KR100584177B1 - Weight modulators, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof - Google Patents

Abstract

FIELD OF THE INVENTION The present invention relates generally to controlling the weight of mammals, including animals and humans, and more particularly to substances identified as weight modulators in the present invention, and diagnostic and therapeutic uses to which such modulators can be applied. It is about.

Description

Weight modulators, corresponding nucleic acids and proteins, and diagnostic and therapeutic uses thereof

FIELD OF THE INVENTION The present invention relates generally to controlling the weight of mammals, including animals and humans, and more particularly to substances identified as weight modulators in the present invention, and diagnostic and therapeutic uses to which such modulators can be applied. It is about.

Obesity, which is defined as excessive body fat relative to lean body mass, is associated with significant physiological and medical morbidity, the latter of which are hypertension, increased blood lipids, and type II or non-insulin-dependent Diabetes mellitus (NIDDM). There are between 6 million and 10 million NIDDM patients in the United States, including 18% of the 65-year-old population [Harris et al., Int. J. Obes., 11: 275-283 (1987). About 45% of men with NIDDM and 70% of women are obese and their diabetes is substantially improved or resolved by weight loss (Harris, Diabetes Care, 14 (3): 639-648 (1991)). As described below, both obesity and NIDDM are potent hereditary, although no predisposition genes have been identified. The molecular genetic basis of these metabolically related diseases is important, but a poorly understood problem.

The assimilation, storage and utilization of nutritional energy constitutes a complex homeostasis system that is central to the survival of the welfare animal. In land-dwelling mammals, storing large amounts of metabolic fuel as triglycerides in adipose tissue is crucial for survival during food deprivation. The desire to maintain energy storage at a fixed level without constantly changing the size and shape of the organism requires a balance between energy intake and consumption. However, the molecular mechanisms regulating the energy clusters are not yet known. Isolating molecules that transform nutrition information and regulate energy balance are important for understanding weight control in health and disease.

Personal levels of overfat are largely genetically determined. Tests for the concordance rate of body weight and hyperlipidemia between identical and fraternal twins, or both and their biological parents, have shown that the heritability of obesity (0.4-0.6) is usually significant in heredity, such as schizophrenia, alcoholism and atherosclerosis. It has been suggested to exceed the permittivity of many other traits that are thought to have a component [Stunkard et al., N. Engl. J. Med., 322: 1483-1487 (1990). Family similarities in the proportion of energy consumption have also been reported (Bogardus et al., Diabetes, 35: 1-5 (1986)). Genetic analysis in geographically separated populations suggests that relatively few genes contribute 30-50% of gymnastic changes [Moll et al., Am. J. Hum. Genet., 49: 1243-1255 (1991). However, none of the genes that cause obesity in the general population have been genetically identified with the correct chromosomal location.

The rodent model of obesity includes seven apparent single-gene mutations. The most intensively studied mouse obesity mutations are the ob (obesity) and db (diabetic) genes. When present on the same genetic strain background, ob and db exhibit indistinguishable metabolic and behavioral phenotypes, suggesting that these genes may act on the same physiological pathway [Coleman et al., Diabetologia, 14: 141-148 (1978). Mice homozygous for either mutation are overeating and low metabolic, which leads to a significant obesity phenotype at 1 month. The weight of these animals tends to stabilize at 60-70 g (compared to 30-35 g in control mice). ob and db animals exhibit a myriad of other hormonal and metabolic changes that make it difficult to identify primary defects due to mutations [Bray et al., Am. J. Clin. Nutr., 50: 891-902 (1989).

Each rodent obesity model involves changes in carbohydrate metabolism similar to those of type II diabetes in humans. In some cases, the severity of diabetes depends in part on background mouse strain [Leiter, Endocrinology, 124: 912-922 (1989)]. In both ob and db , congenic C57BL / Ks mice express severe diabetes with ultimate β cell necrosis and islet atrophy resulting in relative insulin deficiency. Conversely, pseudogenic C57BL / 6J ob and db mice eventually express transient insulin-resistant diabetes, which is offset by β cell hypertrophy similar to human type II diabetes.

The phenotypes of ob and db mice have something in common with human obesity in a different way from the manifestation of diabetes-mutant mice eat more and consume less energy than lean controls (as in obese humans). This phenotype is also very similar to that seen in animals with lesions of the ventral medial hypothalamus, suggesting that both mutations may impair their ability to properly integrate or respond to nutritional information within the central nervous system. This hypothesis states that ob mice lack circulating satiety factor and db mice are resistant to the effects of the ob factor (possibly due to ob receptor deficiency) [Coleman, Diabetologia , 9: 294-298 (1973). These experiments lead to the conclusion that obesity in these mutant mice can arise from various defects in the afferent loops and / or integrative centers of the hypothesized feedback mechanism that regulates body composition.

Molecular and classical genetic markers were used to place the ob and db genes on the proximal chromosome 6 and the midchromosome 4, respectively [Bahary et al., Proc. Nat. Acad. Sci. USA, 87: 8642-8646 (1990); Friedman et al., Genomics, 11: 1054-1062 (1991). In both cases, the mutations are located in the part of the mouse genome that is human and syntheny, suggesting that if there are human homologues of ob and db they will be located on human chromosomes 7q and 1p, respectively. Defects in the db gene can cause obesity in other mammalian species: fa mutations (rat chromosome 5) during gene hybridization between Zucker fa / fa rats and Brown Norway + / + rats Adjacent by the same loci located flanked by db in mice [Truett et al., Proc. Natl. Acad. Sci, USA, 88: 7806-7809 (1991).

Because a number of factors appear to affect weight, it is not possible to predict which factors, and more particularly which homeostatic mechanisms are primarily crucial for weight. Thus, the main problem underlying the present invention is to provide a modulator of body weight which allows for the regulation of fat excess and fat content in mammals.

1 (A-E) show nucleic acid sequences derived for murine OB cDNA (SEQ ID NO: 1) and inferred amino acid sequences (SEQ ID NO: 2). Following the 39 base pair 5 'leader, there was the expected 167 amino acid open reading frame and about 3.7 kb 3' nondock sequence. (Previously filed US patent application Ser. No. 08 / 347,563 (filed Nov. 30, 1994) and patent application 08 / 438,431 (filed May 10, 1995), thereafter further 58-base 5 'non-encoded. The sequence was determined to be a cloning artifact, which is not present on the coding moiety, the 39 base 5 'non-coding part currently shown in Figure 1 or the 3' non-coding part of the gene. .) A total of about 2500 base pairs of the 3 ′ nonpoisonous sequence is shown. Analysis of the protein sequences expected by using and observing the SigSeq computer program suggests the presence of signal sequences (underlined needles). The microheterogeneity of the cDNA showed that about 70% of the cDNAs had glutamine codons at codon 49 and no 30% (see FIGS. 5 and 6 below). This amino acid is underlined as mutated arginine codons in C57BL / 6J ob / ob mice (1J mice).

2 (A and B) show nucleic acid sequences derived for human OB cDNA (SEQ ID NO: 3). The nucleotides were numbered 1 to 701 with nucleotide 46 as the start and terminated at nucleotide 550.

Figure 3 shows the total deduced amino acid sequence (SEQ ID NO: 4) derived for the human OB gene corresponding to the nucleic acid sequences of Figures 2A and B. Amino acids numbered from 1 to 167. Since the signal sequence cleavage site is located after amino acid 21 (Ala), the mature protein spans from amino acid 22 (Val) to amino acid 167 (Cys).

4 compares the inferred amino acid sequences of rat (SEQ ID NO: 2) and human (SEQ ID NO: 4). The sequence of human OB inferred amino acid sequence was very homologous to the sequence of mouse. Conservative changes are indicated by dashes and non-conservative changes are indicated by asterisks. Variable glutamine codons are underlined as the location of nonsense mutations in C57BL / 6J ob / ob (1J) mice. Overall, only 8 substitutions were observed here between valine at codon 22 (directly downstream of the signal sequence) and cysteine at position 117, but there is 83% identity at the amino acid level.

FIG. 5 shows the full length amino acid sequence (SEQ ID NO: 5) derived for the mouse OB gene as shown in FIG. 3 but lacking glutamine at position 49. FIG. Amino acids numbered from 1 to 166. The mature protein spans from amino acid 22 (Val) to amino acid 166 (Cys) because the signal sequence cleavage site is located after amino acid 21 (Ala) (and thus before glutamine 49 deletion).

FIG. 6 shows the total inferred amino acid sequence (SEQ ID NO: 6) derived for the human OB gene as shown in FIG. 4 but lacking glutamine at position 49. FIG. Amino acids numbered from 1 to 166. The mature protein spans from amino acid 22 (Val) to amino acid 166 (Cys) because the signal sequence cleavage site is located after amino acid 21 (Ala) (and thus before glutamine 49 deletion).

In Figure 7 (A) is a physical map of the position of ob on the chromosome of the mouse and YAC and P1 cloning map. "M and N" correspond to Mul I and Not I restriction sites. The numbers correspond to individual animals that are recombinants in the portion of ob of 1606 meiosis obtained. Met, Pax 4, D6Rck39, D6Rck13 and Cpa relate to the position at the portion of ob that binds the DNA probe. YACs were isolated using D6Rck13 and Pax-4 as probes, and the ends were recovered using vectorette PCR and / or plasmid terminal rescue, and again used to isolate new YACs. (B) is the generated YAC contig. One of the YACs in this contig, Y902A0925, was chimeric. Each probe used to determine the genotype of a recombinant animal is shown in parentheses. (6) corresponds to YAC 107; (5) corresponds to M16 (+) (or M16 (pLUS)); (4) corresponds to adu (+); (3) corresponds to aad (pICL); (2) corresponds to 53 (pICL); (1) corresponds to 53 (+). (C) is the PI contig of the bacteriophage P1 clone isolated by the selected YAC terminal probe. The ob gene was isolated in an isolated P1 clone using the distal end (terminal 4) of YAC YB6S2F12 (alternatively referred to herein as adu (+)).

8 shows photographs of ethidium bromide staining of 192 independent isolates of a PCR amplified and characterized fourth exon trapping experiment.

9 is a photograph of ethidium bromide staining of PCR-amplified clones suspected of carrying ob . Each of the seven clones that did not involve artificial products were reamplified using PCR and electrophoresed on 1% agarose gel in TBE and stained with ethidium bromide. The size marker (the left unnumbered lane) is a "1 kB ladder" available on the market. Lane 1 is clone 1D12 containing the "HIV sequence". Lane 2 is clone 1F1, a novel clone excluding the ob portion. Lane 3 is clone 1H3. Lane 4 is clone 2B2 identical to 1F1. Lane 5 is clone 2G7 containing ob exons. Lane 6 is clone 2G11, identical to 1F1. Lane 7 is clone 2H1 containing no inserts.

10 shows the sequence of 2G7 clone (SEQ ID NO: 7) comprising exons encoded for a portion of the OB gene. Primer sequences used to amplify this exon are squared in the figure (SEQ ID NOS: 8 and 9).

FIG. 11A shows reverse transcriptase-PCR analysis of mRNA from various tissues of the same mouse using 2G7 primers and actin primers. RT-PCR reactions were performed using 100 ng of total RNA reverse transcribed using oligo dT as primer for first strand cDNA synthesis. PCR amplification was 94 ° denatured for 1 ′; 55 ° hybridization for 1 ′; And 35 cycles with 72 ° C. extension for 2 ′ with 1 ′ second autoextension per cycle. RT-PCR products were partitioned on 2% low melting agarose gel running in 1 × TBE buffer. (B) shows the Northern blot of mRNA derived from various organs of mice using PCR labeled 2G7 as a probe. 10 μg total RNA from each tissue was electrophoresed on agarose gel with formaldehyde. Probes were hybridized at 65 ° C. in Rapid Hybe (Amersham). The autologous signal was evident after 1 hour of exposure and the experiments resulted in 24 hours of exposure.

12 (A) shows ethidium bromide staining from RT-PCR reactions on adipocytes (white adipose cells) RNA derived from each of the listed mouse strains. Total RNA (100 ng) for each sample was raised and reverse transcribed using dT and reverse transcriptase, and the resulting single-strand cDNA was PCR amplified using 2G7 primer (bottom band) or actin primer (top band). Both 2G7 and actin primers were included in the same PCR reaction. The product was run on a 1% agarose TBE gel. (B) shows the northern analysis corresponding to (A). 10 μg of adipocyte (white adipose tissue) RNA from each of the designated strains was removed and probed with a PCR labeled 2G7 probe as in FIG. 11B above. An approximately 20-fold increase in the level of 2G7 mRNA was evident in white adipose RNA derived from the C57BL / 6J ob / ob (1J) strain compared to the lean littermate. In both RT-PCR and Northern experiments, there was no detectable signal in 2G7 RNA derived from SM / Ckc- + ^Dac ob ²¹ / ob ²¹ (2J) mice even after two weeks of exposure. Twenty four hour autoradiography exposure was shown. The same filter was hybridized to the actin probe (lower part of the panel).

FIG. 13 shows Northern analysis of additional 2J animals and control animals confirming the absence of ob mRNA from 2J animals. Northern analysis was performed as in FIGS. 11 and 12. In this case, the control RNA was ap2, a fat specific transcript. There was no significance for the changing density of the ap2 band here.

FIG. 14 compares the DNA sequences of C57BL / 6J (normal) and C57BL / 6J ob / ob (1J) mice at the portion of the point mutation that induces the introduction of premature stop codons (nonsense mutations) in the mutant strain cDNA. ob / ob mice had a C → T mutation that changed the arginine residue at position 105. This base change is shown as output from an automated DNA sequencer. RT-PCR was performed using white adipose RNA derived from two strains (+ / + and ob / ob ) using primers from the 5 'and 3' non-toxin portions. PCR reaction products were gel purified and manually sequenced using an Applied Biosystems, Inc. 373A automated sequencer with primers along two strands of the coding sequence.

FIG. 15A shows Southern blots of genome DNA derived from each of the listed mouse strains. About 5 μg of DNA (derived from genome DNA prepared from liver, kidney or spleen) was restriction digested with the indicated restriction enzymes. DNA was then electrophoresed in 1% agarose TBE gel and probed with PCR labeled 2G7. Restriction by Bgl II revealed an increase in the size of about 9 kB (maximum) Bg lII fragment in SM / Ckc- + ^Dac ob ²¹ / ob ²¹ (2J) DNA. RFLPs could not be detected by any other restriction enzyme. Preliminary restriction mapping of the genome DNA indicated that the polymorphic Bgl II site was about 7 kB upstream of the transcription start site. None of the other enzymes tested extended beyond the mRNA initiation site. (B) shows the separation of Bgl II polymorphism from the SM / Ckc- + ^Dac ob ²¹ / ob ²¹ strain. Six obesity and five thin progeny derived from the same genotype SM / Ckc- + ^Dac ob ²¹ / ob ²¹ (2J) colonies were genotyped by recording the Bgl II polymorphism as shown in (A). All animals that were phenotypically obese were homozygous for the larger allele of the polymorphic Bgl II fragment. DNA of the "control" lane was prepared from unrelated SM / Ckc- + ^Dac + / + mice bred separately from the SM / Ckc- + ^Dac ob ²¹ / ob ²¹ colonies.

FIG. 16 is a Southern blot (ie, a zoo blot) of Eco RI digested genome DNA from enumerated species using OB cDNA as a probe. Hybridization signals were detectable in all vertebrate samples even after moderately stringent hybridization. Cat DNA was slightly degraded in this experiment. Restricted DNA was run on a 1% agarose TBE gel and transferred to an imobilon membrane for probe. The filter was hybridized at 65 ° C., washed twice with 2 × SSC / 0.2% SDS at 65 ° C. for 20 minutes and exposed for 3 days using a Kodak (Rochester; NY) X-OMAT film.

17 shows the expression cloning portions (SEQ ID NOS .: 11 and 12) of vector pET-15b (Novagen).

18 shows analysis of eluate from His-bound resin (Ni) column for recombinant mature rat ob fusion (A) for His-tag and mature human OB fusion for B-B (B). It is shown. The bacteria were transformed with the vectors pETM9 and pETH14, respectively. When induced at 1 mM IPTG under optimal conditions, the transformed bacteria were able to produce 100-200 μg / ml OB fusion protein, mainly in inclusion bodies. Inclusion bodies were solubilized with 6 M guanidine-HCl or urea and the fusion protein (present in the lysate supernatant) was loaded with urea on a His-bound resin (Ni) column in 10 ml of 1 × binding buffer. The column was eluted stepwise with 5 ml aliquots of 20 μM, 60 μM and 300 μM imidazole, and finally with strip buffer. Aliquots were analyzed for the presence of OB polypeptide fusions on 15% acrylamide gels. Each lane contains 100 μl of the equivalent of bacterial extract.

(A) in FIG. 19 shows in vitro translation of OB RNA. Human OB cDNA was subcloned into pGEM vector. Plasmids were made linear and plus strand DNA was synthesized using Sp6 polymerase. In vitro synthesized RNA was translated in the presence or absence of dog pancreatic microsomal membranes. Adding the microsomal membrane to the reaction induced the appearance of a second detox product that was about 2 kD smaller than the primary detox product. The size of the detoxification product of interleukin-1α RNA lacking the encoded signal sequence was not changed by the addition of the microsomal membrane. These data suggested the presence of a functional signal sequence. (B) shows in vitro detoxification with or without proteinase K. Protease treatment resulted in complete proteolysis of the 18 kD primary detox product, while the 16 kD treated form was not affected. Permeabilization of the microsomes with 0.1% TRITON-X100 allowed the forms to be protease sensitive. These results suggest that the product was translated into lumens of the microsomes.

20 (A-E) show the sequence of human OB gene (SEQ ID NOs: 22 and 24). (F) is a schematic of the rat OB gene. (G) is a schematic of the human OB gene. In both (F) and (G), the start and stop codons are underlined. There is no evidence in the human gene of the first intron homologous to the mouse first intron here, but its presence cannot be excluded.

21 shows a schematic of one of the cloning methods used to obtain recombinant expression of OB in Pichia yeast. (A) shows an expression vector of OB having an α-mating factor signal sequence. (B) shows the amino acid sequence showing the Xho I site and putative KEX-2 and STE-13 cleavage sites (SEQ ID NO: 26), and the N-terminal extra amino acid present after KEX-2 cleavage (SEQ ID NO A schematic of the structure of a recombinant fusion protein comprising: 27). (C) prepares a mature OB comprising preparing a construct having an amino acid sequence corresponding to a KEX-2 cleavage site and a Xho I cleavage site immediately upstream of the mature ob polypeptide sequence (SEQ ID NO: 28). An alternative method is shown.

22 shows alternative expression methods in Pichia . (A) is an expression vector of OB fusion with His-tag adopted from the pET expression system under the control of α-cross-signal signal sequence (SEQ ID NO: 33). (B) is able to obtain OB having three extra N-terminal amino acid residues. It is a schematic of the structure of a recombinant OB fusion protein containing His-tag.

FIG. 23A shows PAGE analysis of expression of rat OB (both microhomogeneous, ie Gln 49 containing and deleted) in transformed pichia yeast. The expected band of about 16 kD is visible in transformed yeast cultures (lanes 2 and 3), but not in cultures from non-transformed yeast (lane 1). (B) shows PAGE analysis of partially purified recombinant OB polypeptide on carboxymethyl cellulose, a weak cation exchanger. A band of about 16 kD is clearly visible in fractions 3 and 4 from the column eluted with 250 mM NaCl. Lane 1 is the loaded sample; Lane 2 is flow-through; Lanes 3-5 are fractions eluted with 250 mM NaCl.

24 shows that OB protein circulates in mouse plasma. (A) shows immunoprecipitation from mouse blood. 0.5 ml of mouse plasma was pre-established with unconjugated Sepharose and incubated overnight with immunopurified anti-OB antibodies conjugated to Sepharose 4B beads. Immunoprecipitates were separated on 15% SDS-PAGE gels, transferred, and western blotted with anti-OB antibodies. The protein had a molecular weight of about 16 kD and moved to the same position as the mature mouse ob protein expressed in yeast. The protein was absent in plasma derived from C57BL / 6J ob / ob mice and increased 10-fold in plasma derived from C57BLB / Ks db / db mice compared to wild type mice. db mice have been proposed to overproduce OB protein and secondaryly resist its effects. (B) shows increased levels of OB in fat rats. Lipid rats are obese as a result of recessive mutations on rat chromosome 5. Genetic data suggested deletion in the same gene mutated in db mice. Plasma derived from lipid rats and thin litters were immunoprecipitated and run on Western blot. A 20-fold increase in circulating levels of OB is seen in mutant animals. (C) shows quantitative analysis of OB protein in mouse plasma. Increasing amounts of recombinant mouse protein were added to 100 λ of plasma derived from ob mice and immunoprecipitated. Signal intensity on Western blot was compared to the intensity from plasma of 100 λ derived from wild type mice. A linear increase in signal strength was seen by increasing amounts of recombinant protein, demonstrating that immunoprecipitation was performed under conditions of antibody excess. Similar signals were seen in wild type plasma samples and in samples with 2 ng of recombinant protein suggesting that the circulation level in mouse plasma is about 20 ng / ml. (D) shows OB protein in adipose tissue extract. Cytoplasmic extracts of mouse adipose tissue were prepared from db and wild type mice. Western blots showed increased levels of 16 kD protein in extracts prepared from db mice.

25 shows that OB protein circulates at various levels in human plasma. (A) is Western blot of human plasma. Plasma samples were obtained from six thin volunteers. Immunoprecipitation and Western blotting revealed the presence of an immunoreactive 16 kD protein of the same size as the recombinant 146 amino acid human protein expressed in yeast. Various levels of protein appeared in each of the six samples. (B) shows an ELISA (enzyme linked immunoassay) of human ob. Microtiter plates were coated with immunopurified anti-human OB antibodies. Known amounts of recombinant protein were added to the plates and detected using immunopurified biotinylated anti-ob antibodies. The absorbance at 414 nm is plotted against the known concentration of OB to obtain a standard curve. The resulting standard curve indicated that this test was able to detect 1 ng / ml or more human OB protein. (C) shows quantitation of OB protein in human plasma. ELISA immunoassays were performed using 100 λ plasma obtained from six thin volunteers and the standard used in Panel B. The level of OB protein was found to range from 2 ng / ml at HP1 to 15 ng / ml at HP6. These data correlated with Western blot data in Panel A.

26 shows that OB proteins form intermolecular or intramolecular disulfide bonds. (A) is Western blot under reducing and non-reducing conditions. Western blots of mouse and human plasma were repeated with or without reducing agent in the sample buffer. When generating β-mercaptoethanol from sample buffer, immunoprecipitates from db plasma migrate to apparent molecular masses of 16 kD and 32 kD. The addition of β-mercaptoethanol to the buffer leads to the loss of the 32 kD site (see FIG. 24). This result is repeated when the mouse protein is expressed in the yeast Pichia pastoris . In this case, the mouse OB protein moves to the location of the dimer. Under reducing conditions, purified recombinant mouse protein migrates by an apparent molecular weight of 16 kD, suggesting that the 32 kD molecular form is the result of one or two intermolecular disulfide bonds. Human proteins expressed in vivo and in Pichia pastoris migrate to a molecular mass of 16 kD under reducing and non-reducing conditions (data not shown). (B) indicates that human proteins expressed in yeast contain intramolecular disulfide bonds. Secreted proteins generally exhibit their exact stereoconfiguration when expressed in the Pichia pastoris expression system. The 146 amino acid mature human protein was expressed in Pichia pastoris and purified from yeast medium by a two-step purification protocol comprising IMAC and gel filtration. Purified recombinant protein was subjected to mass spectrometry before and after cyanogen bromide cleavage. Cyanogen bromide is cleaved at the carboxy terminus of the methionine residue. The molecular mass of the recombinant yeast protein was 16,024 ± 3 Da (calculated molecular mass = 16,024 Da). Cyanogen bromide cleaves behind three methionines in the protein sequence at amino acids 75, 89 and 157. The cyanogen bromide fragment with the measured mass 8435.6 Da corresponds to amino acids 90-157 and 158-167 linked by disulfide bonds between cys-117 and cys-167 (calculated molecular mass = 8434.5 Da). ND = not detected.

Figure 27 shows the preparation of bioactive recombinant proteins. The nucleotide sequence corresponding to the 145 amino acid mature mouse OB protein was cloned into the pET 15b expression vector. This pET vector allows for efficient purification using Immobilized Metal Affinity Chromatography (IMAC) by inserting a polyhistidine tract (His-tag) upstream of the cloned sequence. Recombinant bacterial proteins are first bacterial lysed and then distributed into insoluble membrane fractions. Membrane fractions were solubilized with guanidium hydrochloride and loaded on an IMAC column. The protein was eluted in stages with increasing concentration of imidazole as shown. The eluted protein was re-overlaped as described below and treated with thrombin to remove His-tag. The final yield of soluble protein was 45 ng per ml culture.

28 shows the biological effects of OB protein. Feed intake (panel AC) and body weight (panel DF) are shown over time. Groups of 10 animals did not receive OB protein intraperitoneally daily at a dose of 5 mg / kg / day (black squares), PBS daily (black circles) or not treated (black triangles). Treatment groups included C57B1 / 6J ob / ob mice (Panels A and D), C57B1 / Ks db / db mice (Panels B and E) and CBA / J + / + mice (Panels C and F). Feed intake of the mice was measured daily and body weights were recorded at 3-4 day intervals as indicated. (The scale of body weight in grams is different for ob and db mice compared to wild-type mice.) Feed intake of protein-administered ob mice decreased after the first injection, and after 4 days a false sham injection group. It stabilized to about 40% of the level seen at (p <0.001). The weight of these animals decreased to an average of 1.3 grams / day and stabilized to about 60% of the starting weight after 3 weeks (p <.0001). The effect of the protein could not be demonstrated in db mice. In CBA / J mice a small but obvious effect on body weight was observed at 2 time points (p <.02). The standard error of each measurement is expressed in bars, and the statistical significance of these results is shown in Table 1.

29 shows the results of fair feeding of ob mice. (A) Groups of four C57B1 / 6J ob / ob mice were fed with the same amount of feed as consumed by the group of ob mice receiving recombinant protein. Body weight loss was calculated after 5, 8 and 12 days for both groups. Feed-limited mice (lined bars) lost less weight than protein-administered ob mice (black bars) (p <.02). This result suggests that the weight-loss effect of OB protein is a consequence of both feed intake and energy consumption. (B) is a photograph of the treated ob mouse. Two C57B1 / 6J ob / ob mice are shown. The left mouse received PBS and weighed 65 grams, which was the starting weight. The mouse on the right received a daily injection of recombinant OB protein. The starting weight of this animal was also 65 grams, and after protein treatment the body weight was 38 grams. (C) shows livers of treated and untreated ob mice. Liver derived from treated and untreated C57B1 / 6J ob / ob mice is shown here. Livers from mice administered PBS had a gross appearance of fatty liver and weighed 5.04 grams. Liver from mice receiving recombinant ob protein had a normal appearance and weighed 2.23 grams.

30 shows in situ hybridization of ob to adipose tissue. Sense and antisense ob RNA were labeled using Sp6 and T7 polymerase and digoxigenin in vitro. Hybrid labeled RNAs to paraffin embedded sections of adipose tissue derived from epididymal fat pads of 8-week-old C57B1 / Ks mice (labeled wild type) and C57B1 / Ks db / db mice (labeled db ) It was mad. In this figure, lipid droplets appear as unstained vesicles in cells. The cytoplasm is a thin border around the cell and is indistinguishable from the cell membrane. Hybridization of all adipocytes within the region was detected only in wild-type sections using antisense probes, and significantly increased levels were seen in tissue sections derived from db / db animals.

Figure 31 shows that OB RNA is expressed in adipocytes in vivo and in vitro. Total RNA (10 μg) from several different sources was electrophoresed, blotted and hybridized to ob probes. First, adipocytes were purified using collagenase digestion followed by differences in cell buoyancy. OB RNA was only present in the adipocyte fraction. Lane S represents the stromovascular fraction and A represents the adipocyte fraction. In addition, OB RNA was not expressed in undifferentiated 3T3-442 preadipocyte cell lane U. Differentiated adipocytes derived from these cell lines expressed clearly detectable levels of OB mRNA (lane D).

