 10-20 fold in 1J as well as db/db fat. These results arecompatible with the hypothesis that OB either encodes circulating hormone or isresponsible for the génération of a signal from fat cells that modulâtes body weight.These results supported the conclusion that 2G7 is the OB gene and predicted that IJ 101 01 0596 mice hâve a point mutation, probably a nonsense mutation leading to a prématurétranslation termination.

These Northern results hâve been replicated using fat cell RNA préparations fromfour different 2J animais (Figure 13). In this assay, ap2 is a fat-specific transcriptthat was used as a control much the same as actin in Figure 12B. There is nosignificance to the varying density of the ap2 band. ap2 was labeled by designingPCR primers form the published ap2 sequence. The RT-PCR products of fat cellRNA were then relabeled using the same protocol for PCR labeling. This analysisdemonstrates the presence of OB mRNA in normal homozygous or heterozygousanimais, and its absence from 2J mutant aa«aals,

The mutation has been identified in U mice. The mutation is a C to T base changethat results in a change of an arginine to an apparent prématuré stop codon at aminoacid 108, and in ail likelihood accounts for the IJ mutation (Figure 14) despite highlevel expression of the ob mRNA (see Figures 12 and 13, C57BL/6J ob/ob lanes).

More recently, Southern blots hâve been used to conclude that the 2J mutation is theresuit of a détectable DNA change at the 5' end of OB that appears to completelyabolish RNA expression. The exact nature of this possible rearrangement remains tobe determined. A genomic Southern blot of DNA from the CKC/smj (SM/Ckc-+Doc) and C57BU6Jmice using four different restriction endonucleases was performed in order todétermine whether the mutant ob yielded a unique fragment pattern (Figure 15A).Approximately 10 of DNA (derived from genomic DNA prepared from liver,kidney, or spleen) was digested with the restriction enzyme indicated. The DNA wasthen electrophoresed in a 1 % agarose TBE gel. The DNA was transferred to animobilon membrane and hybridized to the PCR- labeled 2G7 probe. The key bandis the uppermost band in the Bgftî digest for the CKC/smj ob/ob (SM/Ckc-+Oxc 102 010596 ob'J/ob^} DNA. This band is of higher molecular weight than in the other strain,indicating a mutation in this strain.

Figure 15B is a Southern blot of a BgZH digest of genomic DNA from the progenyof an ob^l-r x ob'^l-r cross. Some of the DNAs hâve only the upper band, someonly the lower band, and some hâve both bands. The animais with only the upperband are allo-obese. i.e., ob^/ob^. These data show that the polymorphism (i.e.,mutation) shown in Figure 15A segregates in a genetic sense. EXAMPLE 1 : cDNA Cloning and Sequence Détermination of OBUsing the labeled 2G7 PCR probe, a total okfifty mouse cDNA clones from a murinefat cell Xgtl 1 cDNA library (Clonetech 5'-STRETCH cDNA from testicular fat padsof Swiss mice, #ML3005b), and thirty cross hybridizing human cDNA clones froma human fat cell XgtlO cDNA library (Clonetech 5'-STRETCH cDNA from abdomen#HL1108a) were isolated. Library screening was performed using the plaque liftprocedure. The filters from the plaque lift were denatured using the autoclavemethod. The filters were hybridized in duplicate with the PCR-labeled 2G7 probe(Rapid Hybe buffer, 65 °C, ovemight). After a 2-4 hour prehybridization, the filterswere washed in 2x SSC, 2% SDS, twice for 30 minutes at 65°C and exposed to x-rayfilm. Duplicate positives were plaque purified. Plaque purified phage were PCR-amplified using commercially available vector primers, e.g., XgtlO and Xgtl 1. Theresulting PCR products corresponded to the cDNA insert for each phage with a smallamount of vector sequence at either end. The bands were gel purified and sequencedusing the ABI automated sequencer and the vector primers to probe the DNApolymerase.

The raw sequencing data were then manually examined base by base to correctmishearing from the computer program. As the correct sequence became available,the downstream primers were synthesized and used to continue sequencing. Suchexperiments were repeated until each available cDNA clone was sequenced andsynthesized into a contig. To date, —3000 base pairs from the 5' end of the raRNA 103 01C5S6 has been compiled. One of the cDNA clones extended to the 5' end of the mRNAsince its sequence was identical to that of the 5' RACE product of fat tissue RNA(data not shown).

The sequence data revealed that there is a 167 amino acid open reading frame (Figure1). A Kozak translation initiation consensus sequence was présent with an adenosineresidue three bases upstream of the ATG. Two classes of cDNA were founddiffering by inclusion or exclusion of a single glutamine codon. This residue is foundin a position immediately 3' to the splice accepter of the 2G7 exon. Since the CAGcodon of glutamine includes a possible AG splice accepter sequence, it appears thatthere is slippage at the splice accepter sitej&amp;ith an apparent 3 base pairs délétion ina subset of the cDNA, as shown below. gin ser val ag CAG TCG GTA (with glutamine) (SEQ ED NO: 17) t (splice accepter site) ser val ag CAG TCG GTA (without glutamine)t (splice accepter site)

The "ag" in the sequences above corresponds to the assumed intron sequenceupstream of the glutamine codon, and AG is the putative alternative splice site. Thisglutamine residue is located in a highly conserved région of the molécule and itsimportance for biological activity is as yet unknown. A putative N-terminal signal sequence was detected, the signal cleavage site of whichis predicted to be carboxy-terminal to the alanine residue at amino acid position 21.This putative signal sequence was confirmed by application of a computer algorithmto the method of von Heijne. Using this technique, the most probable signal sequencewas identified in the polypeptide coding région corresponding to amino acids 1-23,having the sequence: 104 010596 MCWRPLCRFLWLWSYLSYVQA t VP (SEQ ID NO: 10)in which the arrow indicates the putative signal sequence cleavage site. The rest ofthe amino acid sequence was largely hydrophilic and did not hâve any notablestructural motifs or membrane spanning domains other than the N-terminal signalsequence. Specifically, we did not find consensus sequences for N-linkedglycosylation or dibasic amino acid sequences indicative of protein cleavage in thepredicted processed protein (Sabatini et al., The metabolic basis ofinherited disease,pp. 177-223, C.V. Scriver et al. eds., McGraw-Hill, New York). Data basesearches using Blast and Block programs did not identify any homologous sequences.

Human fat tissue ENA was analyzed on Northern blotsy ENA species of a similar sizeto the mouse ob gene was detected. Sequencing and analysis of cDNA clonesrevealed that human OB also encodes a 167 amino acid polypeptide (Figure 2A andB and Figure 3). Two classes of cDNA, with or without three base pair délétions,were found in human as well (Figure 6). The mouse and human OB genes werehighly homologous in the predicted coding région, but had only 30% homology in theavailable 3' and 5' untranslated régions. An N-terminal signal sequence was àlsoprésent in the human OB polypeptide. Comparison of the human and mouse OBpolypeptide sequences showed that the two molécules share an overall 83 % identityat the amino acid level (Figure 4). The N-termini of the mature proteins from bothspecies share even higher homology, with only six conservative and threenonconservative amino acid substitutions among the N-terminal 100 amino acidresidues.

Genomic DNA was isolated from mouse, rat, rabbit, vole, cat, cow, sheep, pig,human, chicken, eel, and Drosophila, and restriction digested with EcüEI. Thedigests were electrophoresed on 1 % agarose TBE gel. DNA was then transferred toan immobilon membrane and probed with the PCE-labeled 2G7 probe. The filter washybridized at 65°C and washed with 2x SSC, 0.2% SDS at 65°C twice for twentyminutes each wash, i.e., there were two buffer changes. These data indicate that OB 105 010596 is conserved among vertebrates (Figure 16). Note in this regard that there is a 2 +signal in eel DNA; eel is a fish.

In summary. available evidence suggests that body weight and adiposity arephysiologically controlled. Seven years ago efforts began to identify two of the keycoraponents of this System: the OB and DB genes. As shown in this example, theOB gene has now been identified as a fat spécifie gene that plays a key rôle inregulating body weight. The product of this gene, which is most probably a secretedhormone, will hâve important implications for the diagnosis and treatment ofnutritional disorders in man and non-human animais. EXAMPLE 2: Expression of OB In Bacteria

Both murine and human cDNAs encoding ob hâve been cloned into a pET-15bexpression vector (Novagen). This vector contains a T7 promoter in conjunction witha lac operator, and expresses a fusion protein containing a histidine tag (His-tag) anda thrombin cleavage site immediately upstream of the coding sequence insertion site(Figure 17) (SEQ ED NOS:11 and 12).

The mouse and human cDNAs were modified such that the alanine at the end of thesignal sequence was tumed into an Ndel site, as was a separate sequence in the 3'région. Insertion of the Ndel site was accomplished using PCR with novel primers:Mnde-5' (murine five prime primer); CTTATGTTCA TATGGTGCCG ATCCAGAAAG TC (SEQ ID NO: 13)

Mnde-3' (murine three prime primer): TCCCTCTACA TATGTCTTGG GAGCCTGGTG GC (SEQ ID NO:14)

Hnde-5' (human five prime primer): TCTATGTCCA TATGGTGCCG ATCCAAAAAG TC (SEQ ID NO: 15)

Hnde-3' (human three prime primer): TTCCTTCCCA TATGGTACTC CTTGCAGGAA GA (SEQ ID NO: 16) 106 01 0596

The primers contain a 6-base pair mismatch in the middle that introduces Ndelrestriction sites at each end of the PCR fragment. Phage carrying either the mouseor human cDNA were PCR amplified using those primers. The PCR product wasdigested with Ndel and gel purified on a 1 % low melting point agarose gel. The gelpurified bands were subcloned into the pET vector. The resulting plasmids weresequenced to ensure that mutations were not introduced during the PCR amplificationstep of cloning. Constructs for the human and murine cDNA that encode and thatlacks glutamine 49 hâve been prepared. In particular, pET 15b constructs containingeither the human or the mouse OB coding sequence, minus signal sequence and fusedto a His-tag, hâve been made using a PCR cloning method. The constructs hâve beensequenced to ensure no sequence errors wen&amp;ijntrodueed into the coding région of theOB gene during the PCR amplification step.

Two résultant plasmid constructs, pEIM9 and ρΕΊΉ14, were selected to transforma bacterial expression host. Upon induction with 1 mM IPTG under optimalconditions, the transformed bacteria were able to produce 100-300 ^g/ml of the OBfusion. The majority of the OB fusion protein was found in the inclusion body.After solubilization with 6M guanidine-HCl or urea, the fusion protein was purifiedthrough a His-binding (Ni-chelation) resin column. The conditions for columnpurification of the OB fusion protein (including binding, washing, and eluting) wereestablished experimentally. The OB fusion protein binds to the resin at 5 mMimidazole/6M guanidine-HCl and stays bound at up to 20 mM imidazole/6Mguanidine-HCl. The protein can be eluted from the resin at 60 mM imidazol/6Mguanidine (Figure 18A,B). Both the purified human and mouse OB fusion proteinswere further dialyzed in PBS to remove guanidine-HCl from the préparation, thenused to raise polyclonal antibodies.

In order to test the biological activity of the fusion protein products, the refoldingconditions for the purified protein were tested and developed. This involves initialdialysis of the fusion protein in a 1 M guanidine solution, followed by dilution witha 0.4 M arginine solution. The His-tag was removed from the fusion proteins before 107 01C596 assaying for biological fonction. The tag removal was achieved by treating the fusionprotein with thrombin from human placenta.

In addition, human and mouse OB gene coding sequences minus the signal sequenceare each being inserted into a pET 12c vector using PCR cloning method. Theseconstructs can direct the synthesized OB fosion proteins into the periplasmic space ofthe bacterial host cell. The OB fosion protein recovered from the periplasmic spacemay only need a simple gel filtration to be purified from other host proteins and willnot be denatured during such a process. EXAMPLE 3: Préparation of Antibodies to the OB Polypeptide

In addition to use of the recombinant protein to generate polyclonal antibodies, a setof four peptide sequences from the deduced murine OB sequence were identifiedusing immunogenicity plot software (GCG Package). The four carboxyl terminalpeptide fragments are: (SEP ID NO: 18):

Val-Pro-Ile-Gln-Lys-Val-Gln-Asp-Asp-ThpLys-Thr-Leu-He-Lys-Thr (SEP ID NO: 19):

Leu-His-Pro-üe-Leu-Ser-Leu-Ser-Lys-Met-Asp-Gln-Thr-Leu-Ala (SEP ID NP:20):

Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Leu-Gln-Lys-Pro-Glu-Ser-Leu-Asp (SEP ID NO:21):

Ser-Arg-Leu-Gln-Gly-Ser-Leu-Gln-Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro-Glu-

Cys

These peptides were conjugated to KlEt, and the peptide-KLH conjugates were usedto immunize rabbits using standard techniques. Polyclonal antisera spécifie for eachpeptide is recovered from the rabbits. 108 010596 EXAMPLE 4: In Vitro Translocation of an OB Polypeptide

In order to confirm the presence of a functional signal sequence, a human cDNA thatincluded the entire open reading frame was subcloned into the pGEM vector. Onlythe human cDNA was used in this experiment because suitable mouse subclones werenot recovered. Positive strand human ob RNA was transcribed using Sp6 polymeraseand used in an in vitro translation reaction with and without canine pancreaticmicrosomal membranes. The primary translation product migrated with an apparentmolecular weight of — 18 kD, which is consistent with that predicted by the cDNAsequence. Inclusion of the microsomal membranes in the reaction inhibited theoverall efficiency of translation ~5-fold. Ne&amp;ênheless,approximately 50-70% of theOB primary translation product was truncated by approximately 2 kD in the presenceof the membrane préparation, suggesting that the signal sequence is functional (Figure19A). The size of the primary translation product of interleukin-ΐα RNA, which doesnot encode a signal sequence, was unehanged when microsomal membranes wereincluded in the reaction. In order to confirm that translocation of the OB protein hadtaken place, the in vitro translation products were treated with Proteinase-K. Proteasetreatment resulted in the complété proteolysis of the 18 kD primary translationproduct while the 16 kD processed form was unaffected by the enzyme treatment,indicating that it had translocated into the lumen of the microsomes (Figure 19B).These data are compatible with the hypothesis that OB is a secreted molécule.

After signal sequence cleavage, -two cysteine residues would remain within thepredicted protein raising the possibility that the molécule contains a disulfîde bondcharacteristic of other secreted polypeptides [Shen et al., Science, 224:168-171(1984)]. EXAMPLE 5 : Characterization of the OB Gene

To establish the relationship between obesity and genetic alterations in the OB genein humans, the sequence of the human OB gene was determined (Figure 20A through 109 01 0596 C) (SEQ ID NOS:22 and 24). Spécifie primers from the human coding sequencewere used to screen a human PI library. Three different PI clones were obtained,grown up, and PCR amplified using primers flanking the splicing site between theftfst and second coding exons. The entire intron région, around 2 kb, was amplifiedand partially sequenced (see Figure 20A; and as indicated in SEQ ID NO:22 and 24).

The gene structure of both the murine and human genes was characterized using PCRassays and other standard techniques. The mouse 03 gene was found to consist ofthree exons, the second and third of which account for the coding sequence (Figure20D). The coding région of the human Ofigape shares the same structure; however,the human gene lacks a 5' exon and intron (Figure 20E).

Two sets of primers generated from the intronic sequences of the human gene hâvebeen prepared (Figure 20A through C). The sequences of the primers follows (F andR refer to forward and reverse, respectively): HOB lgF 5'-CCCAAGAAGCCCATCCTG-3' (SEQ ED NÛ:29) HOB lgR 5'-GACTATCTGGGTCCAGTGCC-3' (SEQ ED NO:30)HOB 2gF 5'-CCACATGCTGAGCACTTGTT-3' (SEQ ED NO:31) HOB 2gR 5'-CTTCAATCCTGGAGATACCTGG-3' (SEQ ID NO:32) DNA samples hâve been obtained from various sources, and these sets of primers arebeing used to amplify human genomic DNA from severely obese people. The PCRproducts were run on a low melting point agarose gel, and the bands were eut out anddigested with agarase. The sequences were obtained using the ABI 373A DNAsequencer and Taq dideoxy terminator kit (ABI, Perkin-Elmer). One point mutationin an ob gene from a patient sample has been detected to date. This mutation is inthe first exon and does not change the amino acid sequence. Preliminary dataindicate that an insertion sequence may be présent in the first exon of another patient. 110 010526 A different automated sequencing method using Sequenase instead of Taq DNApolymerase may be employed to yield more easily readable sequences for mutationdétection. EXAMPLE 6: Expression of OB in Yeast

Following the positional cloning of OB, it became important to uncover thephysiological mechanism by which the OB protein reduces food intake and bodyweight. The first step in this direction was to recombinantly produce a functionalprotein using an expression System. In addition to the successful bacterial expressionSystem, a yeast expression System was also-selected. Yeast expression has severalattractive features for expressing OB. The most important is that biologically activeeukaryotic proteins are more likely to be produced. The OB polypeptide is secretedby mammalian cells. Protein sécrétion is very similar for ail eukaryotes, whichmeans that the yeast secretory apparatus is much more similar to the mammaliansecretory pathway than bacterial secretory pathways would be. In particular, proteinmodifications of OB seen in mammalian cells would likely also be seen in theexpression through the yeast secretory System. In addition, protein folding is carriedout in passage through the secretory apparatus and thus, delivering ob through theyeast secretory apparatus is likely to give a properly folded protein with nativebiological activity. This is significant for OB because the two cysteine residues mayform a disulfide bridge. In contrast to secretory pathways, the reducing environmentof the cell cytoplasm prevents formation of disulfide bridges; and therefore it isessential that OB pass through the secretory pathway in order for this disulfide bondto form in vivo. Other advantages hâve to do with the ease and quickness ofmanipulating yeast, the availability of vectors and strains, and the vast expérience inyeast recombinant technology. A Pichia pasioris expression System was chosen for four reasons: (1) it has higherlevels of heterologous protein expression than other yeast Systems such as S.cerevisiae', (2) protein glycosylation is more similar to the mammalian system in P. 111 01 0596 postons than in S. cerevisïae (although glycosylation sites were not detected in obusing a computer search, there still remained the possibility of glycosylation atunrecognized sites): (3) P. postons sécrétés very few proteins natively, and thus itis generally straightforward to purify the expressed foreign protein; and (4) thevectors and yeast strains are commercially available (from Invitrogen). Twostrategies for generating yeast expression vectors are shown in Figures 21 and 22.

The vector chosen was pPIC.9. This vector contains a cloning site just downstreamof the α-mating factor prepro coding sequence which directs the protein encoded bythe gene cloned into the cloning site to be secreted by the secretory pathway. Theother important feature of the vector is a HiS4 gene that aliows sélection for uptakeof the vector using a yeast auxotrophic strain grown on histidine-deficient mediafollowing transformation of the yeast with the vector. The cloning strategy was asfollows: PCR amplify OB cDNA using a 5' primer that contains at its 3' end,sequence complementary to the sequence of OB just following the predicted leaderpeptide cleavage site, and at its most 5' end, a sequence complementary to the 3' endof the α-mating factor sequence of the vector. The 5' primer also contains an Xholsite. The 3' primer was designed to hâve at its 3' end a sequence complementary tothe last few amino acids of OB and an EcoRI site at its 5' end. Following PCRamplification, the PCR product was digested with Xhol and £coRI and cloned intosimilarly digested pPIC.9. Following the cloning of both the mouse and human OBcDNAs, each with and without the glutamine at codon 49, individual clones wereisolated for ail four constructs and sequenced to verify that the constructs were clonedin the correct orientation, and frame, and contained no mutations from the PCR amplification step. Following identification of clones with the correct sequence, thesewere transformed into P. pastoris strain GSI 15, a histidine auxotroph.

For the two mouse OB constructs, transformed yeast clones were screened for proteinexpression. As evidence that the transformed yeast contain OB, a DNA dot-blotassay and a colony hybridization assay were done which both showed OB sequencewithin the transformed yeast, but not within the untransformed yeast. Furthermore, 112 01 0596 the transformed yeast now secreted a 16 kDa proteln into the culture media, whereasthe untransformed yeast does not secrete a protein of this size (Figure 23A). This isthe predicted size of OB. Individual clones for both mouse constructs hâve beenidentified that are high expressors for OB, and currently a purification strategy isbeing developed to purify ob to homogeneity. One strategy has been to purify OBon a cation exchange column (Figure 23B); preliminary data suggest that a strongcation exchanger may be useful. However, after cation exchange chromatogTaphy,the putative ob product is lost. This indicates the presence of a protease in thesample.

One strategy to ovcrcomethis problem is to-prepare oè-His-tag fusions for expressionin yeast (Figure 22). Further évaluation has demonstrated that OB without a His-tagassociâtes tightly with a Ni-chelation column. Purification of the OB polypeptide byNi-chelation, followed by gel filtration, yielded a product of sufficient purity for massspectral analysis. Mass spec. confirms the molecular weight of the expressed proteinis identical to the expected molecular weight, which strongly confums that OB hasbeen successfully expressed in Pichîa.

However, the Ni-chelation/gel filtration purification protocol does not yield an OBpolypeptide in sufficiently pure form. Additional small molécules are présent. Itdoes appear that the proteolytic activity elutes from the Ni-chelation column in thevoid volume. Accordingly, a three-step purification process is planned: Ni-chelation,followed by cation exchange (which éliminâtes the small molécule contaminants),followed by gel filtration.

Estimating expression level by Coomassie blue staining of SDS-PAGE gels revealsapproximately 10 mg/1 when yeast are grown in shaker flasks. These levels areexpected to increase in fermentation vessels, and we are about to initiate fermentationwith the hopes of obtaining larger quantities of protein. Regarding the human OBconstructs, transformed yeast clones containing high copy numbers of the OB gene 113 010596 hâve been identified. and these are expected to express OB proteln. As antibodies aredeveloped, these will be used to confirm the identity of the secreted 16 kDa protein. EXANfPLE 7: High Level Expression of an Qb Fusion Peptide in Bacteria

Préparation of freezer stocks: 5 To each of the two 4 ml aliquots of sterilized M9ZB media without the carbonsource, 40 μ\ stock dextrose (0.4 g/ml, fdter sterilized) 10/xl ampicillîn stock (200mg/ml, and 5 μ\ chloramphenicol stock (34 mg/ml, in éthanol) were added. A singlecolony each of E. coli with cloned mouse and human OBI DNA in a Novagen pET-14b vector was used to inoculate these. The^ûlbes were incubated at 37°C ovemight. 10 0.5 ml of the ovemight cultures were used to inoculate 50 ml M9ZB media with dextrose, ampicillin and chloramphenicol. These were incubated at 30°C and theabsorbance at 600 nm (A^,) was monitored periodically. At A^æ of about 1-1.2, 175μΐ aliquots of the culture were mixed with 25 μ\ 60% glycerol in 2 ml eppendorftubes, flash frozen in liquid nitrogen and stored at -80°C. 15 Culture growth: 50 ml M9ZB media with 0.5 ml 40% dextrose, 125 /xi ampicillin stock and 50 μ\chloramphenicol stock was înoculated with 1 ml freezer stock and incubated at 30° C.At A$oo of 1-1.2, 10 ml of this culture was used to inoculate each of four 2 L flaskswith 500 ml M9ZB media with dextrose, ampicillin and chloramphenicol. These 20 were incubated at 30°C until induction at A^ of about 1-1.2 with a finalconcentration of 0.5 mM IPTG. The cultures were incubated ovemight. The cellswere harvested by centrifugation at 4000 rpm for 20 minutes. This expression Systemyield a recombinant OB polypeptide as a fairly high percentage of total protein; onthe order of gram/liter of E. coli. 114 010596

Cell lysis and resuspension of inclusion bodies:

Cell paste was resuspended in a minimal volume of 20 mM HEPES, pH 7.2, 10%glycerol, 0.1 M KCI, 5 mM MgCk, 1 % aprotinin, 1 mM PMSF, 5 ^g/ml leupeptinand 50 /ig/ml DNase I. The suspension was freeze thawed three times using liquidnitrogen and lukewarm water. Lysed cells were centrifuged at 18000 rpm for 30minutes and resuspended in 20 mM HEPES, pH 7.5, 0.1 M NaCl. The suspensionwas sonicated and Triton X100 was added to a final concentration of 2%. This wascentrifuged for 15 minutes at 18000 rpm. After two more such cycles, three cyclesof Triton free washes were given. Finally the pellet was dissolved in 6 M GdHCl(guanidine-HCl), 20 mM HEPES, pH 7.5 by sonication followed by centrifugation.The supematant was used for further purification.