32 shows that OB RNA is expressed in all adipose tissue depots. All adipose tissue stores tested expressed ob RNA. Although the level of the signal was variable here in different experiments, the inguinal fat pad expressed somewhat lower RNA levels. (A) Lane (1) Epididymal (2) Inguinal (3) Abdominal (4) Uterine connective tissue fat pad. Brown fat also expressed low levels of OB RNA. (FIG. 31B) Although the level of OB expression in brown fat did not change during the week raised at 4 ° C., the abundance of brown fat specific UCP RNA, which is known to be cold inducible, increased 5-fold.

33 shows expression of OB RNA in db / db and gold thioglucose treated mice. Total RNA from gold thioglucose (GTG) and db / db treated mice uterine connective tissue adipose pads were electrophoresed and northern blotted. GTG administered in a single dose is known to cause obesity by inducing specific hypothalamic lesions. In (A), month-old CBA female mice were treated with GTG (.2 mg / g), resulting in an increase of> 20 g in the treated animals compared to the control (<5 g). In (B) hybridization of OB probes to RNA from db / db and GTG treated mice showed a 20-fold increase in the abundance of ob RNA relative to control RNA (actin or GAPDH).

34 shows northern blot analysis of human RNA. Northern blot containing 10 mg total RNA from human adipose tissue (FAT, Panel A) and 2 mg polyA + RNA from other human tissue (Panel B) as indicated by human ob or human β Hybridized to actin probe. A strong signal at about 4.5 kb was indicated by adipose tissue total RNA. Hybridization to polyA + RNA showed detectable signals in the heart (HE) and placenta (PL), whereas OB RNA was found in the brain (BR), lung (LU), liver (LI), skeletal muscle (SM), It was not detected in the kidneys (KI) and pancreas (PA). In each case, the length of the autoradiography exposure is indicated. Note that the occurrence of low molecular weight bands observed in placental RNA (eg, alternative splitting, RNA degradation) is unknown.

35 shows YAC contigs containing the human OB gene and eight microsatellite markers. YAC-base STS-containing map of the portion of chromosome 7 containing the human OB gene as inferred by SEGMAP / version 3.29 [Green et al., PCR Methods Applic., 1: 77-90 (1991)] is shown. It is. Nineteen uniquely organized STSs (see Table 3) are listed along the top. Eight microsatellite-specific STSs are marked with asterisks (see Table 4). Also shown are the expected positions of centromere (CEN) and 7q telomeres (TEL) for STSs and contigs corresponding to Pax 4 and OB genes. Each of the 43 YAC clones is represented by a horizontal bar, whose name is listed on the left and the estimated YAC size (measured in kb by pulsed-field gel electrophoresis) is given in parentheses. It was. The presence of the STS in the YAC is indicated by black circles at appropriate locations. If the STS corresponds to the insertion end of the YAC, the rectangle is placed around the corresponding circle, both along the top (adjacent to the name of the STS) and at the end of the YAC from which it is derived. In the case of five YACs at the bottom (below the horizontal dashed line), one or more STS (s) expected to be present (based on the set STS order) were not detected (at least two corresponding STS−). Evaluated by testing individual YACs by specific PCR assay (s)), which are shown in white circles at appropriate locations. Most of the YACs were isolated from human-hamster hybrid cell-derived libraries (Green et al., Genomics, 25: 170-183 (1995)) and their original names also described. The remaining YACs were isolated from the total human genome library and their original library locations are shown in Table 3. Boxes were placed around the names of three YACs (yWSS691, yWSS999 and yWSS2935) identified by FISH analysis as located at 7q31.3. Contig appears in his "uncomputed form", where we do not use the YAC size to estimate clone overlap or STS spacing, so all STSs are spaced equidistantly Placed. In the 'computer measured form', which estimated the relative spacing and degree of clone overlap between each pair of adjacent STSs using the YAC size, the total YAC contigs appear to extend over 2 Mb.

details

The present invention demonstrates the ability to participate in the regulation of mammalian body weight, incorporating a protein called ob polypeptide or leptin in the present invention, and its variant variants, e.g., optimal codons for expression within a particular expression system. It relates to the description and discovery of nucleic acids encoding proteins comprising. The nucleic acids of interest of the present invention represent coding sequences corresponding to murine and human OB polypeptides that are assumed to play an important role in the regulation of body weight and hyperlipidemia. The data presented herein suggest that the polypeptide product of the nucleic acid of the invention is secreted by the cells expressing it, and the polypeptide acts as a hormone. Additional experimental data demonstrates that the OB polypeptide is very effective in treating obesity in mice carrying mutations in the ob gene. In addition, large bolus doses or moderately continuous doses of OB polypeptides cause weight loss in normal (wild-type) mice.

In addition, the examples herein demonstrate that the OB polypeptide, referred to herein as “leptin”, circulates in mouse, rat, and human plasma. Leptin is not present in plasma derived from ob / ob mice, is present at 10-fold higher concentrations in plasma derived from db / db mice, and at 20-fold higher concentrations in fa / fa rats. do. Most importantly, daily injection of recombinant leptin significantly reduces body mass in ob / ob mice, significantly affects body weight in wild type mice, and does not affect db / db mice.

In a further aspect, OB polypeptides derived from one species are biologically active in the other species. In particular, human OB polypeptides are active in mice.

In a main aspect of the present invention, the present invention relates to identifying substances that act as modulators of mammalian weight. In particular, the present invention relates to the isolation, purification and sequencing of particular nucleic acids corresponding to OB genes or encoding portions thereof, and corresponding polypeptides expressed by these nucleic acids, in both mice and humans. Accordingly, the present invention provides nucleic acids having the nucleotide sequences described in FIGS. 1A-E (SEQ ID NO: 1) and FIGS. 2A and B (SEQ ID NO: 3), and their variant variants, alleles and fragments, all of which are body weight. And has activity to modulate excess fat). The correspondence of the nucleic acids of the present invention to the OB gene is to predict their significant effects on conditions such as obesity and other diseases and dysfunctions caused by abnormal weight. The present invention provides a protein expressed by the nucleic acid of the present invention, and in particular Figures 1A to E (SEQ ID NO: 2), Figure 3 (SEQ ID NO: 4), Figure 5 (SEQ ID NO: 5) and Figure 6 ( To the proteins described in SEQ ID NO: 6) and their conserved variants, active fragments and cognate small molecules.

As noted above, other weight-modulating modulator peptides or their binding partners, or other ligands or agents that are similar to, or antagonize, or modulate their production, are subject to abnormal fluctuations in body weight or hyperlipidemia alone. Or in a pharmaceutical composition with a carrier suitable at a concentration effective for administration by various means to treat them to a patient who has caused them as part of a bad medical condition such as cancer or AIDS. Various dosing techniques may be used, including oral administration, other forms of intranasal or transmucosal administration, parenteral techniques such as subcutaneous, intravenous and intraperitoneal injections, catheterization and the like. The average amount of recognizers or their subunits may vary, and should be in accordance with the recommendations and prescriptions of a specialist or veterinarian in particular.

As described above, assay systems can be prepared that screen for potential drugs effective to mimic or antagonize the activity of a weight modulator. Body weight modulators can be introduced into the test system, the expected drug can also be introduced into the resulting cell culture, and the culture can then be examined to determine the expected addition of the drug alone, or of known amounts Observe whether there is a change in cell activity due to the effect of the weight modulator.

As noted above, the class of substances that act to modulate mammalian body weight at the molecular level by molecular cloning of the OB gene described herein is identified. The discovery of the modulators of the present invention is directed to the diagnosis and treatment of nutritional diseases, including but not limited to obesity, weight loss associated with cancer, and diseases associated with obesity, such as hypertension, heart disease and type II diabetes. It is important to care. There are also potential agricultural uses for gene products where there is a desire to modulate the weight of livestock. Finally, as one or more modulators of the invention are secreted molecules, they can be used biochemically to isolate their receptors using techniques of expression cloning. The following description, with specific reference to the OB gene, encompasses the general applicability of the class of modulators which form part of the present invention and therefore is to be accorded the extent and scope of this description.

As mentioned above, the functional activity of OB polypeptides can be assessed by transduction. In this regard, a transgenic mouse model can be used. The ob gene can be used in complementation studies using transgenic mice. Transgenic vectors, including viral vectors, or cosmid clones (or phage clones) corresponding to the wild type locus of the candidate genes can be constructed using isolated ob genes. Cosmids can be introduced into transgenic mice using known methods [Jaenisch, Science, 240: 1468-1474 (1988)]. The construct is introduced into fertilized eggs derived from xenocrossing between F1 progeny of C57BL / 6J ob / ob X DBA intercross. These crosses require the use of C57BL / 6J ob / ob ovarian grafts to generate F1 animals. Since DBA / 2J mice have a nonagouti coat color, which is important when using ovarian grafts, they are used as occulterstrain. The genotype at the ob locus in cosmid transgenic animals can be determined by characterizing the animal using closely linked RELPs or microsatellites that are adjacent to the mutation and polymorphic among the ancestral strains. Complementarity can be demonstrated when certain constructs cause genetically obese F2 animals (scored by RFLP analysis) to dry and become non-diabetic. Under these circumstances, the final proof of complementarity requires the crossing of ob / ob or db / db animals carrying transgenes to ob / ob or db / db ovarian grafts. In this mating, all N2 animals without transgenes are obese and insulin resistant / diabetic, while animals with transgenes can dry out and have normal glucose and insulin concentrations in plasma. In the genetic concept, the transgene acts as a suppressor mutation.

Instead, OB genes can be tested by examining their phenotypic effects when expressed in antisense orientation in wild-type animals. In this attempt, expression of the wild type allele is inhibited to induce a mutant phenotype. RNA-RNA duplex formation (antisense-sense) interferes with normal handling of mRNA, resulting in partial or complete elimination of wild-type gene effects. The technique has been used to inhibit TK synthesis in tissue culture and generate phenotypes of Kruppel mutations in Drosophila and Shiverer mutations in mice [Izant et al. , Cell, 36: 1007-1015 (1984); Green et al., Annu. Rev. Biochem., 55: 569-597 (1986); Katsuki., Science, 241: 593-595 (1988). An important advantage of this approach is that only a small portion of the required genes are expressed for effective suppression of the expression of complete homologous mRNAs. The antisense transgene is located under the control of its own form promoter or another promoter expressed in the correct cell type and upstream of the SV40 polyA site. This transgene can be used to generate transgenic mice. Transgenic mice can also be crossed with ovarian grafts to test whether the ob heterozygotes are more sensitive to the effects of antisense constructs.

In the long run, the description of the biochemical function of an OB gene product (OB polypeptide or protein) is useful for identifying small molecule agonists and antagonists that affect their activity.

Various terms used throughout this specification have the definitions set forth herein, for example, below.

The terms "weight modulator", "modulator", "modulators" and all variations not specifically listed may be used interchangeably herein and as used throughout this application and claims. As used herein, both nucleotides and proteinaceous material, including both single and multiple proteins. More specifically, the terms described above extend to DNA and nucleotides having the sequences described herein and shown in FIGS. 1A-E (SEQ ID NO: 1) and FIGS. 2A-B (SEQ ID NO: 3). Likewise, proteins having amino acid sequence data described herein and shown in FIGS. 1A-E (SEQ ID NO: 2) and FIG. 3 (SEQ ID NO: 4) are also described herein with respect to all materials in this specification and claims. It is likewise considered because it has a profile of activity. Thus, nucleotides that exhibit substantially equivalent or modified activity, including substantially homologous homologs and allelic variants, are likewise included. Likewise, proteins that exhibit substantially equivalent or modified activity, including proteins that have been modified intentionally, for example by site-directed mutagenesis or through mutations in a host that produces a modulator, are likewise included.

A composition containing “A” (where “A” is a single protein, DNA molecule, vector, recombinant host cell, etc.) comprises at least about 75% by weight of the protein, DNA, vector (A and B to which it belongs) Where "A" is substantially "B" (where "B" is one or more contaminating proteins, DNA molecules, vectors, etc., but excludes the racemic form of A) I never do that. Preferably, "A" contains at least about 90% by weight A + B species in the composition, most preferably at least about 99% by weight. In addition, it is preferred that a composition that is substantially free of contaminants contains only a single molecular weight species having the activity or characteristics of that species.

OB polypeptide

The terms “protein” and “polypeptide”, which refer to naturally occurring polypeptides, are used interchangeably herein with reference to the ob gene product and variants thereof. The term “mature protein” or “mature polypeptide” especially refers to the OB gene product from which the signal sequence (or fusion protein partner) has been removed.

As mentioned above, in certain embodiments the ob polypeptides of the invention include those having the amino acid sequences described herein, such as SEQ ID NOS: 2, 4, 5, 6, and the like, which are conserved Ob polypeptides modified by red amino acid substitutions and biologically active fragments, homologs and derivatives thereof. As used herein, the term “biologically active” includes, for example, specific binding to a receptor, antibody or other recognition molecule; Activation of signal transduction pathways at the molecular level; And / or specific effects of polypeptides including, but not limited to, induction of physiological effects mediated by native ob polypeptides (or inhibition by antagonists) in vivo. OB polypeptides, including fragments, homologs and derivatives, can be prepared synthetically using, for example, well known techniques of solid phase or solution phase peptide synthesis. Preferably, solid phase synthesis techniques are used. Alternatively, the OB polypeptides of the invention may be prepared using well known genetic engineering techniques as described below. In another embodiment, the OB polypeptide is plasma, serum or urine, more preferably derived from a subject who has overexpressed the polypeptide, such as an obese person who has caused obesity associated with mutations in the OB receptor or mutations corresponding to “fats”. , Preferably, but not limited to, biological fluids such as, but not limited to, human plasma, serum or urine, for example by immunoaffinity purification.

Fragment of OB Polypeptide

In certain embodiments, the present invention assumes that naturally occurring fragments of the OB polypeptide may be important. Peptide sequences frequently contain a number of sites, for example arginine residues, that are targeted for proteolytic cleavage. There is a possibility that the full length polypeptide may be cleaved at one or more such sites to form biologically active fragments. Such biologically active fragments may be functional or antagonistic to the functional activity of the OB polypeptide, resulting in weight loss.

Homologs of OB Polypeptides

The present invention particularly includes the preparation of homologues of OB peptides, which are characterized in that they can exhibit the biological activity of OB polypeptides that bind to specific binding partners of ob peptides such as, for example, OB receptors. In one embodiment, the homologues are functional for OB activity, ie it acts similarly to ob peptides. Preferably, OB agonists are more effective than natural proteins. For example, an OB agonist analog can bind to an OB receptor with greater affinity, or exhibit longer half-life in vivo, or both. Nevertheless, OB agonist analogs that are less effective than natural proteins are also included. In another embodiment, the homologues antagonize OB activity. For example, OB homologues that bind to OB receptors but do not induce signal transduction can competitively inhibit binding of native OBs to receptors, thereby lowering OB activity in vivo. Such OB antagonist homologues may also exhibit different properties than ob peptides, eg, longer (or shorter) half-life in vivo, greater (or smaller) binding affinity for the OB receptor, or both. .

In one embodiment, the homologue of an OB peptide is an OB peptide modified by substituting amino acids present at positions on the polypeptide that are not essential for structure or function. For example, since human OB peptides are known to be biologically active in mice, substitution of branched amino acid residues in human sequences can likewise yield useful homologues of OB peptides as compared to mouse amino acid sequences. . For example, a serine residue present at position 53 or at position 98 or both positions (in the untreated peptide sequence shown in FIG. 4) from humans may be substituted by, for example, glycine, alanine, valine, cysteine, methionine or threonine. Can be. Similarly, the arginine residue present at position number 92 (FIG. 4) may be substituted with, for example, asparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine, threonine, methionine or cysteine. Continuing with reference to FIG. 4, other amino acids in the human OB peptide that may be substituted are histidine at position 118, tryptophan at position 121, alanine at position 122, glutamic acid at position 126, threonine at position 127, position Leucine at 128, glycine at position 132, glycine at position 139, tryptophan at position 159, and glycine at position 166. In another embodiment one or more of residues 121-128 (as shown in FIG. 4) may be substituted, for example, with glycine or alanine, or excluding serine at position 123 or leucine at position 125 Some of the residues may be substituted.

In another embodiment the homologue of the OB polypeptide, preferably the human OB polypeptide, is a truncated form of the polypeptide. For example, glutamine at residue 49 is not essential and has already been demonstrated that can be deleted from the peptide. Similarly, it may be possible to delete all or part of an amino acid residue branched at positions 121-128. The present invention also includes providing OB homologues with the minimum amino acid sequence necessary for biological activity. This can be readily determined, for example, by testing the activity of fragments of OBs on their ability to bind OB-specific antibodies, inhibit the activity of native OB polypeptides, or act on the activity of native OB peptides. In one embodiment, the present invention provides a truncated OB polypeptide consisting of a loop structure formed by disulfide bonds formed between cysteine residues 117 and 167 (as shown in FIG. 4). In another embodiment, the cleaved homologue is located immediately before the flexible loop portion detected by residue 22 (located after the putative signal peptide cleavage site) to 53 (limited proteolysis followed by mass spectrometry of the OB polypeptide). Amino acid residues, corresponding to amino acids up to Cohen et al., Protein Science, 4: 1088 (1995)). In another embodiment, the cleaved homologue is residue 61 (residue immediately after the flexible loop portion as detected by limited proteolysis / mass spectrometry of the OB polypeptide) from amino acid residue 116 (residue immediately before the first cysteine residue). Corresponds to amino acids up to In another embodiment, the truncated homologue corresponds to amino acids from residue 61 to amino acid residue 167.

Moreover, one or more of the residues of the putative flexible loop at residues 54-60 are substituted. For example, because the flexible loop structure is a preferred site for derivatization of the protein, one or more residues may be replaced with lysine, glutamic acid, or cysteine (preferably lysine), for example, for crosslinking to the polymer. Can be. Alternatively, the residue at the flexible loop position is more resistant to proteolysis, but the flexible structure may be substituted by retaining amino acid residues, for example one or more prolines. In another embodiment, substitutions by amino acids that can be further derivatized to make the protein more resistant to degradation, such as proteolysis, are also included.

The size of the foregoing fragments is approximate and may include or delete from one to about five amino acids, from each end or both ends of the indicated cleaved homolog, or from the inside of the polypeptide or fragment thereof, provided that disulfide bonds It will be appreciated by those skilled in the art that the cysteine residues in the loop homologs must be maintained.

Murine OB peptides contain 50% α-helix content and human OB polypeptides detect about 60% α-helix content as detected by the circular dichroism of the recombinant peptide under approximate physiological conditions. It was found to contain. Thus, in another embodiment, amino acid residues may be substituted by residues that form α-helix structures, or those that form homologues of OB polypeptides that exhibit increased tendency to form more stable α-helix structures. For example, α-helix structures may be preferred when Glu, Ala, Leu, His, Trp are introduced as substituents to amino acid residues present in the native OB polypeptide. Preferably, aspartic acid glutamic acid (s) at conservative amino acid substitutions, eg, residue (s) 29, 30, 44, 61, 76, 100 and / or 106 (as shown in FIG. 4) ( Glu); Replacing isoleucine (s) with leucine; Replacing glycine or valine or branched amino acid with alanine (eg, serine with alanine at position 53 of the human OB polypeptide); Replacing arginine or lysine with histidine; Substitution of tyrosine and / or phenylalanine with tryptophan is used. By increasing the degree of α-helix structure, or more importantly the stability, one can obtain OB homologues with greater activity, increased binding affinity or longer half-life. In specific embodiments, the helix formation potential of the portion of the OB peptide corresponding to amino acid residues 22-53 is increased. In another embodiment, the helix-forming potential or stability of amino acid residues 61-116 is increased. In another embodiment, the helix formation potential of the disulfide loop structure corresponding to amino acids 117-167 is also increased. Also included are OB homologs that contain enhanced α-helix potential or stability in one or more of the aforementioned regions. In further embodiments, truncated OB polypeptide homologs are generated that incorporate structure-forming, eg, spiral-forming, amino acid residues that compensate for the greater tendency of polypeptide fragments to lack stable structures.

Homologs, such as fragments, can be produced, for example, by pepsin digestion of a peptide substance that is a weight modulator. Other homologues such as muteins can be produced by standard site-directed mutagenesis of peptide coding sequences that are weight modulators. Homologs that exhibit "weight modulating activity" such as small molecules, whether acting as promoters or inhibitors, can be identified by known in vivo and / or in vitro assays.

Small molecule homologs and peptidomimetics of OB polypeptides

The structure of an ob polypeptide, preferably a human OB polypeptide, can be analyzed by various methods known in the art. Protein sequences can be characterized by hydrophilic analysis [eg, Hopp et al., Proc. Natl. Acad. Sci. USA, 78: 3824 (1981). The hydrophilic profile can be used to identify hydrophobic and hydrophilic portions of the OB polypeptide, and portions that are easily accessible on the outside of the polypeptide, which can indicate the portion buried inside the folded polypeptide. In addition, secondary structure analysis (eg, Chou et al., Biochem., 13: 222 (1974)) may also be performed to identify portions of OB polypeptides that exhibit specific secondary structures. Manipulation of predicted or determined structures, including secondary structure predictions, can be accomplished using computer software programs available in the art.

By providing a rich source of presynthesized OB polypeptides, the present invention enables quantitative structural determination of polypeptides. In particular, sufficient materials are provided for nuclear magnetic resonance (NMR), infrared (IR), Raman and ultraviolet (UV), in particular cyclic dichroism (CD), spectroscopic analysis. In particular, NMR provides very powerful structural analysis of corresponding molecules more closely in their natural environment [Marion et al., Biochim. Biophys. Res. Comm., 113: 967-974 (1983); Bar et al., J. Magn. Reson., 65: 355-360 (1985); Kimura et al., Proc. Natl. Acad. Sci. USA, 77: 1681-1685 (1980). Other methods of structural analysis can also be used. These include, but are not limited to, X-ray crystallography [Engstom, Biochem. Exp. Biol., 11: 7-13 (1974).

In further embodiments, homologs of the OB polypeptide can be tested to determine whether it cross reacts with an antibody specific for the native OB polypeptide or a specific fragment thereof. The degree of cross-reactivity provides information about the structural homology or similarity of the protein, or about the availability of the portion corresponding to the portion of the polypeptide used to generate the fragment-specific antibody.

Screening for OB Homologs

Various screening techniques for screening homologs of polypeptides are known in the art. Various libraries of chemicals are available. Accordingly, the present invention is directed to screening such libraries for homologs of OB polypeptides, such as libraries of synthetic compounds, libraries of natural compounds, and combined libraries produced by years of research, as described in more detail below. Include. In one embodiment, the present invention comprises screening such libraries for compounds that bind anti-OB polypeptide antibodies, preferably anti-human ob polypeptide antibodies. In another aspect, once the OB receptor has been identified (see below), any screening technique known in the art can be used to select OB receptor agonists or antagonists. The present invention includes screening for small molecule ligands or ligand analogs and analogs, and screening for natural ligands that bind to and act on or antagonize OB receptors in vivo.

Knowledge of the primary sequence of a receptor and its similarity to that of a protein having a known function can provide an initial clue to the agonist or antagonist of the protein. Identification and selection of antagonists is made easier by determining the structural characteristics of the protein using, for example, X-ray crystallography, neutron diffraction, nuclear magnetic resonance spectroscopy and other techniques for structure determination. These techniques provide for the rational design or identification of agents and antagonists.

Another approach is to generate large libraries using recombinant bacteriophages. "Phage method" [Scott et al., Science, 249: 386-390 (1990); Cwirla et al., Proc. Natl. Acad. Sci. USA, 87: 6378-6382 (1990); Devlin et al., Science, 249: 404-406 (1990) can be used to construct very large libraries (10 ⁶ -10 ⁸ chemicals). In the second approach, mainly chemical methods are used, examples of which include the Geysen method [Geysen et al., Molecular Immunology, 23: 709-715 (1986); Geysen et al., J. Immunologic Method, 102: 259-274 (1987) and Foder et al. (Foder et al., Science, 251: 767-773 (1991)). See also Furka et al., 14th International Congress of Biochemistry, Volume 5, Abstract FR: 013 (1988); Furka, Int. J. Peptide Protein Res., 37: 487-493 (1991); Houghton, US Pat. No. 4,631,211 (patented Dec. 1986); And Rutter et al., US Pat . No. 5,010,175 (patented Apr. 23, 1991), describe a method for producing a mixture of peptides that can be tested as an agonist or antagonist.

In another aspect, synthetic libraries [Needels et al., Proc. Natl. Acad. Sci. USA, 90: 10700-10704 (1993); Lam et al., International Patent Publication No. WO 92/00252, each of which is incorporated herein by reference), and the like. This library allows for the detection of receptor antagonists using cells expressing the receptor without actually cloning the OB receptor.

Alternatively, a test for binding of the soluble ligand to the cell expressing the recombinant form of the OB receptor ligand binding region can be performed. Soluble ligands can be readily provided as recombinant or synthetic OB polypeptides.

The selection method may be performed by recombinant cells expressing the OB receptor, or by using purified receptor proteins produced recombinantly, for example, as described above, in place of substitution. For example, the ability to bind a ligand of a labeled soluble or solubilized OB receptor, including the ligand-binding portion of the molecule, can be used to select a library as described in the literature cited above.

Derivatives of OB Polypeptides

In general, a protein of the invention, wherein the term "protein" is used in the sense including "polypeptide" unless otherwise indicated, can be derivatized by attaching one or more chemical sites to the protein site. have. Chemically modified derivatives may be further formulated for intraarterial, intraperitoneal, intramuscular, subcutaneous, intravenous, oral, nasal, rectal, buccal, sublingual, pulmonary, topical, transdermal or other routes of administration. Chemical modification of biologically active proteins has been found to provide additional benefits under certain circumstances, such as increasing the stability and circulation time of the therapeutic protein and decreasing immunogenicity. [US Pat. No. 4,179,337 (patented in Davis et al., Dec. 18 , 1979; see for review: Abuchowski et al., “Soluble Polymer-Enzyme Adducts”, in Enzymes as Drugs, pp. 367-). 383, Holcenberg and Roberts, eds., Wiley-Interscience, New York, NY (1981). There is also a review literature describing protein modifications and fusion proteins [Francis, Focus on Growth Factors, 3: 4-10 (1992). ].

Chemical site for derivatization

Suitable chemical moieties for derivatization can be selected from water soluble polymers. The polymer chosen should be water soluble so that the protein to which it is attached does not precipitate in an aqueous environment, such as a physiological environment. Preferably, the polymer should be pharmaceutically acceptable for the therapeutic use of the final product formulation. Those skilled in the art will appreciate that based on considerations such as whether the polymer / protein conjugate is used therapeutically and if so, the desired dose, cycle time, resistance to proteolysis, and other considerations. The desired polymer can be selected. In the case of proteins and peptides of the invention, they can be identified using the test methods set forth herein.

Polymer molecules

Water soluble polymers include, for example, copolymers of polyethylene glycol, ethylene glycol / propylene glycol, carboxymethylcellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone, poly-1,3-dioxolane, poly-1,3, 6-trioxane, ethylene / maleic anhydride copolymer, polyamino acid (homopolymer or random copolymer), and dextran or poly (n-vinyl pyrrolidone) polyethylene glycol, propylene glycol homopolymer, polypropylene oxide / ethylene It can be selected from the group consisting of oxide copolymers, polyoxyethylated polyols and polyvinyl alcohols. Polyethylene glycol propionaldehyde may provide advantages in manufacturing due to its stability in water.

The polymer may be of any molecular weight and may or may not be branched. In the case of polyethylene glycol the preferred molecular weight is from about 2 kDa to about 100 kDa for ease of handling and preparation (wherein the term "about" means that some molecules at the time of preparation of polyethylene glycol may be larger or somewhat smaller than the mentioned molecular weight. Implies that you can). Desired therapeutic profile (e.g., desired duration of sustained release, impact on biological activity, if present, ease of handling, degree or lack of antigenicity, and other known effects of polyethylene glycol on therapeutic proteins or homologues Other sizes may be used.

Polymer / protein ratio

The number of polymer molecules thus attached may vary, and those skilled in the art can ascertain the effect on function. It may be mono-derivatized or may be provided with some combination of di-, tri-, tetra-derivatization or derivatization having the same or different chemical moieties (eg polymers such as polyethylene glycol of varying weights). have. The ratio of polymer molecules to protein (or peptide) molecules can vary as well as their concentration in the reaction mixture. In general, the optimum ratio (in terms of the efficiency of the reaction without excess unreacted protein or polymer) is determined by the degree of derivatization desired (eg, mono, di-, tri-, etc.), of the selected polymer. It may be determined by factors such as molecular weight, whether the polymer is branched or not, and reaction conditions.

Attachment of chemical sites to proteins

Polyethylene glycol molecules (or other chemical moieties) should be attached to the protein taking into account the effect on the functional or antigenic region of the protein. There are a number of methods of attachment available to those skilled in the art (e.g. EP 0 401 384 (coupling of PEG to G-CSF), incorporated herein by reference). et al., Exp. Hematol., 20: 1028-1035 (1992) (reporting pegylation of GM-CSF with tresyl chloride). For example, polyethylene glycol can be covalently linked through amino acid residues by reactive groups such as free amino or carboxyl groups. Reactive groups are those to which activated polyethylene glycol molecules can be bound. Amino acid residues having free amino groups may include lysine residues and N-terminal amino acid residues, and those having free carboxyl groups may include aspartic acid residues, glutamic acid residues and C-terminal amino acid residues. Sulhydryl groups may also be used as reactive groups for attaching the polyethylene glycol molecule (s). Preferred for therapeutic purposes are attachments at amino groups such as attachments at the N-terminus or lysine group. Where receptor binding is required, attachment at residues important for receptor binding should be avoided.

Chemically Modified Protein at the N-Terminal

In particular, one may need a protein that is chemically modified at the N-terminus. In the case of using polyethylene glycol as an example of the composition of the present invention, it is used for various polyethylene glycol molecules (by molecular weight, branching, etc.), the ratio of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mixture, the pegylation reaction carried out. And a method for obtaining a phylated protein at the selected N-terminus. A method of obtaining a n-terminally penetrated agent (i.e., separating this site from other mono-pegylated sites, if necessary) results in the removal of the n-terminated phylated material from the population of phylated protein molecules. By purification. Selective N-terminal chemical modifications can be performed by reductive alkylation reactions utilizing different reactivity of various forms of primary amino groups (lysine versus N-terminus) available for derivatization in a particular protein. Under appropriate reaction conditions, substantially selective derivatization of the protein takes place at the N-terminus with a polymer containing carbonyl groups. For example, a protein can be selectively pepsilized at the N-terminus by carrying out the reaction at a pH where the pK _a difference between the ε-amino group of the lysine residue and the α-amino group of the N-terminal residue of the protein is available. have. This selective derivatization regulates the attachment of the water soluble polymer to the protein; Conjugation with the polymer occurs mainly at the N-terminus of the protein and no significant change of other reactive groups such as lysine side chain amino groups occurs. By using reductive alkylation, the water soluble polymer can have the form described above and must have a single reactive aldehyde for coupling to the protein. Polyethylene glycol propionaldehyde containing a single reactive aldehyde can be used.

Nucleic Acids Associated with OB Polypeptides

As noted above, the present invention relates to nucleic acids encoding ob polypeptides, and associated genome non-coding sequences 5 ', 3' and introns for the OB gene. That is, according to the present invention, molecular biology, microbiology and recombinant DNA techniques conventional in the art can be used. Such techniques are described in detail in the literature [see, eg, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (1989); Glover ed., DNA Cloning: A Practical Approach, Volumes I and II, MRL Press, Ltd., Oxford, UK (1985); Gait ed., Oligonucleotide Synthesis, Oxford University Press (1984); Hames et al., Eds., Nucleic Acid Hybridization, Springer-Verlag (1985); Hames et al., Eds., Transcription And Translation, Oxford University Press (1984); Freshney ed., Animal Cell Culture, Oxford University Press (1986); Immobilized Cells And Enzymes, IRL Press (1986); Perbal, A Practical Guide To Molecular Cloning, Wiley, New York (1984). Particularly suitable for the present invention are methods for isolating, cloning, sequencing, analyzing and characterizing drivers or nucleic acids based on well known polymerase chain reaction (PCR) techniques.

A "replicon" is a genetic element (eg, plasmid, chromosome, virus) that acts as an autonomous unit of DNA replication in vivo, i.e., can reproduce under its own control.

A "vector" is a replicon, such as a plasmid, phage or cosmid, to which another DNA fragment may be attached to cause replication of the attached fragment.

"Cassette" means a segment of DNA that can be inserted into a vector at specific restriction sites. Segments of DNA encode the polypeptide of interest, and cassettes and restriction sites are designed to ensure insertion of the cassette into a suitable reading frame for transcription and translation.

"Heterologous" DNA refers to DNA that is not naturally located within a cell or within a chromosomal site of the cell. Preferably, the heterologous DNA comprises a foreign gene for the cell.

When exogenous or heterologous DNA is introduced into a cell, the cell is "transfected" by this DNA. If the transfected DNA caused a phenotypic change, the cell was "transformed" by exogenous or heterologous DNA. Preferably, the transforming DNA should be integrated (covalently bound) into the chromosomal DNA to make up the genome of the cell.

A "clone" is a population of cells derived from a single cell or common progenitor by mitosis.

A “nucleic acid molecule” is a ribonucleoside (adenosine, guanosine, uridine or cytidine; “RNA molecule”) or a deoxyribonucleoside (deoxyadenosine, des) in the single-stranded or double-stranded helix form. Phosphate ester polymer form of oxyguanosine, deoxythymidine or deoxycytidine; "DNA molecule"). There may be double-stranded DNA-DNA, DNA-RNA and RNA-RNA helices. The term nucleic acid molecule, in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to a particular tertiary or quaternary form. Thus, the term particularly includes double-stranded DNA found in linear or circular DNA molecules (eg, restriction fragments), plasmids and chromosomes. In describing the structure of a particular double-stranded DNA molecule, the sequence is used herein to present only sequences in the 5 'to 3' direction along the non-read strands of DNA (ie, strands having sequences homologous to mRNA). It may be described in accordance with standard agreements. A "recombinant DNA molecule" is a DNA molecule on which molecular biological manipulations have been performed.

Where a single-stranded form of a nucleic acid molecule can anneal to another nucleic acid molecule under appropriate conditions of temperature and solution ionic strength, the nucleic acid molecule will "hybridize" to another nucleic acid molecule such as cDNA, genome DNA or RNA. (Sambrook et al., 1989, supra). The conditions of temperature and ionic strength determine the "stringency" of hybridization. For preliminary screening for homologous nucleic acids, low stringency hybridization conditions corresponding to T _m of 55 ° C. can be used (eg 5 × SSC, 0.1% SDS, 0.25% milk, and no formamide; Or 30% formamide, 5 × SSC, 0.5% SDS). Moderately stringent hybridization conditions correspond to higher T _m , for example 40% formamide and 5 × or 6 × SSC. High stringency hybridization conditions correspond to the highest T _m , for example 50% formamide, 5 × or 6 × SCC. Hybridization requires that two nucleic acids contain complementary sequences, but depending on the stringency of the hybridization, mismatches between bases may occur. Proper stringency for hybridizing nucleic acids depends on the length of the nucleic acid and the degree of complementarity, variables well known in the art. The greater the degree of similarity or homology between two nucleotide sequences, the greater the value of T _m for hybridization of nucleic acids having these sequences. The relative stability of nucleic acid hybridization (corresponding to higher T _m ) declines in the following order: RNA: RNA, DNA: RNA, DNA: DNA. For hybrids greater than 100 nucleotides in length, a formula for calculating T _m was derived (Sambrook et al., 1989, supra, 9.50-0.51). In the case of hybridization with shorter nucleic acids, for example oligonucleotides, the location of the mismatch becomes more important, and the length of the oligonucleotide determines its specificity (see Sambrook et al., 1989, supra, 11.7-). 11.8). Preferably, the minimum length for the hybridizable nucleic acid is at least about 10 nucleotides, more preferably at least about 15 nucleotides, and most preferably at least about 20 nucleotides in length.

"Cognate recombination" means the insertion of a foreign DNA sequence of a vector into a chromosome. Preferably, the vector targets specific chromosomal sites for cognate recombination. In the case of specific homologous recombination, the vector contains a sufficiently long site homologous to the sequence of the chromosome to enable complementary binding and import of the vector into the chromosome. The longer the homologous moiety and the greater the degree of sequence similarity can increase the efficiency of homologous recombination.

DNA “coding sequences” are double-stranded DNA sequences that are transcribed or translated into polypeptides in cells in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequences are determined by start codons at the 5 '(amino) terminus and detox stop codons at the 3' (carboxy) terminus. The coding sequence may include, but is not limited to, prokaryotic sequences, cDNAs from eukaryotic mRNAs, genome DNA sequences from eukaryotic (eg, mammalian) DNAs, and synthetic DNA sequences. In the case where the coding sequence is to be expressed in eukaryotic cells, the polyadenylation signal and transcription termination sequence can typically be located 3 'to the coding sequence.

OB coding and isolation of flanking sequences

Nucleic acids included in the present invention are described herein as shown in Figures 1A to D (SEQ ID NO: 2), Figure 3 (SEQ ID NO: 4), Figure 5 (SEQ ID NO: 5) and Figure 6 (SEQ It extends to other nucleic acids that encode to express peptides as described in ID NO: 6). Thus, while specific DNA is isolated and sequenced with respect to the ob gene, any animal cell can potentially be used as a nucleic acid source for molecular cloning of a gene encoding a peptide of the invention. DNA can be synthesized from standard cloned DNA (e.g., DNA "libraries") by chemical synthesis, cDNA cloning, or by cloning purified genome DNA or fragments thereof from cells of interest. Obtainable by: Sambrook et al., 1989, supra; Glover, 1985, supra). Clones derived from genome DNA may contain regulatory and intron DNA portions in addition to the coding portions; Clones derived from cDNA do not contain intron sequences. Whatever the source, the gene must be molecularly cloned in a vector suitable for propagation of the gene.

In molecular cloning of genes from genome DNA, genome DNA can be amplified using primers selected from cDNA sequences. In place of substitution, DNA fragments are generated, some of which encode the genes of interest. DNA can be cleaved at specific sites using various restriction enzymes. In addition, DNA may be fragmented using DNase in the presence of manganese, or the DNA may be physically sheared by, for example, sonication. The linear DNA fragments can then be separated by size by standard techniques, including but not limited to agarose and polyacrylamide gel electrophoresis and column chromatography.

Once the DNA fragments are generated, identification of specific DNA fragments containing the desired ob or ob -quantity genes can be performed in a number of ways. For example, if a quantity of an ob or ob -quantity gene or a portion of a specific RNA thereof, or fragment thereof, is available and can be purified and labeled, the resulting DNA fragment is selected by nucleic acid hybridization to a labeled probe. Benton et al., Science, 196: 180 (1977); Grunstein et al., Proc. Natl. Acad. Sci. USA, 72: 3961 (1975). The present invention is shown in such nucleic acid probes that can be conveniently prepared from the specific sequences described herein, for example in FIGS. 1A-E (SEQ ID NO: 1) or in FIGS. 2A and B (SEQ ID NO: 3). Provided are hybridizable probes having nucleotide sequences corresponding to at least 10, preferably 15 nucleotide fragments of the sequence sequence. Preferably, very unique fragments are selected for the modulator peptides of the invention. These DNA fragments with significant homology to the probes will hybridize. As mentioned above, the greater the degree of homology, the more rigorous the hybridization conditions that can be used. In one embodiment, low stringency hybridization conditions are used to identify homologous modulator peptides. In a preferred aspect, however, as demonstrated experimentally in the present invention, nucleic acids encoding the modulator peptides of the present invention are subjected to moderately stringent conditions, as shown in FIGS. 1A-E (SEQ ID NO: 1) or FIGS. 2A and B (SEQ). Hybridization to a nucleic acid having a nucleotide sequence as shown in ID NO: 3) or a hybridizable fragment thereof, more preferably under highly stringent conditions.

Alternatively, the presence of a gene can be detected by an assay based on the physical, chemical or immunological properties of its expressed product. For example, proteins such as those having electrophoretic migration, isoelectric focusing behavior, proteolytic degradation maps, tyrosine phosphatase activity, or antigenic properties similar or identical to those known for the modulator peptides of the invention. The cDNA clones that are produced, or DNA clones that hybridize-select appropriate mRNAs can be selected. For example, the antibodies of the invention can be conveniently used to select homologs of modulator peptides from other sources.

Genes encoding the modulator peptides of the invention may also be identified by mRNA selection, ie by nucleic acid hybridization followed by in vitro translation. In this method, fragments are used to separate complementary mRNAs by hybridization. Such DNA fragments are available and can represent purified modulator DNA. Immunoprecipitation or functional assays (e.g., tyrosine phosphatase activity) of in vitro detox products of the product of isolated mRNAs identify mRNA, and thus complementary DNA fragments containing the desired sequence. Specific mRNAs can also be selected by adsorbing polysomes isolated from cells to immobilized antibodies specifically directed against modulator peptides.

Radiolabeled modulator peptide cDNA can be synthesized using selected mRNA (from adsorbed polysomes) as a template. The radiolabeled mRNA or cDNA can then be used as a probe to identify homologous modulator peptide DNA fragments from other genome DNA fragments.

As mentioned above, DNA sequences encoding body weight modulator peptides as described herein can be made synthetically, rather than cloned. DNA sequences can be designed by appropriate codons for the weight modulator peptide amino acid sequences. In general, anyone can select a preferred codon for the desired host if the sequence is used for expression. The complete sequence is assembled from overlapping oligonucleotides prepared by standard methods and assembled into fully encoded sequences (see, eg, Edge, Nature, 292: 756 (1981); Nambair et al., Science, 223: 1299 (1984); Jay et al., J. Biol. Chem., 259: 6311 (1984).

Synthetic DNA sequences allow convenient construction of genes expressing weight modulator homologues as described above. Alternatively, DNA encoded homologs can be prepared by site-directed mutagenesis of native OB genes or cDNAs, and homologues can be prepared directly using conventional polypeptide synthesis.

General methods for site-specific incorporation of non-natural amino acids into proteins are described in Noren et al., Science, 244: 182-188 (1989). This method can be used to generate homologues of ob polypeptides with non-natural amino acids.

Non-encoded nucleic acid

The present invention extends to the preparation of antisense nucleotides and ribozymes that can be used to inhibit the expression of weight modulator proteins at the level of translation. This method uses antisense nucleic acids and ribozymes to block the translation of specific mRNAs by masking the mRNAs with antisense nucleic acids or cutting them into ribozymes.

Antisense nucleic acids are DNA or RNA molecules that are complementary to at least a portion of specific mRNA molecules . See Weintraub, Sci. Am., 262: 40-46 (1990); Marcus-Sekura, Anal. Biochem., 172: 289-295 (1988). In cells, they hybridize to their mRNA to form double-stranded molecules. Cells do not decode mRNAs complexed with this double-stranded form. Thus, antisense nucleic acids interfere with the expression of mRNA into protein. Oligomers of about 15 nucleotides and molecules that hybridize to AUG initiation codons are easy to synthesize and are likely to pose fewer problems than larger molecules when introduced into body weight modulator peptide-producing cells as well. Especially efficient. Antisense methods have been used to inhibit expression of many genes in vitro [Marcus-Sekura, 1988, supra; Hambor et al., J. Exp. Med., 168: 1237-1245 (1988).

Ribozymes are RNA molecules that have the ability to specifically cleave other single-stranded RNA molecules in a manner somewhat similar to DNA restriction endonucleases. Ribozymes were discovered by the observation that certain mRNAs have the ability to cleave their own ytrons. By modifying the nucleotide sequences of these RNAs, researchers have been able to manipulate molecules that recognize and cleave specific nucleotide sequences within RNA molecules [Cech, J. Am. Med. Assoc., 260: 3030-3034 (1988). Because they are sequence-specific, only mRNAs with specific sequences are inactivated.

The researchers identified two types of ribozymes, the Tetrahymena -type and the "hammerhead" -type. Tetrahymena-type ribozymes recognize 4-base sequences, while "hammerhead" -type recognize 11--18-base sequences. The longer the recognition sequence, the more likely it is to appear exclusively in the target mRNA species. Thus, hammerhead-type ribozymes are more preferred than tetrahymena-type ribozymes for inactivating specific mRNA species, and 18 base recognition sequences are more preferred than shorter recognition sequences.

Thus, the DNA sequences described herein can be used to prepare ribozymes that cleave antisense molecules and weight modulator proteins and mRNAs for their ligands, thereby inhibiting the expression of ob genes and increasing body weight. Increase and excess fat.

In another embodiment, short oligonucleotides complementary to the encoding and complementary strand of the OB nucleic acid or to the non-coding portion of the OB gene 5 ', 3' or internal (intron) towards the encoding portion are provided by the present invention. Is provided. Such nucleic acids are useful as probes for assessing the presence of mutations in the ob gene or expression level of OB mRNA, ie directly as labeled oligonucleotide probes or as primers for polymerase chain reaction. Preferably the non-encoding nucleic acid of the invention is derived from the human OB gene.

In certain embodiments, the non-encoded nucleic acid is, for example, to provide for higher levels of expression of the OB polypeptide or to overcome mutations in the ob gene regulatory sequence that prevents the appropriate level of expression of the OB polypeptide. , Cognate recombination for integrating amplifiable genes and / or other regulatory sequences in proximity to the OB gene. International Patent Publication WO 91/09955 (Chappel) published July 11, 1991; See also International Patent Publication No. WO 90/14092 (Kucherlapati and Campbell), published November 29, 1990].

Production of OB Polypeptides: Expression and Synthesis

Transcriptional and translational regulatory sequences are DNA regulatory sequences, such as promoters, enhancers, terminators, and the like, that provide for expression of coding sequences in host cells. In eukaryotic cells, polyadenylation signals are regulatory sequences.

If an RNA polymerase transcribes a coding sequence into mRNA, then the mRNA is trans-RNA conjugated and translated into a protein encoded by the coding sequence, the coding sequence is "under control" of the transcriptional and translational regulatory sequences. .

A "signal sequence" is included at the beginning of the coding sequence of a protein to be expressed on the surface of a cell. This sequence encodes an N-terminal signal peptide for the mature polypeptide that directs the host cell to translocate the polypeptide. The term "translocation signal sequence" as used in the present invention means this kind of signal sequence. Translocation signal sequences can be identified in association with a variety of proteins unique to eukaryotic and prokaryotic cells, and are often functional in both types of organisms.

When an expression control sequence regulates and controls the transcription and translation of the DNA sequence, the DNA sequence is "operably linked" to the expression control sequence. The term “operably linked” refers to the expression of the DNA sequence under the control of expression control sequences and the production of the desired product encoded by the DNA sequence, with an appropriate starting signal (eg, ATG) in front of the DNA sequence to be expressed. This includes keeping the reading frame as accurate as possible. If the desired gene to be inserted into the recombinant DNA molecule does not contain an appropriate starting signal, this starting signal can be inserted upstream (5 ') thereof in the reading frame with the gene.

A "promoter sequence" is a DNA regulatory region capable of binding RNA polymerase intracellularly and initiating transcription of downstream (3 'direction) coding sequences. For purposes of defining the present invention, a promoter sequence is bound upwards at its 3 'end by a transcription initiation site and upwards to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above the background amount (5). Direction). There may be transcriptional initiation sites (conveniently defined, for example, by locating by nuclease S1) within the promoter sequence, and protein binding regions (common sequences) that cause the binding of RNA polymerase. .

Another feature of the invention is the expression of the DNA sequences described herein. As is well known in the art, DNA sequences can be expressed by operably linking them to expression control sequences in an appropriate expression vector and transforming the appropriate single cell host using the expression vector.

Of course, operatively linking a DNA sequence of the present invention to an expression control sequence includes providing an initiation codon ATG in the correct reading frame upstream of the DNA sequence if it does not already contain a portion of the DNA sequence.

A wide variety of host / vessel vector combinations can be used to express the DNA sequences of the invention. Useful expression vectors can, for example, consist of segments of chromosomal, non-chromosomal and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids such as E. coli. E. coli plasmid col E1, pCR1, pBR322, pMB9, pUC or pUC plasmid derivatives, for example pGEX vectors, pET vectors, pmal-c, pFLAG and the like and derivatives thereof, plasmids such as RP4; Phage DNAs, for example a number of derivatives of phage λ, such as NM989, and other phage DNA such as M13 and fibrous single-stranded phage DNA; Yeast plasmids such as 2μ plasmid or derivatives thereof; Vectors useful in eukaryotic cells, such as vectors useful in insect or mammalian cells; Vector derived from a combination of plasmid and phage DNAs, such as plasmids modified using phage DNA or other expression control sequences. In a preferred embodiment, the expression of ob is in methylotrophic yeast, for example Pichia pastoris yeast. See, eg, WO 90/03431, published April 5, 1990. Brierley et al . ; International Patent Publication WO 90/10697 (Siegel et al. ) Published September 20, 1990]. In the following specific embodiments, expression vectors are engineered to allow the expression of ob under the control of the α-cross-signal signal sequence.

Any of a wide variety of expression control sequences, ie, sequences that regulate the expression of DNA sequences operably linked to the sequences, can be used to express the DNA sequences of the invention in these vectors. Such useful expression control sequences include, for example, early or late promoters of SV40, CMV, vaccinia, polyoma or adenovirus, lac system, trp system, TAC system, TRC system, LTR system, main operator and promoter of phage λ. Moiety, regulatory portion of the fd envelope protein, promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, promoter of acid phosphatase (eg, Pho5), AOX 1 promoter of methyltrophic yeast, enzyme α-crossing Promoters of factors, and other sequences known to modulate the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof.

A wide variety of unicellular host cells are also useful for expressing the DNA sequences of the present invention. These hosts are well known eukaryotic and prokaryotic hosts, such as E. coli. Strain of E. coli (E. coli), Pseudomonas (Pseudomonas), Bacillus (Bacillus), Streptomyces (Streptomyces); Fungi such as yeast (Saccharomyces process as MY (Saccharomyces), and avoid tooth (Pichia), Candida (Candida), Hanse Cronulla (methyl nutritional yeast such as Hansenula) and sat rulrop sheath (Torulopsis)); And animal cells such as CHO, R1.1, BW and LM cells, African Green Monkey kidney cells (eg, COS 1, COS 7, BSC1, BSC40 and BMT10), insect cells (eg , Sf9) and human and plant cells in tissue culture.

It can be understood that not all vectors, expression control sequences and hosts work equally well to express the DNA sequences of the present invention. Not all hosts work equally well by the same expression system. However, one of ordinary skill in the art will be able to select appropriate vectors, expression control sequences and hosts without undue experimentation to achieve the desired expression without departing from the scope of the present invention. For example, in selecting a vector, the host must be considered because the vector must act in the host. The copy number of the vector, the ability to control the copy number, and the expression of other proteins encoded by the vector, such as antibiotic markers, will also be considered.

In selecting an expression control sequence, various factors are commonly considered. These include, for example, compatibility with a particular DNA sequence or gene to be expressed, in view of the relative strength of the system, its controllability, and in particular of the potential second structure. Suitable unicellular hosts are, for example, selected vectors with their compatibility, their secretory properties, their ability to accurately overlap proteins, their fermentation requirements, and the toxicity of the product encoded by the DNA sequence to be expressed and It is selected in consideration of the ease of purification of the expression product.

In view of these and other factors, those skilled in the art can construct various vector / expression control sequences / host combinations capable of expressing the DNA sequences of the present invention upon fermentation or on large animal cultures. There will be.

In certain embodiments, the OB fusion protein can be expressed. OB fusion proteins include at least functionally active portions of non-OB proteins linked via peptide bonds to at least functionally active portions of the OB polypeptide. The non-ob sequence can be amino- or carboxy-terminally relative to the OB sequence. More preferably, the portion of the non-OB fusion protein is linked to the amino-terminus of the OB protein via peptide bonds for stable expression of the proteolytically inactive OB fusion protein. Recombinant DNA molecules encoding such fusion proteins include sequences encoding at least functionally active portions of non-OB proteins linked in-frame in the OB coding sequence, preferably at OB-non-OB junctions. The cleavage site for a specific protease such as thrombin or factor Xa is encoded. In certain embodiments, the fusion protein is expressed in Escherichia coli or P. pastoris .

In the specific embodiments below, the vectors were prepared to express the mouse and human ob genes as fusion proteins, in the presence or absence of codons for gln-49 in bacterial expression systems and yeast ( Pichia ) expression systems. . The ob gene was produced to have an endonuclease cleavage site using, for example, PCR and novel primers. Since this technique is more likely to involve point mutations, it is desirable to identify sequences generated by PCR. Plasmids containing histidine tags and proteolytic cleavage sites are used. The presence of histidine makes it possible to selectively separate recombinant proteins on a Ni-chelating column or by affinity purification. In the following specific embodiments, the proteolytic cleavage site, the thrombin cleavage site, is engineered such that treatment with a protease, such as thrombin, releases the full length mature (ie lacking signal sequence) OB polypeptide.

In another aspect, a pGEX vector (Smith et al., Gene 67:31 (1988)) can be used. This vector fuses the Japanese schistosomal glutathione S-transferase cDNA to the desired sequence. Bacterial proteins are collected and recombinant proteins can be rapidly purified on a reduced glutathione affinity column. The GST carrier can then be cleaved from the fusion protein by digestion with site-specific proteases. After cleavage, the carrier and the uncleaved fusion protein can be removed by absorbing onto glutathione agarose. In systems, difficulties sometimes arise when the encoded protein is insoluble in aqueous solution.

Expression of recombinant proteins in bacterial systems may require refolding by causing incorrect folding of the expressed proteins. Recombinant proteins may be re-overlaid before or after cleavage to form a functionally active OB polypeptide. The OB polypeptide comprises (i) culturing the protein in a denatured buffer containing a reducing agent, and then (ii) the protein containing an oxidizing agent, preferably also a protein stabilizer or chaotropic agent or both. It can be re-overlaid by culturing in the containing buffer. Suitable redox (reducing / oxidizing) pairs include, but are not limited to, reduced glutathione / glutathione disulfide, cystine / cysteine, cystamine / cysteamine, and 2-mercaptoethanol / 2-hydroxyethyldisulfide It is not limited. In certain aspects, the fusion protein may be solubilized in a denaturant such as urea prior to exchange with a reducing buffer. In a preferred embodiment, the protein is also purified, for example by ion exchange or Ni-chelated chromatography, before exchange with reducing buffer. Denaturants include, but are not limited to, urea and guanidine-HCl. The recombinant protein is then approximately at least 10- into an antioxidant buffer containing an oxidant such as, but not limited to, 0.1 M Tris-HCl, pH 8.0, 1 mM EDTA, 0.15 M NaCl, 0.3 M oxidized glutathione. Dilute to pear, more preferably about 100-fold. The fusion protein is then incubated in oxidizing buffer at room temperature for about 1 to about 24 hours, preferably about 2 to about 16 hours. Oxidative buffers may also contain protein stabilizers such as sugars, alcohols or ammonium sulfate. Oxidation buffers may further contain low levels of disorder-inducing agents to destabilize inaccurate intermolecular interactions and thus promote proper overlap. Suitable disorder-causing agents include, but are not limited to, detergents, polyols, L-arginine, guanidine-HCl, and polyethylene glycol (PEG). To avoid protein denaturation, it is important to use chaotic agents at low enough concentrations. The re-overlapping protein may be concentrated to at least about 10-fold, more preferably up to the amount when it was diluted with oxidant buffer.

Bacterial fermentation processes can also produce recombinant protein preparations containing unacceptable levels of endotoxins. Thus, the present invention includes the removal of such endotoxins, for example using endotoxin-specific antibodies or other endotoxin binding molecules. The presence of endotoxins can be determined using E-TOXATE reagents (Sigma, St. Louis, Missouri), or by standard techniques such as by biological assays.

In addition to certain examples, we contemplate the use of baclovirus, mammalian and yeast expression systems that express ob proteins. For example, baculovirus expression systems include pVL941 ( Bam H1 cloning site; Summers), pVL1393 ( Bam H1, Sma I, Xba I, Eco R1, Not I, Xma III, Bgl II and Pst I cloning sites; Invitrogen) , pVL1392 ( Bgl II, Pst I, Not I, Xma III, Eco RI, Xba I, Sma I and Bam H1 cloning sites; Summers and Invitrogen), and pBlue Bac III ( Bam H1, Bgl II, Pst I, Nco I , And Hind III cloning sites, blue / white recombinant screening possible; non-fusion transition vectors such as, but not limited to, Invitrogen), and pAc700 ( Bam H1 and Kpn I cloning sites, wherein Bam H1 Recognition sites start with initiation codons; Summers), pAc701 and pAc702 (same as pAc700 except that reading frame is different), pAc360 ( Bam H1 cloning site 36 base pairs downstream of polyhedrin initiation codon; Invitrogen (195) ) and pBlueBacHisA, B, C (Bam H1 , Bgl II, Pst I, Nco I , and Hind III cloning site having three different reading frames , ProBond purification and N- terminal peptide for blue / white recombinant screening of plaques; such as Invitrogen (220)) (stage, but is not limited to these) are fused transitions contain both vector.