The OB protein was purified in the unfolded State by immobilized métal ion affinitychromatography (IMAC). The solution was applied to a 40 ml column of Pharmaciachelating fast flow sepharose charged by 5 column volumes of 50 mM NiSO4 andequilibrated in 6 M GdHCl, 20 mM HEPES, pH 7.5. The column was washed with6 M GdHCl, 30 mM imidazole, 20 mM HEPES, pH 7.5. Finally, the protein waseluted with the same buffer containing 0.2 M imidazole. Unfolded protein in 6 MGdHCl was stored at 4°C after adding sodium acetate (NaAc) to 10 mM andadjusting the pH to about 4.5 with acetic acid.

Refolding and the purification of the protein:

6 M GdHCl solution containing 100 mg protein was treated with 67 μΐ 1 Mdithiothreitol (DTT) and diluted to about 67 ml with 6 M GdHCl, 10 mM NaAc, pH 4.5. It was left stirring at room température for about an hour. It was then dilutedinto 4 L of 20% glycerol, 2.5 mM CaC/,, 20 mM Tris, pH 8.4 buffer with stirring.After proper mixing, the solution was left at room température for about 8 hourswithout further stirring. Then 2000 units of purified bovine thrombin (ffomthrombostat, a Parke-Davis product) was added, and the solution was left with gentlestirring. After 2.5 hours it was redosed with 2000 units of thrombin and the cleavageof the histidine-tagwas continued for 3 more hours. The thrombin cleavage was 115 arrested by adding PMSF to a final concentration of 0.1 mM.filtered and stored at 4°C. 010596

The solution was

The cleaved protein was further purified on the same IMAC column as above,equilibrated in 1 M KC1, 20% glycerol, 20 mM HEPES, pH 8.4 buffer. Afterloading the protein solution, it was washed with the same buffer and the cleavedprotein was eluted with IM KC1, 20 % glycerol, 40 mM imidazole, 20 mM HEPES,pH 8.4. Uncleaved protein eluted at 0.2 M imidazole.

Purified cleaved protein was concentrated, treated with 50-100 mM EDTA, 10 mMpotassium ferricyanide (to complété any incojnplete oxidation) and gel filtered on asuperdex 75 16/60 column. Yields using this procedure approached 50% of thestarting peptide.

Once purified, the expressed protein has been characterized by severai methods.Physical characterization includes dynamic light-scattering to détermine homogeneityof structure and is used as a measure of proper folding. Light scattering data indicatethat the human OB polypeptide is expressed predominantly or exclusively as amonomer, while the murine OB polypeptide can be found as a dimer as well as amonomer.

Assays with Ellman’s reagent and mass spectroscopic analysis confirm that the cyteineresidues form a disulfide bond in the protein. This oxidized form of the polypeptidewas administered to mice, as described infra, and demonstrated biological activity.

Circular dichroism has been used to roughly détermine the structural geometry of theprotein. CD spectra in a physiological buffer (pH about 8, approximatelyphysiological ionic strength) indicate that the human OB polypeptide has about 60%α-helical structure and about 40% random coil structure. The murine OB polypeptidewas found to hâve about 50% a-helix and 50% random coil by CD spectroscopy. 116 010596

Limited proteolysis. followed by mass spectrometry (Cohen et al., 1995, supra) hasbeen employed to identify portions of the OB polypeptide that are accessible toproteolysis. This analysis has demonstrated the presence of a flexible loop structureof amino acid residues 54 to 60 (as depicted in Figure 4). It is likely that this flexibleloop connects two domains of defined 2° structure, e.g., a-helix.

Importantly, as shown in the following Examples, bioactivity of the purified proteinwas assayed by administering the protein to both lean and obese rodents via anosmotic pump (e.g., an ALZET osmotic pump from Alza Coiporation, Palo Alto,CA) or by daily bolus dose i.p. over at least a two-week period and effects on feedingbehavior and body weight were observed. EXAMPLE 8: Weight Reducing Effects of the OB Polypeptide (Leptin)

The gene product of the mouse OB locus plays an important rôle in regulating bodyweight. The présent Example establishes that the OB protein circulâtes in mouse, ratand human plasma. The circulating form in ail three species has an identicalmolecular weight by SDS-PAGE to the deduced polypeptide sequence without thesignal sequence, suggesting that, in vivo, the protein is not processed after cleavageof the signal sequence. The OB protein was absent in plasma from C57/B16J ob/obmice and présent at ten-fold higher concentrations in plasma of db/db mice andtwenty-fold higher levels in plasma of fa/fa rats relative to Controls. It is suggestedthat these obese animal mutants are résistant to the effects of OB. There were seven-fold différences in plasma levels of the OB protein within a group of six lean humansubjects. Daily injections of the recombinant mouse OB protein dramatically reducedbody mass in ob/ob mice, had significant effects on body weight of wild-type micebut had no effect on db/db mice. These data suggest that the gene product of the OBlocus serves an endocrine function to regulate body weight. 117 010596

Materials and Methods

Rabbits were immunized with recombinant protein in Freund's adjuvant (HEP, Inc.).Immunopurified anti-mouse OB antibodies were prepared by passage of antiserumover a sepharose 4B column conjugated to the recombinant protein as described[Harlow et al., Antibodies: A Laboraiory Manual, Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, ΝΎ (1988)]. Immunoprécipitation of mouse plasma wascarried out as follows: 0.5 ml of plasma from mouse, rat and human containingapproximately 2.5 mM EDTA was pre-cleared with unconjugated sepharose-4B atroom température with rocking for 2 hours. The sepharose was removed by spinningand 50 ml of a 50% slurry of antibody-conjugated sepharose containing affinity-purifîed antibody at a concentration of 1 mg/ml of packed sepharose was added.One-half ml of 2x EEPA buffer was added to give final binding conditions as follows:50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodiumdeoxycholate and 0.025% sodium azide. The reaction was carried out ovemight at4°C with rocking. The antibody-conjugated sepharose was washed 8 times usingRIPA buffer, followed by rinsing three times with PBS, and run on a 15% SDS-PAGE. The proteins were transferred to nitrocellulose and Western blotted with abiotinylated immunopurified antibody against the recombinant protein. The secondaryantibody used was HRP-streptavidin and ECL was used for détection.

To quantitate the amount of OB in mouse sérum, increasing amounts of the refoldedrecombinant mouse OB protein (0.01, 0.1, 0.5, 2.0, 15.0 ng) were added to 100 λof C57BL/6J ob/ob plasma and incubated at 4°C for 3 hours with the protein Asepharose conjugated antibody. After extensive washing with buffer A (10 mMsodium phosphate buffer, pH 7.4; 100 mM NaCl; 1 % Triton X-100, 5 mM EDTA,1 mM PMSF), samples were resuspended in sample buffer, loaded on a 15% SDS-PAGE and transferred to a nitrocellulose membrane. Western blotting was performedusing an immunopurified biotinylated anti-amino-terminus antibody as a primaryantibody and HRP-streptavidin as a secondary antibody, followed by ECL détection. 118 01 0596

Cytoplasmic extracts were prepared by homogenizing adipose tissue in NDS buffer(10 mNÎ Tris, pH 7.5, 10 mM NaCl, 60 mM ICCI, 0.15 mM spenmine, 0.5 mMspermidine, 14 mM 0-mercaptoethanol, 0.5 m EGTA, 2 mM EDTA, 0.5% NP-40)by polytron and dounce homogenization, and removal of nuclei was accomplished bycentrifuging at 700 g.

Immunoprécipitations were performed as described above except that immunopurifiedanti-human OB antibodies were used. For the EUS A, 100 ml of a 1 mg/ml solutionof immunopurified anti-human OB antibody was dissolved in a borate buffered PBSsolution and applied ovemight to microtiter (Corning cat. #2595) plates at 4°C, Theplates were then washed 4 times with borate-saline solution containing 0.05% Tween20 and excess liquid was removed. Plates were blocked by incubation at roomtempérature for 2 hours with 240 ml per well of borate saline buffer containing 0.3 %gelatin and then washed and dried. Either known amounts of a refolded human OBprotein or plasma samples in a 100 ml volume were incubated in individual wellsovemight at 4°C. After washing, the plates were incubated with 100 ml of abiotinylated immunopurified anti-human antibody (0.1 mg/ml in a gelatin-boratebuffered solution) for 4 hours at room température. After washing, horse radishperoxidase (HRP)-Streptavidin was added to the plates (0.1 mg/ml in borate buffer,0.3% gelatin). HEP substrate solution (ABTS, 0.3 mg/ml and H2Û2, 0.01 % in citricacid) was then used for détection and the O.D. was measured at 414 nM to quantitatethe antibody binding.

The mouse and human OB gene coding sequences were PCR amplified from plasmidscontaining OB cDNA sequences and subcloned into the pPIC.9 plasmid (Invitrogen).The human 5' primer used was 5' GTATCTCTCGAGAAAAGAGTGCCCATCCAAAAAGTCCAAG 3' (SEQ ID NO:34)and the 3' primer was 5' GCGCGAATTCTCAGCACCCAGGGCTGAGGTC 3' (SEQ ID NO:35).

For mouse, the 5' primer was 119 010596 5' GTATCTCTCGAGAAAAGAGTGCCTATCCAGAAAGTCCAGG 3' (SEQ ED NO:36)and the 3' primer was 5' GCGCGAATTCTCAGCATTCAGGGCTAACATC 3' (SEQ ID NO:37).

The 5' primer for both mouse and human contains a Xhol site at the 5' end andcoding sequences for the last 4 amino acids of the α-mating factor signal sequenceprésent in the vector pPIC.9. This vector directs sécrétion of heterologouslyexpressed genes from the cell into the culture media. The 5' PCR primer alsoincludes the first 19 nucléotides of the OB gene open reading frame after the signalsequence cleavage site, before the alanine atapiino acid position 21. The 3' primercontains an £coEI site at its 5' end, which is immediately followed by sequencescomplementary to the putative OB stop codon. The PCR conditions were as follows:denaturing for 1 min. at 94°C, annealing for 1 min. at 55°C and extension for 2.5min. at 72°C. Low-cycle PCR (15 cycles) and the proof-reading polymerase PFU(Stratagene) were used to limit the number of PCR-generated mutations. The PCRproducts were digested with Xhol and £coRI and cloned into similarly digested .vector, pPIC.9. AU constructs were sequenced on both strands to ensure the absenceof any PCR-generated mutations. Clones were transformed into Pichia pastoris (His')by the spheroplast method and selected on histidine déficient media. Approximately200 mouse and human clones were screened for high-copy number intégration by acolony hybridization assay. The high copy number clones were then assayed for OBexpression, initially by Coomassie staining showing the presence of a novel 16 kDprotein présent in the culture media of transformed yeast. The 16 kD band wasconfirmed to be OB using antibodies raised against the bacteriaUy expressed OBprotein. The recombinant proteins were purified by a two-step purification methoddescribed below. Mass spectrometry and cyanogen bromide treatment wereperformed as described in Beavis et al., Proc. Natl. Acad. Sci. USA, 87:6873-6877 (1990). 120 01 0596

The entire OB coding sequence of the mouse and human OB genes C-terminal to thesignal sequence were subcloned into the pET15b expression vector (Novagen) andoverexpressed in Escherichia coli [BL21(DE3)plYsS] using the T7 RNA polymeraseSystem [Studier et al., Meth. Enzymolo°y, 185:80-89 (1990)]. Cells grown at 30°Cto an absorbency of 0.7 at 595 nM and induced with 0.5 mM isopropyl-/?-D-thiogalacto-pyranoside ovemight were collected by low-speed centrifugation. Lysiswas performed by three cycles of freeze thaw and DNA digestion was perform withDNasel. Membrane extraction was performed by sonication and detergentsolubilization, and the final inclusion body pellet was dissolved in 6M guanidine-HCl,20mM HEPES, pH8.4. Recombinant OB proteins were purified under denaturingconditions by IMAC using a Ni-ion affinity-column and washing with increasingamounts of imidazole. Purified denatured OB protein was then stored in 6 Mguanidine-HCl, 10 mM sodium acetate (NaAc), pH 5, and reduced using 1 mM DTTat room température for 1 hour. Dénaturation was performed by diluting the reducedprotein into 20% glycerol, 5 mM CaCl2, 5 mM NaAc, pH 5, through mixing andincubation at room température for 8-12 hours. After dénaturation the pH wasadjusted to 8.4 by addition of Tris to 10 mM, and the hexa-histidine tag was removed .by thrombin cleavage. Cleaved, renatured protein was repurified by IMAC toseparate product from thrombin and uncleaved fusion protein. Cleaved, renaturedprotein elutes from the Ni-ion affinity column at 40 mM imidazole, whereas thrombinis not retained and uncleaved fusion protein elutes at 0.2 mM imidazole. Product wasthen concentrated, treated with 100 mM EDTA and 10 mM potassium ferricyanideand further purified by gel filtration using Pharmacia superdex 75 16/60 column.

An Ellman’s assay was conducted as described in Ellman, Arch. Biochem. Biophys.,82:70-77 (1959). Ellman’s reagent was prepared by dissolving 39.6 mg 5,5'-dithio-bis(2-nitrobenzoic acid) (DTNB) in 10 ml 0.05 M phosphate, pH 8. A calibrationcuive was constructed in the concentration range of 10-120 mM free sulfhydryl (usinga 1 mM stock solution of reduced DTT) at 412 nm. Each assay was performed using0.02 ml Ellman’s reagent and a total reaction mixture of 0.5 ml. The measuredextinction coefficient was 12974 M^crn'1 for free sulfhydryl group (corrélation 121 010596 coefficient 0.99987). which is within 5% of the previously reported value of 13600

Fifty ml of 2 mg/ml pure gel filtered protein, corresponding to a possible freesulfhydryl concentration of about 24 mM in the final reaction mixture, was subjectedto Ellman’s assay. The resulting solution gave A<12 of about 0.02, suggesting that thetwo cysteine residues in the protein are in an oxidized State forming cystine or thattheir free sulfhydryl groups are completely buried within the inaccessible core of thefolded protein. Identical results were obtained by conducting the same assay onunfolded protein in the presence of 6 M guanidine-HCl.

Mice were individually caged in a pathogen-free environment and acclimated to a dietcontaining 35% (w/w) Laboratory Rodent Diet 5001 (PMP Feeds, Inc.), 5.9% (w/w)tapioca pudding mix (General Foods) and 59.1 % water, which has an energy contentof 1.30 kcal/gm. The diet was sterilized by autoclave and packed into 60 mm plasticdishes, which were fixed to the tops of 100 mm pétri dishes. Tapiocagives the dieta pasty texture making it difficult for the animal to spread the food in the cage. The100 mm lid recovers the small amount of food spilled by the animal. A fresh dishof food was placed into the cage each moming and the previous day’s dish wasremoved and weighed. The différence in weight provided a measure of daily foodconsumption. Effects of recombinant protein on food intake and body weight weremeasured in three strains of mice: C57B1/6J ob/ob, C57 Bl/Ks db/àb and CBA/J+/+, purchased from the Jackson Laboratory. Thirty mice from each strain weredivided into groups of 10. One group from each strain received daily intraperitoneal(i.p.) injections of the refolded bacterial ob protein at a dose of 5 mg/g/day in 300jri of PBS. A second group received i.p. injections of the same volume of PBS.These control mice received injections of the PBS dialysate of the recombinantprotein, The PBS was cleared of endotoxin using an Acticlean ETOX column. Athird gToup of animais did not receive injections. Food intake was recorded daily and body weight measurements were recorded regularly over a 3.5 week interval. For 122 G 1 0596 the pair feeding experiment, the food intake of a separate group of ob mice wasmatched on a daily basis to that consumed by the ob mice receiving protein.

Results

The OB Protein Circulâtes in Mouse, Rat and Human Plasma.

Recombinant mouse and human OB protein was prepared using the pET 15b bacterialexpression vector (Novagen) and by cloning into Pichia pastoris, a yeast expressionSystem that sécrétés recombinant proteins directly into the culture media. The obprotein expressed in yeast includes the 146 amino acids carboxy-terminal to the signalsequence. Rabbits were immunized with the bacterial proteins (HRP, Inc.).Antibodies were immunopurifîed (Research Genetics) and used forimmunoprécipitations and Western blots of protein from plasma and adipose tissue.

The OB protein from mouse plasma migrâtes with an apparent molecular weight of16 kD by SDS-PAGE. The electrophoretic mobility is identical to the recombinantOB protein secreted by yeast after signal sequence removal (Figure 24A) The protein ^.was not detected in plasma from C57BL/6J ob/ob mice that hâve a nonsense mutation-at codon 105. Several different antisera failed to identify the truncated 105 residue ..·polypeptide chain predicted by the cDNA sequence. A ten-fold increase in the level of circulating protein was observed in db/db micerelative to a control animal (Figure 24A). Immunoprécipitation of plasma from wild-type and fa/fa rats revealed a twenty-fold increase in the level of OB protein in themutant rat compared to wild type (Figure 24B). The db mutation results in an obesephenotype identical to that seen in ob mice (Bahary et al., 1990, supra), fatty ratsare obese as a resuit of a récessive mutation in a gene homologous to db (Truett etal,, 1991, supra). In order to quantitate the level of OB in mouse plasma, increasingamounts of recombinant protein were added to sérum and immunoprecipitated (Figure24C). A linear increase of the signal intensity on Western blots was seen withincreasing amounts of recombinant protein. Comparison of the signal intensity of thenative protein in rnotise plasma to the standards indicated that the circulating level of 123 01 0596 the OB protein in wild type mice is approximately 20 ng/ml. These data demonstratethat the immunoprécipitations and Western blots were performed under conditions ofantibody excess. Increased levels of the OB protein were also seen in protein extractsof adipose tissue from db/db mies relative to Controls (Figure 24D). As expected fora secreted protein, the protein from the adipose tissue fractionated with the crudemembrane fraction (data not shown).

Plasma samples from six lean human subjects with a Body Mass Index less than 25(BMI=weÎght/length:) were immunoprecipitated using immunopurified antibodies tothe human protein. The immunoprecipitated material migrated with an electrophroticmobility identical to that seen for the 146-ai»ino aeid^human protein expressed inyeast. The intensity of the signais varied significantly among the six samples (Figure25A). Densitometry of the autoradiograph revealed an approximately fïve-folddifférence in the levels in individuals HP1 and HP6, with intermediate levels in theother subjects. An enzyme linked immunoassay (EUSA) was developed using theimmunopurified antibody and the refolded bacterial protein as a standard (see below). xThe resulting standard curve is shown in Figure 25B. Using this assay, the plasma,levels of the OB protein in the six human plasma samples varied between 2-15 ng/ml,(Figure 25C). The level of the OB protein in plasma from HP6 was outside of thelinear range of the immunoassay and is .> 15 ng/ml. These quantitative différencescorrelated with those seen on Western blots.

Preliminary data suggest that leptin may circulate, at least in part, complexed toanother protein or proteins. This conclusion was based on heterogeneity of the shapeof the titration curve for sérum compared with recombinant standard. Analysis of alarge amount of leptin immunopurified on a rabbit anti-OB column by gel filtrationHPLC under denaturing and non-denaturing conditions, with monitoring by EUSAand SDS-PAGE suggested that, the OB polypeptide behaved like a high rnolecularweight complex. However, these data remain preliminary; the OB binding protein,if any, has yet to be characterized. 124 010596

Structural Features of the OB Protein.

Since the OB protein has two cysteine residues, it could form either intra- orintermolecular disulphide bonds under oxidizing conditions in vivo. Western blotswere repeated with and without the addition of reducing agents to the sample buffer.Under both conditions, the OB protein in human seram migrated as a monomer (datanot shown). Under nonreducing conditions, protein immunoprecipitated from dbmouse sérum was detected at positions consistent with that of both a monomer of 16kD and a dimer of approximately 32 kD (Figure 26A). The higher molecular weightmoiety disappeared under reducing conditions suggesting that a fraction of mouse OBcirculâtes as a higher molecular weight species via formation of an intermoleculardisulphide bond. Approximately 80% ofmouse OB circulâtes as the approximately16 kD protein and 20% as the approximately 32 kD form.

The same molecular forms are seen when the mouse and human proteins areexpressed in Pichia pasioris [Abrams et al., Immunol. Rev., :5-24 (1992)]. In thesestudies, the DNA sequence corresponding to the 146 amino acid mature OB proteinwas cloned downstream of the yeast α-mating factor signal sequence in the pPIU9vector (Invitrogen). The OB protein was purified from the yeast media of strainsexpressing the mouse and human proteins and electrophoresed under reducing andnonreducing conditions (Figure 26A). The mouse protein was expressed in yeastmainly as a dimer under nonreducing conditions, and only as a monomer in thepresence of reducing agents. The recombinant human protein migrated to the positionof a monomer under both conditions (data not shown).

The purified human protein expressed in Pichia had a molecular mass of 16,02413Da as determined by mass spectrometry 1990 (Beavis, 1990, supra). This value isin agreement with the mass calculated from the amino acid sequence of the proteincontaining a single intramolecular disulfide bridge (16,024 Da). Matrix-assisted laserdesorption mass spectometric analysis of cyanogen bromide cleavage products of theprotein indicates that cysteines 117 and 167 are linked through an intramolecular 125 0 1 0 5 9 6 disulphide bond (Figure 26B) Cyanogen bromide cleaves carboxyterminal tométhionine residues.

Préparation and Characterization of Bioactive Recombinant Protein.

Mouse OB protein was expressed in E. coli from a pET 15b plasmid as an insolublefusion protein, with a 20 residue, N-terminal hexa-histidine tag containing a thrombincleavage site. Bacterial inclusion bodies were solubilized using guanidine-HCi andpurified under denaturing conditions using immobilized métal ion affinitychromatography (IMAC) (Figure 27). Purified, denatured fusion protein wasreduced, diluted and permitted to refold in aqueous solution at room température.Following thrombin cleavage, renàtured mouseOB protein containing four additionalN-terminal residues (Gly-Ser-His-Met; SEQ ID NO:38) was repurified by IMAC to>98% homogeneity, as judged by SDS-PAGE and mass spectrometry. Matrix-assisted laser desoiption mass spectrometry gave a measured mass of 16,414±3 Da(predicted mass - 16,415 Da). Both reducing and non-reducing SDS-PAGE gelsdemonstrated a single molecular species with apparent and molecular weight of 16 kD(data not shown).

Dynamic light scattering using a DP801 Molecular Size Detector (Protein Solutions,Inc.) demonstrated that the renàtured mouse OB protein was largely monomeric, withsome higher-order aggregates. The protein was treated with EDTA and chemicallyoxidized. Higher molecular weight species were then removed by gel filtration.Further dynamic light scattering confirmed that the purified, renàtured recombinantmouse OB protein was monodispersed. Following dialysis against phosphate bufferedsaline (PBS), bacterial endotoxin was removed using an Acticlean ETOX column(Sterogene Bioseparations, Inc.). The final yield of protein was 45 mg/1.

Ellman’s assay was performed on the purified, renàtured recombinant mouse OBprotein to assess its oxidation State (Ellman, 1959, supra). Both renàtured proteinand protein unfolded by 6M guanidine-HCl demonstrated <0.5% free sulfhydrylcontent, demonstrating that the monomeric product contains an intramolecular 126 01 0596 disulphide bond. This was confirmed by mass spectrometry of the cyanogen bromidecleavage products of the refolded bacterial protein (data not shown).

Bioacriviïÿ of lhe OB Proiein. The purified, renatured recombinant mouse OB proteinwas administered as a daily intraperitoneal injection of 5 mg/kg/day to groups of 10C57B176J ob/ob (âge, 16 weeks), C57B17Ks db/db (âge, 12 weeks) and CBA/J +/+(âge, 8 weeks) mice. An equal number of animais received PBS as a daily injection.The PBS used for the control injections was derived from the dialysate afteréquilibration of the protein. Ten additional animais from the three mouse strains didnot receive injections. The food intake of individual animais was monitored daily andthe weights of the animais were recordéd~anhree orfour day intervals. Thecumulative results for food intake and body weight from each of the 9 groups of miceare shown in Figure 28A through F, and the statistical significance of the data areshown in Table 1. The food intake of the C57B16J obtob mice injected with proteinwas signifîcantly decreased after the first injection and continued to decrease until thefifth day, when it stabilized at a level equal to approximately 40 % of the intake of the~:,5,animais receiving injections of PBS (p< .001). The sham injected OB mice did not-lose weight over the three week study period. The C57B1/6J ob/ob mice receiving -protein lost approximately 10% of their body weight after 5 days (p< .001). Theseanimais continued to lose weight over the three week treatment at which point theweight of the ob animais receiving protein had decreased to an average of 60% oftheir initial body weight (p < .0001). A separate group of ob mice were pair fed tothe ob mice receiving protein. The data in Figure 29B show that the pair fed micelost signifîcantly less weight than the animais receiving the recombinant protein (p < .02). A photograph of two mice receiving injections of either protein or vehicleshows the gross différence in appearance resulting from the protein treatment (Figure29B). In order to further ascertain the effects of the protein, autopsies of two micein each of the groups were performed. Gross inspection of the ob mice receivingprotein revealed a dramatic decrease in body fat as well as the size of the liver. Theliver weights of the db and wild-type mice were unchanged with treatment. Thelivers from the ob mice receiving the injections of PBS weighed 5.04 and 5.02 grams 127 0 1 0 5 9 6 vs. 2.23 and 2.03 grams in the animais receiving the recombinant protein. In contrast to the pale fatty liver characteristic of ob mice, the liver from the ob mice receiving protein acquired the darker color characteristic of normal liver (Figure 29C). Histologie sections of the liver indicated that the untreated animais had a fatty liver that was markedly improved in protein treated animais (data not shown).

In contrast to the ob mice, there were no significant différences in body weight orfood intake in the C57BL/Ks db/db mice receiving protein relative to the controlgroup receiving vehicle (Figure 28A through F, Table 1). Ail three groups of db/dbmice lost between 2-5 grams during the treatment period. The average blood glucoseof the db mice was measured using a glucomet'èr; and was .>. 500 mg/dl in ail of themice indicating that these animais had developed diabètes secondary to obesity. Theinjections of db mice were terminated after two weeks.

In wild-type mice there was a small but significant decrease in body weight following '‘Λ’Λ·... administration of the recombinant ob protein (Figure 28A-F, Table 1). After five.days of protein injection, the treated mice lost an average of 0.5 grams while controlmice gained 0.4 grams (p< .02). At two subséquent time points the animaisreceiving protein weighed significantly less than the mice receiving daily injectionsof PBS. The significance of the weight change was reduced at the later time points.In the animais that lost weight, the food intake was not significantly different fromcontrol animais. The injections of PBS had a small but significant effect on foodintake and body weight in ob, db and wild-type mice as compared to mice notreceiving injections (p < .05). 128 C10596 TABLE 1

Animal Group Treatment Group WEIGHT CHANGE Days n Mean Std, Error P ob/ob protein vehicle 1-5 10 9 -6.38000000 -Ο.14.Π4444 0.47628190 0.24444444 <0.001 protein vehicle 1-12 10 9 -14.45000000 0.98888889 0.70793126 0.38058597 <0.001 protein vehicle 1-27 6 5 -24.28333333 4.30000000 0.69924563 0.79874902 <0.0001 db/db protein vehicle 1-5 10 10 -1:47000000 -2.00000000 '*· 0.36939891 0.23142073 0.240 protein vehicle 1-12 10 10 -3.75000000 -4.19000000 0.77348418 0.34655447 0.610 CBA/J protein vehicle 1-5 10 10 -0.48000000 0.38000000 0.17876117 0.21489015 0.006 protein vehicle 1-12 10 10 -0.12000000 1.20000000 ^0:45748103 0.18378732 0.015 / protein vehicle 1-27 5 6 1.98000000 2.23333333 0.48723711 0.20763215 <0.651

Discussion

An endocrine function for the protein product of the OB locus was first suggested by5 Coleman, who showed that the body weight of ob/ob mice was reduced afterparabiotic union to normal or db mice (Coleman et al., 1978, supra). The resultsindicated above support this hypothesis by showing that OB protein circulâtes in thebloodstream and that injections of recombinant protein reduce body weight. Themolecular weight of the gene product encoded by the OB gene is approximately 1610 kD, which is equal to the 146 amino acid sequence carboxy- terminal to the signalsequence. The recombinant OB protein is not modified when expressed in Pichiapostons. Expression of mammalian genes in Pichia generally results in the formationof the correct protein structure [Cregg et al., Bio/Technology, 11:905-914 (1993)].

These findings suggest that the OB protein is not glycosylated and is not post- 129 010596 translationally processed in vivo. The data do not exclude the possibility that the OBprotein is noncovalently bound to itself or other proteins in plasma or adipose tissue.Although proteolytic cleavage of the protein has not been excluded, lower molecularweight forms of the OB protein were not detected by any of the antisera used,including four anti-peptide antibodies.

The OB protein has two cysteine residues and circulâtes as a monomer in human, andas a monomer and dimer in mouse. An intramolecular disulphide bond typical ofsecreted molécules is found when the human protein is expressed in Pichia posionssuggesting that it is likely to be présent in vivo. This is supported by the bioactivityof the recombinant bacterial protein, which has an intramolecular disulphide bond.The mouse OB protein can be found in plasma as a monomer and as a dimer. Themonomer and dimer are seen when the mouse OB protein is expressed in yeastshowing that the propensity of the mouse protein to form a dimer is a resuit ofdifférences in the primary sequence relative to the human. While it is clear that themonomer has bioactivity, the functional activity of the dimer is unknown. / ·

The effect of the OB protein on food intake and body weight in ob mice is dramatic.After three weeks treatment, the ob mice receiving daily injections of recombinantprotein had lost 40% of their weight and were consuming 40 % as much food ascontrol animais. Moreover, the weight of the treated ob mice had not yet equilibratedat the time the experiment was terminated. The results of the pair feeding experimentindicate weight loss is a resuit of effects on both food intake and energy expenditure.Thus, a separate group of ob mice whose calorie intake was restricted to that of obmice receiving protein, lost significantly less weight than the animais receivingprotein. The réduction in food intake in oblob mice to a level lower than that ofwild-type mice, within a day of receiving the OB protein, indicates that they areespecially sensitive to its effects. Indeed, the OB receptor may be upregulated inthese animais. Food intake of treated ob mice became relatively constant after fivedays of treatment. If this is the resuit of the protein having reached steady Statelevels, it would suggest that the protein has a relatively long half-life [77ie no 010596

Pharmacological Basis of Therapeurics, pp. 19-45, Goodman and Gilman, eds.,Pergamon Press, New York, (1990)]. This conclusion is consistent with data fromparabiosis experiments [Coleman et al., 1978, supra-, Weigle, Int. J. Obesiry,12:567-578 (1988)].

Effects of recombinant protein on the body weight of wild-type mice were small butstatistically significant during the fîrst two weeks of the study. While the différencein weight between wild-type mice receiving protein vs. PBS was sustained at latertime points, the statistical significance of the data greatly diminished after threeweeks. The early weight loss could not be accounted for by a différence in foodintake. Presumably, the measurement of food intake was-not précisé enough to detecta decrease resulting in a one gram différence in body weight during treatment. Theseobservations differ from the results of previous experiments in which wild-typerodents hâve been joined by parabiotic union to db mice, fa rats, rats withhypothalamic lésions and rats rendered obese by a high calorie diet [Coleman et al.,1978, supra-, Harris et al., 1987, supra-, Harris et al., "Physiological and metabolicchange^ in parabiotic partners of obese rats”, in Hormones, Thermogenesis andObesiry, ’Lzrày and Straatman, eds., Elsevier Science Publishing Co., New York(1989); Hervey, J. Physiol., 145:336-352 (1959)]. In each case, the wild-typeanimais become anorectic and lose copious amounts of weight. As the levels of OBprotein are increased in db mice and fa rats and the level of OB RNA is increased inmice with hypothalamic lésions, it is likely that wild type mice can respond to OBwhen it circulâtes in plasma at a sufficiently high level. The findings reported hèreare consistent with the possibility that the levels of the administered protein werebelow endogenous levels, leading to équilibration at a slightly lower body weight.Quantitation of the circulating levels of the OB protein in the treated mice will résolvethis issue. While an immunoassay of the mouse protein is not yet available,immunoprécipitations hâve suggested that the levels of the circulating OB proteinwere not substantially elevated in the wild type mice receiving protein. 131 010596

The lesser effect of the protein on wild type mice and the absence of a response indb mice makes it unlikely that the treatment has nonspecific or aversive effects. Ailof the db mice lost a small amount of weight during the treatment period, whether ornot they were receiving the ob protein. The db animais were markedlyhyperglycémie and the weight loss is likely to be the resuit of diabètes and not theexperimental protocol. C57BL/Ks db/db mice often develop diabètes and begin to losesmall amounts of weight when of the âge of the animais used in this study (Colemanétal., 1978, supra). C57B1/6J ob/ob mice of a similar âge do not develop significanthyperglycemia. These phenotypic différences are thought to be the resuit of geneticdifférences in the strains (O.51B16J vs. CSIBI/Ks) carrying the mutations (Colemanet al., 1978, supra).

The failure to detect the truncated 105 amino acid protein predicted by the cDNAsequence of the OB in C57B1/6J ob/ob mice suggests thayhe mutant protein iseither degraded or not translated. However, the possibility that the antisera used do ."'l.not detect 'this truncated protein cannot be excluded. The observed ten-fold increasein the levels of the ob protein in db mice compared to wild type suggests that the obprotein is overproduced when there is résistance to its effects. These data correlatewith studies of the OB mRNA. As mentioned, previous experiments hâve shown thatmutations of the mouse db and the rat fa genes, which map to homologouschromosomal régions, resuit in overproduction of a plasma factor that suppressesbody weight (Truett et al., 1991,·supra', Coleman, 1978, supra-, Hervey, 1959,supra). In both cases, it has been suggested that the mutant animais are résistant tothe effects of the OB protein. This possibility is confirmed by the observation thatthe OB protein has no effect on body weight or food intake when administered to dbmice.

Obesity in humans could be associated with increased levels of the OB protein in plasma in individuals who are relatively unresponsive to the hormone. On the other hand, reduced expression of OB could also lead to obesity in which case "normal'’ 132 010596 (i.e., inappropriately low) levels of the protein might be found. Thus, the levels ofOB protein in human plasma could be a marker for different forms of obesity. In asmall group of lean subjects with BMI <25, low nanogram levels of circulating OBprotein are détectable by EUSA. Significantly, variable concentrations were notedsuggesting that the level of expression and/or sensitivity to the protein may play a rôlein determining body weight.

The site of action of the OB protein is unknown. The protein affects both food intakeand energy expenditure, a finding consistent with clinical studies indicating thatalterations of both Systems act to regulate body weight [Leibel et al., N. Engl. J.Med., 332:621-628 (1995); Keesey et al., "Mefabolic deferise of the body weightset-point," in Association for Research in Nervous and Mental Disease, pp. 87-96,Stunkard and Stellar, eds., Raven Press, New York. (1984)]. The hypothalamus islikely to be downstream of OB in the pathway that Controls body weight, althoughdirect effects on a variety of organs are possible. EXAMPLE 9: Increased Expression in Adipocytes of OB RNA in Mice withLésions of the Hypothalamus and with Mutations at the db LocusThe gene product of the recently cloned mouse obese gene (OB) plays an importantrôle in regulating the adipose tissue mass. OB RNA is expressed specifically bymouse adipocytes in vivo in each of several different fat cell depots including brownfat. It is also expressed in cultured 3T3-442A preadipocyte cells that hâve beeninduced to differentiate. Mice with lésions of the hypothalamus, as well as micemutant at the db locus, express a twenty-fold higher level of OB RNA in adiposetissue. These data suggest that both the db gene and the hypothalamus aredownstream of the OB gene in the pathway that régulâtes the adipose tissue mass andare consistent with previous experiments suggesting that the db locus encodes the OBreceptor. In the db/db and lesioned mice, quantitative différences in the level ofexpression of OB RNA correlated with the lipid content of adipocytes. The moléculesthat regulate the level of expression of the OB gene in adipocytes are likely to play 133 010596 an important rôle in determining body weight, as are the molécules that médiate the effects of OB at its site of action.

Materials and Methods

In Situ Hybridization.

White fat tissues from identical abdominal régions of wild type (wt) and db mice wereprocessed simultaneously according to the modified method described by Richardsonétal., Growth, Development &amp;Aging, 56:149-157 (1992). Briefly, tissues were fixedin Bouin’s solution for 2 hours at 4°C. They were then dehydrated by serialtreatment of increasing concentrations of éthanol from 10% to 100%, each for 5 min.at 4°C. Further incubation of tissues with xylene (lhr.) and paraffîn (2hr.) wereperformed at 65 °C. Embedded wt and dbfdb fat tissues were sectioned and mountedby the same conditions later. Sections were baked at 65°C for lhr. and treated withxylene and serial dilutions of éthanol from 100% to 50%, each for 3 min. at roomtempérature. An antisense RNA probe of OB gene was synlhesized by in vitrotranscription of linearized OB gene coding sequence upstream of a Sp6 RNApolymerase promoter. In situ hybridization was carried out exactly according toSchaeren-Wiemers, et al. Histochemistry, 100:431-440 (1993). RNA Préparation and Cell Culture.

Total RNA and Northern blots were prepared as described. Stromal vascular cellsand adipocytes were prepared according to Rodbell, and RNA from both fractionswas prepared according to Dani et al., Mol. Cell. Endocrinol., 63:199-208 (1989);Rodbell, J. Biol. Chem. 239:375-380 (19 ). After sub-cloning, 3T3-F442 cells weregrown in Dulbecco’s modified Eagle medium containing 10% foetal bovine sérum(defmed as standard medium) [Dani et al., "Molecular biology techniques in the studyof adipocyte différentiation", in Obesity in Europe vol 88, pp. 371-376, Bjomtorp andRossner, Eds., John Libbey Company Ltd., London, England (1989)]. Atconfluence, cells were treated in standard medium supplemented with 2 nMtriiodothyronine (T3) and 17 nM insulin. Twelve days later, RNA was prepared asabove. 134 010596

Gald ThioGlucose Treatment (GTG).

Two monih old female CBA/J mîce were treated with a single intraperitoneal injectionof aurothioglucose (Sigma Catalog No. A0632) at a dose of 0.2 mg/g in normalsaline. Control animais were injected with normal saline. Mice were weighed one 5 month after the treatment. Adipose tissue RNA was isolated from those treatedanimais whose weight had increased more than twenty grams post- GTG treatment.

Results

The OB gene was recently found to be expressed in adipose tissue [Zhang et al., 10 Nature, 372:425-432 (1994)]. As adipose tissue is composed of many cell typesincluding adipocytes, preadipocytes, fibroblastî^and vasculàr cells, in situhybridization was performed to sections of epididymal fat pads from normal animaiswith sense and antisense OB riboprobes [Richardson et al., 1992, supra\ Wasserman,"The concept of the fat organ" in Rodahl, Issekutz, fat as a tissue", pp. 22-92, 15 McGraw Hill, New York (1964)]. When using the antisense probe, positive signaiswere détectable in ail of the adipocytes in the section (Figure 30 -labeled Wt).Signais were not noted when the antisense probe was hybridized to sections of brain(data not shown). Hybridization of the antisense probe to sections of adipose tissuefrom C57Bl/Ks db/db mice was greatly increased, confirming the adipocyte spécifie 20 expression of OB RNA and demonstrating a large increase in the level of OB RNAper adipocyte in these animais (Figure 30 - labeled db/db). Mice mutant at the dblocus are massively obese as part of a syndrome that is phenotypically identical to thatseen in C57B1/6J ob/ob mice (Bahary et al., 1990, supra}.

25 OB RNA was not synthesized by adipose tissue stromal cells separated fromadipocytes. As expected, cells in the adipocyte fraction expressed OB RNA usingNorthern blots (Figure 31). The same resuit was obtained using RT-PCR (data notshown). These data support the conclusion that only adipocytes express the OB gene.Data from cultured adipocytes confirm this conclusion. In these studies, 3T3-F442A 30 cells were cultured using.conditions that lead to lipid accumulation, as part of acellular program leading to différentiation into adipocytes. OB RNA was not 135 010596 expressed in exponentially growing cells, nor in confluent 3T3-F442A preadipocytecells, which express early markers, while différentiation of these cells into adipocytesled to the expression of détectable levels of OB RNA (Figure 31) [Dani er al., J.Biol. Chem., 264:10119-10125 (1989)]. The level of OB RNA is extremely sensitiveto the culture conditions, as no message was observed in late, post-confluent cells notexposed to insulin.

Hybridization studies showed that OB RNA is expressed in vivo in several differentfat depots including the epididymal, parametrial, abdominal, perirenal, and inguinalfat pads (Figure 32A). The précisé level of expression in each of the depots wassomewhat variable, with inguinal and parametrial fat expressing lower levels of OBRNA. OB RNA is also expressed in brown adipose tissue, although the level ofexpression is approximately 50-fold lower in brown fat relative to the other adiposetissue depots. These quantitative différences correlate loosely with previouslyreported différences in cell size among the different fat cell depots [Johnson et al., J. LipidRes., 13:2-11 (1972)]. The amount of OB RNA in brown fat is unaffectedby cold exposure (Figure 32B). In this experiment, the level of uncoupling proteinRNA (UCP) increased in brown fat after cold exposure while the level of ob RNAdid not change [Jacobsson et al., J. Biol. Chem., 260:16250-16254 (1985)]. Inaggregate, these data confirm that ail adipocytes are capable of producing OB RNAand demonstrate a variable level of expression in different fat depots. These datasupport the possibility that the level of the encoded protein correlates with the totaladipose tissue mass.

Levels of OB RNA in db/db mice and mice with lésions of the hypothalamus weremeasured. Lésions of the ventromedial hypothalamus (VMH) resuit in obesity as partof a syndrome resembling that seen in oblob and db/db mice [Bray et al.,Metabolism, 24:99-117 (1975)]. Parabiosis experiments suggest such lésions resuitin over expression of a blood-bome factor that suppresses food intake and bodyweight (Hervey, 1959, supra). Similar results are noted when mice mutant at the dblocus are parabiosed to normal mice, suggesting that the OB receptor may be encoded 136 010596 by the db locus (Coleman et al., 1978, supra). Thus, obesity resulting from VMHlésions and the db mutation may be the resuit of résistance to the effects of the OBprotein. If so. a secondary increase in the levels of OB RNA in adipose tissue wouldbe predicted.

Hypothalamic lésions were induced in female CBA mice using the Chemical goldthioglucose (GTG) [Debons et al., Fed. Proc., 36:143-147 (1977)]. This treatmentresults in spécifie hypothalamic lésions, principally in the ventromedial hypothalamus(VMH), with the subséquent development of obesity within several weeks. Usually,a single intraperitoneal injection of GTG of 0.2 mg/gm body weight results in thedevelopment of obesity within four weeks. One month old female CBA/J mice (20-25 grams) were treated with GTG and the subséquent weight gain of treated andcontrol animais is shown (Table 2). Adipose tissue RNA was prepared from db/dbmice and from those GTG treated animais that gained >20 gm. Northern blotsshowed a twenty-fold increase in the level of OB RNA in two-month old db/db and GTG-treated mice compared to normal animais (Figure 33). /

Table 2. Weight Gain in Gold Thioglucose Treated Mice control (n = 41) GTG (ri = 93) <10 g 41, (100%) 4, (4%) 10 g-20 g 0, (0%) 15, (16%) >20 g 0, (0%) 74, (80%)

Two month old female CBA/J mice were treated with gold thioglucose (GTG). Goldthioglucose (Sigma A0632) was administered intraperitonealy in normal salinesolution at a dosage of 2.0 mg/g. Body weight of control and injected animais wasrecorded before and one month after the injection. Animais were housed five to acage and were fed ad libitum. The amount of weight gained one month post-injectionis shown in the Table 2. Animais with a body weight gain greater that 20 g onemonth after injection were selected for further study. 137 010596

Discussion

The gene product of the mouse OB gene circulâtes in mouse and human plasma whereit may act to regulate the adipose tissue mass. Further studies on the régulation ofexpression and mechanism of action of OB will hâve important implications for our 5 understanding of the physiologie pathway that régulâtes body weight.

The présent Example shows that the OB gene product is expressed exclusively byadipocytes in ail adipose tissue depots. This resuit is consistent with the possibilitythat the protein product of the OB gene correlates with the body’s lipid stores. 10 Moreover O B ENA is upregulated twenty fold in db mice and mice withhypothalamic lésions. In these animais, the actuaJ increase in the level of O B RNAper cell is llkely to be even higher than twenty-fold since the adipocyte cell size isincreased approximately ftve-fold in these animais (see Figure 30) (Debons et al.,1977, supra}. These data position the db gene and the hypothalamus downstream of 15 OB in the pathway that Controls body weight and is consistent with thehypothesis thatthe OB receptor is encoded at the db locus [Coleman et al., Diabetologia 14:141-148(1978)]. The'molecular cloning of the OB receptor and/or the db gene will résolvethis issue. The increase in the level of OB RNA in db/db and GTG-treated mice alsosuggests a non cell-autonomous fonction of the OB gene product in fat cells [Ashwell 20 et al., Proc. R. Soc. Lond.., 195:343-353 (1977); Ashwell et al., Diabetologia,15:465-470]. Thus, if the encoded protein acted directly on fat cells to inhibitgrowth or différentiation, the overexpression of the wild type OB gene in GTGtreated mice would resuit in a lean phenotype. 25 The most parsimonious explanation of these data is that the OB protein fonctions asan endocrine signaling molécule that is secreted by adipocytes and acts, directly orindirectly, on the hypothalamus. Direct effects on the hypothalamus would requirethat mechanisms exist to allow passage of the OB gene product across the blood brainbanier. Mechanisms involving the circumventricular organ and/or spécifie 30 transporter could permit brain access of a molécule the size of that encoded by theOB gene [Johnson et al., FASEB J., 7:678-686 (1983); Baura et al., J. Clin. Invest., 138 010596 92:1824-1830 (1993); Pardridge, Endocrine Reviens, 7:314-330 (1986)]. However,this hypothesis must be considered with caution until the means by which the proteinmight cross the blood brain barrier hâve been identified. Moreover, possible effectson other target organs will need to be evaluated.

The fat cell signal(s) that are responsable for the quantitative variation in theexpression level of the OB gene is not yet known but correlates with différences inadipocyte cell size. Adipocytes from db/db mice are five times as large as those fromnormal mice, with a cell size of approximately 1.0 /xg lipid/cell (Johnson étal., 1972,supra). Prior evidence has indicated that fat cell lipid content and/or size is animportant parameter in determining body weight [Faust et al., Am. J. Physiol.,235:279-286 (1978); Faust et al., Science, 197:393-396 (1977)]. It could be that eachfat cell expresses a low level of OB RNA that further increases in proportion to thecell size. It is also possible that cell size is not the sensed parameter, but merelycorrelates with the intracellular signal that increases the expression of the OB genein adipocytes from db/db and VMH- lesioned mice. In any case, the components ofr .the signal transduction pathway regulating the synthesis of OB RNA are likely to beimportant in determining body weight. Genetic and environmental influences thatreduce the level of expression of OB would act to increase body weight, as wouldinfluences that decreased sensitivity to the encoded protein. The spécifie moléculesthat regulate the level of expression of the OB gene are as yet unknown, and awaita détermination of the level(s) of gene control that leads to quantitative variation inthe level of OB RNA, and an examination of the regulatory éléments of the OB gene.The identification of the molécules that regulate the expression of the OB gene inadipocytes, and those that médiate the effects of the encoded protein at its site(s) ofaction, will greatly enhance our understanding of the physiologie mechanisms that regulate body weight. 139 010596 EXAMPLE 10: RNA Expression Pattern and Mapping on the Physical,Cytogenetic. and Genetic Maps of Chromosome 7 OB RNA is expressed at high levels in human adipose tissue, and at substantially 5 lower levels in placenta and heart. The human OB gene maps to a large yeastaitificial chromosome (YAC) contig derived from chromosome 7q31.3. In additionto confirming the relative location of the gene based on mouse-human comparativemapping, this study has identified 8 established microsatellite markers in closephysical proximity to the human OB gene. Since mutations in mouse OB can resuit 10 in a syndrome that closely resembles morbidobesity in humans, these genetic markersrepresent important tools for studying the possible rôle of the OB gene in inheritedforms of human obesity. 15

Materials and Methods ΐ

Northern Blot Analysis.