Mammalian expression vectors contemplated for use in the present invention include, but are not limited to, vectors with inducible promoters, such as dihydrofolate reductase (DHFR) promoters, for example, expression vectors with DHFR complex vectors, or pED ( Pst I, Sal). I, Sba I, Sma I and Eco RI cloning sites, vectors express both cloned genes and DHFR ; DHFR / methotrexate coamplification vectors such as Kaufman, Current Protocols in Molecular Biology, 16.12 (1991)) . As a substitute, glutamine synthetase / methionine such as pEE14 ( Hind III, Xba I, Sma I, Sba I, Eco RI and Bcl I cloning sites, where the vector expresses glutamine synthase and cloned genes; Celltech) There is a snowpox citizen amplification vector. In yet another embodiment, pREP4 (Bam H1, Sfi I, Xho I, Not I, Nhe I, Hind III, Nhe I, Pvu II, and Kpn I cloning site, constitutive RSV-LTR promoter, hygromycin selectable marker ; Introgen), pCEP4 (Bam H1, Sfi I, Xho I, Not I, Nhe I, Hind III, Nhe I, Pvu II, and Kpn I cloning site, constitutive hCMV immediate early gene (immediate-type early gene), high thereof hygromycin selectable marker; Invitrogen), pMEP4 (Kpn I, Pvu I, Nhe I, Hind III, Not I, Xho I, Sfi I, Bam H1 cloning site, inducible metallothionein IIa gene promoter, hygromycin selection marker; Invitrogen), pREP8 (Bam H1, Xho I, Not I, Hind III, Nhe I, and Kpn I cloning site, RSV-LTR promoter, Heath T dinol selectable marker; Invitrogen), pREP9 (Kpn I, Nhe I , Hind III, Not I, Xho I, Sfi I and Bam HI cloning sites, RSV-LTR promoter, G418 selectable marker, Invitrogen), and pEBVHis (RSV-LTR promoter, hygromycin selector Vectors that direct episomal expression under the control of the Epstein Barr Virus (EBV), such as N-terminal peptides (Invitrogen) cleaved by enterokinase and can be purified through a competent marker, ProBond resin, can also be used. . Selectable mammalian expression vectors for use in the present invention include pRc / CMV ( Hind III, Bst XI, Not I, Sba I and Apa I cloning sites, G418 selection; Invitrogen), pRc / RSV ( Hind III, Spe I, Bst XI, Not I, Xba I cloning site, G418 selection; Invitrogen) and the like. Vaccinia virus mammalian expression vectors (see Kaufman, 1991, supra) for use in accordance with the present invention include pSC11 ( Sma I cloning site, TK- and β-gal selection), pMJ601 ( Sal I, Sma I, Afl). I, Nar I, Bsp MII, Bam HI, Apa I, Nhe I, Sac II, Kpn I and Hind III cloning sites; TK- and β-gal selection), and pTKgptF1S ( Eco RI, Pst I, Sal I, Acc I, Hind II, Sba I, Bam HI, and Hpa cloning site; TK or XPRT selection) include, but, are not limited to these.

Yeast expression systems can also be used to express OB polypeptides in accordance with the present invention. For example, only two mentioned non-fusion pYES2 vectors ( Xbd I, Sph I, Sho I, Not I, Gst XI, Eco RI, Bst XI, Bam H1, Sac I, Kpn 1 and Hind III cloning sites; Invitrogen ) Or fusion pYESHisA, B, C ( Xba I, Sph I, Sho I, Not I, Bst XI, Eco RI, Bam H1, Sac I, Kpn 1 and Hind III cloning sites, purified with ProBond resin and by enterokinase Truncated N-terminal peptides (Invitrogen) can be used according to the invention.

It is also understood that body weight modulator peptide homologs can be prepared from nucleotide sequences derived within the scope of the present invention.

In addition to recombinant expression of OB polypeptides, the present invention intends and makes it possible to produce OB polypeptides or fragments thereof using well known and highly developed techniques of solid phase peptide synthesis. The present invention includes the use of both conventional Boc and Fmoc as well as other protecting group strategies to prepare ob polypeptides or fragments thereof. Various techniques for refolding and oxidizing cysteine side chains are also well known in the art.

Antibodies Against OB Polypeptides

According to the present invention, an antibody that recognizes an OB polypeptide may be generated using an OB polypeptide produced recombinantly or by chemical synthesis, and fragments or other derivatives or homologs thereof including fusion proteins as immunogens. have. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments and Fab expression libraries.

When a molecule can specifically interact with antigen recognition molecules of the immune system, such as immunoglobulins (antibodies) or T cell antigen receptors, these molecules are "antigenic". The antigenic polypeptide contains at least about 5, preferably at least about 10 amino acids. The antigenic portion of the molecule may be a portion that is immunodominant for antibody or T cell receptor recognition, or may be the portion used to generate an antibody to the molecule by conjugating the antigenic portion to a carrier molecule for immunization. The antigenic molecule does not need to be immunogenic on its own, ie it does not need to be able to elicit an immune response without a carrier.

An "antibody" is an immunoglobulin comprising an antibody and fragment thereof that binds a specific epitope. This term refers to polyclonal, monoclonal and chimeric antibodies (the last mentioned here being described in more detail in US Pat. Nos. 4,816,397 and 4,816,567), as well as Fab, F (ab ') ₂ and F ( v) antigen-binding portion of the antibody, including (including single chain antibodies). Thus, in its various grammatical forms as used herein, the phrase “antibody molecule” includes both fully immunoglobulin molecules and immunologically active portions of immunoglobulin molecules containing antibody binding sites. An "antibody binding site" is a structural part of an antibody molecule that consists of heavy and light chain variable and highly variable moieties that specifically bind antigen.

Typical antibody molecules are referred to as fully immunoglobulin molecules, substantially complete immunoglobulin molecules, and Fab, Fab ', F (ab') ₂ and F (v), which are preferred portions for use in the therapeutic methods described herein. Portions of immunoglobulin molecules containing paratopes, including those known in the art.

The Fab and F (ab ') ₂ portions of the antibody molecules are prepared by proteolytic reactions of papain and pepsin on substantially complete antibody molecules by well known methods (see, eg, Theofilopolous, US Pat. No. 4,342,566). et al . Fab 'antibody molecule moieties are also well known, and the disulfide bonds linking the two heavy chain moieties from the F (ab') ₂ moiety are reduced with mercaptoethanol, and the resulting protein mercaptan is then reacted with iodoacetamide. It is produced by alkylation with the same reagent. In the present invention, antibodies containing complete antibody molecules are preferable.

The phrase "monoclonal antibody" used in its various grammatical forms means an antibody having only one species of antibody binding site capable of immunoreacting with a particular antigen. Thus, monoclonal antibodies typically exhibit a single binding affinity for any antigen that immunes to it. Thus, monoclonal antibodies may contain antibody molecules each having a plurality of immunospecific binding sites for different antigens, for example bispecific (chimeric) monoclonal antibodies.

The term "adjuvant" refers to a compound or mixture that enhances an immune response to an antigen. Adjuvants may act as tissue depots that slowly release antigens and may also act as lymphoid system activators that nonspecifically enhance immune responses [Hood et al., In Immunology, p. 384, Second Ed., Benjamin / Cummings, Menlo Park, California (1984). Often, primary attack with antigen alone in the absence of adjuvant may fail to elicit a humoral or cellular immune response. Adjuvants include complete Freund's adjuvant, incomplete Freund's adjuvant, saponins, inorganic gels such as aluminum hydroxide, lyso lecithin, pluronic polyols, polyanions, surface active substances such as peptides, oils or hydrocarbon emulsions, keyholes Keyhole limpet hemocyanins, dinitrophenols, and potentially useful human auxiliaries such as BCG ( bacille Calmette-Guerin ) and Corynebacterium parvum , but are not limited to these. . Preferably, the adjuvant is pharmaceutically acceptable.

Various methods known in the art can be used for the production of polyclonal antibodies against OB polypeptides, or fragments, derivatives or homologs thereof. For the production of antibodies, a variety of compounds, including but not limited to rabbits, mice, rats, sheep, goats, and the like, may be injected by injecting OB polypeptides or derivatives thereof (eg, fragments or fusion proteins). The host animal can be immunized. In one embodiment, the OB polypeptide or fragment thereof may be conjugated to an immunogenic carrier such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Freund's aids (complete and incomplete), inorganic gels such as aluminum hydroxide, lysolecithin, pluronic polyols, daions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and BCG (depending on host species) A variety of adjuvants may be used to increase the immune response, including but not limited to potentially useful human adjuvants such as bacille Calmette-Guerin and Corynebacterium parvum .

Any technique that provides for the production of antibody molecules by continuous cell lines in culture can be used for the preparation of monoclonal antibodies against OB polypeptides, or fragments, homologs or derivatives thereof. These include hybridoma technology, which was first developed by Kohler et al., Nature, 256: 495-497 (1975), and trioma technology, human B-cell hybridoma technology [Kozbor et al. , Immunology Today, 4:72 (1983), and EBV-hybridoma technology for producing human monoclonal antibodies [Cole et al., In Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc., (1985)], but is not limited to these. Immortal antibody-producing cell lines can be generated by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Schreier et al., “Hybridoma Techniques” (1980); Hammerling et al., "Monoclonal Antibodies And T-cell Hybridomas"(1981); Kennett et al., "Monoclonal Antibodies"(1980); In addition, US Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,451,570; 4,466,917; 4,472,500; 4,491,632; And 4,493,890].

In a further embodiment of the invention, monoclonal antibodies can be produced in sterile animals using recent techniques (PCT / US90 / 02545). According to the present invention, human antibodies can be used, using human hybridomas or by Cote et al., Proc. Natl. Acad. Sci, USA, 80: 2026-2030 (1983)], or by transforming human B cells with EBV virus in vitro (Cole et al., 1985, supra). Indeed, according to the present invention a technique developed to produce "chimeric antibodies" by splitting genes from mouse antibody molecules specific for ob polypeptides with genes from human antibody molecules of appropriate biological activity [Morrison] et al., J. Bacteriol., 159-870 (1984); Neuberger et al., Nature, 312: 604-608 (1984); Takeda et al., Nature, 314: 452-454 (1985); Such antibodies are included within the scope of the present invention. Since these human or humanized antibodies themselves will induce much less immune responses, especially allergic reactions than heterologous antibodies, human or humanized chimeric antibodies may be used for the treatment of human diseases or disorders (described below). Preferred for use.

According to the present invention, the techniques described for the production of single chain antibodies (US Pat. No. 4,946,778) can be adapted to produce OB polypeptide-specific single chain antibodies. In a further embodiment of the present invention the desired target for an ob polypeptide or derivative or homologue thereof using the techniques described for the fabrication of Fab expression libraries (Huse et al., Science, 246: 1275-1281 (1989)). Monoclonal Fab fragments with specificity can be identified quickly and easily.

Antibody fragments containing the idiotype of the antibody molecule can be produced by known techniques. For example, such fragments include F (ab ') ₂ fragments that can be produced by pepsin digestion of antibody molecules; Fab 'fragments that can be produced by reducing the disulfide bridges of F (ab') ₂ fragments, and Fab fragments that can be produced by treating antibody molecules with papain and a reducing agent are included, but are not limited to these.

In the production of antibodies, screening for the desired antibody can be carried out using techniques known in the art, for example, radioimmunoassay, ELISA (enzyme-linked immunosorbent assay), " Sandwich "immunoassays, immunoadiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (e.g., colloidal gold, enzymes) Or radioisotope labels), Western blots, precipitation reactions, agglutination assays (e.g. gel agglutination, erythrocyte agglutination), complement fixation assays ), Immunofluorescence assays, protein A tests, immunoelectrophoresis assays, and the like. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of the secondary antibody or reagent to the primary antibody. In further embodiments, the secondary antibody is labeled. Many means for detecting binding in immunoassays are known in the art and they are within the scope of the present invention. For example, to select antibodies that recognize specific epitopes of OB polypeptides, the resulting hybridomas can be tested for products that bind to OB polypeptide fragments containing these epitopes. To select an antibody specific for an OB polypeptide from a particular species of animal, it can be selected based on positive binding with an OB polypeptide expressed by or isolated from cells of that animal species.

The aforementioned antibodies can be prepared by methods known in the art regarding the localization and activity of OB polypeptides, eg, Western blotting, in situ OB polypeptide imaging, their levels in appropriate physiological samples. It can be used in methods such as measurement.

In certain embodiments, antibodies can be generated that function or antagonize the activity of the OB polypeptide. Such antibodies can be tested using the test methods described below for identifying ligands.

In certain embodiments, the antibody is expressed by immunizing the rabbit with a synthetic peptide predicted by the protein sequence or with a recombinant protein prepared using a bacterial expression vector. The selection of synthetic peptides is made after careful analysis of the predicted protein structure as described above. In particular, peptide sequences between putative cleavage sites are selected. Synthetic peptides are conjugated to a carrier such as KLH hemocyanin or BSA using carbodiimide and used in Freund's aid to immunize rabbits. To prepare recombinant proteins, pGEX vectors can be used to express polypeptides (Smith et al., 1988, supra). Alternatively, fusion proteins may also be produced using only hydrophilic regions. A large amount of the expressed protein can be prepared and used to immunize rabbits in Freund's auxiliaries.

In another specific embodiment, recombinant OB polypeptides are used to immunize chickens and recover chicken anti-OB polypeptides from egg yolk by, for example, affinity purification on OB-columns. Preferably, chickens used for immunization are maintained under specific pathogen free (SPF) conditions.

In another embodiment, the antibodies against leptin are ob / ob mice that are expected to be able to generate an anti-OB polypeptide response because they lack circulating OB proteins and therefore they will not be acceptable for polypeptides, and It is produced in wild type mice. Splenocytes from two groups of mice can be fused with myeloma cells to produce hybridomas against monoclonal antibodies.

In another embodiment, recombinant OB polypeptides are used to immunize rabbits and immunopurify polyclonal antibodies before further use. Purified antibodies are particularly useful for semi-quantitative testing to detect whether circulating OB polypeptide is present in serum or plasma.

Panels of monoclonal antibodies produced against modulator peptides can be screened for a variety of properties, i.e. isotype, epitope, affinity, and the like. Of particular importance are monoclonal antibodies that neutralize the activity of modulator peptides. Such monoclonal antibodies can be easily identified in a method for measuring activity on a weight modulator. High affinity antibodies are also useful when immunoaffinity purification of natural or recombinant modulators is possible.

Preferably, the anti-modulator antibody used in the diagnostic and therapeutic methods of the invention is an affinity-purified polyclonal antibody. More preferably, the antibody is a monoclonal antibody (mAb). In addition, the anti-modulator antibody molecule used in the present invention is preferably in the form of Fab, Fab ', F (ab') ₂ or F (v) portion of the whole antibody molecule.

Diagnostic relationship

The present invention also refers to the ability to induce activity mediated by the weight modulators of the present invention, including a method for detecting the presence of conditions and / or stimuli that affects body weight abnormalities or excess fat. Application areas. As mentioned above, weight modulator peptides can be used to produce antibodies against themselves by a variety of known techniques, which can then be isolated to test for the presence of specific transcriptional activity in suspicious target cells. It is available. Alternatively, the nucleic acid of the present invention may be used at the time of diagnosis.

Antibody-Basic Diagnosis

As already indicated, diagnostic methods useful in the present invention include an effective amount of an antagonist against an anti-modulator antibody, preferably an affinity-purified polyclonal antibody, more preferably a modulator protein such as mAb. Test of the cellular sample or medium is performed using the test method. In addition, the anti-modulator antibody molecules used in the present invention are preferably in the form of Fab, Fab ', F (ab') ₂ or F (v) moieties or whole antibody molecules. As noted above, patients who can use this method include patients suffering from cancer, AIDS, obesity, or other conditions that are characterized or caused by abnormal body weight. Methods of isolating modulators and inducing anti-modulatory antibodies and measuring and optimizing the ability of anti-modulatory antibodies to aid in the examination of target cells are all well known in the art.

In addition, antibodies, including both polyclonal and monoclonal antibodies, and drugs that modulate the production and activity of weight modulators and other recognizers and / or their subunits may have specific diagnostic applications. For example, it may be used for the purpose of detecting and / or measuring a condition in which an abnormality in body weight appears or is likely to appear. For example, modulator peptides or their active fragments may be polyclonal to themselves in a variety of cellular media, for example by known techniques such as hybridoma technology using fused mouse splenocytes and myeloma cells. And monoclonal antibodies can be used. These techniques are described in detail below. Likewise, small molecules that mimic or antagonize the activity (s) of the receptor recognizers of the invention can be found or synthesized and used in diagnostic and / or therapeutic protocols.

The presence of weight modulators in the cells can be confirmed by conventional immunological methods available for such determinations. Many useful methods are known. Three such methods that are particularly useful utilize a receptor recognizer labeled with a detectable label, antibody Ab ₁ labeled with a detectable label, or antibody Ab ₂ labeled with a detectable label. These methods can be summarized by the following scheme, where the asterisk indicates that the particles are labeled and "WM" means weight modulator:

A. WM ^* + Ab ₁ = WM ^* Ab ₁

B. WM + Ab ^* ₁ = WMAb ₁ ^*

C. WM + Ab ₁ + Ab ₂ ^* = Ab ₁ WMAb ₂ ^*

Such methods and their application are familiar to those skilled in the art and can therefore be used within the scope of the present invention. Method A, a “competitive” method, is described in US Pat. Nos. 3,654,090 and 3,850,752. Method B is representative of well-known competitive test techniques. The “sandwich” method, method C, is described in US Pat. Nos. 31,006 and 4,016,043. Other methods are also known, such as the "double antibody" or "DASP" method.

In each case, the weight modulator forms a complex with one or more antibody (s) or binding partners, and one member of the complex is labeled with a detectable label. The fact that the complex is formed and, if necessary, its amount, may be determined by known methods applicable to the detection of the label.

From the foregoing, it can be seen that the characteristic characteristic of Ab ₂ is that it can react with Ab ₁ . This is because Ab ₁ caused in one mammalian species is used in another species as the antigen causing antibody Ab ₂ . For example, Ab ₂ can be raised in goats using rabbit antibodies as antigens. Thus, Ab ₂ may be an anti-rabbit antibody raised in goats. For the purposes of the description and claims herein, Ab ₁ is referred to as primary or anti-weight modulator antibody and Ab ₂ is referred to as secondary antibody or anti-Ab ₁ antibody.

The most commonly used labels for these tests are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light.

Many fluorescent materials are known and can be used as labels. These include, for example, fluorescein, rhodamine and aruamine. Particular detectable substances are anti-rabbit antibodies prepared in chlorine and conjugated to fluorescein via isothiocyanates.

Weight modulators or their binding partners may also be labeled by radioactive elements or by enzymes. Radiolabels can be detected by any counting method currently used. Preferred isotopes can be selected from ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ I, ¹³¹ I and ¹⁸⁶ Re.

Enzyme labels are likewise useful and can be detected by any of the colorimetric, spectrophotometric, fluorescence spectrophotometric, current titration or gas quantitative methods currently used. The enzyme is conjugated to selected particles by reaction with bridge molecules such as carbodiimide, diisocyanate, glutaraldehyde and the like. Many enzymes that can be used in these methods are known and can be used. Preferred are peroxidase, β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, glucose oxidase and peroxidase and alkaline phosphatase. US Patent No. 3,654,090; 3,850,752; And 4,016,043 are cited as examples of their description of selective labeling agents and labeling methods.

In a further embodiment of the invention, a test kit suitable for use by a medical practitioner can be prepared to determine the presence or absence of a predetermined transcriptional activity or a potential transcriptional activity on a suspected target cell. According to the test techniques described above, one class of such kits is at least a labeled body weight modulator or a binding partner thereof, for example an antibody specific for it, and of course selected methods such as "competitive", "sandwich", " DASP "and the like. The kit may also contain ancillary reagents such as buffers, stabilizers and the like.

Thus, (a) a reserved amount of at least one labeled immunochemically reactive component obtained by direct or indirect attachment of a weight modulator of the invention or a specific binding partner thereto to a detectable label; (b) other reagents; And (c) instructions for use of the kit, test kits can be prepared to demonstrate the presence or possibility of predetermined transcriptional activity in the cell.

More specifically, diagnostic test kits (a) are generally bound to a solid phase to form an immunosorbent, or alternatively a known amount of a weight modulator (or binding partner) as described above, bound to a suitable tag, or a plurality of One of each of these end products or the like (or their binding partners); (b) other reagents as needed; And (c) instructions for using the kit.

In a further variant, test kits can be prepared and used for the above-mentioned purposes, which operate according to a predetermined protocol (eg, "competitive", "sandwich", "dual antibody", etc.) Contains:

(a) a labeled component obtained by coupling a body weight modulator to a detectable label;

(b) a ligand capable of binding at least one reagent with (i) a labeled component (a), (ii) a ligand capable of binding a binding partner of the labeled component (a), (iii) a component to be measured ( A ligand or immobilized ligand selected from the group consisting of a ligand capable of binding at least one of (s), and (iv) a ligand capable of binding at least one of at least one binding partner of the component (s) to be measured. Or further additional immunochemical reagents; And

(c) Instructions for carrying out a protocol for the detection and / or measurement of one or more components of an immunochemical response between the weight modulator and its specific binding partner.

Nucleic Acids-Basic Diagnostics

As demonstrated in the examples below, the nucleic acids of the invention can be used to detect defects associated with defects in the OB polypeptide causing the obesity phenotype. For example, using nucleic acid probes (eg, in Northern analysis or RT-PCR analysis) in db / db mice (if the deficiency is due to lack of OB receptors) or mutations are transcribed mRNA As in the case of producing the above, it can be determined whether the obesity phenotype is associated with a lack of expression of OB mRNA, or expression of non-functional OB mRNA. In addition, the nucleic acid-based diagnostic techniques of the present invention may be used in conjunction with antibody-based techniques to further provide a molecular understanding of the obese or anorexic phenotype.

Recently isolated human cDNA clones were sequenced as set forth in the present invention. This facilitates the determination of the complete sequence of the human gene (see FIGS. 20A-C; SEQ ID NO: 22). The OB gene from human genome DNA to determine the DNA sequence has been obtained (Fig. 20), mutation or allelic variants of the OB gene according to the above protocol in this specification in all cases using them from the introns of the human OB gene PCR primers were prepared to PCR amplify the encoded sequences. Specific PCR primers for amplifying human genome OB are described in the specific examples below.

The current hypothesis is that heterozygous mutations in the ob gene may be associated with mild / moderate obesity, while homozygous mutations may be associated with several DNA sequence-based diagnostic tests for obesity. If this is true, this may enable identification of humans at risk of developing obesity, and may allow for the application of medication and / or lifestyle changes before the increased weight is fully manifested.

Instead, the presence of microsatellites separated by the mutant form of human OB can be used for diagnosis. In this regard, various PCR primers can be used, including primers based on the nucleotide sequences shown in FIGS. 20A-C.

The OB gene may also be diagnostically useful for measuring its encoded RNA and protein in dystrophy. Especially in malnutrition, it will be important to know whether OB RNA and / or its encoded proteins are unregulated or downregulated. Thus, if an obese person has an increased level of OB, the problem appears to be downstream of OB, whereas if OB decreases, an inappropriately low level of OB may be responsible for obesity (in the OB gene). Defective or not). Conversely, if weight loss cancer or AIDS patients have increased OB levels, it can be concluded that the expression of inappropriately high OB is the cause of weight loss.

Cloned human cDNA can be used to measure the level of human OB RNA. In addition, recombinant human proteins can be prepared and subjected to immunoassays to measure plasma and possibly plasma levels of OB proteins.

Therapeutic relationship

Polypeptides, nucleic acids and antibodies of the invention have significant therapeutic potential. Preferably, a therapeutically effective amount of such ingredient in a pharmaceutically acceptable carrier, diluent or excipient is administered.

The phrase “pharmaceutically acceptable”, when administered to a human, is physiologically acceptable and typically does not cause allergic or similarly unsuitable reactions such as gastric upset, dizziness, etc. Means. Preferably, as used in the present invention, the term "pharmaceutically acceptable" means a pharmacologically recognized or commonly recognized US pharmacopeia or otherwise recognized by a federal or state authority for use in animals, more particularly humans. It means what is disclosed in. The term "carrier" refers to a diluent, adjuvant, excipient or vehicle with which the compound is administered. Such pharmaceutical carriers may be sterile liquids such as water and oils including oils of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or solution saline solutions and aqueous dextrose and glycerol solutions are particularly preferably used as carriers for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, PA (1990).

The phrase “therapeutically effective amount” in the present invention reduces clinically significant deficiency in the activity, function and response of the host by at least about 15%, preferably by at least 50%, more preferably by at least 90%. Most preferably used in an amount sufficient to prevent it. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in clinically significant status in the host.

Administration of the recombinant OB polypeptide results in weight loss, in particular reduction of adipose tissue. OB polypeptides can be prepared synthetically using standard bacterial and / or mammalian expression vectors, or can be purified from plasma or serum, all of which are as described above in detail herein. Alternatively, increased expression of native OB polypeptide can be induced by cognate recombination techniques as described above.

Reduction of OB polypeptide activity (by use of generated antibodies, inhibitors, neutralizing antibodies, or antisense molecules) results in weight gain, which would be desirable for the treatment of weight loss associated with cancer, AIDS or anorexia nervosa. Modulation of OB activity may be useful for losing weight (by increasing its activity) or increasing weight (by reducing its activity).

Polypeptide-Based Therapeutic Methods

In the simplest analysis, the OB gene determines body weight in mammals, especially mice and humans. The OB gene product and thus the cognate molecules appear to be part of the signaling pathway through which adipose tissue connects with the brain and other organs. OB polypeptides are believed to be signaling molecules themselves, ie hormones.

The OB polypeptide, or functionally active fragment thereof, or antagonist thereof, may be administered orally or parenterally, preferably parenterally. Because constitution is a continuous process, controlled release administration of ob polypeptides is preferred. For example, the polypeptide can be administered using intravenous infusion, an implantable osmotic pump, transdermal patch, liposomes, or other modes of administration. In one embodiment, pumps may be used [Langer et al., Eds., Medical Applications of Controlled Release, CRC Pres., Boca Raton, FIorida (1974); Sefton, CRC Cit. Ref. Biomed. Eng., 14: 201 (1987); Buchwald et al., Surgery, 88: 507 (1980); Saudek et al., N. Engl., J. Med., 321: 574 (1989). In another embodiment, polymeric materials can be used [Langer, 1974, supra; Sefton, 1987, supra; Smolen et al., Eds., Controlled Drug Bioavailability, Drug Product Design and Performance, Wiley, New York (1984); Ranger et al., J. Macromol. Sci. Rev. Macromol. Chem., 23:61 (1983); See also Levy et al., Science, 228: 190 (1985); During et al., Ann. Neurol., 25: 351 (1989); Howard et al., J. Neurosurg., 71: 105 (1989). In yet another embodiment, a controlled release system can be placed in close proximity to a therapeutic target, ie the brain, so that only a fraction of the systemic dose is needed. See, eg, Goodson, in Medical Applications of Controlled Release, vol. 2, pp. 115-138 (1984). Other controlled release systems are mentioned in the review by Langer, Science, 249: 1527-1533 (1990). In another embodiment, the therapeutic compound can be delivered in endoplasmic reticulum, especially liposomes. See, eg, Langer, 1990, supra; Treat et al., In Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); Lopez-Berestein, et al., Pp. 317-327; See generally the same document].

In a further aspect, recombinant cells transformed with the OB gene and expressing high levels of the polypeptide may be transplanted into a subject in need of an ob polypeptide. Preferably, autologous cells transformed with OB are transplanted to avoid rejection; Alternatively, a technique may be employed that protects non-autologous cells that produce soluble factors in a polymer matrix that prevents immune recognition and rejection.

OB polypeptides can be delivered by intravenous, intraarterial, intraperitoneal, intramuscular or subcutaneous routes of administration. Alternatively, suitably formulated OB polypeptides can be administered by intranasal or oral administration. Sustained supply of OB can be ensured by providing a therapeutically effective amount (ie, a dose effective to induce metabolic changes in a subject) at the required intervals, eg, daily, every 12 hours, and so on. These parameters can be readily determined according to the severity of the disease state being treated, other actions such as dietary changes carried out, the patient's weight, age and sex, and good standard medical techniques by a person skilled in the art. It depends on other criteria.

Pharmaceutical composition

In a still further aspect of the present invention, the pharmaceutical composition is provided. Such pharmaceutical compositions may be for injection or administration in oral, pulmonary, intranasal or other dosage forms. In general, the present invention includes pharmaceutical compositions containing an effective amount of a protein or derivative product of the present invention in combination with a pharmaceutically acceptable diluent, preservative, solubilizer, emulsifier, adjuvant and / or carrier. Such compositions include diluents having various buffer contents (eg, tris-HCl, acetate, phosphate), pH and ionic strength; Additives such as detergents and solubilizers (eg, Tween 80, Polysorbate 80); Antioxidants (eg, ascorbic acid, sodium metabisulfite); Preservatives (eg thimerosal, benzyl alcohol); And bulking substances (eg, lactose, mannitol); The material may also be incorporated into particulate preparations of polymer compounds such as polylactic acid, polyglycolic acid, or the like in liposomes. Hyaluronic acid may also be used. Such compositions may affect the physical state, stability, in vivo release rate and in vivo clearance rate of the proteins and derivatives of the invention. See, eg , Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042) pages 1435-1712; Incorporated herein by reference]. The composition may be prepared in liquid form or in the form of a dried powder, such as a lyophilized form.

Oral service

In the present invention, Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, PA 18042), Chapter 89; The use of solid oral dosage forms generally described in the present invention is incorporated herein by reference. Solid dosage forms include tablets, capsules, pills, troches or lozenges, cachets or pellets. In addition, liposomes or proteinoid encapsulations can also be used to formulate the compositions of the present invention (eg, as proteinoid microspheres as reported in US Pat. No. 4,925,673). . Liposomal encapsulation may be used, and liposomes may be derivatized by various polymers (eg, US Pat. No. 5,013,556). A description of solid dosage forms available for treatment can be found in Marshall, in Modern Pharmaceutics, Chapter 10, Banker and Rhodes ed., (1979); Inc., incorporated herein by reference. In general, formulations may include proteins (or chemically modified proteins), and inert ingredients that protect from the stomach environment and allow the release of biologically active substances in the intestine.

Also contemplated are oral dosage forms, particularly of such derivatized proteins. Proteins can be chemically modified such that oral delivery of derivatives is effective. In general, the chemical modification contemplated is the attachment of at least one site to the protein (or peptide) molecule itself, where such site comprises (a) inhibition of proteolysis; And (b) uptake into the bloodstream from the stomach or intestine. In addition, an increase in the overall stability of the protein and an increase in circulation time in the body are required. Examples of such sites include polyethylene glycol, copolymers of ethylene glycol and propylene glycol, carboxymethyl cellulose, dextran, polyvinyl alcohol, polyvinyl pyrrolidone and polyproline . Abuchowski et al., 1981 . Reference; Newmark et al., J. Appl. Biochem., 4: 185-189 (1982). Other polymers that can be used are poly-1,3-dioxolane and poly-1,3,6-thioxocan. Preferred for pharmaceutical use as mentioned above is the polyethylene glycol moiety.

In the case of a protein (or derivative), the release site can be the stomach, small intestine (duodenum, jejunum or ileum), or large intestine. Those skilled in the art can use agents that do not dissolve in the stomach but can release the substance in the duodenum or elsewhere in the intestine. Preferably, the release should avoid the deleterious effects of the stomach environment by protecting proteins (or derivatives) or releasing biologically active substances beyond the stomach environment, such as in the intestine.

A coating that is impermeable to at least pH 5.0 is essential to ensure total gastric fluid resistance. Examples of more common inert ingredients used in enteric coatings include cellulose acetate trimellitate (CAT), hydroxypropylmethylcellulose phthalate (HPMCP), HPMCP 50, HPMCP 55, polyvinyl acetate phthalate (PVAP), Eudragit ( Eudragit) L30D, Aquateric, cellulose acetate phthalate (CAP), Eudragit L, Eudragit S and Shellac. These coatings may be used as mixed films.

Coatings or mixtures of coatings may also be used for tablets that do not want to be protected against the stomach. This may include a sugar coating, or a coating that makes the tablet more swallowable. Capsules may consist of a dry therapeutic agent, ie a hard shell (eg gelatin) for delivering a powder; If in liquid form a soft gelatin sheath may be used. The casing of the case may be concentrated starch or other edible paper. In the case of pills, lozenges, shaped tablets or tablet abrasives, moist massing techniques may be used.

The therapeutic agent may be included in the formulation as fine multiparticulates in the form of granules or pellets having a particle size of about 1 mm. Formulations of substances for capsule administration may also consist of powders, weakly compressed plugs, or of tablets. Therapeutic agents can be prepared by compression.

Both colorants and fragrances may be included. For example, the protein (or derivative) may be formulated (e.g., by methods such as liposomes or microsphere encapsulation) and then included in an edible product, such as a frozen beverage, which further contains colorants and fragrances. .

The volume of therapeutic agent may be diluted or increased with an inert material. These diluents may include carbohydrates, in particular mannitol, α-lactose, anhydrous lactose, cellulose, sucrose, modified dextran and starch. Certain inorganic salts may be used as fillers, including calcium triphosphate, magnesium carbonate and sodium chloride. Some commercially available diluents are Fast-Flo, Emdex, STA-Rx 1500, Emcompress and Avicel.

Disintegrants can be included when formulating a therapeutic agent in a solid dosage form. Materials used as disintegrants include, but are not limited to, starches including Explotab, a commercially available disintegrant based on starch. Sodium starch glycolate, Amberlite, Sodium Carboxymethylcellulose, Ultra Mylopectin, Sodium Alginate, Gelatin, Orange Peel, Acid Carboxymethyl Cellulose, Natural Sponges and Bentonite can all be used. Another form of excipient is an insoluble cation exchange resin. Powdered rubbers can be used as disintegrants and as binders, which can include powdered rubbers such as agar, karaya or tragacanth. Alginic acid and its sodium salt are also useful as disintegrants.

The binder can be used to bind the therapeutic agents together to form a hard tablet, which includes materials selected from natural products such as Arabia, tragacanth, starch and gelatin. Others include methyl cellulose (MC), ethyl cellulose (EC) and carboxymethyl cellulose (CMC). Both polyvinyl pyrrolidone (PVP) and hydroxypropylmethyl cellulose (HPMC) can be used as alcoholic solutions to granulate the therapeutic.

Antifrictional agents can be included in the formulation of the therapeutic to prevent sticking during the formulation process. Lubricants may be used as the layer between the therapeutic agent and the mold wall, which may include stearic acid, including magnesium and calcium salts of stearic acid, polytetrafluoroethylene (PTFE), liquid paraffin, vegetable oils and waxes. It is not limited. Soluble lubricants such as sodium lauryl sulfate, magnesium lauryl sulfate, polyethylene glycols of various molecular weights, and Carbowax 4000 and 6000 may also be used.

Glidants may be added during formulation to improve the flow properties of the drug and to aid rearrangement during the compression process. Glidants may include starch, talc, pyrogenic silica, and hydrated silicoaluminates.

Surfactants may be added as a hydrating agent to help the therapeutic agent dissolve in the aqueous environment. Surfactants may include anionic detergents such as sodium lauryl sulfate, dioctyl sodium sulfosuccinate and dioctyl sodium sulfonate. Cationic detergents may also be used, which may include benzalkonium chloride or benzetonium chloride. The list of potential nonionic detergents that may be included as surfactants in the formulation includes lauromacrogol 400, polyoxyl 40 stearate, polyoxyethylene hardened castor oil 10, 50 and 60, glycerol monostearate, polysorbate 40, 60, 65 and 80, sucrose fatty acid esters, methyl cellulose and carboxymethyl cellulose. These surfactants may be present alone or in mixtures of various ratios in the preparation of the protein or derivative.

Additives that potentially enhance the absorption of proteins (or derivatives) are, for example, the fatty acids oleic acid, linoleic acid and linolenic acid.

Controlled release formulations may be preferred. The drug may be incorporated into an inert matrix, ie rubber, which allows release by diffusion or leaching mechanisms. Slowly altering matrices can also be incorporated into the formulations. Another controlled release form of the therapeutic agent of the invention is by a method based on the Oros therapeutic system (Alza Corp.), i.e. the osmotic effect allows water to enter and the drug through a single small opening. The drug is enclosed in the pushing semipermeable membrane. Some enteric coatings also have a sustained release effect.

Other coatings may be used in the formulation. These include various sugars that can be applied in coating pans. Therapeutic agents may also be prepared as film-coated tablets; The substances used in this case are classified into two groups. The first group is a nonenteric material, methyl cellulose, ethyl cellulose, hydroxyethyl cellulose, methylhydroxy-ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl-methyl cellulose, sodium carboxy-methyl cellulose, providone and Polyethylene glycols. The second group consists of enteric materials which are usually esters of phthalic acid.

Mixtures of materials can be used to provide optimal film coatings. Film coating can be carried out in a pan coater or in a fluidized bed, or by compression coating.

Intrapulmonary service

In the present invention, intrapulmonary delivery of the protein (or derivative thereof) of the present invention is also contemplated. Proteins (or derivatives) are delivered to the lungs of a mammal during inhalation and enter the bloodstream across the pulmonary epithelial layer. Other reports on this are described in Adjei et al., Pharmaceutical Research, 7 (6): 565-569 (1990); Adjei et al., International Journal of Pharmaceutics, 63: 135-144 (1990) (leuprolide acetate); Braquet et al., Journal of Cardiovascular Pharmacology, 13 (suppl. 5): 143-146 (1989) (endodotlin-1); Hubbard et al., Annals of Internal medicine, 3 (3): 206-212 (1989) (α1-antitrypsin); Smith et al., J. Clin. Invest., 84: 1145-1146 (1989) (α1-proteinases); Oswein et al., "Aerosolization of Proteins", Proceedings of Symposium on Respiratory Drug Delivery II, Keystone, Colorado, (1990. 3) (recombinant human growth hormone); Debs et al., J. Immunol., 140: 3482-3488 (1988); And Platz et al., US Pat . No. 5,284,656 (granulocyte colony promoter). In the practice of the present invention, all are designed for intrapulmonary delivery of therapeutic agents, including nebulizers, metered-dose inhalers and powder inhalers, which are familiar to those skilled in the art. The use of a wide variety of mechanical devices is contemplated.

Some specific examples of commercially available devices suitable for the practice of the present invention include Ultravent nebulizers (manufactured by Mallinckrodt, Inc., St, Louis, Missouri); Acorn II nebulizer (manufacturer: Marquest Medical Products, Englewood, Colorado); Ventolin quantitative inhaler (manufacturer: Glaxo Inc., Research Triangle Park, North Carolina); And Spinhaler powder inhalers (manufactured by Fisons Corp., Bedford, Massachusetts).

All of these devices require the use of agents suitable for the distribution of proteins (or derivatives). In general, the respective formulations are specific to the type of device used and may include the use of suitable propellant materials in addition to conventional diluents, adjuvants and / or carriers useful for treatment. Also contemplated are the use of liposomes, microcapsules or microspheres, inclusion complexes, or other forms of carriers. Chemically modified proteins may also be prepared in various formulations depending on the form of chemical modification or the type of device used.

Formulations suitable for use by jet or ultrasonic nebulizers may generally contain a protein (or derivative) dissolved in water at a concentration of about 0.1-25 mg biologically active protein, per ml of solution. The formulations may also include buffers and simple sugars (eg, for protein stabilization and control of osmotic pressure). Nebulizer formulations may also contain surfactants that reduce or prevent surface induced aggregation of proteins caused by atomization of the solution upon formation of the aerosol.

Formulations used by quantitative inhaler devices generally contain finely divided powders containing the protein (or derivative) suspended in the propellant with the aid of a surfactant. Propellants include chlorofluorocarbons, hydrochlorofluorocarbons, including trichlorofluoromethane, dichlorodifluoromethane, dichlorotetrafluoroethanol and 1,1,1,2-tetrafluoroethane, or combinations thereof Hydrofluorocarbons, or conventional materials used for this purpose, such as hydrocarbons. Suitable surfactants include sorbitan trioleate and soy lecithin. Oleic acid may also be useful as a surfactant.

Formulations for dispensing from a powder inhaler device may consist of finely divided dry powder containing proteins (or derivatives), and may also contain a bulking agent such as lactose, sorbitol, sucrose or mannitol to facilitate dispersion of the powder from the device. For example, in an amount of from 50 to 90% by weight of the formulation. Proteins (or derivatives) should most preferably be prepared in particulate form with an average particle size of less than 10 μm (or microns), most preferably 0.5 to 5 μm, for most effective delivery to the distal lung. do.

Intranasal service

Intranasal delivery of a protein (or derivative) is also contemplated. Intranasal delivery allows the protein to pass into the bloodstream immediately after administration of the therapeutic product to the nose without the need for depositing the product in the lungs. Formulations for nasal delivery contain them together with dextran or cyclodextran.

Treatment method, medicine manufacturing method

In a still further aspect of the invention there is provided a method of treatment and a method of making a medicament. Conditions that are alleviated or modulated by the administration of the derivatives of the invention are those mentioned above.

Dosage

For all of the above molecules, as additional tests are performed, information on dosage levels appropriate for treating various conditions in various patients can be obtained, including the therapeutic environment, age of recipients, and general health. Considering the condition, a skilled worker will usually be able to ascertain the appropriate dosage. In general, in the case of injections or infusions, the dosage may be between 0.01 μg of the biologically active protein (calculating the mass of the protein alone without chemical modification) and 10 mg / kg (on the same basis) per kg of body weight. The dosing schedule may vary depending on the circulating half-life of the protein or derivative used, whether the polypeptide is delivered by bolus dose or continuous infusion, and the formulation used.

Dosing with other compounds

For the treatment associated with obesity, the protein (or derivative) of the present invention may be used to treat other obesity, such as those used to treat diabetes (eg, insulin), hypertension, high cholesterol and other harmful conditions that are incidental to obesity. It may be administered with one or more pharmaceutical compositions used to treat clinical complications of. In addition, other appetite suppressants, such as amphetamines, may be coadministered. Administration may be simultaneous (eg, administration of a mixture of protein and insulin of the invention) or may be sequentially.

Nucleic Acid-Based Therapeutic Therapies

The OB gene can be introduced into human adipocytes to provide gene therapy for obesity. This therapy is expected to reduce weight. In contrast, introducing antisense constructs into human adipocytes can be expected to increase the body fat excess by reducing the level of active OB polypeptide.

In one embodiment, the gene encoding the OB polypeptide is introduced into a viral vector in vivo. Such vectors include, but are not limited to, attenuated or defective DNA viruses such as herpes simplex virus (HSV), papilloma virus, Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the like. do. Defective viruses that are wholly or almost completely devoid of viral genes are preferred. Defective viruses are not infectious after introduction into cells. The use of a defective viral vector may allow administration to cells in specific local regions without fear that the vector may infect other cells. Thus, adipose tissue can be specifically targeted. Examples of specific vectors include the defective herpes virus 1 (HSV1) vector [Kaplitt et al., Molec. Cell. Neurosci., 2: 320-330 (1991), Stratford-Perricaudet et al., J. Clin. Inves., 90: 626-630 (1992), and attenuated adenovirus vectors, such as the vectors described in Samulski et al., J. Virol., 61: 3096-3101 (1987). ; Samulski et al., J. Virol., 63: 3822-3828 (1989), but are not limited to these.

In another embodiment, genes are described, for example, in Anderson et al., US Pat . No. 5,399,346; Mann et al., Cell, 33: 153 (1983); Temin et al., US Pat . No. 4,650,764; Temin et al., US Pat . No. 4,980,289; Markowitz et al., J. Virol., 62: 1120 (1988); Temin et al., US Pat . No. 5,124,263; International Patent Publication No. WO 95/07358, published March 16, 1995 (Dougherty et al. ); And Kuo et al., Blood, 82: 845 (1993).

Alternatively, the vector can be introduced in vivo by lipofection. Over the past decade, the use of liposomes for the encapsulation and transfection of nucleic acids has been increased in vitro. Synthetic cationic lipids designed to limit the difficulties and risks faced by liposome-mediated transfection can be used to prepare liposomes for in vivo transfection of marker-encoded genes [Felgner et al., Proc. Natl. Acad. Sci. USA, 84: 7413-7417 (1987); See Mackey et al., Proc. Natl. Acad. Sci. USA, 85: 8027-8031 (1988). The use of cationic lipids can promote the encapsulation of negatively charged nucleic acids, and can also promote fusion with negatively charged cell membranes [Felgner et al., Science, 337: 387-388 (1989) ]. The use of lipofection to introduce exogenous genes into specific organs in vivo has certain practical advantages. Molecular targeting of liposomes to specific cells represents one area of benefit. It is evident that directing transfection to specific cell types can be particularly beneficial in tissues with cell heterogeneity such as pancreas, liver, kidney and brain. Lipids may be chemically coupled to other molecules for targeting purposes (Mackey et al., 1988, supra). Targeted peptides such as hormones or neurotransmitters, and proteins such as antibodies, or non-peptide molecules can be chemically coupled to liposomes.

The vector can also be introduced as a naked DNA plasmid in vivo. Exposed DNA vectors for gene therapy include methods known in the art, such as transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate sedimentation, gene gun Can be introduced into the host cell of interest by the use of or by the use of a DNA vector transporter . See, eg, Wu et al., J. Biol. Chem., 267: 963-967 (1992); Wu et al., J. Biol. Chem., 263: 14621-14624 (1988); Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990].

Agriculture

The OB gene may also be isolated from livestock, thereby obtaining the corresponding OB polypeptide. In the specific examples below, probes derived from the murine OB gene are hybridized to corresponding homologous coding sequences derived from the majority of animal species. As mentioned in the case of human therapy, recombinant proteins may also be prepared and administered to livestock. Administration of the polypeptide can be performed to produce thinner edible animals such as beef, pig, poultry, sheep and the like. Preferably, autologous OB polypeptides are administered, but the invention also includes the administration of anti-autologous polypeptides. Since the OB polypeptide consists of about 160 amino acid residues, it may not be highly immunogenic. Thus, administration of non-autologous polypeptides may not elicit an immune response.

Alternatively, the introduction of cloned genes into transgenic livestock can potentially reduce weight and excess fat by overexpressing the OB transgene. The simplest way to achieve this may be to target the OB transgene to fat using its own or another fat specific promoter.

In contrast, an increase in body fat may be desirable in other circumstances, such as to generate Kobe beef or fatty liver to make foie gras. This can be accomplished by targeting the antisense OB transgene to fat or using gene knockout techniques. Alternatively, inhibitors or antagonists of the OB polypeptide can be administered if weight gain is desired by percentage of fat. Such inhibitors or antagonists include antibodies that are reactive with the polypeptide and fragments of the polypeptide that bind to the OB receptor but do not activate the OB receptor, ie the antagonist of the OB polypeptide.

Beauty field

OB polypeptides are of significant value for cosmetic use in addition to health benefits. In particular, because the OB polypeptides of the present invention, including their derivatives and agonists thereof, are useful for modulating the rate and amount of adipocyte deposition in animals, they do not reach unpleasant adipose tissue, i.e., essentially obesity, but nevertheless It is useful for reducing fat deposits in the abdomen, buttocks, thighs, neck and chin, which impair the appearance of the individual. The fat reduction effect is thought to be partly due to a decrease in appetite, ie a decrease in food intake, or an increase in basal metabolism or both. In other words, the OB polypeptides or derivatives or analogs thereof of the present invention are useful for administering to a subject to cause cosmetic changes in adipose tissue deposits, whether to modulate fat deposition, reduce appetite, or both.

In addition, the compositions and methods of the present invention are cosmetic surgery (eg liposuction or laser surgery designed to reduce body mass by aspirating or removing adipose tissue) designed to change the overall appearance of the body, exercise (especially running And weight training, low fat eating, hypnosis, biofeedback, and the like, which may attempt to reduce the percentage of adipose tissue and improve the appearance of the body. Can be.

Accordingly, the present invention provides a method for causing cosmetic adipose tissue modulation in a subject by administering a modulated amount of the OB polypeptide or a derivative or a homologue thereof to the subject in need of cosmetic adipose tissue modulation to improve the overall body appearance. It is about. In certain aspects, adipose tissue modulation is the result of appetite suppression. Preferably, the adipose tissue modulation is a reduction of adipose tissue.

In a further embodiment, the present invention improves overall body appearance by combining a method of altering body appearance with administration of a fat modulating amount of an OB polypeptide or a derivative or agonist thereof to an individual in need of cosmetic adipose tissue modulation. It relates to a method of causing cosmetic fat tissue loss.

OB receptor

The development of small molecule agonists and antagonists of OB factor can be greatly facilitated by the separation of their receptors. This can be done by preparing an active OB polypeptide and using it to select an expression library using standard methods. Receptor binding in the expression library administers a recombinant polypeptide prepared using a bacterial or mammalian expression vector and observes the effect of short and continuous administration of the recombinant polypeptide on the cells of the expression library, or the OB polypeptide on the cell. It can be tested by directly detecting the binding of.

At present, since the OB receptor is believed to be located in the hypothalamus and possibly in the liver, preferably cDNA libraries from these tissues can be constructed in standard expression cloning vectors. These cDNA clones can then be introduced into COS cells as pools, and the resulting transformants can be selected using active ligands to identify COS cells expressing the OB receptor. The positive clone can then be isolated to recover the cloned receptor. Cloned receptors can be used with OB ligands (which are presumed hormonal) to develop the components needed to select small molecule modulators of OB.

The particular test system used in accordance with the present invention is known as a receptor test method. In the receptor test method, appropriate labeling of the material to be tested followed by culturing a specific cellular test colony with both a quantity of labeled and unlabeled material, followed by a binding test to bind the labeled material to the cellular receptor. Measure the degree to In this method, differences in affinity between materials can be identified.

Thus, purified amounts of weight modulators can be radiolabeled and combined with, for example, antibodies against them or other inhibitors, followed by binding testing. Thereafter, solutions containing various amounts of labeled and unlabeled unbound body weight modulators can be prepared, and then the cell samples can be inoculated and subsequently cultured. The resulting cell monolayers are then washed, solubilized and counted on a gamma counter for a time sufficient to yield a standard error of <5%. These data can then be processed by Scatchard analysis, followed by observations and considerations regarding substance activity. The foregoing is exemplary, but this illustrates the manner in which receptor testing can be performed and used where the cell binding capacity of the tested material can serve as an identifiable feature. In other words, receptor test methods are particularly useful for the identification of specific receptors for modulators of the invention, such as db receptors.

Additional test methods that are useful and contemplated in accordance with the present invention are known as "cis / trans" test methods. In short, this test method uses two gene constructs, one of which is generally a plasmid that continuously expresses the particular receptor in question when transfected into the appropriate cell line, and the second is the regulation of the receptor / ligand complex. Plasmids that express receptors such as luciferase. Thus, for example, where one wants to evaluate a compound as a ligand for a particular receptor, one of the plasmids is a construct that induces the expression of the receptor in the selected cell line, while the second plasmid is a response to a particular receptor. It may have a promoter linked to the luciferase gene is inserted. If the compound under test is an agonist for the receptor, the ligand can form a complex with the receptor, and the resulting complex binds to the reactive element to initiate the transcription of the luciferase gene. The resulting chemiluminescence is then measured by photometry and a dose response curve is obtained and compared with known ligands and dose response curves. The aforementioned protocol is described in detail in US Pat. No. 4,981,784 and PCT International Publication No. WO 88/03168, the purpose of which is referred to by a skilled expert.

Once the recombinants expressing the OB receptor gene sequence are identified, the recombinant OB receptor can be analyzed. This is done by a test method based on the physical or functional properties of the OB receptor, including analysis of the radiolabel of the receptor followed by gel electrophoresis, immunoassay, ligand binding, and the like. In addition, antibodies to the ob receptor may be generated as described above.

The structure of the OB receptor can be analyzed by various methods known in the art. Preferably, the structure of the various regions, in particular the OB binding site, is analyzed. Structural analysis can be performed by identifying sequence similarity with other known proteins, in particular hormones and protein receptors. The degree of similarity (or homology) may provide a basis for predicting the structure and function of an OB receptor or region thereof. In certain embodiments, sequence comparisons are performed by GenBank, for example, using the FASTA and FASTP programs. By GenBank (Pearson et al., Proc. Natl. Acad. Sci. USA, 85: 2444-48 (1988).

Protein sequences can be further specified by hydrophilic analysis (see, eg, Hopp et al., 1981, supra). The hydrophilic profile can be used to identify hydrophobic and hydrophilic portions of the OB receptor protein, which in turn can represent extracellular, membrane bound and intracellular portions.

Secondary structural analysis (see, for example, Chou et al., 1974, supra) can also be performed to identify portions of OB receptors that exhibit specific secondary structures.

Manipulation, decryption, and secondary structure prediction and open reading frame prediction and plotting can also be performed using computer software programs available in the art.

By providing an abundant source of recombinant OB polypeptide and the opportunity to separate OB receptors (ie db gene products), the present invention provides for the quantitative structural determination of the active conformation of OB polypeptides and OB receptors, or regions thereof. can do. In particular, sufficient materials are provided for nuclear magnetic resonance (NMR), infrared (IR), Raman and ultraviolet (UV), in particular circular dichroism (CD), spectroscopic analysis. In particular, NMR provides very powerful structural analysis of molecules in solutions that are more closely related to their natural environment (Marion et al., 1983, supra; Bar et al., 1985, supra; Kimura et al. , 1980, supra). Other methods of structural analysis may be used. These include, but are not limited to, X-ray crystallography (Engstom, 1974, supra).

More preferably, co-crystals of the OB polypeptide and the OB receptor can be tested. Analysis of the co-crystals provides detailed information on the binding, which in turn enables the ideal design of ligand agonists and antagonists. Computer modeling may also be used, particularly with regard to NMR or X-ray methods [Fletterick et al., Eds., Computer Graphics and Molecular Modeling, in Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (1986)].

Identification and isolation of genes encoding the OB receptor of the present invention is more specifically than can be isolated from natural sources, or indicator cells specifically engineered to exhibit the activity of the expressed receptor after transfection or transformation of cells ( expression of receptors in indicator cells. Thus, in addition to the ideal design of agonists and antagonists based on the structure of OB polypeptides, the present invention provides alternative methods for identifying specific ligands of OB receptors using various screening methods known in the art.

The invention may be better understood with reference to the following examples, which are presented by way of example and not of limitation of the invention.

Summary of the Invention

According to the present invention, the problem of controlling excess fat and fat content in animals, in particular mammals, has been solved by providing obesity (OB) polypeptides as described herein and nucleic acid molecules encoded for these polypeptides. The present invention firstly encodes such polypeptides useful for modulating, ie controlling and regulating body weight and hyperlipidemia, as well as allowing the production of a composite of the OB polypeptide, as well as allowing themselves to modulate body weight. One nucleic acid sequence is provided.

Obesity (OB) polypeptides of the invention have an allelic variant or analogue having from about 145 to about 167 amino acids and capable of modulating weight in animals, especially mammals, including fragments thereof having the same biological activity . Polypeptides can be prepared by recombinant or chemical synthesis. Currently preferred OB polypeptides include allelic variants or analogs having those having the amino acid sequence of SEQ ID NOS: 2, 4, 5 or 6, or fragments thereof.

Immunogenic fragments of the OB polypeptides of the invention include Val-Pro-Ile-Gln-Lys-Val-Gln-Asp-Asp-Thr-Lys-Thr-Leu-Ile-Lys-Thr (SEQ ID NO: 18); Leu-His-Pro-Ile-Leu-Ser-Leu-Ser-Lys-Met-Asp-Gln-Thr-Leu-Ala (SEQ ID NO: 19); Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Leu-Gln-Lys-Pro-Glu-Ser-Leu-Asp (SEQ ID NO: 20); And Ser-Arg-Leu-Gln-Gly-Ser-Leu-Gln-Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro-Glu-Cys (SEQ ID NO: 21) .