Total RNA was prepared from adipose tissue using the method of Chirgwin et al.,Biochem., 18:5294-5299 (1979). Northern blots, radiolabeling, and hybridizations 20 were performed as described (Zhang et al., 1994, supra}. Northern blots of polyA*RNA (human MTN, human MTN Π, and human fêtai MTN Π) were obtained fromCLONETECH (Palo Alto, CA), as were PCR primers used to generate theradiolabeled human actin probe. 25 STS Development.

Sequence tagged-site (STS)-specific PCR assays were developed and optimizedessentially as described [(Green et al., PCR Methods Applic., 1991; Green et al.,Genomics, 11:548-564 (1991); Green, "Physical mapping of human chromosomes:génération of chromosome-specific sequence-tagged sites", in Methods in Molecular 30 Genetics Vol. 1, Gene and Chromosome Analysis (Part A), pp. 192-210, Adolpbed., Academie Press, Inc., San Diego (1993); Green et al., Hum. Mol. Genet., 140 010596 3:489-501 (1994)]. Each STS is named using the prefix ‘sWSS’ foUowed by a uniquenumber. Details about the 19 STSs reported here are provided in Table 3, withadditional information (e.g., PCR reaction conditions, complété DNA sequence)available in GenBank and/or the Genome Data Base (GDB). For the microsatellite- 5 spécifie STSs, the oligonucleotide primers used in the PCR assays (Table 3)corresponded either to those employed for génotype analysis (Table 4), or thosedesigned (most often with the computer program OSP) [Hillier et al., PCR MethodsApplic., 1:124-128 (1991)] using the DNA sequence available in GenBank. Table 3illustrâtes STSs in the YAC contig containing the human OB gene 10 ΓΊ ό ο Ο 1^1

Zl cl es ΓΊ

O

"T — CM’T *9·

Γ*. TtT ”T 010596 r* -y es en y? τ

(N i V“> V-Ί m en Γγ r-

O en ά

O

O -y

O -y *y

©S ΡΊ

oO oo C"·.

<M U*i g Γ*

A

O m 6 o

C "y

CM v> en Ύ Ô

O en m-

t"* DÛV ''T

Os oV en — CMen en <n en Ό *C ZI Z Z)

f" 00 Cs O en en en Ό

en en

O

KO 00 rr 0 U y U· y c •x u u «e 83 «I T3 c υ Σ s U Λ *2 .y .2 U < <e y C y y c V >- J ü Ü ü •a

D

C ü

C en 00 «•4

CM

CO r* Û v

B

O < <

O <

D

H

O < <

O < υ f- < < < < υ υ

O 1) c

V <

U <

O

H

U

H <

H < < □ < < < <

O < Ü t—

U

U <

O £ t— « £ < fc

< G < U. 2 5 < ί- ο <

B

U •o c ω y t£> S — c U Σ y •5 c ω u U U y u < < < c y < >- >- > U > Ό 00 en XJ· \o rr Ό O Os ’Φ r* 00 r- 00 o 00 Os r· Ό OO ’y 00 CM co r* £ V) r* Ό co Γ" •M v> t- co F- CM CO f» un co r*. CM co Ω Q Û Û û Q Û Ω Ω o

Os fcû je M &amp; en en >» KO CM Os O O CM «3 83 en en S S Σ H U. U. LU □ < < < x oo

CM

S u. < ©s *τ

CO co en 00 00

CO co

On en en

CM V)

CO

\O en en

CM

CO

CO 00

••M

CM

CO

CO te

CM

O co

CO

Os

Os

Os

«O

CO en r* co r* co co Ό

O

CM <0

CO iq-2. 010596 σ ω

CO

Z £ es

C

C

CM tn xn

*T

C

O ü οχ <Z1

CM V“i νΊ © o

O U* » r* o m cm V* xç r· o

Ox ΓΊ

CM Ό

xO

Tf

xO xa ΌΌ 50 r* 00

sO o

xO o r* m v-> Ό Ό

CM

xA V“) o w-k

CM t ”± rx co

O

O

O o «a cm xn χ/Ί « g □ — CM Cï •’T XA Ό r* r* r» r* r* r*

r- « Ά

CO 3 O <s co * * en Ό CO o xa co c r* < r* r* •J o a. û Q en XO Ά -o- XA r» Ox Ox 00 C0 CO CO t" es r» Γ"* O O û Û

COI « <1

fci

O

Ox o =t *a ’Ct *3

S u. < 00 ©0 xa

CM co co % CM 00 Ox Ox 00 Ox 'XJ· cm Ό o n VA s O en 00 •-«M •M CM •*T cm CO co CO CO C0 CO CO CO . . co CO £9 CO CO co &amp; CO £ «0 £ C0 * «0 £ «0 £ «0 £ 00 143 01 0596

The 19 chromosome 7-specific STSs mapped to the YAC contig containing the humanOB gene (Figure 35) are listed. In each case, the designated ‘sWSS’ name, relevantalias, GDB-assigned locus name, STS source, PCR primer sequences, STS size, andGDB identification number are indicated. The sources of STSs are as follows: ‘YACEnd’ (isolated insert end of a YAC) (Green, 1993, supra), ‘Lambda Clone’ (randomchromosome 7-specific lambda clone) (Green et al. 1991, supra; Green, 1993, supra),‘Genetic Marker’ (microsatellite marker, see Table 2) (Green et al. 1994, supra),‘YAC Insert’ (random segment from YAC insert), and ‘Gene’ (gene-specific STS).Note that for some genetic marker-specific STSs, the PCR primers used foridentifying YAC s (listed in this table) are different from those used for performinggénotype analysis (Table 4), since the détection of YACs containing a genetic markerdoes not require amplification of the polymorphie tract itself. AU of the indicatedPCR assays utilized an annealing température of 55°C, except for sWSS494,sWSS883, sWSS1529, and sWSS2619 (which used 50°C), sWSS999 and sWSS1174(which used 60°C), and sWSS808 (which used 65°C). Additional. details regardingthe STS-specific PCR assays are available in GDB. 144 010596

Z

O

CS û

P Ό en en en T o © rr © OÙ O ’V 00 CS CS CS CS CS es P^ p» g 00 Os 00 ΓΊ en 00 Os CO en ’T CS — ·—· 6 © © ô O © © O O o © © O © O u ü □ U □ o V> t- n έ □

Table 4

Microsatellite markers in the YAC contig containing the huinan ob gene. ω q o| 75 — 2| f”· ΟΘΓ* Γ*

O 00 — <sOÛ 00 00 00 vt Ό00 00 Γ» 0000 00 CA O00 Os — CSθ' Os o U f t < < < < P P t P < U p o < P b P < < F F o P < f p P P F H < P < f- « < F < o Z F o < P P < < g p r* F p F F F < p P p < P < p O < f p P p P F P p F < p < < H P P P U u. < P ü P F < P F P F P P < P < < p < F < 5 p F P P P < < p < P F ü < F < F F P P P P p < P < P P < F < P p P P P p < P F p P < P F P < O P P F < P H < P p p F P P P < < P P P F P < P h* P < H f-

H

O <

O p o u

P

U

U r

O « OU <££ p «p <U- ï— p 2□ f H u P F< Pρ ph ou υh o 5

U < £ υ < < < u < υ « υ < ο <

U $ < ô pP 52 00 ΓΊ •s* 1/S Os p* o Tf V"1 P* »1 00 00 oo ·"· n o 00 3 ·* ** Ό vn Ό VA O 75 75 75 75 75 75 75 75 ci P· r* p* p- P* p* p- J û Q Û O Q Û Û Q SI •i c Z** Z“\ c z~* X c Z*» z«î 9 h < < < < < < < H £ U 5i P Q y. U s-z P V-/ <5 E Os oo Ξ £ £ CS « N £ 2 o 2 7"» Ά >» X K >2 SO CS Os 00 Os ha 00 O «—I O o Os 7 _w CS « « en n CS «M ÎJ (2 Σ 2 Σ 2 s S r· u. u. u. u. u. Ua Σ O < < < < < < O\ υ

S V-i < 145 010596

The eight microsatellite markers mapped to the YAC contig containing the human OBgene (Figure 35) are listed. In each case, the marker name (indicated as the alias inTable 3), type of microsatellite motif (tetranucleotide- ‘Tetra’ repeat or (CA)a repeat),GDB-assigned locus name, primer sequences utilized for PCR-based génotypeanalysis, and GDB identification number are indicated. Additional details regardingthe PCR assays and the polymorphisms are available in GDB.

The human GS-specific STS (sWSS2619) was designed using DNA sequence obtainedfrom the 3’ untranslated région of the cDNA. The human Pax4-spécifie STS(sWSS808) was developed using the following strategy. Oligonucleotide primersspécifie for the mouse Pax4 gene (GGCTGTGTGAGCAAGATCCTAGGA) (SEQIDNO:63) and (GGGAGCCTTGTCCTGGGTACAAAG) (SEQ ID NO:93) [Walther etal., 1991, Genomics 11:424-434) (1991)] were used to amplify a 204-bp fragmentfrom human genomic DNA (which was the same size product as that generated frommouse genomic DNA). This PCR assay was not suitable for identifyingcorresponding YACs, since a similarly-sized (200-bp) product was also amplifiedfrom yeast DNA. However, DNA sequence analysis of the PCR product generated.from human DNA revealed substitutions at 20 positions among the 156 bases analyzed(data not shown). Using this human-specific sequence, a new primer(TTGCCAGGCAAAGAGGGCTGGAC) (SEQ ID NO:64) was designed and usedwith the first of the above mouse Pox4-specific primers (see Table 3). The resultinghuman Pûx4-specific PCR assay did not amplify a significant product from yeastDNA and was thus used for identifying corresponding YACs.

Identification ο/YACs by PCR-based screening.

Most of the YACs depicted in Figure 35 were derived from a collection of cloneshighly enriched for human chromosome 7 DNA (the ‘chromosome 7 YAC resource’)(Green et al., 1995, supra) using a PCR-based screening strategy [Green ét al. , 1995,supra-, Greena et al., Proc. Natl. Acad. Sel. USA, 87:1213-1217 (1990)]. In afewcases, clones were isolated by PCR-based screening (Greena et al., 1990, supra) ofavailable total human genomic YAC libraries constructed at CEPH [Dausset et al., h6 010596

Behring Inst, Mitt., 91:13-20 (1992); Albertsen étal., Proc. Natl. Acad. Sci. USA,87:4256-4260 (1990)] or ICI [Anand et al., Nucl. Acids Res., 17:3425-3433 (1989);Anand et al., Nucl. Acids Res. 18:1951-1956 (1990)]. Each Y AC is named using theprefix ‘yWSS’ followed by a unique number.

Results and Discussion

Examination of the tissue expression of the human OB gene by Northern blot analysisrevealed that OB RNA is expressed at a high level in human adipose tissue and muchlower levels in placenta and heart (Figure 34). The size of the RNA (approximately 4.5 kb) was équivalent in human and mouse as well as in each of the expressingtissues. In these studies, five-fold higher signais were seen in 10 μξ of total adiposetissue RNA, as in 2 of polyA* placental RNA. A five-fold lower signal was seenin polyA+ RNA from heart compared to placenta. It is estimated that the level of OBRNA is approximately 250-fold lower in placenta than in adipose tissue. In thisexperiment, OB RNA was not detected in any of the other tissues analyzed, includingbrain, lung, liver, skeletal muscle, kidney, and pancréas. Additional experiments did.not reveal OB RNA in spleen, thymus, prostate, testis, ovary, small intestine, colon, "’peripheral blood leukocytes, or in fêtai brain, liver, or kidneys (data not shown). Itis possible that OB is expressed at an undetectable level (by Northern blot analysis)in these latter tissues or in other tissues that were not studied. The observed patternof expression in human differs somewhat from mouse, in which OB RNA is detectedalmost exclusively in adipose tissue.

Comparative mapping ofthe OB gene région in the mouse and human genomes. Themouse OB gene is located on proximal chromosome 6 in a région homologous witha portion of human chromosome 7q. Genes within this segment include (fromproximal to distal): the Met protooncogene, the cystic fibrosis transmembraneconductance regulator (Cftr), paired box-containing gene 4 (Pax4), OB, andcarboxypeptidase A (Cpa) (Zhang et al., 1994, supra", Friedman et al., 1991, supra).In the mouse, genetic mapping was used to demonstrate that Pax4 is tightly linked toob [Walther et al., 1991, supra\ Zhang et al., 1994, supra]. The physical distance 147 0 1 0 5 9 6 between OB and Pax4 was found to be approximately one megabase pairs (Mb)(Zhang et al. 1994, supra). Based on these comparative mapping studies, it wasexpected that the human OB gene would résidé between Pax4 and CPA onchromosome 7q. Furthermore, since human CFTR [Heng et al., Cell Genet.,62:108-109 (1993)] and Pax4 [Tamura et al., Cytogenet. Cell Genet., 66:132-134(1994)] were mapped by fluorescence in situ hybridization (FISH) to 7q31.3 and7q32, respectively, the most likely cytogenetic position of the human OB gene wouldbe in the vicinity of the 7q31.3-q32 boundary.

Mapping the OB gene on human chromosome 7.

An STS (sWSS2619) amplifying a small segment of the S’^untranslated région of thehuman OB gene was used to screen a collection of YAC clones that is highly enrichedfor human chromosome 7 DNA (Green et al., 1995a, Genomics 25: 170-183), and9 YACs were identified (yWSS69l, yWSS1332, yWSS1998, yWSS2087, yWSS3319,yWSS3512, yWSS4875, yWSS4970, and yWSS5004). To verify that these YACscontain the authentic human OB gene, two additional experiments were performed. .First, each of the YACs was tested with a second human OS-specific PCR assay, and 'ail were found to be positive (data not shown). Second, yeast DNA from each clonewas digested with EcoRI and analyzed by gel-transfer hybridization, using a humanOB cDNA-derived probe. In ail instances, a single hybridizing band was seen; andthis band was the same size in the YACs and a PI clone known to contain the humanOB gene (data not shown).

Using the computer program SEGMAP (Green and Green, 1991, supra) and otherYAC-based STS-content data that we hâve generated for chromosome 7 (Green et al.1991, supra·, Green et al. 1994, supra; Green et al. 1995, supra), the human OBgene was found to résidé within the YAC contig depicted in Figure 35. Specifically,this contig consists of 43 overlapping YACs and 19 uniquely-ordered STSs. Detailsabout each of the 19 STSs are provided in Table 3. In addition to the <95-specificSTS, the contig also contains an STS (sWSS808) spécifie for the human Pax4 gene(Tamura et al. 1994, supra; Stapleton et al., 1993, Nature Genet. 3:292-298), 7 STSs 148 01 0596 derived from chromosome 7-specific YACs, 2 STSs derived from chromosome 7-specific lambda clones, and, importantly, 8 microsatellite-specifïc STSs. Additionaldetails about these 8 genetic markers, including sequences of the primers used forgénotype analysis, are provided in Table 2. Of note, there is redundant YAC-basedconnectivity throughout the contig (i.e., there are 2 or more YACs connecting eachadjacent pair of STSs), lending strong support for the relative order of STSs shownin Figure 35.

As depicted in Figure 35, the predicted orientation of the human OB-containing YACcontig is such that sWSS1734 is the centromeric-most STS (i.e., closest to CFTR)whereas sWSS2367 is the telomeric-most STS (i.e., closest to CPA). This orientationis predominantly based on comparative mapping data, which places Pax4 proximaland OB distal within the syntenic block présent in mouse and human DNA (Zhanget al. 1994, supra). The OB gene maps near the telomeric end of the contig, basedon the placement of the OB-specific STS (sWSS2619).

While the contig shown in Figure 35 was deduced by SEGMAP without considérationof YAC sizes (thereby displaying STSs équidistant from one another), a similaranalysis of the data by SEGMAP that accounted for YAC sizes indicated that the totalsize of the région covered by the contig is just over 2 Mb (data not shown). Thus,while ail 8 of the microsatellite-specifïc STSs (Table 4) are contained within agenomic interval spanning roughly 2 Mb, the 3 closest to the telomeric end of thecontig (sWSS1392, sWSS1148, and sWSS2367) are particularly close to the OB geneitself (perhaps within an interval as small as approximately 500 kb). In fact, ail 3 ofthe latter STSs are présent in at least 1 of the human OB-containing YACs. Of note,the interval between human Pax4 (sWSS808) and ob (sWSS2619) is estimated to beapproximately 400 kb, whereas this région was predicted to span approximately 1 Mbin mouse (Zhang et al., 1994, supra). Finally, 3 of the YACs within the contig(yWSS691, yWSS999, and yWSS2935) hâve also been analyzed by FISH, and eachwas found to hybridize exclusively to 7q31.3. One of these YACs (yWSS691)contains the OB-specific STS, while the other 2 clones contain the Pox4-specific STS. 149 0 1 0 5 9 6

The latter results are generaUy consistent with the previous cytogènetic assignmentof human Pax4 to 7q32 (Tamura et al. 1994, supra). Based on these data, the humanOB gene can be assigned to cytogenetic band 7q31.3. 5 EXAMPLE 11 : Human OB Polypeptide is Biologically Active in Mice

Groups of 10 ob/ob mice were treated by i.p. injection with 10 ^g/g/day recombinant(bacterial) human and murine OB polypeptide or saline. After four days, the groupreceiving saline gained 0.3 g. The group receiving murine OB lost 3.2 g. The group 10 receiving human OB lost 2 g (p < .01 compared to saline Controls). These groupswere also tested for food intake. The data foFTood intake^ïre shown in Table 5; thedata for body mass are shown in Table 6.

Table 5

Food intake/day (g) of treated ob/ob mice (value ± S.Dev)

Treatment Day 0 Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7 saline 13.4 ±2.6 12.8 12.8 13.1 14.0 12.3 12.4 8.3 murine OB 14.9 3.7 4.4 5.1 8.9 8.1 8.7 3.5 human OB 14.3 10.3 8.7 7.0 8.9 5.3 3.8 13.0

Table 6

Body weight and weight change in treated ob/ob mice (value ± S.Dev)

Treatment Body Weight(Day 0) Body Weight(Day 4) Percentchange (Day 0 to 4) Body Weight(Day 6) Percent Change(Day 0 to 6) saline 39.9 ± 1.8 40.7 ± 1.6 0.8 ± 0.5 41.1 ± 2.2 1.2 ± 1.1 murine OB 39.5 ± 2.1 36.2 ± 2.0 -3.3 ± 1.2 36.3 ± 2.2 -3.1 ± 1.2 human OB 39.5 ± 2.0 37.6 ± 1.7 -2.0 ± 1.0 36.1 ± 1.3 -3.5 ± 1.3

These data demonstrate that human OB is biologically active in mice. EXAMPLF. 12: A High Dose of OB Affects Wild-type Mice 150 010596

Wild-type mice (C57B16J 4-/?) were treated with 10 Mg/g/day i-P- of recombinantmurine OB, and body mass was measured every four days. The results are shownin Table 7. 5 Table 7

Body mass (g) of normal mice receiving OB

Treatment Day 0 Day 4 Day 8 Day 12 Day 16 saline 22.6 + 1.4 22.2±1.2 22.5 ±1.3 23 22.5 murine OB 22.4 ±1.5 20.6 ±1.5 20.8 ±1.3 20.8 21.8

These data demonstrate that OB affects the bjg^y mass of v^ild-type as well as obese{ob/ob} mice, albeit to a much smaller degree. EXAMPLE 13: OB Polypeptide Administered Bv Continnous Pump Infusion 15

This example demonstrates that continuous infusion of OB polypeptide results inweight loss in normal mice. Normal (non-obese) mice were administered murineob polypeptide via osmotic pump infusion. A dosage of 0.5 mg protein/kg bodyweight/day resulted in a 4.62% loss (+/- 1.34%) from baseline weight by the 6th 20 day of infusion.

Materials and Methods

Animais

Wild type (+/+) C57B16 mice were used in this Example. Mice were 25 single-housed, and maintained under humane conditions. The âge of the mice at theinitial time point was 8 weeks, and the animais were weight stabilized. Ten micewere used for each cohort (vehicle vs. protein).

Feeding and weight measurement 30 Mice were given ground rodent chow (PMI Feeds, Inc.) in powdered food feeders(Allentown Caging and Equipment), which allowed a more accurate and sensitivemeasurement of food intake than use of regular block chow. Weight was measured 151 010596 at the same lime each day (2:00 p.m.). for a period of 6 days. Body weight on lheday prior to infusion was defined as baseline weight.

Cloning of Murine OB DNA

The cloning of the murine OB DNA for expression in E. coli was performed asfollows. The DNA sequence as deduced from the published peptide sequence thatappeared in (Zhang et al., 1994, supra, i.e, Example 1, supra) was reverse translatedusing E. coli optimal codons. The terminal cloning sites were Àfral to BamHX. Aribosomal binding enhancer and a strong ribosomal binding site were included in frontof the coding région. The duplex DNA sequence was synthesized using standardtechniques. Correct clones were confirmed by demonstrating expression of therecombinant protein and presence of the correct OB DNA sequence in the résidentplasmid. The amino acid sequence (and DNA sequence) is as follows:

Recombinant murine met OB (double stranded) DNA and amino acid sequence. (Seq.ED. NOS:94 and 95):

TCTAGATTTGAGTTITAACTTTTAGAAGGAGGAATAACATATGGTACCGATCCAGAAAGT 9 - + -- -- -- -- - + -- -- -- -- - + -- -- -- -- - + -- -- -- -- - + -- -- -- -- -4·····“"·*’ 68

AGATCTAAACTCAAAATTGAAAATCTTCCTCCTTATTGTATACCATGGCTAGGTCTTTCA Μ V P I Q K V -

TCAGGACGACACCAAAACCTTAATTAAAACGATCGTTACGCG'TATCAACGACATCAGTCA

AGTCCTCCTCTGGTŒTrGGAATTAATTTTGCTAGCAATGCGCATAGTTGCTGTAGTCAGT QDDTKT LIKTIVTRINDISH-

CACCCAGTCGGTCTCCGCTAAACAGCGTGTTACCGGTCTGGACTTCATCCCGGGTCTGCA

GTGGGTCAGCCAGAGGCGATTTGTCGCACAATGGCCAGACCTGAAGTAGGGCCCAGACGT TQSVSAKQRVTGLDFI P G L H -

CCCGATCCTAAGCTTGTCCAAAATGGACCAGACCCTGGCTGTATACCAGCAGGTGTTAAC 189 - +.........+.........+.........+.........+.........+-------- 248

GGGCTAGGATTCGAACAGGTTTTACCTGGTCTGGGACCGACATATGGTCGTCCACAATTG PILSLSKMDQTLAVYQQVLT-

CTCCCTGCCGTCCCAGAACGTTCTTCAGATCGCTAACGACCTCGAGAACCTTCGCGACCT 249 - +.........+.........+---------+ ---......+.........+-------- 308

GAGGGACGGCAGGGTCTTGCAAGAAGTCTAGCGATTGCTGGAGCTCTTGGAAGCGCTGGA 152 010596 SLPSQNVLQIANDLENLR-DL - GCTGCACCTGCTGGCATTCTCCAAATCCTGCTCCCTGCCGCAGACCTCAGGTCTTCAGAA309 - +.........+.........+.........+.........+......--- +.......- 363

CGACGTGGACGACCGTAAGAGGTTTAGGACGAGGGACGGCGTCTGGAGTCCAGAAGTCTT LHLLAFSKSCSLPQTSGLQK-

ACCGGAATCCCTGGACGGGGTCCTGGAAGCATCCCTGTACAGCACCGAAGTTGTTGCTCT369 --+---------- + -- -- -- — - + 42S

TGGCCTTAGGGACCTGCCCCAGGACCTTCGTAGGGACATGTCGTGGCTTCAACAACGAGA PESL DGVLEASLYSTEVVAL - GTCCCGTCTGCAGGGTTCCCTTCAGGACATCCTTCAGCAGCTGGACGTTrCTCCGGAATG429 - +---------+---------+ ·........+---------+ ---------+........489

CAGGGCAGACGTCCCAAGGGAAGTCCTGTAGGAAGTCGTCGACCTGCAAAGAGGCCTTAC SRLQGSLQDILQQLDVSPE.C - TTAATGGATCC489 ·+.........