Human OB polypeptide analogs include amino acids 53, 56, 71, 85, 89, 92, 95, 98, 110, 118, 121, 122, 126, 127, 128, 129, 132, 139, 157, 159, 163 and 166 SEQ ID NOS: 4, wherein one or more of those according to the numbering of SEQ ID NO: 4 is substituted with another amino acid, such as a branched imino acid or alanine of the mouse OB polypeptide as described in SEQ ID NO: 2 And human amino acid sequences of six. Such analogs also include (a) a substitution of the serine residue at position 53 with glycine, alanine, valine, cysteine, methionine or threonine; (b) the serine residue at position 98 is substituted with glycine, alanine, valine, cysteine, methionine or threonine; (c) The variant analogues of claims 5 to 7 in which the arginine residue at position number 92 is asparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine, threonine, methionine or cysteine are clearly variable in position It includes a judge's intellectual substitution that was not specified. The OB polypeptide analogs according to the invention preferably have 83% or more amino acid sequence homology to the human OB polypeptide amino acid sequence set forth in SEQ ID NO: 2, 4, 5 or 6.

Further human OB polypeptide analogs according to the invention have the amino acid sequences of SEQ ID NOS: 4 and 6, comprising: (a) one or more aspartic acid residues substituted with glutamic acid; (b) one or more isoleucine residues substituted with leucine; (c) one or more glycine or valine residues substituted with alanine; (d) one or more arginine residues substituted with histidine; (e) one or more tyrosine or phenylalanine residues substituted with tripptophan; (f) one or more of residues 121-128 (according to numbering of SEQ ID NO: 4) substituted with glycine or alanine; And (g) one or more residues at positions 54 to 60 or 118 to 166 (in accordance with numbering of SEQ ID NO: 4) substituted with lysine, glutamic acid, cysteine or proline.

Preferred human OB polypeptide truncated analogs according to the present invention (according to the numbering of SEQ ID NO: 4) (a) delete one or more residues at positions 121-128; (b) residues 1-116 are deleted; (c) residues 1-21 and 54 to 167 are deleted; (d) residues 1-60 and 117-167 are deleted; (e) residues 1-60 are deleted; (f) the residues 1-53 are deleted; And (g) analogs of subpart (a) from which residues 1-21 are deleted. OB polypeptides and ob polypeptide analogs of the present invention lacking a 21 amino acid “signal” sequence (eg, amino acids 1 to 21 of SEQ ID NO: 4) include (1) methionine, (2) glycine-serine-histidine -Methionine sequence (SEQ ID NO: 38), (3) Methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine- Serine-histidine-methionine sequence (SEQ ID NO: 98), (4) leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (5) glutamic acid-alanine-glutamic acid- Alanine sequence (SEQ ID NO: 27), (6) leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (7) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine- Histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine- Lin-proline sequence (SEQ ID NO: 99) and (8) a glycine-serine-can have an N- terminal amino acid or amino acid sequence, such as proline sequence.

Derivatives of the OB polypeptides according to the invention have one or more chemical moieties comprising a water soluble polymer, such as polyethylene glycol, attached thereto. Polyethyleneglycol derivatized derivatives may be mono-, di-, tri- or tetrapezylated, for example N-terminal monopezylated. Preferred N-terminal monofezylated derivatives of the ob polypeptides of the invention include amino acid residues 22 to 167 of SEQ ID NO: 4 or residues 22 to 167 of SEQ ID NO: 6, optionally with methionine (pezylated) at position 21. OB polypeptides containing 166 are included.

The isolated nucleic acid molecules provided by the present invention encode OB polypeptides, alleles or analogs, including fragments, as described above. Specifically, for use in ensuring expression of OB polypeptides having biological activity that modulates body weight in mammals, the method comprises: (a) a DNA molecule or fragment thereof as set forth in SEQ ID NOS: 1 and 3; (b) a DNA molecule or a hybridizable fragment thereof that hybridizes to the DNA molecule defined in (a); And (c) a DNA molecule selected from the group consisting of DNA molecules encoding expression for amino acid sequences encoded by any of the aforementioned DNA molecules. Examples of such molecules are the human genome DNA molecules of SEQ ID NOS: 22 and 24.

Preferred DNA molecules according to the invention include (a) SEQ ID NO: 2; (b) amino acids 22-167 of SEQ ID NO: 2; (c) SEQ ID NO: 4; (d) amino acids 22 to 167 of SEQ ID NO: 4; (e) SEQ ID NO: 5; (f) amino acids 22 to 166 of SEQ ID NO: 5; And (g) SEQ ID NO: 6; And (h) encodes a polypeptide having an amino acid sequence set forth as amino acids 22-166 of SEQ ID NO: 6, and a polypeptide having an N-terminal amino acid or amino acid sequence as described above. For example, a preferred DNA molecule has a sequence described by the protein coding sequence of SEQ ID NO: 3, in particular a sequence described by the sequence encoding amino acids 22-167.

Also provided is a detectably labeled nucleic acid molecule hybridizable to a DNA molecule of the invention, wherein the ratio of OB nucleic acid selected from the group consisting of intron, 5 'non-coding portion and 3' non-coding portion The coding moiety includes a hybridizable nucleic acid molecule. The present invention also provides oligonucleotide primers for amplifying human genome DNA encoding ob polypeptides such as oligonucleotides described in SEQ ID NOS: 29-32.

The vector provided by the present invention contains a DNA molecule according to the present invention as described above, and preferably has the form of an expression vector comprising a DNA molecule operably linked to an expression control sequence. Single cell host cells of the invention are transformed or transfected with the DNA molecules of the invention, or with the vectors as described above. Preferred host cells include bacteria, yeast, mammalian cells, plant cells, insect cells, and human cells that are cultured. For example, these host cells are E. coli. Coli (E. coli), Pseudomonas (Pseudomonas), Bacillus (Bacillus), Streptomyces (Streptomyces), yeasts, CHO, R1.1, BW, LM , COS 1, COS 7, BSC1, BSC40, BMT10 and Sf9 cells It is selected from the group consisting of. The presently preferred yeast host include My process as Saccharomyces (Saccharomyces), a tooth blood (Pichia), Candida (Candida), Hanse Cronulla (Hansenula) and sat rulrop sheath (Torulopsis). In addition, a higher degree of expression of the ob polypeptide can be achieved by using a cognate recombination process containing an ob polypeptide encoding DNA sequence and consisting of inserting an expression control sequence operably adjacent to the ob polypeptide encoding sequence. Modified mammalian cells are provided in vitro. The expression control sequence may or may not express the ob polypeptide and may replace the mutant ob polypeptide regulatory sequence in the cell.

The present invention is directed to (a) culturing cells as described above under conditions providing expression of ob polypeptides; (b) recovering the expressed ob polypeptide. The method also comprises: (c) chromatography of the polypeptide on a Ni-chelating column; (d) may involve purifying the polypeptide by gel filtration. In a preferred embodiment, the method comprises chromatography of the ob polypeptide on a strong cation exchange column between steps (c) and (d).

The invention also provides labeled and unlabeled monoclonal and polyclonal antibodies specific for the ob polypeptides of the invention, and immortal cells producing the monoclonal antibodies of the invention. The preparation of an antibody according to the invention comprises (a) conjugating an ob polypeptide to a carrier protein; (b) immunizing the host animal with the OB polypeptide fragment-carrier protein conjugate of step (a) mixed with an adjuvant; (c) obtaining the antibody from the immunized host animal.

The present invention is directed to (a) specifically binding a sample suspected of containing an OB polypeptide (preferably to a solid support) that specifically binds to the OB polypeptide under conditions that allow the formation of a reaction complex containing the antibody and the OB polypeptide. Contacted) antibody; (b) detecting the formation of a reaction complex containing the antibody and the ob polypeptide in the sample, wherein detection of the formation of the reaction complex indicates the presence of an OB polypeptide in the sample, Provided are methods for measuring the presence of OB polypeptide in a sample. Correspondingly (a) detecting the formation of a reaction complex in a biological sample according to the methods described above; (b) assessing the level of OB polypeptide in the biological sample, comprising assessing the amount of reaction complex formed, wherein the amount of the reaction complex corresponds to the level of the OB polypeptide in the biological sample. To provide. In the case of detecting or diagnosing the presence of a disease associated with an elevated or reduced level of OB polypeptide according to the present invention, an assessment as described above is made, wherein the detected water is present in normal subjects or earlier subjects. Compare with the level of OB polypeptide. Increased levels of OB polypeptide relative to normal or previous levels suggest a disease associated with elevated levels of OB polypeptide, and decreased levels of OB polypeptide relative to normal levels may be associated with reduced levels of OB polypeptide and Suggests associated diseases. Correspondingly, evaluating the level of OB polypeptide as described above in a series of biological samples obtained at various time points from a mammalian subject undergoing therapeutic treatment of a disease associated with elevated or decreased levels of the OB polypeptide. Including, there is provided an in vitro method for monitoring the therapeutic treatment of a disease associated with elevated or decreased levels of OB polypeptide in a mammalian subject.

The pharmaceutical composition according to the present invention contains an OB polypeptide as described above together with a pharmaceutically acceptable carrier and is useful in therapeutic methods for reducing the weight of an animal. Further pharmaceutical compositions of the invention for use in therapeutic methods of gaining weight in animals are preferably antibodies that bind to OB polypeptides to neutralize the activity of OB polypeptides, but bind to OB polypeptide receptors And an antagonist of an OB polypeptide selected from the group consisting of a fragment of an ob polypeptide that does not activate the molecule, and a small molecule antagonist of the OB polypeptide. The present invention is also useful in a cosmetic method for improving the body appearance of an individual, and provides a corresponding cosmetic composition for improving body appearance for reducing or increasing the weight of an individual. Such cosmetic compositions are administered to a subject in a dose sufficient to modulate the subject's weight to the desired level.

The invention also relates to a nucleic acid molecule of the invention for the manufacture of a medicament for modifying (eg, gene therapy) an animal's body weight, and an antisense nucleic acid molecule hybridizable to a nucleic acid encoding an OB polypeptide according to the invention. It is about a use. Also provided is the use of an OB polypeptide or antagonist according to the invention for the manufacture of a medicament for modifying the weight of an animal. The medicine thus developed can be used to modify the body weight of a mammal in the treatment of a disease selected from the group consisting of diabetes, hypertension and high cholesterol and as part of a combination therapy with medicine for treating such a disease. Such medicines can be used in therapeutic methods including intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous, intranasal, oral or pulmonary delivery systems.

The data presented herein indicate that the OB polypeptides of the invention are mainly secreted from mammalian adipocytes in their form, and the polypeptide acts as a hormone.

Embodiments of the present invention demonstrate that OB polypeptides (otherwise referred to herein as "leptin") circulate in mouse, rat and human plasma. Leptin is absent in the plasma of ob / ob mice, 10-fold higher concentrations in the plasma of db / db mice and 20-fold higher concentrations in fa / fa rats. Most importantly, daily injections of recombinant leptin significantly reduce the body mass of ob / ob mice, significantly affect the body weight of wild-type mice, and do not affect db / db mice.

In a further aspect, ob polypeptides derived from one species are biologically active in another species. In particular, human OB polypeptides are active in mice.

First, a modulator of the present invention is a polypeptide that acts as a modulator of weight control as defined below (the polypeptides are shown in FIGS. 1A-E (SEQ ID NO: 2), FIG. 3 (SEQ ID NO: 4). ), 5 (SEQ ID NO: 5) and 6 (SEQ ID NO: 6), or a conserved variant or fragment thereof, in particular a fragment deleted with a signal peptide A recombinant DNA molecule (e.g., a vector containing cDNA or cDNA or isolated genome DNA) or cloned gene (i.e., isolated genome DNA) encoding (in other words, a mature OB polypeptide). , Or nucleic acid molecules, including modified variants thereof. In certain embodiments, amino acid sequences for two variants of murine and human ob polypeptides are provided. Both polypeptides are found in a form in which glutamine 49 is deleted, which can arise from mRNA splicing anomaly. OB polypeptides from various species can be very homologous; As shown in Figure 4, the rat and human OB polypeptide is at least 80% homologous.

The nucleic acid molecule, recombinant DNA molecule or cloned gene may have a nucleotide sequence or may be complementary to the DNA coding sequence shown in FIGS. 1A-E (SEQ ID NO: 1) and FIGS. 2A and B (SEQ ID NO: 3). Can be. In particular, such DNA molecules may be cDNA or genome DNA isolated from chromosomes. Nucleic acid molecules of the invention may also correspond to the 5 'and 3' flanking sequences of DNA and intron DNA sequences. Accordingly, the invention also provides nucleic acids having nucleotide sequences selected from the sequences of FIGS. 1A-E (SEQ ID NO: 1) and FIGS. 2A and B (SEQ ID NO: 3) of the present invention, as well as degenerate variants, allelic variants and To the identification of similar homologous molecules.

Nucleic acid molecules of the invention may be DNA or RNA including phosphate or phosphate homologues, eg, synthetic variants thereof having thiophosphate bonds. Both single-stranded and double-stranded sequences are included in the present invention.

The present invention further provides nucleic acid molecules for use as molecular probes or as primers for polymerase chain reaction (PCR) amplification, ie FIGS. 1A-E (SEQ ID NO: 1), FIGS. 2A and A sequence corresponding to a portion of the sequence shown in B (SEQ ID NO: 3) and FIGS. 20A-C (SEQ ID NOs: 22 and 24); Or the 5 'and 3' flanking sequences of the coding sequence; Or synthetic or native oligonucleotides having intron sequences of genome DNA. In particular, the present invention includes nucleic acid molecules having at least about 10 nucleotides, wherein the sequence of nucleic acid molecules is shown in FIGS. 1A-E (SEQ ID NO: 1), FIGS. 2A and B (SEQ ID NO: 3) and Corresponding to the same number of nucleotide sequences in the nucleotide sequences of 20A to C (SEQ ID NOs: 22 and 24), or to sequences complementary thereto. More preferably, the nucleic acid sequence of the molecule has at least 15 nucleotides. Most preferably, the nucleic acid sequence has at least 20 nucleotides. In embodiments of the invention where the oligonucleotide is a probe, the oligonucleotide is detectably labeled, for example, by radionuclide (eg, ³² P) or enzyme.

In a further aspect, the invention provides a cloning vector containing a nucleic acid of the invention encoding an ob polypeptide; And a bacterial, insect or mammalian expression vector containing the nucleic acid molecule of the invention encoding the ob polypeptide, which is operably linked to an expression control sequence. Accordingly, the present invention further relates to the above-mentioned operations in the preparation of host cells, such as bacterial cells, yeast cells, insect cells or mammalian cells transfected or transformed with appropriate expression vectors, and thus modulators of the present invention. It relates to the use of the offering.

In still a further aspect, the present invention relates to an antibody that binds to an ob polypeptide. Such antibodies may be produced against full-length polypeptides or antigenic fragments thereof. In one aspect, such antibodies inhibit the functional (ie, modulate body weight and fat composition) activity of ob polypeptides. In another aspect, antibodies can be used to determine the level of circulating ob polypeptides in plasma or serum. Also in a further aspect, site-specific antibodies, in particular monoclonal antibodies, can be used as probes of the OB polypeptide structure.

All of the materials mentioned above are considered in the present invention as modulators of body weight and fat composition and can be used in a variety of situations per se. In particular, the present invention encompasses both diagnostic and therapeutic applications and certain agricultural applications that presuppose using the modulators defined herein, including both nucleic acid molecules and peptides. Moreover, modulation of body weight involves certain therapeutic relationships and advantages that obesity or, conversely, a condition in which cachexia is an unwanted physical condition can be treated by the administration of one or more modulators of the present invention.

Thus, a protein encoded by a nucleic acid having a nucleotide sequence selected from the sequences of FIGS. 1A-E (SEQ ID NO: 1), the sequences of FIGS. 2A and B (SEQ ID NO: 3), and their degenerate and allelic variants Methods of modulating the weight of a mammal, including modulating expression, are proposed. Such regulation may be achieved by gene therapy to introduce the nucleotide in question into the adipose cells of the patient or host to control or reduce obesity. In contrast, the preparation and administration of antagonists to nucleotides, such as antisense molecules, can be directed and performed when conditions exist or are being treated with excessive weight loss such as anorexia nervosa, cancer or AIDS. Such constructs can be introduced directly into adipocytes in a manner similar to nucleotides to cause these changes.

Correspondingly, proteins as defined by FIGS. 1A to E, 3, 5 and 6 (SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 5 and SEQ ID NO: 6), conserved variants, activity thereof Fragments, and cognate small molecules, may be formulated to be administered directly for therapeutic purposes to reduce or control excessive body fat or weight gain. Correspondingly, antibodies and other antagonists against the mentioned protein materials, such as fragments thereof, may also be prepared and administered similarly to obtain a preservative effect. Accordingly, the present invention advantageously relates to pharmaceutical compositions containing the OB polypeptide of the present invention, or alternatively its antagonist in admixture with a pharmaceutically acceptable carrier or excipient.

In addition, the OB polypeptide of the present invention may be administered for its cosmetic effect, for example, to improve body appearance by reducing fat deposition. The OB polypeptide can be used independently for its cosmetic effect or in combination with other cosmetic methods such as surgery.

The diagnostic use of the nucleotides and corresponding peptides of the invention uses nucleic acids to identify further mutations of allele variants thereof to develop a repertoire of active nucleotide material useful in both diagnostic and therapeutic applications. Extends to. In particular, both homozygous and heterozygous mutations of the nucleotide in question may be identified that may be required to more accurately quantify the patient's condition to determine the potential of the individual to be at risk in relation to obesity. Specifically, heterozygous mutations are currently being considered in connection with mild to moderate obesity, while homozygous mutations are associated with more pronounced and severe obesity. Subsequently, accurate long-term predictions of specific trends are made to indicate changes in diet or other personal habits by conducting corresponding DNA tests using the identified substances mentioned above as benchmarks. Therapeutic interventions can be directed to facilitate this or to avoid such a condition.

The diagnostic utility of the present invention is to determine the presence and extent of the modulators of the present invention in a cell sample or biological extract (or sample) received from a test subject to determine the nucleic acid (genome DNA or mRNA) and / or protein in such test sample. It extends to how you can see the level. If the increased activity of the nucleotides and the presence of the resulting protein reflects the subject's ability to inhibit obesity, the specialist reviewing these results in an obese subject would be interested in other than dysfunction, relating to the presence and activity of the nucleotides of the present invention. It may be determined that the factor is the cause of obesity. In contrast, the inhibited levels of nucleotides and / or expressed proteins suggest that these levels must be raised to treat such obesity conditions, and thus appropriate therapeutic modalities can be provided.

In addition, the nucleotides found and shown in FIGS. 1A to E and 2A and B represent cDNAs useful for the determination of corresponding RNA as briefly mentioned above. Likewise, a recombinant protein material corresponding to the polypeptides of FIGS. 1A to E and 3 is prepared, for example for the purpose of measuring plasma levels of fat and / or OB proteins, or on receptors for OB on tissues such as the hypothalamus. In order to detect the presence and level of P, it may be suitably labeled, for example for use in radioimmunoassays.

In addition, the present invention includes the identification of the nucleotides and corresponding proteins presented herein, as well as the description of the receptors for such substances. In this regard, the polypeptides of FIGS. 1A-E, 3, 5, and / or 6 can be prepared and used to select appropriate expression libraries for isolating active receptors. After cloning the receptor, the receptor can then be used alone or in combination with a ligand to select small molecules that may have similar activity as the modulators of the invention.

In addition, the present invention provides that certain modulators, preferably sequences of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, according to the present invention, are prepared as preparations for various modes of administration where such therapies are appropriate And pharmaceutical compositions containing the polypeptides set forth in SEQ ID NO: 6, their antibodies, their corresponding small molecule agonists or antagonists, or active fragments. Such formulations may include a pharmaceutically acceptable carrier, or other adjuvants as needed, and are prepared in each case in an effective dosage range determined by the clinician or physician.

Accordingly, it is a primary object of the present invention to provide a pure form of weight modulator, as defined herein, that exhibits certain properties and activities associated with the regulation and change of excess fat and fat content in mammals.

A further object of the present invention is to provide a means for effectively diagnosing and monitoring pathological conditions in which changes in the level of such modulators may be characterized or may be characterized by detecting and controlling modulators of weight control as described herein. Provide a method of measurement.

It is yet another object of the present invention to provide a method for screening a substance, such as a drug, a medicament, etc., which is potentially effective in simulating or inhibiting the activity of the modulator of the invention in a mammal and a test system associated therewith.

It is yet a further object of the present invention to provide a method for the treatment of a mammal which is characterized by controlling the body weight and fat content in the mammal and / or treating certain pathological conditions characterized by abnormal suppression or increase in body weight. will be.

A further object of the present invention is to create a gene for use in a gene therapy protocol, containing or based on one or more modulators, binding partners or agents capable of modulating their production or simulating or antagonizing their activity. To prepare a pharmaceutical composition for the formulation and / or the corresponding method of treatment.

Other objects and advantages will become apparent to those skilled in the art from the following description, which is described with reference to the following exemplary drawings.

The following is a schematic of the method used to identify genetic material that is a good example of the invention. This attempt involves four consecutive steps: A) Gene Mapping, B) Physical Mapping, C) Candidate Gene Isolation, and D) Mutation Detection. After confirming that the target mouse gene was isolated (step D), homologous human genes were identified and both murine and human genes and putative proteins were characterized. The steps are summarized in more detail below.

A. Gene Mapping

The ob mutations were isolated at gene crossing and standard binding assays were used to determine the location of the mutations along RFLPs (restriction fragment length polymorphisms). These data placed the OB gene at ˜5 cM intervals on proximal mouse chromosome 6. (5cM is a measure of the genetic distance corresponding to five apparent gene crossovers per 100 animals.) A total of 771 informative meioses were generated, followed by genes. Used in mapping (Friedman et al., 1991, supra). All of the genetic loci that have been mapped against OB are already open. The two closest RFLPs described were defined by probes derived from carboxypeptidase and met oncogene genes.

Since generally none of the genetic markers were tightly bound, the genetic solution of the experiment described above was inadequate for cloning ob . In order to identify the necessary tightly linked RFLPs, additional probes were isolated and gene crosses were expanded. Random pieces of DNA were isolated from proximal mouse stain 6 using a method known as chromosome microdissection (Bahary et al., Mammalian Genome, 4: 511-515 (1993)). Individual cloned probes were tested for tight binding to ob . Based on these tests, one probe, D6Rck13, also called psd3, was chosen for further analysis because of its genetic proximity to OB .

This probe was used to determine the genotype of 835 ob offspring from interspecies or subspecies hybridization, as reported by Bahari et al., Suggesting that D6Rck13 is nonrecombinant in all 835 animals. In the course of physical mapping, new polymorphic markers were identified from cosmid subclones derived from YAC 53A6. This new marker was located between the D6Rck13 and OB genes and was used to determine the genotype of additional 771 informative meiosis from intraspecies double and backcross. Single animal # 167 was found to have recombinant hybridization between ob and D6Rck39. These tests indicated that D6Rck39 / D6Rck13 was ˜0.06 cM from ob . Additional probe Pax 4 showed close to .12 cM ob . Pax 4 was recombinant in two animals # 111 and # 420. Pax 4 is a pseudogene already mapped to proximal mouse chromosome 6 by Grus and co-workers [Gruss et al., Genomics, 11: 424-434 (1991)]. Based on this, the OB gene was determined to be present at an interval of ˜0.2 cM between Pax 4 and D6Rck13. This led to efforts to clone interposing DNA when trying to isolate OB .

B. Physical Mapping

Cloning of DNA at this interval often uses yeast artificial chromosomes (YACs), which are relatively new cloning vectors that can allow cloning of long stretches of continuous DNA longer than one million base pairs in length.

Yeast chromosomes were isolated using D6Rck13 and Pax 4. This was done by preparing purified DNA probes and using them to isolate the corresponding YACs. These YACs (# 8, # 16, # 107 and # 24) were isolated and primarily characterized and concluded that based on the results obtained, YAC 16 is the farthest extending ie YAC closest to ob Got off. Thereafter, the weekend end of YAC # 16 was restored, which was determined to be closer to ob than Pax 4. This end is called 16M (+). This conclusion was reached because the probe was found to be not recombinant in animal # 420 (because it was Pax 4). The sequence at this end was determined and used to perform a PCR test. This PCR test was used to select YAC libraries. Four positive clones were isolated. Subsequent steps include characterizing these YACs by Southern blots using end-rescuing, restriction mapping, pulse field gel electrophoresis, and gene cross-linking. Two, adu and aad , were determined to be important for subsequent testing. YAC aad is the farthest extending 550 kB nonchimeric YAC. Therefore, the physical map was completed using aad (pICL), the distal end of the YAC. YAC adu is a 370 kb nonchimeric YAC and its distal end adu (+) was determined to be nonrecombinant in all ob offspring of the gene hybrid, including animals # 111 and # 167, which indicates that the OB gene is present in this YAC. It suggests that you can.

Performing a PCR test for these two terminal aad (pICL) and adu (+), and to continue physical mapping was used to separate more of the YACs and P1 clones. Important P1 clones isolated by this effort included 498, 499, 500 (isolated using probes derived from aad (pICL)) and 322, 323 and 324 (using probes derived from adu (+)). .

On the other hand, YACs (53A6, 25A8, 25A9, 25A10) separated by D6Rck13 were specified. These tests determined that 53A6 extends the closest and furthest towards aad YAC. The size of the gap between 53A6 and aad was determined to be ˜70 kB. Thereafter, three available YAC libraries and P1 libraries were selected using 53 (pICL), the weekend end of 53A6. An important P1 clone, 325, was isolated. This P1 clone overlapped with the P1 clone separated by aad (pICL) as described above and was therefore used to fill the gap between 53 (pICL) and aad (pICL). As a result, the entire contig of ~ 2.5 million base pairs, containing YACs and P1 clones, spanning Pax4, 16M (+), adu (+), aad (pICL), 53 (pICL), D6Rck39 and D6Rck13. ) Was cloned. Careful mapping of the recombination sites seen in animals # 111 and # 167 concluded that the OBs were located at 400 kB intervals. About 500 kB containing these nonrecombinant sites were isolated from a total of 24 P1 clones to provide a practical DNA source for isolating the OB gene. These P1 clones, including 322 and 323, later identified as useful clones, were used for exon trapping.

Physical maps of portions of chromosomes with OB are shown in FIG. 7A. 7B shows YAC contigs. 7C shows P1 contigs.

C. Isolation of Candidate Genes

The method used to isolate genes at this interval was exon trapping. This method used a commercial vector to identify exon DNA (ie, coding sequences) by selecting functional splice receptor and donor sequences in the genome DNA introduced into the test construct. DNA derived from these P1 clones was grown and subcloned into exon trapping vectors. These clones were short inserts cloned into Bluescript vectors. Each clone was PCR amplified using PCR primers corresponding to the plasmid sequences flanking the insert. PCR amplification was performed directly on the bacteria carrying the plasmids. The reaction was set up using a Biomek robot. PCR products were electrophoresed on 1% agarose gel in TBE buffer containing ethidium bromide. Modification of exon trapping techniques results in contaminating E. coli from P1 clones. E. coli DNA was removed and abundant artificial exons> 80-90% of the trapped putative exons were screened. Exon trapping vectors include HIV sequences, and short segments of these vector sequences correspond to this artifact.

Exon trapping experiments were performed using various P1 clones. The exon trapping product was then amplified by PCR, selected for sequence analysis. Sequences of putative "exons" were compared to sequences in Genbank using the Blast computer program. About 15 exons were selected for further testing for the presence of corresponding RNA or retained sequences by RT-PCR, Northern analysis and zoo blot. Seven of the 15 putative exons 325-2, 323-9, 322-5, D1-F7, 1H3 and 2G7 were found to encode RNA transcripts. 325-2 is a testicular specific gene; 323-8 and 323-9 are likewise two exons from the same gene mainly expressed in the brain and kidney. IH3 and 322-5 represent two low level brain transcripts. D1-F7 is an exon from a previously cloned gene inosine monophosphate dehydrogenase ( IMPDH ) with a ubiquitous expression pattern. None of these genes seemed to encode OB . OB exon 2G7 is further described below.

After three unsuccessful efforts to exon trap the OB gene, another attempt was made by retaining DNA in the pool from all P1s from the critical OB moiety. These include P1s: 258, 259, 322, 323, 324, 325, 498, 499, 500, 653, 654 and the like. Thereafter, P1s 258, 260, 322, 498 and 499 were subcloned into exon trapping vectors, and then several plates were prepared using bacterial clones, each containing putative exons. Approximately 192 clones representing the OB candidates of the putative were obtained. As mentioned above, stable artifacts were observed in which many isolates contained two trapped exons derived from the vector. Thus, the clones were confirmed both by their size and the fact that hybridization of the DNA probe corresponding to this artifact hybridized to the corresponding band on the Southern blot of the gel. In this way, 185 of 192 clones were excluded from further evaluation. Exclusion of artificial products based on size alone is not possible, as this may eventually lead to the exclusion of exons corresponding to OB .

Therefore, a total of seven exons out of 192 exons were selected for further testing. Templates to determine the sequence of seven exons were prepared and sequenced. Sequences for the seven exons were analyzed and seven were identified as identical and one apparent artifact. In particular, clone 1D12 contained an "HIV sequence", ie an artificial band. This left three exons 1F1, 2G7 and 1H3 for further analysis. 1F1 was excluded because the map was drawn out of critical sections. PCR primers for both 1H3 and 2G7 were selected and synthesized.

The sequence of exons on 2G7 was determined and shown in FIG. 10 (SEQ ID NO: 7). PCR primers for 2G7 were selected and synthesized. Portions of the sequence corresponding to the PCR primers are underlined. The primers used are as follows:

5 'CCA GGG CAG GAA AAT GTG (Tm = 60.0 ° C) (SEQ ID NO: 8)

3 'CAT CCT GGA CTT TCT GGA TAG G (Tm = 60.0 ℃) (SEQ ID NO: 9)

These primers amplified the genome DNA using the following PCR conditions: annealing at 55 ° C. for 2 ′ in a standard PCR buffer, extending 72 ° C. for 2 ′, denaturing at 94 ° C. for 1 ′ 25-. 30 cycles. These primers were also used to generate labeled probes by including ³² P-dCTPs in the PCR reaction while correspondingly reducing the amount of cold dCTPs.

RT-PCR was performed on various tissue RNAs, and it was concluded that 2G7 was expressed exclusively in white fat in the tissues tested (FIG. 11A). Thereafter, ³² P-labeled 2G7 was hybridized to the northern blot of tissue RNAs (FIG. 11B), whose RNA was expressed at high levels in adipose tissue but not at all or at very low levels in all other tissues. (Signal may be due to fat contaminating the tissue preparation). 10 μg of total RNA from each of the tissues mentioned was electrophoresed on agarose gel using formaldehyde. Probes were hybridized to blots at 65 ° C. in standard hybridization buffer Rapid Rapid (Amersham). The size of the RNA was about 4.9 kB. At this point, 2G7 was considered to be a viable candidate gene for OB and further analyzed.

D. Mutation Detection

To confirm that 2G7 encodes the OB gene, it was necessary to demonstrate a difference in the level of RNA expression of the DNA sequence of this gene in the mutant compared to wild-type animals. Two separate mutations of the ob gene, C57BL / 6J ob / ob (1J) and Ckc / Smj ob / ob (2J), can be used for testing. These are referred to hereinafter as 1J and 2J, respectively. (The abbreviated name is used to refer to the mouse strain tested. Throughout this specification and drawings, C57BL / 6J means C57BL / 6J + / +, and CKC / smj is SM / Ckc- + ^Dac- + / +). CKC / Smj ob / ob represents SM / Ckc- + ^Dac - ob ²¹ / ob ^21. ) RNA was prepared from adipose tissue isolated from 1J, 2J and control animals. Total RNA for each sample was treated with DNase and then reverse transcribed using oligo-dT and reverse transcriptase as primers. The resulting single-strand cDNA was then PCR amplified using 2G7 primer (conditions are shown above) for the lower band and actin primer available commercially for the upper band. RT-PCR product was run on a 1% agarose TBE gel and stained with ethidium bromide (FIG. 12A). Using RT-PCR, 2G7 mRNA was expressed in 1J and all other control mice, whereas in 2J mice it was completely deleted. No signal was detected after 30 cycles of amplification. This experiment provided direct evidence that 2G7 corresponded to exons from the OB gene.

Since 2J mutations are relatively new and remain as pseudogenic strains, this result was the first useful evidence that 2G7 is an exon from the OB gene. Mutations can be located in the promoter moiety to induce an overall misfire of mRNA synthesis. The presence of signals in 1J mice in these RT-PCR experiments suggested that 1J would involve point mutations that did not result in significant changes in the size of the RNA sample. In addition, 2G7 mRNA was absent in four additional 2J animals when tested by RT-PCR.

This result was confirmed on Northern blot (FIG. 12B). Adipocyte RNA was prepared from each strain (C57B1 / 6J, 1J, CKC / smj, and 2J). 10 μg of these RNAs were drained and blotted. Blots were probed using PCR-labeled 2G7 probes by amplifying the material, ie band in FIG. 11 using ³² P-dCTP in the PCR reaction. Actin is a control for the amount of RNA loaded. Actin signals are quite similar in all samples. Since mRNA is specific for adipocytes, OB signals are not present in the brain.

The results of the northern assay demonstrate that 2G7 specific RNA is absent in 2J mice. ob RNA is absent in CKC / smj ob / ob mice because genes in this obese mutant strain are cleaved to prevent RNA from being produced. In addition, the level of 2G7 RNA increased ˜10-20 fold at 1J as well as db / db fat. These results are consistent with the hypothesis that OB is involved in the generation of signals from adipocytes that encode circulating hormones or modulate body weight. These results supported the conclusion that 2G7 is the OB gene, and 1J mice were expected to have point mutations, nonsense mutations that usually lead to premature translation termination.

These northern results were repeated using adipocyte RNA preparations from four different 2J animals (FIG. 13). In this test, ap 2 is a fat-specific transcript that was used as a control nearly identical to actin in FIG. 12B. There is no significance for the changing density of the ap 2 band. ap 2 was labeled by designing PCR primers from known ap 2 sequences. The RT-PCR product of adipocyte RNA was then relabeled using the same protocol as the PCR label. This analysis shows the presence of OB mRNA in standard homozygous or heterozygous animals and its absence in 2J mutant animals.

Mutations were identified in 1J mice. The mutation causes a change in arginine to an apparent premature stop codon at amino acid 108 and is a base change from C to T that causes the 1J mutation (FIG. 14) despite all possible high levels of ob mRNA (see 12 and 13, C57BL / 6J ob / ob lanes.

More recently, using Southern blots, it was concluded that 2J mutations were the result of detectable DNA changes at the 5 'end of OB which seemed to completely abolish RNA expression. The exact nature of this possible rearrangement has not yet been determined.

To determine whether mutant ob obtained a unique fragment pattern, genome Southern blot of DNA from CKC / smj (SM / Ckc- + ^Dac ) and C57BL / 6J mice using four different restriction endonucleases Was performed (FIG. 15A). About 10 μg of DNA (derived from genome DNA prepared from liver, kidney or spleen) was digested with the indicated restriction enzymes. DNA was then electrophoresed in a 1% agarose TBE gel. DNA was transferred to an imobilon membrane and hybridized to a PCR-labeled 2G7 probe. The key band is the top band in the Bgl II digest for CKC / smj ob / ob (SM / Ckc- + ^DAC ob ²¹ / ob ²¹ ) DNA. This band is more high molecular weight than in other strains, suggesting mutations in this strain.

FIG. 15B is a Southern blot of Bgl II digest of genome DNA from the progeny of an ob ²¹ / + x ob ²¹ / + hybrid. Some of the DNAs have only the upper band, some go only the lower band, and some have both. Animals with only the upper band are allo-obesed, ie ob ²¹ / ob ²¹ . These data show that the polymorphisms (ie mutations) shown in FIG. 15A are genetically deviated.

Example 1: OB CDNA Cloning and Sequencing

Using labeled 2G7 PCR probes, a total of 50 mouse cDNA clones from a mouse adipocyte λgt11 cDNA library (Clonetech 5′-STRETCH cDNA from testicular adip pad of Swiss mouse # ML3005b), and human adipocyte λgt10 cDNA library (abdominal Thirty cross-hybridized human cDNA clones were isolated from Clonetech 5'-STRETCH cDNA) from # HL1108a. Library screening was performed using the plaque lift procedure. Filters from plaque lifts were denatured using the autoclave method. Filters were hybridized in duplicate using PCR-labeled 2G7 probe (Rapid Hybe buffer, 65 ° C., overnight). After 2-4 hours charge hybridization, the filter was washed twice at 65 ° C. for 30 minutes in 2 × SSC, 2% SDS and exposed to x-ray film. Replicated positives were plaque purified. Plaque purified phage were PCR-amplified using vector primers such as λgt10 and λgt11 that are commercially available. The resulting PCR product corresponded to the cDNA insert for each phage with a small amount of vector sequence at either end. The bands were gel purified and sequences were determined using ABI automated sequencer and vector primers that probe DNA polymerase.

The original sequencing data was then manually inspected by base and corrected for incorrect reading from computer programs. Once accurate data were available, downstream primers were synthesized and used to continue sequencing. This experiment was repeated until each available cDNA cron was sequenced and synthesized into contigs. To date, 3,000 base pairs have been collected from the 5 'end of the mRNA. One of the cDNA clones extends to the 5 'end of the mRNA because its sequence was the same as for the 5' RACE product of adipose tissue RNA (data not shown).

Sequence data indicated that there was a 167 amino acid open reading frame (FIG. 1). The Kozak initiation consensus sequence was present with adenosine residues upstream of three bases of ATG. Two classes of cDNA have been identified that differ due to the inclusion or exclusion of a single glutamine codon. This residue is found at the 3 'position directly towards the splice receptor of the 2G7 exon. Since the CAG codon of glutamine includes the AG splice receptor sequence that may be present, it appears that there is a slip at the splice receptor site due to the apparent deletion of three base pairs in the subset of cDNA as shown below.

(page 103, line 12-19)

[Content: with glutamine glutamine present

splice accepter site

without glutamine without glutamine

splice accepter site]

"Ag" in the above sequence corresponds to the assumed intron sequence upstream of the glutamine codon, and AG is a putative surrogate splice site. This glutamine residue is located in the highly conserved portion of the molecule, and its importance for biological activity is still unknown.

A putative N-terminal signal sequence was detected and its signal cleavage site is expected to be the carboxy-terminal from amino acid position 21 towards the alanine residue. This putative signal sequence was confirmed by applying a computer algorithm to von Heijne's method. Using this technique, the most likely signal sequence was identified in the polypeptide encoding portion corresponding to amino acids 1-23 with the following sequence, where arrows indicate putative signal sequence cleavage sites:

MCWRPLCRFLWLWSYLSYVQA ↑ VP (SEQ ID NO: 10)

The rest of the amino acid sequence was predominantly hydrophilic and did not have any obvious structural motifs or membrane spanning domains other than the N-terminal signal sequence. In particular, we have not identified a consensus sequence for N-linked glycosylation or a dibasic amino acid sequence suggesting protein cleavage in the expected processed protein (Sabatini et al., The metabolic basis of inherited disease, pp. 177-223, CV Scriver et a1.eds., McGraw-Hill, New York. Database searches using Blast and Block programs did not identify any homologous sequences.

Human adipose tissue RNA was analyzed on northern blots and RNA species similar in size to the mouse ob gene were detected. Sequencing and analysis of the cDNA clones revealed that human OB also encodes a 167 amino acid polypeptide (FIGS. 2A and B and FIG. 3). Two classes of cDNAs with or without three base pair deletions were found in humans as well (FIG. 6). The mouse and human OB genes were highly homologous in the expected coding portion, but had only 30% homology in the 3 'and 5' venom portions available. The N-terminal signal sequence was also present in human OB polypeptide. Comparison of human and mouse OB polypeptide sequences showed that the two molecules shared 83% identity overall at the amino acid level (FIG. 4). The N-terminus of the mature protein from both species shares even higher homology with only 6 conservative and 3 non-conservative amino acid substitutions among the N-terminal 100 amino acid residues.

Genome DNA was isolated from mice, rats, rabbits, bowls, cats, cows, sheep, pigs, humans, chickens, eel, and Drosophila, and was limited by Eco RI. The digest was electrophoresed on a 1% agarose TBE gel. The DNA was then transferred to an immobilon membrane and probed with a PCR-labeled 2G7 probe. The filter was hybridized at 65 ° C. and washed twice for 20 minutes at 65 ° C. with 2 × SSC, 0.2% SDS, ie there were two buffer changes. These data suggest that OB is preserved in vertebrates (FIG. 16). In this regard, eel DNA has been shown to have 2+ signals, where eel is a fish.

In summary, the available evidence indicates that body weight and excess fat are physiologically controlled. Seven years ago, efforts were made to identify two of the key components of the system: the OB and DB genes. As can be seen in this example, the OB gene in the present invention has been identified as a fat-specific gene that plays a major role in weight control. The product of this gene, which is almost always a secreted hormone, can have important consequences for the diagnosis and treatment of nutritional diseases in humans and non-human animals.

Example 2: Expression of OB in Bacteria

Both mouse and human cDNAs encoding ob were cloned into the pET-15b expression vector (Noagen). This vector contains the T7 promoter with the lac operator and expresses a fusion protein containing a thrombin cleavage site and histidine tag immediately upstream of the coding sequence insertion (FIG. 17) (SEQ ID NOS: 11 And 12).

Mouse and human cDNAs were modified such that alanine at the end of the signal sequence changed to the Nde I site as being a separate sequence at the 3 'portion. Insertion of the NdeI site was performed using PCR with novel primers:

Mnde-5 '(5' primer of rat):

Mnde-3 '(mouse 3' primer):

Hnde-5 '(human 5' primer):

Hnde-3 '(human 3' primer):

The primer contains a 6-base pair mismatch at the center that introduces an Nde I restriction site at each end of the PCR fragment. Phages carrying mouse or human cDNA were PCR amplified using these primers. PCR products were digested with Nde I and gel purified on 1% low melting agarose gel. Gel purified bands were subcloned into the pET vector. The resulting plasmids were sequenced to ensure that no mutations were introduced during the PCR amplification step of cloning. Constructs for human and murine cDNA encoded and lacking glutamine 49 were prepared. In particular, a pET 15b construct was deleted using the PCR cloning method, in which the signal sequence was deleted and containing the human or mouse OB encoded sequence fused to His-tag. The construct was sequenced to ensure that no sequence error was introduced into the coding portion of the OB gene during the PCR amplification step.

Two resulting plasmid constructs, pETM9 and pETH14, were selected to transform bacterial expression hosts. The introduction of 1 mM IPTG under optimal conditions allowed the transformed bacteria to produce 100-300 μg / ml OB fusion. Most OB fusion proteins were identified in inclusion bodies. After solubilization with 6M guanidine-HCl or urea, the fusion protein was purified via His-bonded (Ni-chelated) resin column. Conditions for column purification (including binding, washing and elution) of OB fusion proteins were set experimentally. The OB fusion protein is bound to the resin at 5 mM imidazole / 6M guanidine-HCl and kept bound below 20 mM imidazole / 6M guanidine-HCl. Proteins can be eluted from the resin at 60 mM imidazole / 6M guanidine (FIG. 18A, B). Both purified human and mouse OB fusion proteins were further dialyzed in PBS to remove guanidine-HCl from the formulation and then used to induce polyclonal antibodies.

In order to test the biological activity of the fusion protein product, refolding conditions for the purified protein were found by testing. This includes initial dialysis of the fusion protein in 1 M guanidine solution followed by dilution with 0.4 M arginine solution. His-tag was removed from the fusion protein before assay for biological function. Removal of the tag was performed by treating the fusion protein with thrombin derived from the human placenta.

In addition, the human and mouse OB gene coding sequences minus the signal sequences are each inserted into the pET 12c vector using PCR cloning methods. These constructs can direct the synthesized OB fusion protein into the periplasmic space of bacterial host cells. OB fusion proteins recovered from the protoplasts may only require simple gel filtration to purify from other host proteins and are not denatured during this process.

Example 3: Preparation of Antibodies Against OB Polypeptides

In addition to the use of the recombinant protein to generate reclonal bodies, a set of four peptide sequences derived from the deduced mouse OB sequences were identified using immunogenicity plot software (GCG Package). The four carboxyl terminal peptide fragments are as follows:

(SEQ ID NO: 18):

(SEQ ID NO: 19):

(SEQ ID NO: 20):

(SEQ ID NO: 21):

These peptides were conjugated to KLH and peptide-KLH conjugates were used to immunize rabbits using standard techniques. Polyclonal antiserum specific for each peptide is recovered from the rabbit.

Example 4 In vitro Translocation of OB Polypeptides

To confirm the presence of functional signal sequences, human cDNA, including the entire open reading frame, was subcloned into the pGEM vector. Only human cDNA was used in this experiment since no suitable mouse subclone was recovered. Positive strand human ob RNA was transcribed using Sp6 polymerase and used in an in vitro translation reaction in the presence and absence of pancreatic microsome membranes in dogs. The primary detoxification product shifted to an apparent molecular weight of ˜10 kD, which is consistent with that expected by the cDNA sequence. Inclusion of microsomal membranes in the reaction inhibited ˜5-fold the overall efficiency of detoxification. Nevertheless, about 50-70% of the OB primary detoxification products were cleaved to about 2 kD in the presence of the membrane agent, suggesting that the signal sequence is functional (FIG. 19A). The size of the primary detoxification product of interleukin-1α RNA that does not encode a signal sequence did not change when the microsomal membrane was included in the reaction. To confirm that translocation of the OB protein occurred, in vitro detoxification products were treated with proteinase-K. The protease treatment induced complete proteolysis of the 18 kD primary detoxification product, whereas the 16 kD treated form was not affected by the enzymatic treatment, suggesting that the form was translocated into the lumen of the microsome ( 19B). These data do not contradict the hypothesis that OB is a secreted protein.

After cleaving the signal sequence, two cysteine residues may remain in the expected protein causing the possibility that the molecule contains disulfide bonds characteristic of other secreted polypeptides [Shen et al., Science, 224: 168 -171 (1984)].

Example 5: OB  Gene specification

In order to establish the relationship between obesity and genetic modification of the OB gene in humans, and determining the sequence of the human OB gene (Figure 20A through C) (SEQ ID NOS: 22 and 24). Human P1 libraries were selected using specific primers from human encoding sequences. Three different P1 clones were obtained, grown and PCR amplified using primers flanking the splitting site between the first and second encoded exons. The entire intron portion of about 2 kb was amplified and partially sequenced (see FIG. 20A; as shown in SEQ ID NOs: 22 and 24).

Gene structures of both mouse and human genes were characterized using PCR assays and other standard techniques. The mouse OB gene was found to consist of three exons, the second and third of which describe the coding sequence (FIG. 20D). The coding portions of the human OB gene share the same structure, but the human gene lacks the 5 'exon and intron (Figure 20E).

Two sets of primers generated from intron sequences of human genes were prepared (FIGS. 20A-C). The sequence of the primers is as follows (F and R mean forward and reverse, respectively):

DNA samples were obtained from a variety of sources, and a set of these primers was used to amplify human genome DNA from severely obese people. The PCR product was run on a low melting agarose gel, the band was removed and digested with agarase. Sequences were obtained using an ABI 373A DNA sequencer and Taq dideoxy terminator kit (ABI, Perkin-Elmer). To date, one point mutation in the ob gene has been detected from patient samples. This mutation is present in the first exon and does not change the amino acid sequence. Preliminary data suggest that the insertion sequence may be present in the first exon of another patient.

Different automated sequencing methods using Sequinase instead of Taq DNA polymerase may be used to obtain sequences that are easier to read for mutation detection.

Example 6: Expression of OBs in Yeast

Following the positional cloning of OBs, it has become important to elucidate the physiological mechanisms by which OB proteins reduce food intake and weight. The first step in this direction was to recombinantly produce functional proteins using expression systems. In addition to successful bacterial expression systems, yeast expression systems have also been selected. Yeast expression has several interesting features for expressing OB . Most importantly, it will be more possible to produce biologically active eukaryotic proteins. OB polypeptides are secreted by mammalian cells. Protein secretion is very similar for all eukaryotes, meaning that the yeast secretory apparatus is much more similar to the mammalian secretion pathway than the bacterial secretion pathway. In particular, protein modifications of OB appearing in mammalian cells can also be seen when expressed through the yeast secretion system. In addition, protein overlap is performed upon passage through the secretory apparatus, so delivery of ob through the yeast secretory apparatus can provide suitably nested proteins with natural biological activity. This is significant in the case of OB because two cysteine residues can form a disulfide bridge. In contrast to the secretory pathway, the reducing environment of the cellular cytoplasm prevents the formation of disulfide bridges, and therefore, it is necessary for the OB to pass through the secretory pathway in order to allow these disulfide bonds to form in vivo. Other advantages are the ease and speed of yeast manipulation, availability of vectors and strains, and enormous experimentation in yeast recombination techniques.

The Pichia pstoris system was chosen for four reasons: (1) it has a higher level of heteroprotein expression than other yeast systems such as Saccharomyces cerevisiae ; (2) Protein glycosylation is more similar to mammalian systems in P. pastoris than in S. cerevisiae (although glycosylation sites are ob Was not detected, but there was still a possibility of glycosylation at unrecognized sites); (3) P. pastoris naturally secretes very little protein, so it generally simply purifies the expressed foreign protein; (4) Vectors and yeast strains can be used as commercial products (from Invitrogen). Two ways of generating yeast expression vectors are shown in FIGS. 21 and 22.

The vector chosen was pPIC.9. This vector contains a cloning site immediately downstream of the α-crossing factor prepro coding sequence which directs the secretion of the protein encoded by the cloned gene at the cloning site. Another important feature of this vector is the HIS 4 gene, which can be selected for use with the vector using yeast trophic strains grown on histidine-deficient media after the yeast has been transformed with the vector. The cloning scheme was as follows: PCR contains a sequence complementary to the sequence of OB immediately following the expected leader peptide cleavage at its 3 'end, and at most 5' end of the vector the α-crossing factor sequence of the vector. 5 'primers containing sequences complementary to the 3' end are used to amplify the OB cDNA. The 5 'primer also contains an Xho I site. The 3 'primer was designed to have a sequence complementary to the last few amino acids of OB at its 3' end and an Eco RI site at its 5 'end. After PCR amplification, PCR products were digested with Xho I and Eco RI and cloned into similarly digested pPIC.9. In each case, after cloning both mouse and human OB cDNAs with or without glutamine at codon 94, each clone was isolated for all four constructs and the sequence was determined so that the constructs were placed in the correct arrangement and frame. It was cloned and demonstrated that it did not contain mutations due to the PCR amplification step. After identifying clones with the correct sequence, they were transformed in histidine nutritional strain, P. pastoris strain GS115.

In the case of two mouse OB constructs, the transformed yeast clones were screened for protein expression. As evidence that the transformed yeast contains OB , a DNA dot-blot test and colony hybridization test were performed, both of which showed OB sequences in the transformed yeast but not in untransformed yeast. In addition, the transformed yeast secreted 16 kDa protein into the culture medium, while the untransformed yeast did not secrete protein of this size (FIG. 23A). This is the expected size of the OB. Individual clones for both mouse constructs have been identified as high expressors for OB, and current purification schemes are under development to uniformly purify ob . One way was to purify OB on a cation exchange column (FIG. 23B); Preliminary data suggest that powerful cation exchangers may be useful. However, putative ob product is lost after cation exchange chromatography. This suggests the presence of protease in the sample.

One way to overcome this problem is to make ob- His-tag fusions for expression in yeast (FIG. 22). Further evaluation demonstrated that His-tagged OB tightly associates with the Ni-chelated column. Purification of the OB polypeptide by Ni-chelating followed by gel filtration yielded a product of sufficient purity for mass spectrometry. Mass spectrometry proves that the molecular weight of the expressed protein is equal to the expected molecular weight, which strongly demonstrates that OB was successfully expressed in Pichia .

However, the Ni-chelation / gelfiltration purification protocol does not yield OB polypeptides in sufficiently pure form. There are additional small molecules. This indicates that proteolytic activity elutes from the Ni-chelating column in the pore volume. Thus, a three-stage purification scheme is planned, which is followed by Ni-chelation followed by cation exchange (removing small molecule contaminants), followed by gel filtration.

When yeast is grown in shake flasks, the expression level by Coomassie blue staining of SDS-PAGE gels is estimated to represent about 10 mg / l. These levels are expected to increase in fermentation vessels, and we would like to initiate fermentation with the aim of obtaining larger amounts of protein. Regarding human OB constructs, transformed yeast clones containing high copy number OB genes have been identified, which are expected to express OB proteins. As antibodies are produced, they may be used to confirm the identity of the secreted 16 kDa protein.

Example 7: High Level Expression of Ob Fusion Protein in Bacteria

Preparation of freezer stocks:

40 μl of stock dextrose (0.4 g / ml, filter sterilized), 10 μl of ampicillin stock (200 mg / ml), and 5 each in two 4 ml aliquots of sterile M9ZB medium containing no carbon source. Μl of chloramphenicol stock solution (34 mg / ml in ethanol) was added. These were inoculated using a single colony of each E. coli with cloned mouse and human OB1 DNA in a Novagen pET-14b vector. The tube was incubated overnight at 37 ° C.

0.5 ml of overnight culture was used to inoculate 50 ml of M9BZ medium with dextrose, ampicillin and chloramphenicol. These were incubated at 30 ° C. and absorbance at 600 nm (A ₆₀₀ ) was periodically monitored. A 175 μl aliquot of the culture at A ₆₀₀ of about 1-1.2 was mixed with 25 μl of 60% glycerol in 2 ml eppendorf tubes, flash frozen in liquid nitrogen and stored at -80 ° C.

Culture Growth:

50 ml of M9ZB medium with 0.5 ml of 40% dextrose, 125 µl of ampicillin stock and 50 µl of chloramphenicol stock were inoculated with 1 ml of freezer stock and incubated at 30 ° C. At A ₆₀₀ of 1-1.2, 10 ml of this culture was used to inoculate each of 4 2 L flasks containing 500 ml of M9ZB medium with dextrose, ampicillin and chloramphenicol. They were incubated at 30 ° C. until an A ₆₀₀ of about 1-1.2 was induced at a final concentration of 0.5 mM IPTG. Cultures were incubated overnight. Cells were harvested by centrifugation at 4000 rpm for 20 minutes. This expression system yielded a recombinant OB polypeptide with a considerably high percentage of total protein, which is about the same gram / liter of E. coli .

Cell lysis and resuspension of inclusion bodies:

The cell paste was prepared with a minimum volume of 20 mM HEPES, pH 7.2, 10% glycerol, 0.1 M KCl, 5 mM MgCl ₂ , 1% aprotinin, 1 mM PMSF, 5 μg / ml leupetin and 50 μg / ml DNase Resuspended in I. The suspension was freeze thawed three times with liquid nitrogen and lukewarm water. The fused cells were centrifuged at 18000 rpm for 30 minutes and resuspended in 20 mM HEPES, pH 7.5, 0.1 M NaCl. The suspension was sonicated and Triton X100 was added at a final concentration of 2%. It was centrifuged at 18000 rpm for 15 minutes. After two more cycles of this cycle, three cycles of triton free washes were provided. Finally, the pellet was dissolved in 6 M GdHCl (guanidine-HCl), 20 mM HEPES, pH 7.5 by sonication and then centrifuged. Supernatant was used for further purification.

OB protein was purified unimmobilized by immobilized metal ion affinity chromatography (IMAC). The solution was charged to 5 column volumes of 50 mM NiSO ₄ and applied to a 40 ml column of Pharmacia chelated fast flowing Sepharose equilibrated in 6 M GdHCl, 20 mM HEPES, pH 7.5. The column was washed with 6 M GdHCl, 30 mM imidazole, 20 mM HEPES, pH 7.5. Finally, the protein was eluted with the same buffer containing 0.2 M imidazole. The non-overlapping protein in 6 M GdHCl was stored at 4 ° C. after adding sodium acetate (NaAc) to 10 mM and adjusting the pH to about 4.5 with acetic acid.

Refolding and Purification of Proteins:

6 M GdHCl solution containing 100 mg of protein was treated with 67 μl of 1 M dithiothreitol (DTT) and diluted to about 67 mL with 6 M GdHCl, 10 mM NaAc, pH 4.5. It was left stirring at room temperature for about 1 hour. This was then diluted with 4 L of 20% glycerol, 2.5 mM CaCl ₂ , 20 mM Tris, pH 8.4 buffer. After proper stirring, the solution was left at room temperature for about 8 hours without further stirring. Then 2000 units of purified bovine thrombin (from Thrombostat, Parke-Davis) were added and the solution was left with gentle stirring. After 2.5 hours, 2000 units of thrombin were re-added and the cleavage of the histidine-tag was continued for another 3 hours. Thrombin cleavage was inhibited by adding PMSF to a final concentration of 0.1 mM. The solution was filtered and stored at 4 ° C.