AATTACCTAGG

Expression Vector and Ho si Strain.

The plasmid expression vector used to produce the protein was pCFM1656, AmericanType Culture Collection (ATCC) Accession No. 69576. The above DNA was ligatedinto the expression vector pCFM1656, which had been linearized with Xbal andZtomHI/and transformed into the E. coli host strain, FM5. E. coli FM5 cells werederived at Amgen Inc., Thousand Oaks, CA from E. coli K-12 strain [Bachmann etal., Bacieriol, Rev., 40:116-167 (1976)] and contain the integiated lambda phagerepressor gene, clw7 [Sussman et al., C.R. Acad. Sci., 254:1517-1579 (1962)].Vector production, cell transformation, and colony sélection were performed bystandard methods. e.g., Sambrook et al., 1989, supra. Host cells were grown in LBmedia.

Administration of Protein or Vehicle

Recombinant murine OB polypeptide was used for the présent experiments, generallyat a concentration of about 0.9 mg/ml phosphate buffered saline, pH 7.4. The aminoacid sequence (and DNA sequence) used is set out immediately above. Protein orvehicle (phosphate buffered saline, pH 7.4) were administered by osmotic pumpinfusion. Alzet osmotic minipumps (Alza, Palo Alto, CA, model no. 1007D) weresurgically placed in each mice in a subcutaneous pocket in the subscapular area. The 153 01 0596 pumps were calibrated to administer 0.5 ml protein in solution per hour for a dosageof 0.5 mg protein/kg body weight/day. Control animais were infused with phosphatebuffered saline (pH 7.4) via an Alzet osmotic minipump.

Fermentation Process. A three-phase fermentation protocol known as a fed-batchprocess was used to préparé the protein. Media compositions are set forth below.

Batch. A nitrogen and phosphate source were sterilized (by raising the températureto 122°C for 35 minutes, 18-20 psi) in the fermentation vessel (Biolafitte, 12 litercapacity). Upon cooling, carbon, magnésium, vitamins, and trace métal sources wereadded aseptically. An ovemight culture (rebours or more) of the above recombinantmurine protein-producing bacteria of 500 ml (grown in LB broth) was added to thefermentor.

Feed I. Upon reaching between 4.0-6.0 O.D.joo, Feed I was added to cultures. Theglucose was added at a limiting rate in order to control the growth rate (μ). Anautomated System (called the Distributive Control System) was programmed to controlthe growth rate at 0.15 générations hr'1.

Feed IL When the O.D. reached 30, the température was slowly increased to 42°Cand the feed was changed to Feed H, described below. The fermentation was thenallowed to continue for 10 hours with sampling every 2 hours. After 10 hours, thecontents of the fermentor were chilled to below 20 °C and harvested by centrifugation. 154

Media Composition: 010596

Batch:

Feed I:

Feed Π 10 g/L Yeast extract 5.25 g/L (NH4)2SO4 3.5 g/L k,hpo4 4.0 g/L kh2po4 5.0 g/L Glucose 1.0 g/L MgSO4*7H2O 2.0 ml/L Vitamin Solution 2.0 ml/L Trace Métal Solution 1.0 ml/L P2000 Antifoam 50 g/L Bacto-tryptone 50 g/L Yeast extract 450 g/L Glucose 8.75 g/L MgSO4*7H2O 10 ml/L Vitamin Solution 10 ml/L Trace Métal Solution 200 g/L Bacto-tryptone 100 g/L Yeast extract 110 g/L Glucose

Vitamin Solution (Batch, Feed I): 0.5 g biotin, 0.4 g folie acid, and 4.2 g riboflavin,were dissolved in 450 ml H2O and 3 ml 10 N NaOH, and brought to 500 ml withHjO. Fourteen grams of pyridoxine-HCl and 61 grams of niacin were dissolved 150ml HjO and 50 ml 10 N NaOH, and brought to 250 ml with H2O. Fifty-four gramsof pantothenic acid were dissolved in 200 ml H2O, and brought to 250 ml. The threesolutions were combined and brought to 10 liters total volume.

Trace Métal Solution (Batch, Feed I):

Ferrie Chloride (FeCl3-6H2O): 27 g/LZinc Chloride (ZnCl24H2O): 2 g/L 155 010596

Cobalt Chloride (CoCl: 6H:O): 2 g/L

Sodium Molybdate (NaMo042H;0): 2 g/L

Calcium Chloride (CaCl;-2H;O): 1 g/LCupric Sulfate (CuSO4‘5H;O): 1.9 g/LBoric Acid (H3BO3): 0.5 g/LManganèse Chloride (MnCl;4H2O): 1.6 g/LSodium Citrate dihydrate: 73.5 g/L

Purification Process for Murine OB polypeptide

Purification was accomplished by the following steps (unless otherwise noted, thefollowing steps were performed at 4°C):'~*" 1. Cell paste. E. coli cell paste was suspended in 5 times volume of 7 mM ofEDTA, pH 7.0. The cells in the EDTA were further broken by two passes througha microfluidizer. The broken cells were centrifuged at 4.2k rpm for 1 hour in aBeckman JB-6 centrifuge with a J5-4.2 rotor. “Ôi. 2. Inclusion body wash #1. The supematant from above was removed, and the pellet was resuspended with 5 times volume of 7 mM EDTA, pH 7.0, andhomogenized. This mixture was centrifuged as in step 1. 3. Inclusion body wash #2. The supematant from above was removed, and thepellet was resuspended in ten times volume of 20 mM Tris, pH 8.5, 10 mM DIT,and 1 % deoxycholate, and homogenized. This mixture was centrifuged as in step 1. 4. Inclusion body wash #3. The supematant from above was removed and thepellet wàs resuspended in ten times volume of distilled water, and homogenized. Thismixture was centrifuged as in step 1.

5. Refolding. The pellet was refolded with 15 volumes of 10 mM HEPES, pH 8.5, 1% sodium sarcosine (N-lauryl sarcosine), at room température. After 60minutes, the solution was made to be 60 mM copper sulfate, and then stirredovemight. 6. Removal of sarcosine. The refolding mixture was diluted with 5 volumes of10 mM Tris buffer, pH 7.5, and centrifuged as in step 1. The supematant was 156 01 0596 collected, and mixed with agitation for one hour with Dowex 1-X4 resin, 20-50 mesh,chloride form (at 0.066% total volume of diluted refolding mix). This mixture waspoured into a column and the eluant was collected. Removal of sarcosine wasascertained by HPLC. 7. Acid précipitation. The eluant from the previous step was collected, and thepH adjusted to pH 5.5, and incubated for 30 minutes at room température. Thismixture was centrifuged as in step 1. 8. Cation exchange chromatography. The pH of the supematant from the previous step was adjusted to pH 4.2, and loaded on CM Sepharose Fast Flow.Twenty column volumes of sait gradient were used at 20 mM NaOAC, pH 4.2, 0 Mtol.OMNaCl. ~ *

9. HIC chromatography. The CM Sepharose pool of peak fractions (ascertainedfrom ultraviolet analysis) from the above step was adjusted to be 0.2 M ammoniumsulfate. A 20 column volume reverse sait gradient was done at 5 mM NaOAc, pH 4.2, with 0.4 M to 0 M ammonium sulfate. This material was concentrated anddiafiltered into PBS.

Results

Presented below are the percent (%) différences from baseline weight in C57B16Jmice (8wks old):

Table 8

Weight Loss Upon Continuous Infusion

Time (davs) Vehicle (PBS) Recombinant OBDolvoeotide Days 1-2 3.24 +/- 1.13 1.68 +/- 1.4 Days 3-4 4.3 +/- .97 -2.12 +/- .79 Days 5-6 4.64 +/- .96 -4.62 +/- 1.3 157 010596

As can be seen, at the end of a 6 day continuous infusion régime, animaisreceiving the OB polypeptide lost over 4% of their body weight, as compared tobaseline. This is a substantially more rapid weight loss than has been observedwith intraperitoneal (i.p.) injection. Weight loss of only 2.6-3.0% was seen at theend of a 32-day injection period, in wild-type (normal) mice, with daily i.p.injections of recombinant murine OB polypeptide at a 10 mg/kg dose, and had notbeen more than 4% at any time during the dosing schedule (data not shown). Theprésent data indicate that with continuous infusion, a 20-fold lower dosage (0.5mg/kg vs. 10 mg/kg) achieves more weight loss in a shorter time period.

The results seen here are statistically signîTicant, e.g?T-4.62% with p <.0001.

EXAMPLE 14: Cloning and Expression of a Recombinant Human OB

Polypeptide Analog

This example provides compositions and methods for préparation of an analogrecombinant human version of the OB polypeptide.

The human version of OB DNA was constructed from the murine OB DNA, as inExample 13, above, by replacing the région between the Mlul and BamHl siteswith duplex DNA (made from synthetic oligonucleotides) in which 20 codonsubstitutions had been designed. Codons for arginine at mouse mature position35, and leucine at mouse mature position 74, were unchanged. The Mlul site isshown under the solid line in the sequence below. This DNA was put into thepCFM 1656 vector (ATCC Accession No. 69576), in the same fashion as therecombinant murine protein, as described above. 158 010596

Recombinant human met OB (Double-Stranded) DNA and amino acid sequence(Seq. ID. NOS:96 and 97)

CATATGGTACCGATCCAGAAAGTTCAGGACGACACCAAAACCTTAATTAAAACGATCGTT X - - — --------- + ,.-------4---------- + -- -- -- -- .+ 60 GTATACCATGGCTAGGTCTTTCAAGTCCTGCTGTGGTTTTGGAATTAATTTTGCTAGCAAMVPIQKVQDDTKTLI KTIV - ACGCGTATCAACGACATCAGTCACACCCAGTCGGTGAGCTCTAAACAGCGTGTTACAGGC61 ---------+---------+---------+---------+---------+---------4. 120

TGCGCATAGTTGCTGTAGTCAGTGTGGGTCAGCCACTCGAGATTTGTCGCACAATGTCCG

TRINDISHTQSVSS KQRVTG

CTGGACTTCATCCCGGGTCTGCACCCGATCCTGACCTTGTCCAAAATGGACCAGACCCTG121 ISO

GACCTGAAGTAGGGCCCAGACGTGGGCTAGGACTGGAACAGGTTTTACCTGGTCTGGGAC

LDFIPGLHPILTLSKMDQTL

GCTGTATACCAGCAGATCTTAACCTCCATGCCGTCCCGTAACGTTCTTCAGATCTCTAAC

CGACATATGGTCGTCTAGAATTGGAGGTACGGCAGGGCATTGCAAGAAGTCTAGAGATTG

AVYQQILTSMPSRNVLQISN

GACCTCGAGAACCTTCGCGACCTGCTGCACGTGCTGGCATTCTCCAAATCCTGCCACCTG

CTGGAGCTCTTGGAAGCGCTGGACGACGTGCACGACCGTAAGAGGTTTAGGACGGTGGAC , D L E N L R D L L H V L A F S K S C H L - CCATGGGCTTCAGGTCTTGAGACTCTGGACTCTCTGGGCGGGGTCCTGGAAGCATCCGGT301 ---------4.--------- + -- -- -- -- -4.--------- + -- -- -- -- - + -- -- -- -- -4. 360

GGTACCCGAAGTCCAGAACTCTGAGACCTGAGAGACCCGCCCCAGGACCTTCGTAGGCCA

PWASGLETLDSLGGVLEASG

TACAGCACCGAAGTTGTTGCTCTGTCCCGTCTGCAGGGTTCCCTTCAGGACATGCTTTGG 361 .........4·---------4----------+ --.....--4----------4·---------4· 420

ATGTCGTGGCTTCAACAACGAGACAGGGCAGACGTCCCAAGGGAAGTCCTGTACGAAACC

YSTEVVALSRLQGSLQDMLW CAGCTGGACCTGTCTCCGGGTTGTTAATGGATCC421 .........4-.........4-.........+ ---- 454

GTCGACCTGGACAGAGGCCCAACAATTACCTAGG QLDLSPGC*

Fermentation

Fermentation of the above host cells to produce recombinant human OBpolypeptide was accomplished using the conditions and compositions as describedabove for recombinant murine material. The results were analyzed for yield 159 010596 (grams/liter), pre-purification, of the recombinant human OB material (and minoramounts of bacterial protein), and correlated to analyze bacterial expression:

Table 9

Analysis of Human OB Polypeptide Expression

Timcpoint OD Yield Expression (@600 nm) (g/L) (mg/OD · L) lcd. + 2 hrs. 47 1.91 41 Ind. + 4 hrs. 79 9.48 120 Ind. + 6 hrs. 95 13.01 137 Ind. + 8 hrs. 94 m4 • Ind. + 10 hrs. 98 14.65 149 abbreviations: Ind. +_hours means the hours after induction of protein expression, as described in Example 13 for the recombinant murine material using pCFM 1656 O.D.: optical density, as measured by spectrophotometer milligrams per O.D. unit per liter mg/O.D. · L: expression in tenus of mg of protein per O.D. unit per liter.

Purification of the recombinant human ob polypeptide -¾.

Recombinant human protein may be purified using methods similar to those used forpurification of recombinant murine protein, as in Example 13, above. Forpréparation of recombinant human OB polypeptide, step 8 was performed by adjustingthe pH of the supematant from step 7 to pH 5.0, and loading this on to a CMSepharose fast flow column. The 20 column volume sait gradient was performed at20 mM NaOAC, pH 5.5, 0M to 0.5 M NaCl. Step 9 was performed by diluting theCM Sepharose pool four-fold with water, and adjusting the pH to 7.5. This mixturewas made to 0.7 M ammonium sulfate. A twenty column volume reverse saitgradient was done at 5 mM NaOAc, pH 5.5, 0.2 M to 0M ammonium sulfate.Otheiwise, the above steps were identical. EXAMPI.E 15: Dose Response Studies

An additional study demonstrated that there was a dose response to continuousadministration of OB protein. In this study, wild-type mice (non-obese, CD-I mice, 160 010596 weighing 35-40 g) were administered recombinant murine OB protein using methodssimilar to Examples 12 and 13. The results were as follows (with % body weight lostas compared to baseline, measured as above): 5 Table 10: Dose Response With Continuous Administration DOSE TIME % REDUCTION IN BODY WEIGHT 0.03 mg/kg/day Day 2 3.5% 1 mg/kg/day Day 2 7.5% 1 mg/kg/day Day 4 14%

As can be seen, increasing the dose from 0.03 mg/kg/day to 1 mg/kg/day increasedthe weight lost from 3.5% to 7.5%. It is also noteworthy that at day 14, the 1mg/kg/day dosage resulted in a 14% réduction in body weight. 15 EXAMPLE 16: Effects of Leptin on Body Composition of ob/ob Mice C57B1/6J ob/ob 16 week old mice were treated with 5 /xg/g/day of murine leptin,vehicle, or received no treatment for 33 days. In a second experiment, 7 week old 20 ob/ob mice were treated with 10 ^g/g/day of human leptin, murine leptin, or vehiclefor 12 days. The mice were sacrificed and total body weight, body composition,insulin levels, and glucose levels were evaluated. The data from these experimentsare reported in Table 11.

-H ,61 010596

-H © d 00 c c. x 'So ÛÛ

Body Weight, Composition, Insulin Levels, and Glucose Levels of Treated Mice ε- υ

J cm

-H

O

-H © o

CM en c •a c.

CM

V Ή

O vj r* d en-H -Ht** Ό-oo en© OΜ* Ό w-J <5O ~ +i ήm r·Γ* «Λ d —

© CM—« CM-H ΉO O

Os —.

00 00*- CM ©

CM

V oo d

CM

•H en wn

CM wn

-H wn en c ‘2 s-

X es 5 Σ 2

O u υ £ Ό c a o. 2 υ c

X 3 Σ

-H

O Ό

N

-H

O c* © ~ ^7 cm-H +i© ©en >OC Oken vn

V CM © -îΉ -H© o Ό O\ —

© —«H -H© ©cm ’-roo co— CM en d en

-H r- en en — enH -H© ©

C\ 00<M © +1 ï© ©oo en\o

CM

00 CM© TT +î Ή o ©© en\o ©—« wn O\ ©

CM

«H © d

"S C. 3

O

La

O

W

C

U

E 8

U

H

-C

.2F

*C £

X •g a 3 {2 55 fcfc 3 o

H >* «t ti- s e

S

U «1 £

E *»» 2 Ξ 'e** .5 2 (Λ

C 5 162 0 1 0596

The body composition data demonstrate the effect of ieptin on three compartments ofthe body: fat mass, lean body mass, and water mass. The date indicate that Ieptinsignificantly decreases body fat mass and has a marginal effect on lean body mass.However, the effects on lean body mass were not statistically significant. 5

Comparison of the insulin and glucose levels in Ieptin treated and control (untreated)mice indicates that Ieptin reduces blood sugar and insulin levels, and thus améliorâtesthese indicia of diabètes. 10 EXAMPLE 17: High Dose Effects of Leptin on Wild-type Mice

Lean Controls of the ob/ob mice (C57B1/6J+/?) were injected once a day i.p. with10 jxg/g murine leptin or vehicle (PBS), and body weight and food intake weremeasured over the next two weeks. There was a significant decrease in body weight 15 from day 4 onward and a significant decrease in food intake for the first week.However, after one week, the levels of food intake became indistinguishable betweenboth groups of mice. The animais were sacrificed at the end of the two weeks anâbody composition was determined. The results of the body composition analysis areshown in Table 12. The data show a decrease in body fat of the animais receiving 20 leptin versus the animais receiving PBS. 163 010596

Body Composition and Wcight of Wildtypc (+/?) Micc

010596 164 A second experiment showed the effects of twice a day i.p. injections of 12.5 Mg/gof murine leptin on wild-type C57B1/6J mice. There was a significant decrease inbody weight and food intake associate with twice daily injections of the polypeptide.For this experiment, the animais were placed in metabolic chambers. Food consistedof a powdered Purina #5001 chow diet. This diet differed from earlier experiments,which used the diet consisting of chow diet, tapioca, and water. Thus the food usedin the metabolic chambers had a higher calorie content, which explains why theamount of food consumed differs from those animais on the water-containing diet.

The following is a list of référencés related to the above disclosure and particularlyto the experimental procedures and discussions.

Bahary et al., Genomics, 11:33-47 (1991).

Bahary et al., Genomics, 13:761-769 (1992).

Bahary et al., Molecular mapping of mouse chromosomes 4 and 6: Use of aflow-sorted Robertsonian chromosome (1991).

Blank et al., Mammalian Genome, I:s51-s78 (1991).

Bogardus et al., Armais ofthe New YorkAcademy of Sciences, 630:100-115 (1991).

Friedman et al., Mammalian Genome, 1:130-144 (1991).

Harris, FASEB J., 4:3310-3318 (1990).

Jacobowitz et al., N. Engl. J. Med., 315:96-100 (1986).

Kessey, in Obesity, pp. 144-166, Stunkard ed., Philadelphia, W.B. Sauders Co.(1980). 165

Kessey et al., Ann. Rev. Psychol., 37:109-133.22 (1986). 010596

Leibel et al., "Genetic variation and nutrition in obesity: Approaches to the moleculargenetics of obesity’", in Genetic Variation and Nutrition, pp. 90-101.1, Simopoulosand Childs eds., S. Karger, Basel (1990).

Siegel et al., Cytogenet. Cell Genet., 61(3):184-185 (1992).

This invention may be embodied in other forms or carried out in other ways withoutdeparting from the spirit or essential characteristics thereof, The présent disclosureis therefore to be considered as in ail respects illustrative and not restrictive, thescope of the invention being indicated by the appended Claims, and ail changes whichcorne within the meaning and range of equivalency are intended to be embracedtherein.

Various references are cited throughout this spécification, each of which isincorporated herein by reference in its entirety.

The invention as claimed is enabled in accordance with the above spécification andreadily available references and starting materials. Nevertheless, Applicants hâve onAugust 9, 1995, made the following deposits with the American Type CultureCollection, 12301 Parklawn Drive, Rockville, MD, 20852-1178, U.S.A. in accordwith the régulations of the Budapest Treaty on the International Récognition of theDeposit of Microorganisms for the Purposes of Patent Procedure: E. coli H14harboring plasmid pETH14, accession No. 69880; and E. coli M9 harboring plasmidpETM9, accession No. 69879. 166 010596

SEQUENCE LISTING GENERAL INFORMATION :

(i) APPLICANT: THS ROCKEFELLER UNIVERSITE

<ii) TITLE OF INVENTION: MODULATORS OF BODY WEIGHT, CORRESPONDING NUCLEIC

ACIDS AND PROTEINS, AND DIAGNOSTIC AND THERAPEUTIC USES THEREOF (iii) NUMBER OF SEQUENCES: 99 (iv) CORRESPONDENCE ADDRESS : (A) ADDRESSES: Klauber &amp; Jackson (B) STREET: 411 Hackensack Avenue (C) CITY: Hackensack (D) STATE: New Jersey

(E) COUNTRY: USA (F) ZIP: 07601 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk(3) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: 08/483,211 (B) FILING DATE: June 7, 1995 (C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: 08/438,431 (B) FILING DATE: May 10, 1995 (C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: 08/347,563 (B) FILING DATE: November 30, 1994 (C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: 08/292,345 (B) FILING DATE: August 17, 1994 (C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION: (A) NAME: Jackson Esq., David A. (B) REGISTRATION NUMBER: 26,742 167 (C) REFERENCE/DOCKET NÜMBER: 600-1-087 PCT 010596 (ix) TELECOMMUNICATION INFORMATION: (A) TELEPHONE: 201 487-5800(3) TELEFAX: 201 343-1684 5 (C) TELEX: 133521 (2) INFORMATION FOR SSQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 2793 base pairs (3) TYPE: nucleic acid 10 , (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic)

(A) DESCRIPTION: Murine ob cDNA ----

(iii) HYPOTHSTICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Murine (ix) FEATURE:

(A) ΝΑΜΕ/ΚΞΥ: CDS 20 (B) LOCATION: 57..560 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: GGATCCCTGC TCCAGCAGCT GCAAGGTGCA AGAAGAAGAA GATCCCAGGG AGGAAA 56 ATG TGC TGG AGA CCC CTG TGT CGG TTC CTG TGG CTT TGG TCC TAT CTG Met Cys Trp Arg Pro Leu Cys Arg Phe Leu Trp Leu Trp Ser Tyr Leu 104 1 5 10 15 25TCT TAT GTT CAA GCA GTG CCT ATC CAG AAA GTC CAG GAT GAC ACC AAA 152 Ser Tyr Val Gin Al a Val Pro Ile Gin Lys Val Gin Asp Asp Thr Lys 20 25 30 ACC CTC ATC AAG ACC ATT GTC ACC AGG ATC AAT GAC ATT TCA CAC ACG 200 Thr Leu Ile Lys Thr Ile Val Thr Arg île Asn Asp Ile Ser His Thr 30 35 40' 45 CAG TCG GTA TCC GCC AAG CAG AGG GTC ACT GGC TTG GAC TTC ATT CCT 248 Gin Ser Val Ser Ala Lys Gin Arg Val Thr Gly Leu Asp Phe Ile Pro 50 55 60 GGG CTT CAC CCC ATT CTG AGT TTG TCC AAG ATG GAC CAG ACT CTG GCA 296 35 Gly Leu His Pro Ile Leu Ser Leu Ser Lys Met Asp Gin Thr Leu Ala 65 70 75 80 010596 168 GTC TAT CAA CAG GTC Val 85 CTC ACC AGC CTG CCT TCC CAA AAT GTG CTG CAG 344 Val Tyr Gin Gin Leu Thr Ser Leu Pro Ser Gin 90 Asn Val Leu 95 Gin ATA GCC AAT GAC CTG GAG AAT CTC CGA GAC CTC CTC CAT CTG CTG GCC 392 lie Al a Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Leu Leu Ala 100 105 110 TTC TCC AAG AGC TGC TCC CTG CCT CAG ACC AGT GGC CTG CAG AAG CCA 440 Phe Ser Lys Ser Cys Ser Leu Pro Gin Thr Ser Gly Leu Gin Lys Pro 115 120 125 GAG AGC CTG GAT GGC GTC CTG GAA GCC TCA CTC TAC TCC ACA GAG GTG 488 Glu Ser Leu Asp Gly Val Leu Glu Ala Ser Leu Tyr Ser Thr Glu Val 130 135 140 GTG GCT TTG AGC AGG CTG CAG GGC TCT CTG CAG GAC ATT CTT CAA CAG 536 Val Al a Leu Ser Arg Leu Gin Gly Ser LeuJSln Asp Ile Leu sk Gin Gin 145 150 155 160 TTG GAT GTT AGC CCT GAA TGC TGA AGTTTCAAAG GCCACCAGGC TCCCAAGA 588 Leu Asp Val Ser Pro Glu Cys * 165 ATCATGTAGA gggaagaaac CTTGGCTTCC AGGGGTCTTC AGGAGAAGAG AGCCATGTGC 648 20 ACACATCCAT CATTCATTTC TCTCCCTCCT GTAGACCACC CATCCAAAGG CATGACTCCA 708 CAATGCTTGA CTCAAGTTAT CCACACAACT TCATGAGCAC AAGGAGGGGC CAGCCTGCAG 768 AGGGGACTCT CACCTAGTTC TTCAGCAAGT AGAGATAAGA GCCATCCCAT CCCCTCCATG 828 TCCCACCTGC TCCGGGTACA TGTTCCTCCG TGGGTACACG CTTCGCTGCG GCCCAGGAGA 888 GGTGAGGTAG GGATGGGTAG AGCCTTTGGG CTGTCTCAGA GTCTTTGGGA GCACCGTGAA 948 25 GGCTGCATCC ACACACAGCT GGAAACTCCC AAGCAGCACA CGATGGAAGC ACTTATTTAT 1008 TTATTCTGCA TTCTATTTTG GATGGATCTG AAGCAAGGCA TCAGCTTTTT CAGGCTTTGG 1058 GGGTCAGCCA GGATGAGGAA GGCTCCTGGG GTGCTGCTTT CAATCCTATT GATGGGTCTG 1128 CCCGAGGCAA ACCTAATTTT TGAGTGACTG GAAGGAAGGT TGGGATCTTC CAAACAAGAG 1188 TCTATGCAGG TAGCGCTCAA GATTGACCTC TGGTGACTGG TTTTGTTTCT ATTGTGACTG 1248 33 ACTCTATCCA AACACGTTTG CAGCGGCATT GCCGGGAGCA TAGGCTAGGT TATTATCAAA 1308 AGCAGATGAA TTTTGTCAAG TGTAATATGT ATCTATGTGC ACCTGAGGGT AGAGGATGTG 1368 TTAGAGGGAG GGTGAAGGAT CCGGAAGTGT TCTCTGAATT ACATATGTGT GGTAGGCTTT 1428 TCTGAAAGGG TGAGGCATTT TCTTACCTCT GTGGCCACAT AGTGTGGCTT TGTGAAAAGG 1488 acaaaggagt TGACTCTTTC CGGAACATTT GGAGTGTACC AGGCACCCTT GGAGGGGCTA 1548 010596 169 AAGCTACAGG CCTTTTGTTG GCATATTGCT gagctcaggg AGTGAGGGCC CCACATTTGA 1608 GACAGTGAGC CCCAAGAAAA GGGTCCCTGG TGTAGATCTC CAAGGTTGTC CAGGGTTGAT 1668 CTCACAATGC GTTTCTTAAG CAGGTAGACG TTTGCATGCC AATATGTGGT TCTCATCTGA 1728 TTGGTTCATC CAAAGTAGAA CCCTGTCTCC CACCCATTCT GTGGGGAGTT TTGTTCCAGT 1788 ^GGAATGAGA AATCACTTAG CAGATGGTCC TGAGCCCTGG GCCAGCACTG CTGAGGAAGT 1848 GCCAGGGCCC CAGGCCAGGC TGCCAGAATT GCCCTTCGGG CTGGAGGATG AACAAAGGGG 1908 CTTGGGTTTT TCCATCACCC CTGCACCCTA TGTCACCATC AAACTGGGGG GCAGATCAGT 1968 GAGAGGACAC TTGATGGAAA GCAATACACT TTAAGACTGA GCACAGTTTC GTGCTCAGCT 2028 CTGTCTGGTG CTGTGAGCTA GAGAAGCTCA CCACATACAT ATAAAAATCA GAGGCTCATG 2088 KJTCCCTGTGGT TAGACCCTAC TCGCGGCGGT GTACTCCSCC acagcagcAc CGCACCGCTG 2148 GAAGTACAGT GCTGTCTTCA ACAGGTGTGA AAGAACCTGA GCTGAGGGTG ACAGTGCCCA 2208 GGGGAACCCT GCTTGCAGTC TATTGCATTT ACATACCGCA TTTCAGGGCA CATTAGCATC 2268 CACTCCTATG GTAGCACACT GTTGACAATA GGACAAGGGA TAGGGGTTGA CTATCCCTTA 2328 TCCAAAATGC TTGGGACTAG AAGAGTTTTG GATTTTAGAG TCTTTTCAGG CATAGGTATA 2388 15TTTGAGTATA TATAAAATGA GATATCTTGG GGATGGGGCC CAAGTATAAA CATGAAGTTC 2448 ΑΤΤΤΑΤΑΤΓΤ CATAATACCG TATAGACACT GCTTGAAGTG TAGTTTTATA CAGTGTTTTA 2508 AATAACGTTG TATGCATGAA AGACGTTTTT ACAGCATGAA CCTGTCTACT CATGCCAGCA 2558 CTCAAAAACC TTGGGGTTTT GGAGCAGTTT GGATCTTGGG TTTTCTGTTA AGAGATGGTT 2628 AGCTTATACC TAAAACCATA ATGGCAAACA GGCTGCAGGA CCAGACTGGA TCCTCAGCCC 2688 20 TGAAGTGTGC CCTTCCAGCC AGGTCATACC CTGTGGAGGT GAGCGGGATC AGGTTTTGTG 2748 GTGCTAAGAG AGGAGTTGGA GGTAGATTTT GGAGGATCTG AGGGC 2793 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTK: 168 amino acids(S) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) DESCRIPTION: Murine ob polypeptide 170 20 30 ίο 15 (X i) S EQUE NCE desc RIPTION: SEQ ID NO: 2 J Met 1 Cys Trp Arg Pro 5 Leu Cys Arg Phe Leu 10 Trp Leu Trp Ser Tyr 15 Leu Ser Tyr Val Gin 20 Al a Val Pro Ile Gin 25 Lys Val Gin Asp Asp 30 Thr Lys Thr Leu Ile 35 Lys Thr Ile Val Thr 40 Arg Ile Asn Asp Ile 45 Ser His Thr Gin Ser 50 Val Ser Al a Lys Gin 55 Arg Val Thr Gly Leu 60 Asp Phe Ile Pro Gly 65 Leu His Pro Ile Leu 70 Ser Leu Ser Lys Met 75 Asp Gin Thr Leu Ala 80 Val Tyr Gin Gin Val 85 Leu Thr Ser Leu Pro 90 Ser Gin Asn Val Leu 95 Gin Ile Al a Asn Asp 100 Leu Glu Asn Leu Arg 105 Asp Leu Leu His Leu 110 Leu Ala Phe Ser Lys 115 Ser Cys Ser Leu Pro 120 Gin Thr Ser Gly Leu 125 Gin Lys Pro Glu Ser 130 Leu Asp Gly Val Leu 135 Glu Ala Ser Leu Tyr 140 Ser Thr Glu Val Val 145 Al a Leu Ser Arg Leu 150 Gin Gly Ser Leu Gin 155 Asp Ile Leu Gin Gin 160 Leu Asp Val Ser Pro 165 Glu Cys * (2) INFORMATION FOR . SEQ ID NO:3 • 010596 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 700 base pairs (B) TYPE: nucleic acid (C) STRANDEDNSSS: double (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (A) DESCRIPTION: Human ob cDNA where N représente any nucléotide

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 171 (ix) FSATUKE: (A) ΝΑΜΞ/ΚΕΥ: CDS(S) LOCATION: 46..546 010596 (Xi) SSQUENCS DESCRIPTION: SEQ ID NO:3: .NNNGNNGTTG CAAGGCCCAA GAAGCCCANN NTCCTGGGAA GGAAA ATG CAT TGG> Mec His Trp 1 54 20 25 30 10 20 100 ACC CTG TGC GGA TTC TTG TGG CTT TGG CCC TAT CTT TTC ' Thr Leu Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu Phe ' 5 10 15 GCT GTG CCC ATC CAA AAA GTC CAA GAT GAC ACC AAA ACC Al a Val Pro Ile Gin Lys Val Gin Asp Asp Thr Lys Thr 25 30 ACA ATT GTC ACC AGG ATC AAT GAC ATT TCA CAC ACG CAG Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gin 40 45 Tcfc AAA CAG AAA GTC ACC GGT TTG GAC TTC ATT CCT GGG Ser Lys Gin Lys Val Thr Gly Leu Asp Phe Ile Pro Gly 55 60 65 ATC CTG ACC TTA TCC AAG ATG GAC CAG ACA CTG GCA GTC Ile Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Al a Val 70 Z 75 80 ATC CTC ACC AGT ATG CCT TCC AGA AAC GTG ATC CAA ATA Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gin Ile 85 90 95 CTG GAG AAC CTC CGG GAT CTT CTT CAC GTG CTG GCC TTC Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Al a Phe 105 110 TGC CAC TTG CCC TGG GCC AGT GGC CTG GAG ACC TTG GAC • Cys His Leu Pro Trp Al a Ser Gly Leu Glu Thr Leu Asp 120 125 î GGT GTC CTG GAA GCT TCA GGC TAC TCC ACA GAG GTG GTG • Gly Val Leu Glu Al a Ser Gly Tyr Ser Thr Glu Val Val 50 130 135 140 145 102 150 35 35 198 246 294 342 390 115 438 486 AGC AGG CTG CAG GGG TCT CTG CAG GAC ATG CTG TGG CAG CTG GAC CTCSer Arg Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu 150 155 160 534

AGC CCT GGG TGC TGAGGCCTT GAAGGTCACT CTTCCTGCAA GGACTNACGT

Ser Pro Gly Cys 165 585 172 010596

TAAGGGAAGG AACTCTGGTT TCCAGGTATC TCCAGGATTG AAGAGCATTG CATGGACACC

CCTTATCCAG GACTCTGTCA ATTTCCCTGA CTCCTCTAAG CCACTCTTCC AAAGG 645 700 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 167 amino acids ’ (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) DESCRIPTION: Human ob polypeptide , (vi) ORIGINAL SOURCE: Human (xi) SEQUENCE DESCRIPTION: SEQ ID_UO:4: Met 1 His Trp Gly Thr Leu Cys Gly Phe Leu Trp Leu 5 10 Trp Pro Tyr Leu15 Phe 15 Tyr Val Gin Ala Val Pro Ile Gin Lys Val Gin20 25 Asp Asp Thr Lys30 Thr Leu Ile Lys Thr Ile Val Thr Arg Ile Asn Asp35 40 Ile Ser His Thr 45 Gin Ser Val Ser Ser Lys Gin Lys Val Thr Gly Leu50 55 60 Asp Phe Ile Pro 20Gly 65 Leu His Pro Ile Leu Thr Leu Ser Lys Met Asp70 75 Gin Thr Leu Ala80 Val Tyr Gin Gin Ile Leu Thr Ser Met Pro Ser Arg85 90 Asn Val Ile Gin 95 Ile 25 Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu100 105 His Val Leu Ala110 Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly115 120 Leu Glu Thr Leu125 Asp Ser Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr130 135 140 Ser Thr Glu Val 30 Val145 Ala Leu Ser Arg Leu Gin Gly Ser Leu Gin Asp150 155 Met Leu Trp Gin160

Leu Asp Leu Ser Pro Gly Cys165 173 (2) INFORMATION FOR SEQ ID NO : 5 : 010596 [i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 166 ajnino acids(3) TYPE: amino acid . (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) DESCRIPTION: Murine ob polypeptide lacking Gin at position 49 (vi) ORIGINAL SOURCE: (A) ORGANISM: Murine 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Met 1 Cys Trp Arg Pro 5 Leu Cys Arg Phe Leu 10 Trp Leu Trp e* Ser Tyr 15 Leu Ser Tyr Val Gin 20 Ala Val Pro Ile Gin 25 Lys Val Gin Asp Asp 30 Thr Lys Leu Ile 35 Lys Thr Ile Val Thr 40 Arg Ile Asn Asp Ile 45 Ser His Thr Ser Val 50 Ser Ala Lys Gin Arg 55 Val Thr Gly Leu Asp 60 Phe Ile Pro Gly 20 Leu 65 His Pro Ile Leu Ser 70 Leu Ser Lys Met Asp 75 Gin Thr Leu Ala Val 80 Tyr Gin Gin Val Leu 85 Thr Ser Leu Pro Ser 90 Gin Asn Val Leu Gin 95 Ile Ala Asn Asp Leu 100 Glu Asn Leu Arg Asp 105 Leu Leu His Leu Leu 110 Ala Phe 25 Ser Lys Ser 115 Cys Ser Leu Pro Gin 120 Thr Ser Gly Leu Gin 125 Lys Pro Glu Ser Leu 130 Asp Gly Val Leu Glu 135 Ala Ser Leu Tyr Ser 140 Thr Glu Val Val 30 Ala 145 Leu Ser Arg Leu Gin 150 Gly Ser Leu Gin Asp 155 Ile Leu Gin Gin Leu 160

Asp Val Ser Pro Glu Cys165 174 010596 (2) INFORMATION FOR SEQ ID NO : 6 : (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 167 amino acids(3) TYPE: amino acid 5 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) Description: Human ob polypeptide lacking Gin at position 49 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Met 1 His Trp Gly Thr 5 Leu Cys Gly Phe Leu Trp10 Leu Trp Pro Tyr 15 Leu Phe Tyr Val Gin 20 Al a Val Pro Ile Gin 25 Lys -Val- Gin Asp Asp 30 Thr Lys Leu Ile 35 Lys Thr Ile Val Thr 40 Arg Ile Asn Asp Ile 45 Ser His Thr Ser Val 50 Ser Ser Lys Gin Lys 55 Val Thr Gly Leu Asp 60 Phe Ile Pro Gly o5 His Pro Ile Leu Thr 70 Leu Ser Lys Met Asp75 Gin Thr Leu Ala Val 80 Tyr Gin Gin Ile Leu 85 Thr Ser Met Pro Ser Arg90 Asn Val Ile Gin 95 Ile Ser Asn Asp Leu 100 Glu Asn Leu Arg Asp 105 Leu Leu His Val Leu 110 Ala Phe 2£er Lys Ser 115 Cys His Leu Pro Trp 120 Ala Ser Gly Leu Glu 125 Thr Leu Asp Ser Leu 130 Gly Gly Val Leu Glu 135 Ala Ser Gly Tyr Ser 140 Thr Glu Val Val 3$la 145 Leu Ser Arg Leu Gin 150 Gly Ser Leu Gin Asp155 Met Leu Trp Gin Leu 160

Asp Leu Ser Pro Gly Cys165 175 (2) INFORMATION FOR SSQ ID NO : 7 : 010596 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 175 base pairs(3) TYPE: nucieic acid (C) STRANDEDNSSS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (gencmic)(A) DESCRIPTION: exon 2G7

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GTGCAAGAAG AAGAAGATCC CAGGGCAGGA AAATGTGCTG GAGACCCCTG * TGTCGGGTCC 60 NGTGGNTTTG GTCCTATCTG TCTTATGTNC AAGCAGTGCC TATCCAGAAA GTCCAGGATG 120 ACACCAAAAG CCTCATCAAG ACCATTGTCA NCAGGATCAC TGANATTTCA CACACG 175 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs(3) TYPE: nucieic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) PCR 5' primer for exon 2G7

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 25 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CCAGGGCAGG AAAATGTG 18 30 35 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucieic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) PCR 3' primer for exon 2G7 176 010596

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9

CATCCTGGAC TTTCTGGATA GG 22 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 23 amino acids (3) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide # (A) DESCRIPTION: putative N-terminal signal peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Met Cys Trp Arg Pro Leu Cys Arg Phe Leu Trp Leu Trp Ser Tyr Leu15 10 15

Ser Tyr Val Gin Ala Val Pro (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 287 base pairs «η (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: circular (ii) MOLECULE TYPE: DNA (plasmid) (A) DESCRIPTION: pET-15b expression vector

25 (iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO ( ix) FEATURE: (A) NAME/KEY: T7 promoter (B) LOCATION: 20..37 30 (ix) FEATURE: (A) NAME/KEY: lac operator (B) LOCATION: 39..G4 177 010596 (ix) FEATUÆ:

(A) ΝΑΜΞ/ΚΕΥ : CDS (B) LOCATION : 108..24 3 (ix) FEATURE:

5 (A) NAMS/KEY

(B) LOCATION

His-Tag123 . .137 (ix) FEATURE: (A) ΝΑΜΞ/ΚΕΥ: Thrombin cleavage site (B) LOCATION: 184..196 10 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: AGATCTCGAT CCCGCGAAAT TAATACGACT CACTATAGGG GAATTGTGAG CGGATAACAA 60 TTCCCCTCTA CAAATAATTT TGTTTAACTT TAAGAAGGAG ATATACC ATG GGC AGC 116

Met Gly Ser 1 AGC CAT CAT CAT CAT CAT CAC AGC AGC GGC CTG GTG CCG CGC GGC AGC 164 Ser His His His His His His 10 Ser Ser Gly Leu Val Pro 15 Arg Gly Ser Ii) 5 CAT ATG CTC GAG GAT CCC GCT GCT AAC AAA GCC CGA AAG GAA GCT GAG 212 His Met Leu Glu Asp Pro Ala Ala Asn Lys Ala Arg Lys Glu Ala Glu 20 25 30 35 TTG GCT GCT GCC ACC GCT GAG CAA TAA CTA G CATAACCCCT TGGGGCCTCT 263 20 Leu Ala Ala Ala Thr Ala Glu Gin * 40 AAACGGGTCT TGAGGGGTTT TTTG 287 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: 25 (A) LENGTH: 45 amino acids (B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: 30

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro15 10 15

Arg Gly Ser His Met Leu Glu Asp Pro Ala Ala Asn Lys Ala Arg Lys20 25 30 35 Glu Ala Glu Leu Ala Ala Ala Thr Ala Glu Gin• 35 40 178 010596 (2) INFORMATION FOR SEQ ID NO:l3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs(3) TYPE: nucleic acid 5 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Murine 5' primer

(iii) HYPOTHETICAL: NO

1Q (iv) ΑΝΤΙ-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: CTTATGTTCA TATGGTGCCG ATCCAGAAAG TC 32 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: 15 (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) ' TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 20 (A) DESCRIPTION: Murine 3' primer

(iii) HYPOTHETICAL: NO (iv) ANTI-SENSE: Yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: TCCCTCTACA TATGTCTTGG GAGCCTGGTG GC 32 25(2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (3) TYPE: nucleic acid qn (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Human 5' primer 179 010596

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: TCTATGTCCA TATGGTGCCG ATCCAAAAAG TC 32 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 32 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Human 3' primer

(iii) HYPOTHSTICAL: NO (iv) ΑΝΤΙ-SENSE: Yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: TTCCTTCCCA TATGGTACTC CTTGCAGGAA GA 32 (2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 11 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (A) DESCRIPTION: Splice acceptor site in ob

25 (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (ix) FEATURE: (A) NAME/KEY: Splice acceptor site 11 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

30 AGCAGTCGGT A 180 010596 (2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS : (A) LENGTH: 16 amino acids (B) TYPE: amino acid(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (A) DESCRIPTION: ob peptide fragment (v) FRAGMENT TYPE: internai (vi) ORIGINAL SOURCE: (A) CRGANISM: Murine {Xi) SEQUENCE DESCRIPTION: SEQ ID NO:18: · «*

Val Pro Ile Gin Lys Val Gin Asp Asp Thr Lys Thr Leu Ile Lys Thr15 10 15 (2) INFORMATION FOR SEQ ID NO:19: 15 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 amino acids (B) TYPE: amino acid(D) TOPOLOGY: unknown 20 (ii) MOLECULE TYPE: peptide (A) DESCRIPTION: ob peptide fragment (v) FRAGMENT TYPE: internai (vi) ORIGINAL SOURCE: (A) ORGANISM: Murine (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

Leu His Pro Ile Leu Ser Leu Ser Lys Met Asp Gin Thr Leu Ala15 10 15 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid(D) TOPOLOGY: unknown (ii) MOLECULE TYPE: peptide (A) DESCRIPTION: ob peptide fragment (v) FRAGMENT TYPE : internai 181 010596 (vi) ORIGINAL SOURCE: (A) ORGANISM: Murine (xi) SEQUENCE DESCRIPTION: SEQ ID N0:20:

Ser Lys Ser Cys Ser Leu Pro Gin Thr Ser Gly Leu Gin Lys Pro Glu15 10 15

Ser Leu Asp (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 amino acids (3) TYPE: amino acid 1U (D) TOPOLOGY : unknown _ „ (ii) MOLECULE TYPE: peptide (A) DESCRIPTION: ob peptide fragment (v) FRAGMENT TYPE: Carboxyl terminal (vi) ORIGINAL SOURCE: (A) ORGANISM: Murine (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

Ser Arg Leu Gin Gly Ser Leu Gin Asp Ile Leu Gin Gin Leu Asp Val15 10 15 20 Ser Pro Glu Cys20 (2) INFORMATION FOR SEQ ID NO:22: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 414 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (A) DESCRIPTION: portion of the human ob gene including noncoding30 sequence upstream of first exon, coding sequence of first exon, and 5' région of first intron

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 35 (A) ORGANISM: Human 182 010596 (ix) FÈATURE:

(A) NAME/KEY: CDS (B) LOCATION: 38..181 (ix) FEATURE: 5 (A) NAME/KEY: 5' région of first intron (B) LOCATION: 182..414 (ix) FEATURE: (A) NAME/KEY: 5' noncoding sequence of the human ob gene from whichthe HOB lgF DNA primer was generated 10 (3) LOCATION: 11..28 {ix) FEATURE: (A) NAME/KEY: intronic sequence of the human ob gene from which the HOB lgR primer was generated(B) LOCATION: 241..260 — J* 15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: GG1TGCAAGG CCCAAGAAGC CCATCCTGGG AAGGAAA ATG CAT TGG GGA ACC CTG 55

Met His Trp Gly Thr Leu 1 5 TGC GGA TTC TTG TGG CTT TGG CCC TAT CTT TTC TAT GTC CAA GCT GTG 103 20 Cys Gly Phe Leu Trp Leu Trp Pro Tyr Leu Phe Tyr Val Gin Ala Val 10 15 20 CCC ATC CAA AAA GTC CAA GAT GAC ACC AAA ACC CTC ATC AAG ACA ATT 151

Pro Ile Gin Lys Val Gin Asp Asp Thr Lys Thr Leu Ile Lys Thr Ile 25 30 35 GTC ACC AGG ATC AAT GAC ATT TCA CAC ACG GTAAGGAGAG TATGCGGGGA 201 25 Val Thr Arg Ile Asn Asp Ile Ser His Thr 40 45 CAAAGTAGAA CTGCAGCCAG CCCAGCACTG GCTCCTAGTG GCACTGGACC CAGATAGTCC 261 . AAGAAACATT TATTGAACGC CTCCTGAATG CCAGGCACCT ACTGGAAGCT GAGAAGGATT 321 TTGGATAGCA CAGGGCTCCA CTCTTTCTGG TTGTTTCTTN TGGCCCCCTC TGCCTGCTGA 381 GATNCCAGGG GTTAGNGGTT CTTAATTCCT AAA 414 3θ (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS : (A) LENGTH: 48 amino acids (B) TYPE; amino acid(D) TOPOLOGY: linear 183 010596 (ii) MOLECULE TYPE: protein (A) DESCRIPTION: N-terminal portion of the human ob proteinencoded by first exon (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: 5 Met 1 His Trp Gly Th** 5 Leu Cys Gly Phe Leu 10 Trp Leu Trp Pro Tyr 15 Leu Phe Tyr Val Gin 20 Ala Val Pro Ile Gin 25 Lys Val Gin Asp Asp 30 Thr Lys 10 Thr Leu Ile 35 Lys Thr Ile Val Thr 40 Arg Ile Asn Asp Ile 45 Ser His Thr (2) INFORMATION FOR SEQ ID NO:24 : (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 801 base pairs (B) TYPE: nucleic acid

Ig (C) STRANDSDNESS: double (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (A) DESCRIPTION: portion of the human ob gene including 3' région offirst intron, coding sequence of second exon, and 3' 20 x noncoding sequence

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 25 (ix) FEATURE:

(A) NAME/KEY: CDS (B) LOCATION: 291..648 (ix) FEATURE: (A) NAME/KEY: 3' of first intron30 (B) LOCATION: 1..290 {ix) FEATURE: (A) NAME/KEY: intronic sequence of the human ob gene HOB from which the HOB 2gF primer was generated (B) LOCATION: 250..269 35 (ix) FEATURE: (A) NAME/KEY : 3 ' noncoding sequence of the human ob gene from which the HOB 2gR DNA primer was generated (B) LOCATION: 707..728 184 010596 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: CTGGTTCTTT CAGGAAGAGG CCATGTAAGA GAAAGGAATT GACCTAGGGA AAATTGGCCT 60 GGGAAGTGGA GGGAACGGAT GGTGTGGGAA AAGCAGGAAT CTCGGAGACC AGCTTAGAGG 120 CTTGGCAGTC ACCTGGGTGC AGGANACAAG GGCCTGAGCC AAAGTGGTGA GGGAGGGTGG 180 AAGGAGACAG CCCAGAGAAT GACCCTCCAT GCCCACGGGG AAGGCAGAGG GCTCTGAGAG 240 CGATTCCTCC CACATGCTGA GCACTTGTTC TCCCTCTTCC TCCTNCATAG CAG TCA Gin Ser 296 1 GTC TCC TCC AAA Lys CAG AAA GTC ACC GGT TTG GAC TTC ATT CCT GGG CTC 344 Val Ser Ser 5 Gin Lys Val Thr Gly10 Leu Asp Phe Ile 15 Pro Gly Leu CAC CCC ATC CTG ACC TTA TCC AAG ATG GAC CAG ACA CTG GCA GTC TAC 392 His Pro Ile Leu Thr Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr 20 25 30 CAA CAG ATC CTC ACC AGT ATG CCT TCC AGA AAC GTG ATC CAA ATA TCC 440 Gin Gin Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gin Ile Ser 35 40 45 50 AAC GAC CTG GAG AAC CTC CGG GAT CTT CTT CAC GTG CTG GCC TTC TCT 488 Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser 55 60 65 AAG AGC TGC CAC TTG CCC TGG GCC AGT GGC CTG GAG ACC TTG GAC AGC 536 Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser 70 75 80 CTG GGG GGT GTC CTG GAA GCT TCA GGC TAC TCC ACA GAG GTG GTG GCC 584 Leu Gly Gly Val Leu Glu Ala Ser Gly Tyr Ser Thr Glu Val Val Ala 85 90 95 CTG AGC AGG CTG CAG GGG TCT CTG CAG GAC ATG CTG TGG CAG CTG GAC 632 Leu Ser Arg Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp 100 105 110 CTC AGC CCT GGG TGC T GAGGCCTTGA AGGTCACTCT TCCTGCAAGG ACTACGTTAA 688

Leu Ser Pro Gly Cys 115 GGGAAGGAAC TCTGGCTTTC CAGGTATCTC CAGGATTGAA GAGCATTGCA TGGACACCCC 748

TTATCCAGGA CTCTGTCAAT TTCCCTGACT CCTCTAAGCC ACTCTTCCAA AGG 801 185 (2) INFORMATION FOR SEQ ID NO:25: 010596 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 119 amino acids (3) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) DESCRIPTION: C-terminal portion of the human ob proteinencoded by second exon (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

Gin Ser Val Ser Ser Lys Gin Lys Val Thr Gly Leu Asp Phe Ile Pro 1 5 10 15 10 Gly Leu His Pro Ile Leu Thr Leu Ser W- Met Asp Gin ♦» fff Thr Leu Ala 20 25 30 Val Tyr Gin Gin Ile Leu Thr Ser Met Pro Ser Arg Asn Val Ile Gin 35 40 45 Ile Ser Asn Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala 15 50 55 60 Phe Ser Lys Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu 65 70 75 80 Asp Ser / Leu Gly Gly Val Leu Glu Al a Ser Gly Tyr Ser Thr Glu Val 85 90 95 20 Val Al a Leu Ser Arg Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin 100 105 110 Leu Asp Leu Ser Pro Gly Cys 115 (2) INFORMATION FOR SEQ ID NO:26: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 8 amino acids (B) TYPE: amino acid(D) TOPOLOGY : unknown (ii) MOLECULE TYPE: peptide 3Q (v) FRAGMENT TYPE: internai (vi) ORIGINAL SOURCE: (A) ORGANISM: pichia yeast 186 010596 (xi) SEQUENCE DESCRIPTION: SSQ ID NO-.26:

Leu Glu Lys Arg Glu Ala Glu Ala1 5 (2) INFORMATION FOR SSQ ID NO:27: <i) SEQUENCE CHARACTERISTICS: 3 (A) LENGTH: 4 amino acids (3) TYPE: amino acid(D) TOPOLOGY : unknown (ii) MOLECULE TYPE: peptide 3.0 (v) FRAGMENT TYPE: internai (vi) ORIGINAL SOURCE: (A) ORGANISM: pichia yeast . (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

Glu Ala Glu Ala1 j$2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acids (B) TYPE: amino acid(D) TOPOLOGY: unknown 20 (ü) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: Internai (vi) ORIGINAL SOURCE : (A) ORGANISME pichia yeast 30 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: 25 Leu Glu Lys Arg1 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 187 010596 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: HOB lgF DNA primer generated frcm the 5' noncoding sequence of the human ob gene

(iii) KYPOTHETICAL: NO (iv) ΑΝΤΙ-SENSE: NO5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29: CCCAAGAAGC CCATCCTG 18 (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs 10 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear * (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: HOB lgR DNA primer generated from the first intronic sequence of the human ob gene

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30: GACTATCTGG GTCCAGTGCC 20 (2) INFORMATION FOR SEQ ID NO:31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid 25 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: HOB 2gF DNA primer generated from the first

intronic sequence of the human ob gene3Q (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO

CCACATGCTG AGCACTTGTT 20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31: &amp; (2) INFORMATION FOR SEQ ID NO:32: 188 010596 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs(S) TYPE: nucleic acid (C) STRANDEDNESS: single 5 (D) TOPOLOGY: linear * <ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: HOB 2gR DNA primer generated frcm the 3' noncodingsequence of the human ob gene

(iii) HYPOTHETICAL: NO

(iv) ANTI-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ IDJSO:32: CTTCAATCCT GGAGATACCT GG 22 (2) INFORMATION FOR SEQ ID NO:33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: SI base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double,{D) TOPOLOGY: circular

(ii) MOLECULE TYPE: DNA (A) DESCRIPTION: pPIC.9 cloning site

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:

25 CTCGAGAAAA GAGAGGCTGA AGCTTACGTA GAATTCCCTA GGCCGGCCGG G 51 (2) INFORMATION FOR SEQ ID NO:34: 30 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) PCR 5' primer for amplifying human ob cDNA sequence

(iii) HYPOTHETICAL: NO 189 010596

(iv) ΑΝΤΙ-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: GTATCTCTCG AGAAAAGAGT GCCCATCCAA AAAGTCCAAG 40 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) PCR 3' primer for amplifying human ob cDNA sequence

(iii) HYPOTKSTICAL: NO

(iv) ΑΝΤΙ-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: GCGCGAATTC TCAGCACCCA GGGCTGAGGT C 31 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 40 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) PCR 5' primer for amplifying murine ob cDNA sequence

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

GTATCTCTCG AGAAAAGAGT GCCTATCCAG AAAGTCCAGG 40 190 (2) INFORMATION FOR SEQ ID NO:37: 010596 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 31 base pairs(S) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear <ii) MOLECULE TYPE: DNA (primer) (A) PCR 3' primer for amplifying murine ob cDNA sequence

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: YES (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:

GCGCGAATTC TCAGCATTCA GGGCTAACAT C j» 31 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 4 amino acids (3) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) DESCRIPTION: tetrapeptide at N-terminus of renatured murineob protein after thrombin cleavage (vi) ORIGINAL SOURCE: (A) ORGANISM: Murine (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:

Gly Ser His Met (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS1734

(iii) HYPOTHETICAL: NO 191 010596

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39: CAAGACAAAT GAGATAAGG 19 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear — Ig?- (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS1734

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID N0:40: AGAGTTACAG CTTTACAG 18 20 25. (2) INFORMATION FOR SEQ ID N0:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS494

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 30 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human

CTAAACACCT TTCCATTCC 19 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41: 192 010596 (2) INFORMATION FOR SEQ ID NO:42: ( i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: single 5 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS494

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO .0 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO?42: TTATATTCAC TTTTCCCCTC TC 22 (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid(Ç) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS883

(iii) HYPOTHETICAL: NO 25

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:

TGCAGTAAGC TGTGATTGAG (2) INFORMATION FOR SEQ ID NO:44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 20 30 193 010596 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS883

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 5 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: GTGCAGCTTT AATTGTGAGC 20 (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: 10 (A) LENGTH: 18 base pairs r. (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 15 (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS2359

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 20 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: AGTGTTGTGT TTCTCCTG ’ 18 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: .25 (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 30 (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS2359

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human A* Λ· 194 0 1 0 5 9 6 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: AAAGGGGATG TGATAAGTG 19 (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: ' g (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS2336

(iii) HYPOTHETICAL: NO —•MJ’ 3?

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 25 (xi) SEQUENCE DESCRIPTION: SEQ ID N0:47: GGTGTTACGT TTAGTTAC 18 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs 20 (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS2336

25 (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:

3Û&amp;GAATAATGA GAGAAGATTG 20 195 010596 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs(S) TYPE: nucleic acid(C) STRANDEDNESS: single 5 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSSl218

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 10 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human —&amp; (xi) SEQUENCE.DESCRIPTION: SEQ ID NO:49: GCTCAACTGA CAGAAAAC 18 (2) INFORMATION FOR SEQ ID NO:50: 15 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single 20 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS1218

(iii) HYPOTHETICAL : NO

(iv) ΑΝΤΙ-SENSE: NO «g (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: GACTATGTAA AAGAAATGCC 20 (2) INFORMATION FOR SEQ ID NO:51: 30 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 196 010596 (xi) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS1402

(iii) KYPOTHSTICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE:b (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: AAAGGGCTTC TAATCTAC 18 (2) INFORMATION FOR SEQ ID NO:52: 10 (i) SEQUENCE CHARACTERISTICS: —«· -* (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 15 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS1402

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 20 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:

CCTTCCAACT TCTTTGAC 18 (2) INFORMATION FOR SEQ ID NO:53: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS999

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human a·

Z 197 0 1 0 5 9 6 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: TAAACCCCCT TTCTGTTC 18 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs 5 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer)

(A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS999lO

(iii) KYPOTHETICAL: NO —«ut*

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: TTGCATAATA GTCACACCC 19 (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 22 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer)

(A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS175125 (iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:

30 CCAAAATCAG AATTGTCAGA AG 22 010596 (2) INFORMATION FOR SEQ ID NO:56: (i) SEQUENCE. CHARACTERISTICS: (A) LENGTH: 20 base pairs (3) TYPE: nucleic acid(C) STRANDEDNESS: single 5 (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS1751

(iii) KYPOTHETICAL: NO (iv) ΑΝΤΙ-SENSE: NOl0 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: AAACCGAAGT TCAGATACAG 20 (2) INFORMATION FOR SEQ ID NO:57; (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (3) TYPE: nucleic acid(Ç) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence cagged-site spécifie PCR primer sWSS1174

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: AATATCTGAC ATTGGCAC 18 (2) INFORMATION FOR SEQ ID NO:58: 30 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 199 010596 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer 6WSS1174

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 5 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: TTAGACCTGA GAAAAGAG 18 (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: * (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS2061

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: GTTGCACAAT ACAAAATCC 19 (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: 25 (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 30 (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS2061

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human â* Λ 200 010596 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:

CTTCCATTAG TGTCTTATAG 20 (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS2588

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 15 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:

ATCACTACAC ACCTAATC 18 (2) INFORMATION FOR SEQ ID NO:62: 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS : single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS2588

25 (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:62:

30 CCATTCTACA TTTCCACC 18 201 010596 (2) INFORMATION FOR SEQ ID NO:G3: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 24 base pairs (3) TYPE: nucleic acid(C) STRANDEDNESS: single 5 (d) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS808

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 10 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NC>?63 : * GGCTGTGTGA GCAAGATCCT AGGA 24 (2) INFORMATION FOR SEQ ID NO:64: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 23 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS808

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO - (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:64: TTGCCAGGCA AAGAGGGCTG GAC 23 (2) INFORMATION FOR SEQ ID NO:65: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 30 â* Λ 202 0 1 0 5 9 6 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer 8WSS1392

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: ' 5 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:65: CTCAGGTATG TCTTTATC 18 (2) INFORMATION FOR SEQ ID NO:66: (i) SEQUENCE CKARACTERISTICS: \ lü (A) LENGTH: 18 base pairs * (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS1392

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 20 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:66:

TGTCTCTGCA TTCTTTTC 18 (2) INFORMATION FOR SEQ ID NO: 67: (i) SEQUENCE CHARACTERISTICS : 25 (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 30 (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS1148

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 203 010536 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:67: GACACATACA AACACAAG 18 g (2) INFORMATION FOR SEQ ID NO: 68: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (3) TYPE: nucleic acid(C) STRANDEDNESS: single 1Q (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-s.ite spécifie PCR primer sWSS1148

(iii) KYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 15 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:68:

ATTGAGTTGA GTGTAGTAG 19 (2) INFORMATION FOR SEQ ID NO:69: 20 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 25 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS1529

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:69:

CAGGGATTTC TAATTGTC 18 30 Λ· 204 010596 (2) INFORMATION FOR SEQ ID NO:70: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 18 base pairs (3) TYPE: nucleic acid 5 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSSl529

(iii) KYPOTKETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISE: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:70: AAAAGATGGA GGCTTTTG 18 (2) INFORMATION FOR SEQ ID NO:71: 15 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 20 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS2619

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 25 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:71:

CGTTAAGGGA AGGAACTCTG G (2) INFORMATION FOR SEQ ID NO:72: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 21 205 010596 <ix) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer SWSS2619

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 5 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:72: TGGCTTAGAG GAGTCAGGGA 20 (2) INFORMATION FOR SEQ ID NO:73: £0 (i) SEQUENCE CHARACTERISTICS : (A) LENGTH: 18 base pairs —* (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS404

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: 20 (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:73: ACCAGGGTCA ATACAAAG 18 (2) INFORMATION FOR SEQ ID NO:74: (i) SEQUENCE CHARACTERISTICS: 25 (A) LENGTH: 18 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 30 (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS404

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 206 010596 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:74: TAATGTGTCC TTCTTGCC 1Θ (2) INFORMATION FOR SEQ ID NO:75: (i) SEQUENCE CHARACTSRISTICS: * (A) LENGTH: 18 base pairs 5 (3) TYPE: nucleic acid (C) STRANDEDNSSS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) θ (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS2367

(iii) HYPOTHETICAL: NO (iv) ΑΝΤΙ-SENSE: NO * (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 5 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:75: CAATCCTGGC TTCATTTG 18 (2) INFORMATION FOR SEQ ID NO:76: / (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 base pairs 20 (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: sequence tagged-site spécifie PCR primer sWSS2367

25 (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:76:

30 AAGGTGGGTA GGATGCTA 18 207 010596 (2) INFORMATION FOR SEQ ID NO:77: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid 5 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker UT528

(iii) HYPOTKETICAL: NO

10 (iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NOTT): * TGCAGTAAGC TGTGATTGAG 20 15 (2) INFORMATION FOR SEQ ID NO:78: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base·pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single 20 (DZ) TOPOLOGY : linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker UT528

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 25 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:78: GTGCAGCTTT AATTGTGAGC 20 (2) INFORMATION FOR SEQ ID NO:79: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 208 010596 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFMaO6Szg9

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO c (vi) ORIGINAL SOURCE: , &amp; (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:79: AGCTTCAAGA CTTTNAGCCT 20 (2) INFORMATION FOR SEQ ID NO:80: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs —*"**' (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 15 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFMaO65zg9

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 20 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80:

GGTCAGCAGC ACTGTGATT 19 (2) INFORMATION FOR SEQ ID NO:81: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFMal25whl

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 30 209 010596 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 81

TCACCTTGAG ATTCCATCC 19 (2) INFORMATION FOR SEQ ID NO:82: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) 10 (A) DESCRIPTION: Marker AFMal25whl

(iii) HYPOTHETICAL: NO (iv) ΑΝΤΙ-SENSE: NO ***** (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:82: AACACCGTGG TCTTATCAAA 20 (2) INFORMATION FOR SEQ ID NO:83: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs 20 (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear iii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFM309yfl0

25 (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:83:

30 CATCCAAGTT GGCAGTTTTT 20 Λ* Λ 210 010596 (2) INFORMATION FOR SEQ ID NO:84: ( i) SEQUENCE.CHARACTERISTICS: (A) LENGTH: 20 base pairs (3) TYPE: nucleic acid(C) STRANDEDNESS: single 5 (D) TOFOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFM309yfl0

(iii) KYPOTHZTICAL: NO 10 (iv)

ΑΝΤΙ-SENSE

NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NOT84 :

AGATGCTGAA TTCCCAGACA 20 15 (2) INFORMATION FOR SEQ ID NO:85: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer)

(A) DESCRIPTION: Marker AFM218xflO

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO 25 (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:85:

TGGGCAACAC AGCAAA (2) INFORMATION FOR SEQ ID NO:86: 30 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (3) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear 16 211 010596 (ii) MOLECULE TYPE : DNA (primer)

(A) DESCRIPTION: Marker AFM218xflO

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NC 5{vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:86:

TGCAGTTAGT GCCAATGTCA 20 (2) INFORMATION FOR SEQ ID NO:87: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 16 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFM206xcl or

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO / (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:87:

CCAGGCCATG TGGAAC 16 (2) INFORMATION FOR SEQ ID NO:88: 25 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFM206xcl 30

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human 212 010596 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:80: AGTTCTTGGC TTGCGTCAGT 20 (2) INFORMATION FOR SEQ ID NO:89: (i) SEQUENCE CHARACTERISTICS:(A) LENGTH: 16 base pairs(S) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFM199xhl2 10

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:89:

TCTGATTGCT GGCTGC (2) INFORMATION FOR SEQ ID NO:90: (i) SEQUENCE CHARACTERISTICS: 20 (A) LENGTH: 17 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFM199xhl2 2.5 (iii) HYPOTHETICAL: NO (iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:90: 30

GCGCGTGTGT ATGTGAG 17 213 010596 (2) INFORMATION FOR SEQ ID NO:91: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 20 base pairs (3) TYPE: nucleic acid g (C) STRANDEDNESS: single (D) TCPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFMa345wc9

10 (iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID N'ÔTSl : * 15AGCTCTTGGC AAACTCACAT 20 (2) INFORMATION FOR SEQ ID NO:92: 20 (i) SEQUENCE CHARACTERISTICS: . (A) LENGTH: 20 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: Marker AFMa345wc9

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: Human (xi) SEQUENCE DESCRIPTION: SEQ ID NO:92:

GCCTAAGGGA ATGAGACACA 30 (2) INFORMATION FOR SEQ ID NO:93: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base pairs (B) TYPE: nucleic acid «r (C) STRANDEDNESS: single (D) TOPOLOGY: linear 20 Λ* ?· 214 (ii) MOLECULE TYPE: DNA (primer) (A) DESCRIPTION: primer for mouse Pax4 gene

(iii) HYPOTHETICAL: NO

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: ' 5 (A) ORGANISM: murine 0î0596 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:93:

GGGAGCCTTG TCCTGGGTAC AAAG 24 (2) 10 15 INFORMATION FOR SEQ ID NO:94: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 491 base pairs(S) TYPE: nucleic acid (C) STRANDEDNESS : double (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: cDNA (A) DESCRIPTION: Recombinant murine met ob

(iii) HYPOTHETICAL: NO /

(iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: murine (ix) FEATURE:

(A) ΝΑΜΞ/ΚΞΥ: CDS (B) LOCATION: 41..47Θ (xi) SEQUENCE DESCRIPTION: SEQ ID NO:94: 25 TCTAGATTTG AGTTTTAACT TTTAGAAGGA GGAATAACAT ATG GTA CCG ATC CAGMet Val Pro Ile Gin 1 5 55 AAA GTTLys Val CAG GAC GACGin Asp Asp 10 ACC AAA ACC TTA Leu ATT AAA ACG ATC GTT ACG CGT Thr Lys Thr Ile 15 Lys Thr Ile Val Thr 20 Arg ATC AAC GAC ATC AGT CAC ACC CAG TCG GTC TCC GCT AAA CAG CGT GTT Ile Asn Asp Ile Ser His Thr Gin Ser Val Ser Ala Lys Gin Arg Val 25 30 35 103 151 215 010596 ACC GGTThr Gly CTG Leu 40 GAC Asp TTC Phe ATC Ile CCG GGT CTG CAC His CCG Pro ATC île CTA Leu 50 AGC Ser TTG Leu TCC Ser 199 Pro Gly45 Leu AAA ATG GAC CAG ACC CTG GCT GTA TAC CAG CAG GTG TTA ACC TCC CTG 247 Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin Val Leu Thr Ser Leu 55 60 65 CCG TCC CAG AAC GTT CTT CAG ATC GCT AAC GAC CTC GAG AAC CTT CGC 295 Pro Ser Gin Asn Val Leu Gin Ile Ala Asn Asp Leu Glu Asn Leu Arg 70 75 80 85 GAC CTG CTG CAC CTG CTG GCA TTC TCC AAA TCC TGC TCC CTG CCG CAG 343 Asp Leu Leu His Leu Leu Ala Phe Ser Lys Ser Cys Ser Leu Pro Gin 90 95 100 ACC TCA GGT CTT CAG AAA CCG GAA TCC CTG GAC GGG GTC CTG GAA GCA 391 Thr Ser Gly Leu 105 Gin Lys Pro Glu Ser 110 Leu Asp Gly Val Leu*115 Glu Ala TCC CTG TAC AGC ACC GAA GTT GTT GCT CTG TCC CGT CTG CAG GGT TCC 439 Ser Leu Tyr Ser Thr Glu Val Val Ala Leu Ser Arg Leu Gin Gly Ser 120 125 130 CTT CAG GAC ATC CTT CAG CAG CTG GAC GTT TCT CCG GAA TGT TAATGGA 488 Leu Gin Asp Ile Leu Gin Gin Leu Asp Val Ser Pro Glu Cys 135 140 145 TCC 491 20 (2) INFORMATION FOR SEQ ID NO:95: (i) SEQUENCE CHARACTERISTICS: (A) LENGTK: 146 amino acids (B) TYPE: amino acid(D) TOPOLOGY: linear 25 (ii) MOLECULE TYPE: protein (A) DESCRIPTION: Recombinant murine met ob protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:95:

Met Val Pro Ile Gin Lys Val Gin Asp Asp Thr Lys Thr Leu Ile Lys15 10 15 30 Thr Ile Val Thr Arg Ile Asn Asp Ile Ser His Thr Gin Ser Val Ser20 25 30

Ala Lys Gin Arg Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro35 40 45 lie Leu Ser Leu Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin 35 50 55 60 •Y· ζ· 2ΐδ 01 0596

Val Leu Thr 65 Ser Leu Pro Ser Gin Asn Val Leu Gin Ile Ala Asn Asp 70 75 80 Leu Glu Asn Leu Arg Asp Leu Leu His Leu Leu Ala Phe Ser Lys Ser 85 90 95 Cys Ser Leu Pro Gin Thr Ser Gly Leu Gin Lys Pro Glu Ser Leu Asp 5 100 105 ' 110 Gly Val Leu Glu Ala Ser Leu Tyr Ser Thr Glu Val Val Ala Leu Ser 115 120 125 Arg Leu Gin Gly Ser Leu Gin Asp Ile Leu Gin Gin Leu Asp Val Ser 130 135 140 10 Pro Glu Cys 145 * (2) INFORMATION FOR SEQ ID NO:96: (i) SEQUENCE CHARAÇTERISTICS: (A) LENGTH: 454 base pairs (B) TYPE: nucleic acid(Cl STRANDEDNESS: double(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (A) DESCRIPTION: Recombinant human met ob /

(iii) KYPOTHETICAL: NO

20 (iv) ΑΝΤΙ-SENSE: NO (vi) ORIGINAL SOURCE: (A) ORGANISM: human (ix) FEATURE:

(A) ΝΑΜΞ/ΚΕΥ: CDS 25 (B) LOCATION: 4..444 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:96: CAT ATGMet 1 GTA CCG ATC CAG AAA GTT CAG GAC GAC ACC AAA ACC TTA ATT 48 Val Pro Ile Gin Lys Val Gin Asp Asp Thr Lys Thr Leu Ile 15 5 10 AAA ACG ATC GIT ACG CGT ATC AAC GAC ATC AGT CAC ACC CAG TCG GTG 96 Lys Thr Ile Val Thr Arg Ile Asn Asp île Ser His Thr Gin Ser Val 20 25 30 AGC TCT AAA CAG CGT GTT ACA GGC CTG GAC TTC ATC CCG GGT CTG CAC 144 Ser Ser Lys Gin Arg Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His 35 40 45 217 010596 CCG Pro ATC CTG ACC TTG TCC AAA ATG GAC CAG ACC CTGThr Leu GCT GTA TAC CAG Gin 192 Ile Leu50 Thr Leu Ser Lys Met 55 Asp Gin Ala 60 Val Tyr CAG ATC TTA ACC TCC ATG CCG TCC CGT AAC GTT CTT CAG ATC TCT AAC 240 fcln Ile Leu Thr Ser Mec Pro Ser Arg Asn Val Leu Gin Ile Ser Asn 65 70 75 GAC CTC GAG AAC CTT CGC GAC CTG CTG CAC GTG CTG GCA TTC TCC AAA 288 Asp Leu Glu Asn Leu Arg Asp Leu Leu His Val Leu Ala Phe Ser Lys 80 85 90 95 IOtcc TGC CAC CTG CCA TC-G GCT TCA GGT CTT GAG ACT CTG GAC TCT CTG 336 Ser Cys His Leu Pro Trp Ala Ser Gly Leu Glu Thr Leu Asp Ser Leu 100 105 110 GGC GGG GTC CTG GAA GCA TCC GGT TAC AGC ACC GAA GTT GTT GCT CTG 384 Gly Gly15 Val Leu 115 Glu Al a Ser Gly Tyr 120 Ser ThrGlu Val Val **· 125 Ala Leu TCC CGT CTG CAG GGT TCC CTT CAG GAC ATG CTT TGG CAG CTG GAC CTG 422 Ser Arg Leu Gin Gly Ser Leu Gin Asp Met Leu Trp Gin Leu Asp Leu 130 135 140 TCT 20 „Ser CCG GGT TGT TAATGGATCC 454 Pro Gly Cys 145 (2) INFORMATION FOR SEQ ID NO:97: 25 (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 147 amino acids (B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (A) DESCRIPTION: Recombinant human met ob protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:97: 30 Met Val Pro Ile 1 Gin Lys Val Gin Asp Asp Thr Lys Thr Leu Ile Lys5 10 15 Thr Ile Val Thr20 Arg Ile Asn Asp Ile Ser His Thr Gin Ser Val Ser25 30 35 Ser Lys Gin Arg35 Val Thr Gly Leu Asp Phe Ile Pro Gly Leu His Pro40 45 Ile Leu Thr Leu50 Ser Lys Met Asp Gin Thr Leu Ala Val Tyr Gin Gin55 60 Ile Leu Thr Ser65 Met Pro Ser Arg Asn Val Leu Gin Ile Ser Asn Asp70 75 80 218 010596

Leu Glu Asn Leu Arg Asp85 Leu Leu His Val 90 Leu Ala Phe Ser Lys 95 Ser Cys His Leu Pro 100 Trp Ala Ser Gly Leu 105 Glu Thr Leu Asp Ser 110 Leu Gly Gly Val Leu 115 Glu Al a Ser Gly Tyr 120 Ser Thr Glu Val, Val 125 Ala Leu Ser Arg Leu 130 Gin Gly Ser Leu Gin 135 Asp Met Leu Trp Gin 140 Leu Asp Leu Ser

Pro Gly Cys145 (2) INFORMATION FOR SEQ ID NO:98: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 21 amino acids (B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: N-terminal His-tag (xi) SEQUENCE DESCRIPTION: SEQ ID NO:98:

Met Gly Ser Ser Kis His His His His His Ser Ser Gly Leu Val Pro15 10 15

Arg Gly Ser His Met20 (2) INFORMATION FOR SEQ ID NO:99: (i) SEQUENCE CKARACTERISTICS: (A) LENGTH: 20 amino acids (B) TYPE: amino acid(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (v) FRAGMENT TYPE: N-terminal His-tag

Arg Gly

Ser Pro20 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:99:

Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro 15 10 15

Claims (62)

1. 219 010596 CLAIMS:

   1. An obesity (OB) polypeptide having about 145 to about 167 aminoacids, capable of modulating body weight in an animal, or allelic variants or analogs,including fragments, thereof having the same biological activity.
2. 2. An OB polypeptide of claim 1, comprising the amino acid sequence ofSEQ ID NOS: 2. 4, 5 or 6, or allelic variants or analogs, including fragments,thereof.
3. 3. An immunogenic fragment of an OB polypeptide according to claim 1 or 2.
4. 4. An immunogenic fragment of an OB polypeptide selected from thegroup consisting of : Val -Pro-Ile-Gln-Lys-Val-Gln-Asp-Asp-Thr-Lys-Thr-Leu-Ile-Lys-Thr (SEQ ID NO: 18); Leu-His-Pro-Ile-Leu-Ser-Leu-Ser-Lys-Met-Asp-Gln-Thr-Leu-Ala (SEQ ID NO: 19); Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Leu-Gln-Lys-Pro-Glu-Ser-Leu- Asp (SEQ ID NO: 20); and Ser-Arg-Leu-Gln-Gly-Ser-Leu-Gln-Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro- Glu-Cys (SEQ ID NO: 21).
5. 5. A human OB polypeptide analog according to claim 2 wherein one ormore amino acids selected from the group consisting of amino acids 53, 56, 71, 85,89, 92, 95, 98, 110, 118, 121, 122, 126, 127, 128, 129, 132, 139, 157, 159, 163,and 166 (according to the numbering of SEQ ID NO: 4) is substituted with anotheramino acid. 220 010596
6. 6. A human OB polypeptide analog according to claim 5 whereinsubstitution is with the divergent amino acid of the mouse OB polypeptide as set outin SEQ ID NO: 2.
7. 7. A human OB polypeptide analog according to claim 5 whereinsubstitution is with an alanine.
8. 8. A human OB polypeptide analog according to claim 5 selected from thegroup consisting of polypeptides wherein: (a) the serine residue at position 53 is substituted with glycine, alanine,vaîine, cysteine, méthionine, or threonine; (b) the serine residue at position 98 is substituted with glycine, alanine,valine, cysteine, méthionine, or threonine; and (c) the arginine residue at position number 92 is substituted withasparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine,threonine, méthionine, or cysteine.
9. 9. An OB polypeptide analog according to claim 2 having 83 percent orgreater amino acid sequence homology to the human OB polypeptide amino acidsequence set out in SEQ ID NOS: 2, 4, 5 or 6. 221 010596 10
10. 10. A human OB polypeptide analog according to claim 2 selected from thegroup consisting of polypeptides wherein: (a) one or more aspartic acid residues is substituted with glutamic acid; (b) one or more isoleucine residues is substituted with leucine; (c) one or more glycine or valine residues is substituted with alanine; (d) one or more arginine residues is substituted with histidine; (e) one or more tyrosine or phenylalanine residues is substituted withtryptophan; (f) one or more of residues 121 through 128 (according to the numberingof SEQ ID No:4) is substituted with glycine or alanine; and (g) one or more residues at positions 54 through 60 or 118 through 166(according to the number of SEQ ID NO: 4) is substituted with lysine, glutamic acid,cysteine, or proline.
11. 11. An OB polypeptide according to any of claims 1, 2, 3, 5, 6 or 9 selected from the group consisting of polypeptides: (a) having residues 1 through 21 deleted; and (b) polypeptides of subpart (a) having a methione at position 21, or havinga glycine-serine-histidine-methionine sequence SEQ ID NO: 38 at positions 18 20 through 21, or having a methionine-glycine-serine-serine-histidine-histidine-histidine- histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine- glycine-serine-histidine-methionine sequence (SEQ ID NO: 98) at positions 1 through 21. 222 010596
12. 12. An OB polypeptide according to any of daims 1, 2, 3, 5, 6 or 9selected from the group consisting of polypeptides: (a) having residues 1 through 21 deleted; and (b) polypeptides of subpart (a) having a leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26) at positions14 through 21, or having a glutamic acid-alanine-glutamic acid-alanine sequence (SEQID NO: 27) at positions 18 through 21, or having a leucine-glutamic acid-lysine-arginine sequence (SEQ ED NO: 28) at positions 18 through 21, or having amethionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-prolinesequence (SEQ ID NO: 99) at positions 2 through 21, or having a glycine-serine-proline sequence at positions 18 through 21.
13. 13. An OB polypeptide according to any of daims 7, 8, 9, or 10 selectedfrom the group consisting of polypeptides: (a) having residues 1 through 21 deleted; and (b) polypeptides of subpart (a) having a methione at position 21, or havinga glycine-serine-histidine-methionine sequence (SEQ ID NO: 38) at positions 18through 21, or having a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98) at positions 1 through21, or having a leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamicacid-alanine sequence (SEQ ID NO: 26) at positions 14 through 21, or having aglutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27) at positions18 through 21, or having a leucine-glutamic acid-lysine-arginine sequence (SEQ IDNO: 28) at positions 18 through 21, or having a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99) at positions2 through 21, or having a glycine-serine-proline sequence at positions 18 through 21. 223 010596
14. 14. A human OB polypeptide truncated analog according to claim 2selected from the group (according to the numbering of SEQ ID NO: 4) consistingof polypeptides wherein: (a) one or more residues at positions 121 to 128 are deleted; (b) residues 1-116 are deleted; (c) residues 1-21 and 54 to 167 are deleted; (d) residues 1-60 and 117 to 167 are deleted; (e) residues 1-60 are deleted; (f) résides 1-53 are deleted; (g) an analog of subpart (a) wherein residues 1-21 are deleted; and (h) an analog of subpart (a) through (g) having an N-terminal amino acidor amino acid sequence selected from the group consisting of: (1) méthionine, (2) a glycine-serine-histidine-methionine sequence (SEQ ED NO:38), (3) a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ED NO: 98), (4) a leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ DD NO: 26), (5) a glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ED NO: 27), (6) a leucine-glutamic acid-lysine-arginnine sequence (SEQ ID NO: 28), (7) a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99), and (8) a glycine-serine-proline sequence.
15. 15. A recombinant OB polypeptide according to any of claims 1 through 14 224 010596
16. 16. A chemically synthesized OB polypeptide according to any of clalms1 through 14.
17. 17. A dérivative of an OB polypeptide according to any of daims 1 through16 having one or more Chemical moieties attached thereta.
18. 18. A dérivative of daim 17, wherein the Chemical moiety is a water-soluble polymer.
19. 19. A dérivative of daim 18, wherein the water-soluble polymer ispolyethylene glycol.
20. 20. A dérivative of daim 19 which is mono-, di-, tri- or tetrapegylated.
21. 21. A dérivative of daim 20 which is N-terminal monopegylated.
22. 22. A dérivative of daim 21 which is an OB polypeptide comprising the · amino acid residues 22 through 167 of SEQ ID NO:4 or residues 22 through 166 of SEQ ID NO: 6.
23. 23. A dérivative of daim 21 which is an OB polypeptide comprising theamino acid sequence of residues 22 through 167 of SEQ ID NO: 4 or residues 22through 166 of SEQ ID NO: 6 and having a méthionine at position 21.
24. 24. An isolated nucleic acid molécule encoding an OB polypeptideaccording to any of daims 1 through 6, 9 or 11.
25. 25. An isolated nucleic acid molécule encoding an OB polypeptideaccording to any of daims 7, 8, 10, 12, 13 or 14. 225 01 0596
26. 26. A DNA molécule for use in securing expression of an OB polypeptidehaving the biological activity of modulating body weight in a mammal, the DNAbeing selected from the group consisting of: (a) the DNA molécules set out in SEQ ID NOS: 1 and 3 or fragmentsthereof, (b) DNA molécules which hybridize to the DNA molécules defined in (a)or hybridizable fragments thereof; and (c) DNA molécules that code on expression for the amino acid sequenceencoded by any of the foregoing DNA molécules.
27. 27. A DNA molécule according to claim 26 which is the human genomicDNA molécule of SEQ ED NOS: 22 and 24.
28. 28. A DNA molécule according to claim 24 encoding a polypeptide havingan amino acid sequence selected from the group consisting of the amino acidsequences set out in: (a) SEQ ID NO: 2; (b) amino acids 22 through 167 of SEQ ED NO: 2; (c) SEQ ED NO: 4; (d) amino acids 22 through 167 of SEQ ID NO: 4; (e) SEQ ID NO: 5; (f) amino acids 22 through 166 of SEQ ID NO: 5; (g) SEQ ID NO: 6; (h) amino acid 22 through 166 of SEQ ID NO: 6; and (i) the amino acid sequences of subpart (b) (d), (f) or (h) having an N-terminal amino acid or amino acid sequence selected from the group consisting of: (1) méthionine, (2) a glycine-serine-histidine-methione sequence (SEQ ED NO: 38),and (3) a methionine-glycine-serine-serine-histidine-histidine-histidme-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98). 226 010596 10
29. 29. A DNA molécule according to claim 28 encoding an amino acid ofsubpart (b), (d), (f) or (h) having an N-terminal amino acid sequence selected fromthe group consisting of: (1) a leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: Ï6), (2) a glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27), (3) a leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (4) a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ED NO: 99), and (5) a glycine-serine-proline sequence. 15 30. A DNA molécule according to claim 24 comprising the sequence set out as the protein coding sequence of SEQ ED NO: 3.
30. 31. A DNA molécule according to claim 24 comprising the sequence setout as the sequence encoding amino acids 22 through 167 of SEQ ED NO: 3. 20
31. 32. A detectably labeled nucleic acid molécule hybridizable to a DNAmolécule according to any one of daims 24 to 31.
32. 33. A nucleic acid hybridizable to a non-coding région of an OB nucleic25 acid, which non-coding région is selected from the group consisting of an intron, a 5 ' non-coding région, and a 3 ' non-coding région.
33. 34. An oligonucleotide primer for ampliiying human genomic DNA encoding an OB polypeptide. 30 227 010596
34. 35. An oligonucleotide according to claim 32, which is selected from thegroup consisting of: HOB lgF 5 '-CCCAAGAAGCCCATCCTG-3 ' (SEQ ED NO. 29); HOB lgR 5'-GACTATCTGGGTCCAGTGCC-3 ' (SEQ ED NO. 30); HOB 2gF 5 '-CCACATGCTGAGCACTTGIT-3 ' (SEQ ID NO. 31); andHOB 2gR 5 '-CTTCAATCCTGGAGATACCTGG-3 ' (SEQ ID NO. 32).
35. 36. A vector which comprises a DNA molécule according to any of daims24 through 31.
36. 37. An expression vector which comprises a DNA molécule according toany of daims 24, 26, 30 or 31 operatively associated with an expression controlsequence.
37. 38. An expression vector which comprises a DNA molécule according todaim 27 or 29 operatively associated with an expression control sequence.
38. 39. An expression vector which comprises a DNA molécule according todaim 25 operatively associated with an expression control sequence.
39. 40. An unicellular host transformed or transfected with a DNA moléculeof claim 24 or 25 or an expression vector of any one of daims 36 through 39.
40. 41. A unicellular host according to claim 40, wherein the unicellular hostis selected from the group consisting of bacteria, yeast, mammalian cells, plant cells,insect cells, and human cells in tissue culture.
41. 42. The unicellular host of claim 40, wherein the unicellular host isselected from the group consisting of E. coli, Pseudomonas, Bacillus, Streptomyces,yeast, CHO, Rl.l, B-W, LM, COS 1. COS 7, BSC1, BSC40, BMT10, and Sf9 cells. 228 010596
42. 43. A unicellular host according to claim 40 wherein the unicellular hostis a yeast host selected from the group consisting of Saccharomyces, Pichia, Candida,Hansenuîa and Torulopsis.
43. 44. A mammalian cell containing an OB polypeptide encoding DNA sequenceand modified in vitro to permit higher expression of OB polypeptide by means of ahomologous recombinational event consisting of inserting an expression regulatorysequence in functional proximity to the OB polypeptide encoding sequence.
44. 45. A cell according to claim 44 wherein the expression regulatorysequence is an OB polypeptide expression regulatory sequence and the homologousrecombinational event replaces a mutant OB polypeptide expression regulatorysequence.
45. 46. A cell according to claim 45 wherein the expression regulatorysequence insert is not an OB polypeptide regulatory sequence.
46. 47. A method for preparing an OB polypeptide comprising: (a) culturing a cell according to any of daims 40 through 46 underconditions that provide for expression of the OB polypeptide; and (b) recovering the expressed OB polypeptide.
47. 48. The method according to claim 47 wherein the cell is a bacterium ora yeast.
48. 49. The method according to claim 47 or 48 further comprising: (c) chromatographing the OB polypeptide on a Ni-chelation column; and (d) purifying the OB polypeptide by gel filtration. 229 010596
49. 50. The method according to claim 49, further comprising after step (c)and before step (d) chromatographing the OB polypeptide on a strong cationexchanger column.
50. 51. An antibody spécifie for an OB polypeptide according to any of claims1 through 16 or produced by the method of claims 47 through 50.
51. 52. An antibody according to claim 51 which is a monoclonal or polyclonalantibody.
52. 53. An antibody according to claim 52 labeled with a détectable label.
53. 54. An immortal cell line that produces a monoclonal antibody accordingto claim 52.
54. 55. A method for preparing an antibody spécifie to an OB polypeptide,comprising: (a) conjugating an OB polypeptide according to any of claim 1 through 16or produced by the method of claims 47 through 50 to a carrier protein; (b) immunizing a host animal with the OB polypeptide fragment-carrierprotein conjugate of step (a) admixed with an adjuvant; and (c) obtaining antibody from the immunized host animal.
55. 56. A method for measuring the presence of an OB polypeptide in asample, comprising: (a) contacting a sample suspected of containing an OB polypeptide with an antibody that specifically binds to the OB polypeptide underconditions which allow for the formation of reaction complexes comprising theantibody and the OB polypeptide; and (b) detecting the formation of reaction complexes comprising the antibodyand OB polypeptide in the sample, 230 010596 wherein détection of thc formation of réaction complexes indicates the presence of OBpolypeptide in the sample.
56. 57. The method of claim 56 in which the antibody is bound to a solid phasesupport.
57. 58. An in vitro method for evaluating the level of OB polypeptide in abiological sample comprising: (a) detecting the formation of reaction complexes in a biological sampleaccording to the method of claim 56 or 57; and (b) evaluating the amount of reaction complexes formed, which amount ofreaction complexes corresponds to the level of OB polypeptide in the biologicalsample. 5% A pharmaceutical composition comprising an OB polypeptide accordingto any of claims l through 16 or produced by the process of claims 47 through 50and a pharmaceutically acceptable carrier. 60; A pharmaceutical composition of claim 61 for reducing the body weightof an animal. 611 A pharmaceutical composition for increasing the body weight of ananimal comprising an antagonist of an OB polypeptide according to any of claims 1through 16 or produced by the process of claims 47 through 50 and apharmaceutically acceptable carrier. * 62« The pharmaceutical composition of claim 63, wherein the antagonist is seleçted from the group consisting of an antibody that binds to and neutralizes the activity of the OB polypeptide, a fragment of the OB polypeptide that binds to but does not activate the OB polypeptide receptor, and a small molécule antagonist of the OB polypeptide. 231 010596
58. 63. A body appearance improving cosmetic composition for reducing thebody weight of an individual comprising an OB polypeptide «ccording to any ofdaims 1 through 16 or produced by the process of daims 47 through 50 and anacceptable carrier. 5 64 » A body appearance improving cosmetic composition for increasing the body weight of an individual comprising an antagonist of an OB polypeptideaccording to any of daims 1 through 16 or produced by the process of daims 47through 50 and an acceptable carrier. 65 A cosmetic composition according to daim 66, wherein the antagonist10 is selected from the group consisting of an antibody that binds to and neutralizes theactivity of the OB polypeptide, a fragment of the OB polypeptide that binds to butdoes not activate the OB polypeptide receptor, and a small molécule antagonist of the OB polypeptide. 66» A cosmetic process for improving the body appearance of an15 individual, wherein a cosmetic composition according to any of daims 64 through 67is administered to the individual in a dose amount sufficient to modulate the individual’s body weight to a desired level. 67 f Use of an antisense nucleic acid molécule hybridizable to a nucleic acidencoding an OB polypeptide according to any of daims 1 through 4 or 9 for 20 manufacture of a médicament for modifying the body weight of a mammal.
59. 68 , Use of a nucleic acid molécule encoding an OB polypeptide accordingto any of daims I through 16 or produced by the process of daims 47 through 50 forthe manufacture of a gene therapy médicament for modifying the body weight of ananimal. Z 2 32 010596 69 « Use of an OB polypeptide according to any of the clalms 1 through 16or produced by the method of daims 47 through 50 for the manufacture of amédicament for modification of the body weight of an animal. 70 k Use of an OB polypeptide according to any of the daims 1 through 165 or produced by the method of daims 47 through 50 for the manufacture of a médicament for modification of the body u eight of a mammal in treating a disorderselected from the group consisting of diabètes, high blood pressure and highcholestérol. 71 v Use of an ob polypeptide according to any of the daims 1 through 1610 or produced by the method of daims 47 through 50 for the manufacture of a médicament for modification of the body weight of a mammal for use in combinationwith a médicament for treating diabètes, high blood pressure and high cholestérol.
60. 72. Use of an antagonist of an OB polypeptide according to any of daims1 through 16 or produced by the process of daims 47 through 50 for the manufacture 15 of a médicament for increasing the body weight of an animal.
61. 73. The use according to daim 74 wherein the antagonist is selected fromthe group consisting of an antibody that binds to and neutralizes the activity of the OBpolypeptide, a fragment of the OB polypeptide that binds to but does not activate theOB receptor, and a small molécule antagonist of the OB polypeptide. *
62. 74. The use according to any of daims 71 through 75 for the manufacture of a médicament for intravenous, intraarterial, intraperitoneal, intramuscular, subeutaneous, nasal, oral or pulmonary delivery.