The cleaved protein was further purified on the same IMAC column as described above equilibrated in 1 M KCl, 20% glycerol, 20 mM HEPES, pH 8.4 buffer. After loading the protein solution, it was washed with the same buffer and the cleaved protein was eluted with 1 M KCl, 20% glycerol, 40 mM imidazole, 20 mM HEPES, pH 8.4. Uncleaved protein was eluted with 0.2 M imidazole.

Purified truncated protein was concentrated, treated with 50-100 mM EDTA, 10 mM potassium ferricyanide (to complete the incomplete oxidation reaction) and gel filtered on a Superdex 75 16/60 column. Yield using this method was close to 50% of the starting peptide.

Once purified, the expressed protein was characterized by several methods. Physical features include dynamic light scattering to measure the homogeneity of the structure and are used as a measure of proper overlap. Light scattering data suggest that human OB polypeptides are expressed predominantly or exclusively as monomers, whereas murine OB polypeptides can exist as monomers as well as dimers.

Tests and mass spectrometry using Elman's reagent confirm that the cysteine residues form disulfide bonds in the protein. This oxidized form of the polypeptide was administered to mice as described below to demonstrate biological activity.

Circular dichroism was used to approximate the structural geometry of the protein. CD spectra in physiological buffer (pH about 8, approximately physiological ionic strength) suggest that the human OB polypeptide has about 60% α-helical structure and about 40% random coil structure. Murine OB polypeptide was identified by CD spectroscopy with about 50% α-helix and 50% random coils.

Limited proteolysis followed by mass spectrometry (Cohen et al., 1995, supra) identified portions of the OB polypeptide that are prone to proteolysis. This analysis demonstrated the presence of the flexible loop structure of amino acid residues 54 to 60 (as shown in FIG. 4). This flexible loop seems to connect two regions of defined 2 ° structure, such as α-helix.

As shown in the examples below, the bioactivity of the purified protein is importantly an osmotic pump (eg, an Alzet osmotic pump from Alza Corporation (Palo Alto, Calif.)) Over a period of at least two weeks. Was tested by administering the protein to both dry and overweight rodents and obese rodents at daily or bolus doses and observed the effects on feeding behaviour and body weight.

Example 8 Weight Loss Effect of OB Polypeptide (Leptin)

The gene product of the mouse OB locus plays an important role in controlling body weight. This example demonstrates that the OB protein circulates in the plasma of mice, rats, and humans. The cyclic in all three species has the same molecular weight as the deduced polypeptide sequence without signal sequence, by SDS-PAGE, suggesting that the protein is not processed in vivo after cleavage of the signal sequence. The OB protein was absent in the plasma of C57 / B16J ob / ob mice, 10 times higher concentrations in the plasma of db / db mice and 20 times higher in the plasma of fa / fa rats than in the control group. This suggests that these obese mutants are resistant to the effects of OB. There was a sevenfold difference in plasma levels of OB protein in a group of six thin human subjects. Daily injection of recombinant mouse OB protein significantly reduced body mass in ob / ob mice, had a significant effect on body weight of wild type mice, and no effect on db / db mice. These data suggest that the gene product of the OB locus exhibits endocrine function of controlling body weight.

Materials and methods

Rabbits were immunized with recombinant proteins in Freund's adjuvant (HRP, Inc.). Immunopurified anti-mouse OB antibodies are conjugated to a recombinant protein with antisera as described in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1988). Prepared by passing over a Sepharose 4B column. Immunoprecipitation of mouse plasma was performed as follows: 0.5 ml of serum from mice, rats and humans containing about 2.5 mM EDTA was chartered with Sepharose-4B unconjugated at room temperature with shaking for 2 hours. Decided. Sepharose was spun off and 50 ml of a 50% slurry of antibody-conjugated Sepharose containing affinity-purified antibody at a concentration of 1 mg per ml of packed Sepharose was added. 0.5 ml of 2 × RIPA buffer was added to provide the following final binding conditions: 50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate and 0.025% sodium azide. The reaction was carried out overnight at 4 ° C. with shaking. Antibody-conjugated Sepharose was washed eight times with RIPA buffer, then three times with PBS and then run on 15% SDS-PAGE. Proteins were transferred to nitrocellulose and western blotted using biotinylated immunopurified antibodies to recombinant proteins. The secondary antibody used was HRP-streptavidin, and ECL was used for detection.

To quantify the amount of OB in mouse serum, an increase in the amount of re-overlapping recombinant mouse OB protein (0.01, 0.1, 0.5, 2.0, 15.0 ng) was added to 100 λ C57BL / 6J ob / ob plasma and the protein Incubated with A Sepharose conjugated antibody for 3 hours at 4 ° C. After extensive washing with Buffer A (10 mM sodium phosphate buffer, pH 7.4; 100 mM NaCl; 1% Triton X-100, 5 mM EDTA, 1 mM PMSF), the sample was resuspended in sample buffer to give 15% SDS- Loaded on PAGE and transferred to nitrocellulose membrane. Western blotting was performed using biotinylated anti-amino-terminal antibodies as primary antibodies and HRP-streptavidin as secondary antibodies, followed by ECL detection.

Cytoplasmic extracts were prepared by polytron and dounce homogenization in NDS buffer (10 mM Tris, pH 7.5, 10 mM NaCl, 60 mM ICCI, 0.15 mM spermine, 0.5 mM spermidine, 14 mM β-mercaptoethanol , 0.5 m EGTA, 2 mM EDTA, 0.5% NP-40) was prepared by homogenizing adipose tissue and removal of nuclei was performed by centrifugation at 700 g.

Immunoprecipitation reactions were performed as described above except using immunopurified anti-human OB antibodies. For ELISA, 100 ml of 1 mg / ml solution of immunopurified anti-human OB antibody was dissolved in borate buffered PBS solution and applied overnight to microtiter (Corning cat. # 2595) plates at 4 ° C. The plate was then washed four times with a borate saline solution containing 0.05% Tween 20 and excess liquid was removed. Plates were blocked by incubating for 2 hours at room temperature with 240 ml of borate saline buffer containing 0.3% gelatin per well, then washed and dried. A known dose of either 100 ml volume of re-overlapping human OB protein or plasma sample was incubated overnight at 4 ° C. in each well. After washing, the plate was incubated with 100 ml biotinylated immunopurified anti-human antibody (0.1 mg / ml in gelatin-borate buffer) for 4 hours at room temperature. After washing, horse radish peroxidase (HRP) -streptavidin was added to the plate (0.1 mg / ml in borate buffer, 0.3% gelatin). Thereafter, HRP substrate solution (ABTS, 0.3 mg / ml and H ₂ O ₂ , 0.01% in citric acid) was used for detection, and OD was measured at 414 nM to quantify antibody binding.

Mouse and human OB gene coding sequences were PCR amplified from plasmids containing OB cDNA sequences and subcloned in the pPIC.9 plasmid (Invitrogen). The human 5 'primers used were SEQ ID NO: 34 and the 3' primers were SEQ ID NO: 35:

For mice the 5 'primer was SEQ ID NO: 36 and the 3' primer was SEQ ID NO: 37:

The 5 'primers for both mouse and human contain the coding sequence for the last 4 amino acids of the α-crossover signal sequence present in the Xho I site and vector pPIC.9 at the 5' end. This vector directs the heterologous gene to be secreted from the cell into the culture medium. The 5 'PCR primer also includes the first 19 nucleotides of the OB gene open reading frame, following the signal sequence cleavage site and before alanine at amino acid position 21. The 3 'primer contains an Eco RI site at its 5' end, which immediately follows the sequence complementary to the putative OB stop codon. PCR conditions were as follows: denaturation at 94 ° C. for 1 minute, annealing at 55 ° C. for 1 minute, and extension at 72 ° C. for 2.5 minutes. Low cycle PCR (15 cycles) and proof-reading polymerase PFU (Stratagene) were used to limit the number of PCR-generated mutations. PCR products were digested with Xho I and Eco RI and cloned into similarly digested vector pPIC.9. All constructs were sequenced on two strands to confirm the absence of PCR-generated mutations. Clones were transformed in Pichia pastoris (His ⁻ ) by the spheroplast method and selected on histidine deficient media. Approximately 200 mouse and human clones were selected for integration of high copy numbers by colony hybridization test method. High copy clones were then tested for OB expression by Coomassie staining, indicating the presence of novel 16 kD proteins present in the culture medium of preferentially transformed yeast. The 16 kD band was identified to be OB using antibodies generated against bacterially expressed OB proteins. The recombinant protein was purified by a two-step purification method described below. Mass spectrometry and cyanogen bromide treatment were performed as described in Beavis et al., Proc. Natl. Acad. Sci. USA, 87: 6873-6877 (1990).

The entire OB encoding sequence of the mouse and human OB genes C-terminal towards the signal sequence was subcloned into the pET15b expression vector (Novagen) and the T7 RNA polymerase system [Studier et al., Meth. Enzymology, 185: 80-89 (1990)] overexpressed in Escherichia coli [BL21 (DE3) p1YsS]. Cells grown at 595 nM to absorbance 0.7 at 30 ° C. and overnight induced with 0.5 mM isopropyl-β-D-thiogalacto-pyranoside were harvested by low speed centrifugation. Thawing was performed by 3 cycles of freeze thawing, and DNA digestion was performed using DNaseI. Membrane extraction was performed by sonication and detergent solubilization, and the final inclusion body pellet was dissolved in 6 M guanidine-HCl, 20 mM HEPES, pH 8.4. Recombinant OB protein was purified under denaturing conditions by IMAC using a Ni-ion affinity column and washing with increasing amounts of imidazole. The purified denatured OB protein was then stored in 6 M guanidine-HCl, 10 mM sodium acetate (NaAc), pH 5 and reduced using 1 mM DTT for 1 hour at room temperature. Denaturation was performed by diluting the reduced protein with 20% glycerol, 5 mM CaCl ₂ , 5 mM NaAc, pH 5, mixing thoroughly and incubating at room temperature for 8-12 hours. After denaturation, Tris was added to 10 mM to adjust the pH to 8.4 and the hexa-histidine tag was removed by thrombin cleavage. Cleaved and restored proteins were reconstituted by IMAC to separate product from thrombin and uncleaved fusion protein. The cleaved and restored protein elutes from the Ni-ion affinity column at 40 mM imidazole, whereas thrombin is not stored and uncleaved fusion protein elutes at 0.2 mM imidazole. The product was then concentrated, treated with 100 mM EDTA and 10 mM potassium ferricyanide and further purified by gel filtration using a Pharmacia superdex 75 16/60 column.

Elmans test was performed as described in Ellman, Arch. Biochem. Biophys., 82: 70-77 (1959). Elmans reagent was prepared by dissolving 39.6 mg of 5,5'-dithio-bis (2-nitrobenzoic acid) (DTNB) in 10 ml of 0.05 M phosphate, pH 8. The calibration curve was constructed at a concentration range of 10-120 mM free sulfhydryl (using 1 mM stock of reduced DTT) at 412 nm. Each test was performed using 0.02 mL Elmans reagent and 0.5 mL total reaction mixture. The measured extinction coefficient was 12974 M ⁻¹ cm ⁻¹ for the glass sulfhydryl group (correlation coefficient 0.99987), which is within 5% of the previously reported value of 13600 M ⁻¹ cm ⁻¹ .

Elman's test was performed on 50 ml of 2 mg / ml pure gel filtered protein corresponding to a possible free sulfhydryl concentration of about 24 mM in the final reaction mixture. The resulting solution exhibited an A ₄₁₂ of about 0.02, suggesting that two cysteine residues in the protein are present in an oxidized state that forms cystine, or that their free sulfhydryl groups are accessible to overlapping proteins. It suggests that it is completely embedded in the missing core. The same test was performed on the non-overlapping protein in the presence of 6 M guanidine-HCl to obtain the same results.

Mice were individually housed in a pathogen free environment, had an energy content of 1.30 kcal / gm, 35% (w / w) Laboratory Rodent Diet 5001 (PMP Feeds, Inc.), 5.9% ( w / w) was adapted to a tapioca pudding mix (General Foods) and a diet containing 59.1% water. The diet was sterilized by autoclave and filled in a 60 mm plastic dish fixed on top of a 100 mm Petri dish. Tapioca makes diet into a staple mixture, which makes it difficult for animals to spread food in cages. A small amount of feed scattered by the animal is recovered with a 100 mm lid. A new dish of feed was placed in the cage every morning, and the previous day's dish was taken out and weighed. Differences in weight provided a measure of daily feed consumption. The effect of recombinant protein on feed intake and body weight was measured on three strains of mice: C57Bl / 6J ob / ob , C57 B1 / Ks db / db and CBA / J + / + (they were purchased from Jackson Laboratory). Thirty mice from each strain were divided into groups of ten. One group from each strain was injected daily with ip intraperitoneally injected with bacterial ob protein at a dose of 5 mg / g / day in 300 μl of PBS. The second group was injected intraperitoneally with the same dose of PBS. These control mice were injected with PBS dialysate of recombinant protein. PBS was detoxified using an Acticlean ETOX column. The third group of animals was not injected. Feed intake was recorded daily and weight measurements were regularly recorded at 3.5 week intervals. Pair (pair) to a feeding experiment, was compared on a daily basis to that consumed by a separate group of feed intake of the ob mice ob mice fed the protein.

result

OB protein circulates in mouse, rat and human plasma.

Recombinant mouse and human OB proteins were prepared by cloning into Pichia pastoris , a yeast expression system that secretes recombinant proteins directly into culture medium using the pET 15b bacterial expression vector (Novagen). The ob protein expressed in yeast comprises 146 amino acids that are carboxy-terminal towards the signal sequence. Rabbits were immunized with bacterial protein (HRP, Inc.). Antibodies were immunopurified (Research Genetics) and used for immunoprecipitation and Western blot of proteins from plasma and adipose tissue.

OB protein from mouse plasma is shifted to an apparent molecular weight of 16 kD by SDS-PAGE. Electrophoretic mobility is identical to recombinant OB protein secreted by yeast after removing the signal sequence (FIG. 24A). Protein was not detected in plasma from C57BL / 6J ob / ob mice with nonsense mutations in codon 105. Several different antisera failed to identify the cleaved 105 residue polypeptide chains expected by the cDNA sequence.

A 10-fold increase in the level of circulating protein was observed in db / db mice compared to control animals (FIG. 24A). Immunoprecipitation of plasma from wild type and fa / fa rats showed a 20-fold increase in OB protein levels in mutant rats compared to wild type (FIG. 24B). db mutations result in the same obesity phenotype as seen in ob mice (Bahary et al., 1990, supra). Fatty rats are obese as a result of recessive mutations in genes homologous to db (Truett et al., 1991, supra). To quantify the level of OB in mouse plasma, increasing amounts of recombinant protein were added to the serum and immunoprecipitated (FIG. 24C). The linear increase in signal intensity on Western blots was seen as the amount of recombinant protein increased. Comparing the signal intensity of the natural protein in mouse plasma with the standard, the circulating level of OB protein in wild-type mice was found to be about 20 ng / ml. These data demonstrate that immunoprecipitation and Western blot were performed under conditions of antibody excess. Increased levels of OB protein were also seen in protein extracts of adipose tissue from db / db mice compared to controls (FIG. 24D). As expected for secreted proteins, proteins from adipose tissue were classified as crude membrane fractions (data not shown).

Plasma samples from six lean human subjects with a Body Mass Index (BMI = weight / length ² ) of less than 25 were immunoprecipitated using immunopurified antibodies to human proteins. The immunoprecipitated material migrated to the same electrophoretic mobility shown for the 146 amino acid human protein expressed in yeast. The intensity of the signal varied significantly between the six samples (FIG. 25A). Density measurements of autoradiography showed approximately 5-fold differences in levels for individuals HP1 and HP6, with median levels in other subjects. Enzyme-linked immunoassays (ELISA) were performed using bacterial proteins and immunorefined antibodies re-overlapping as standards (see below). The resulting standard curve is shown in Figure 25B. Using this test method, plasma levels of OB protein in 6 human plasma samples varied between 2-15 ng / ml (FIG. 25C). The level of OB protein in plasma from HP6 is outside the linear range of the immunoassay and is ≧ 15 ng / ml. These quantitative differences were associated with those seen in Western blot.

Preliminary data suggest that leptin can at least partially form a circulatory complex with another protein or proteins. This conclusion was based on the heterogeneity of the shape of the titration curve for serum compared to recombinant standards. Analysis of large amounts of leptin immunopurified on rabbit anti-OB columns by gel filtration HPLC under denaturing and non-denaturing conditions, monitored by ELISA and SDS-PAGE, suggested that the OB polypeptide behaves like a high molecular weight complex. However, these data remain preliminary and this has not yet been specified if there is an OB binding protein.

Structural Features of OB Protein

Since the OB protein has two cysteine residues, it can form intramolecular or intermolecular disulfide bonds under oxidative conditions in vivo. Western blot was repeated with or without reducing agent in the sample buffer. Under two conditions, OB protein in human serum migrated as monomers (data not shown). Under non-reducing conditions, immunoprecipitated proteins from db mouse serum were detected at positions consistent with both 16 kD monomers and about 32 kD dimers (FIG. 26A). The high molecular weight site was lost under reducing conditions, suggesting that the fraction of mouse OB circulates into high molecular weight species through the formation of intramolecular disulfide bonds. About 80% of mouse OB circulates about 16 kD protein and 20% circulates in about 32 kD form.

The same molecular form appears when mouse and human proteins are expressed in Pichia pastoris [Abrams et al., Immunol. Rev., : 5-24 (1992). In these studies, the DNA sequence corresponding to the 146 amino acid mature OB protein was cloned downstream of the yeast α-crossover signal sequence in the pPIC.9 vector (Invitrogen). OB protein was purified from yeast medium of strains expressing mouse and human proteins and electrophoresed under reducing and non-reducing conditions (FIG. 26A). Mouse proteins were expressed mainly as dimers in yeast under non-reducing conditions and only as monomers in the presence of reducing agents. Recombinant human protein migrated to the position of the monomer under both conditions (data not shown).

Purified human protein expressed in Pichia had a molecular mass of 16,024 ± 3 Da as determined by mass spectrometry 1990 (Beavis, 1990, supra). This value is consistent with the mass calculated from the amino acid sequence of the protein containing a single intramolecular disulfide bridge (16,024 Da). Matrix-assisted laser desorption mass spectrometry of the cyanogen bromide cleavage product of the protein suggests that cysteines 117 and 167 are linked via intramolecular disulfide bonds (FIG. 26B). Cyanogen bromide cleaves the carboxy terminus against methionine residues.

Preparation and Characterization of Bioactive Recombinant Proteins

Mouse OB protein is this. E. coli was expressed from the pET 15b plasmid as an insoluble fusion protein with a 20 residue N-terminal hexa-histidine tag containing thrombin cleavage site. Bacterial inclusion bodies were solubilized using guanidine-HCl and purified under denaturing conditions using immobilized metal ion affinity chromatography (IMAC) (FIG. 27). Purified and denatured fusion proteins were reduced, diluted and allowed to re-overlap in aqueous solution at room temperature. After thrombin cleavage, the restored mouse OB protein containing four additional N-terminal residues (Gly-Ser-His-Met; SEQ ID NO: 38) was determined by SDS-PAGE and mass spectrometry. Repurchased by IMAC to> 98% uniformity. Matrix-assisted laser desorption mass spectrometry provided a measured mass of 16,414 ± 3 Da (expected mass = 16,415 Da). Both the reduced and non-reduced SDS-PAGE gels showed a single molecular species with an apparent molecular weight of 16 kD (data not shown).

Dynamic light scattering using a DP801 Molecular Size Detector (Protein Solutions, Inc.) demonstrated that the restored mouse OB protein was mostly monomeric and had some higher grade aggregates. Proteins were treated with EDTA and chemically oxidized. The high molecular weight species were then removed by gel filtration. Further dynamic light scattering demonstrated that the purified and restored recombinant mouse OB protein was monodisperse. Following dialysis against phosphate buffered saline (PBS), bacterial endotoxins were removed using an Acticlean ETOX column (Sterogene Bioseparations, Inc.). The final yield of protein was 45 mg / l.

Elman's test was performed on purified and restored recombinant mouse OB protein to assess its oxidation state (Ellman, 1959, supra). Both the restored protein and the protein unoverlapping with 6 M guanidine-HCl showed a free sulfhydryl content of <0.5%, demonstrating that the monomeric product contains intramolecular disulfide bonds. This was confirmed by mass spectrometry of the cyanogen bromide cleavage product of the re-overlapping bacterial protein (data not shown).

Bioactivity of OB Protein. 5 mg of purified and restored recombinant mouse OB protein in a group of 10 C57B1 / 6J ob / ob (16 weeks old), C57B1 / Ks db / db (12 weeks old) and CBA / J + / + (8 weeks old) mice Administration was by daily intraperitoneal injection at a dose of / kg / day. The same number of animals were injected daily with PBS. PBS used for control injection was derived from dialysate after equilibration of the protein. Ten additional animals from three mouse strains were not injected. Feed intake of the individual animals was monitored daily and the body weights of the animals were recorded at 3 or 4 day intervals. Cumulative results for feed intake and body weight from each of the nine groups of mice are shown in FIGS. 28A-F and the statistical significance of the data is shown in Table 1. Feed intake of protein-injected C57B1 / 6J ob / ob mice decreased significantly after the first injection and continued to decrease until day 5, when stabilized at approximately 40% of the intake of animals injected with PBS. (p <0.001). OB mice injected with sham showed no weight loss over the three week test period. C57B1 / 6J ob / ob mice receiving protein lost about 10% of their body weight after 5 days (p <0.001). These animals consistently exhibited weight loss over three weeks of treatment, at which point the protein weights of ob animals decreased to an average of 60% of their initial weight (p <0.001). A group of separate ob mouse was contained just in the ob mice treated with protein pairs. The data in FIG. 29B show that paired fed mice lost much less body weight than animals fed the recombinant protein (p <0.02). Photographs of the two mice injected with protein or vehicle by injection show visual differences in appearance due to protein treatment (FIG. 29B). To further confirm the effect of the protein, necropsy was performed on two mice in each group. Visual examination of protein-administered ob mice showed a marked decrease in liver size as well as body fat. Liver weight of db and wild type mice was not changed by treatment. Liver from ob mice injected with PBS was weighed to be 5.04 and 5.02 grams compared to 2.23 and 2.03 grams in animals receiving recombinant protein. In contrast to the pale fatty liver characteristics of ob mice, livers from ob mice that received protein obtained darker color features of normal livers (FIG. 29C). Histological sections of the liver showed that untreated animals had fatty liver and that in protein treated animals this was a marked improvement (data not shown).

Unlike ob mice, body weight or feed intake did not show a significant difference in protein-administered C57BL / Ks db / db mice compared to vehicle-administered controls (FIGS. 28A-F, Table 1). All three groups of db / db mice lost 2-5 grams during processing. The mean blood glucose of db mice was measured using a glucometer and was ≧ 500 mg / dL in all mice, suggesting that these animals developed diabetes secondary to obesity. Injection of db mice ended after two weeks.

In wild type mice there was a small but significant decrease in body weight after administration of the recombinant ob protein (FIGS. 28A-F, Table 1). After 5 days of protein injection, treated mice lost an average of 0.5 grams, whereas control mice gained 0.4 grams (p <0.02). At two subsequent time points, the animals administered the protein were much less weight than mice injected daily with PBS. Significance of body weight change decreased at later time points. Feed intake in animals that lost weight did not differ significantly from control animals. Injection of PBS showed a small but significant effect on feed intake and body weight in ob, db and wild-type mice compared to non-injected mice (p <0.05).

Review

The endocrine function for the protein product of the OB locus was first proposed by Coleman, who showed that the weight of ob / ob mice was reduced after paraabiotic union for normal or db mice. (Coleman et al., 1978, supra). The above-mentioned results support this hypothesis by indicating that OB proteins circulate in the bloodstream and that injection of recombinant proteins results in weight loss. The molecular weight of the gene product encoded by the OB gene is about 16 kD, which corresponds to the 146 amino acid sequence that is carboxy-terminally towards the signal sequence. Recombinant OB protein is not modified when expressed in Pichia pastoris . Expression of mammalian genes in Pichia results in the formation of correct protein structures (Cregg et al., Bio / Technology, 11: 905-914 (1993)). These findings suggest that the OB protein is not glycosylated and is not post-detoxified in vivo. The data do not exclude the possibility that the OB protein binds to itself or to other proteins in plasma or adipose tissue. Although proteolytic cleavage of the protein was not excluded, low molecular weight forms of the OB protein were not detected by any antiserum used including four anti-peptide antibodies.

The OB protein has two cysteine residues and circulates as monomers in humans and monomers and dimers in mice. Representative intramolecular disulfide bonds to secreted molecules appear when human proteins are expressed in Pichia pastoris , suggesting that they are likely to exist in vivo. This is supported by the bioactivity of recombinant bacterial proteins with intramolecular disulfide bonds. Mouse OB proteins can be found in the plasma as monomers and as dimers. Monomers and dimers appear when the mouse OB protein is expressed in yeast, indicating that the tendency of mouse proteins to form dimers is the result of differences in primary sequences relative to the human body. It is clear that the monomer has bioactivity, but the functional activity of the dimer is unknown.

The effect of OB protein on feed intake and body weight in ob mice is significant. After three weeks of treatment, ob mice injected daily with recombinant protein lost 40% of their body weight and consumed 40% of the feed as control animals. Moreover, the weights of treated ob mice were still not equilibrated at the end of the experiment. The results of the paired feeding experiments suggest that weight loss is the result of effects on both feed intake and energy consumption. Thus, a separate group of ob mice, whose calorie intake was limited to the intake of protein-administered ob mice, lost much less weight than the protein-administered animals. Reducing feed intake in ob / ob mice to levels lower than that of wild type mice within days of administration of the OB protein indicates that they are particularly sensitive to their effects. Indeed, OB receptors can be upregulated in these animals. Feed intake of treated ob mice became relatively constant after 5 days of treatment. If this is the result of the protein reaching steady state levels, this suggests that the protein has a relatively long half-life [ The Pharmacological Basis of Therapeutics, pp. 19-45, Goodman and Gilman, eds., Pergamon Press, New York, (1990). This result is consistent with data from by-products experiments [Coleman et al., 1978, supra; Weigle, Int. J. Obesity, 12: 567-578 (1988).

The effect of recombinant protein on the weight of wild type mice was small but statistically significant during the first two weeks of the test. The difference in body weight between the wild type mice receiving the protein and the wild type mice receiving the PBS persisted at a later time point, but the statistical significance of the data decreased significantly after 3 weeks. Initial weight loss may not be due to differences in feed intake. Perhaps the measurement of feed intake was not accurate enough to detect a reduction that caused a 1 gram difference in body weight during treatment. These observations differ from the results of previous experiments in which wild-type rodents are bound by abysmal union of db mice, fa rats, rats with hypothalamic lesions, and rats with obesity by a high-calorie diet [Coleman et al. , 1978, supra; Harris et al., 1987, supra; Harris et al., "Physiological and metabolic changes in parabiotic partners of obese rats", in Hormones, Thermogenesis and Obesity, Lardy and Straatmen, eds., Elsevier Science Publishing Co., New York (1989); Hervey, J. Physiol., 145: 336-352 (1959). In each case, wild-type animals became anorexic and lost large amounts of weight. Because levels of OB protein increase in db mice and fa rats, and levels of OB RNA increase in mice with hypothalamic lesions, wild-type mice may respond to OB when OB circulates in the plasma at high enough levels. I think I can. The results reported here are consistent with the possibility that the level of protein administered is below the endogenous level, leading to equilibrium with slightly smaller body weights. Quantification of the circulating level of OB protein in treated mice can solve this problem. Although immunoassay of mouse proteins is not yet available, immunoprecipitation has indicated that levels of circulating OB protein have not been substantially elevated in wild-type mice receiving the protein.

The smaller effect of proteins on wild-type mice and the absence of responses in db mice do not seem to make treatments have nonspecific or evasive effects. All db mice lost a small amount of body weight during the treatment, whether or not they received the ob protein. db animals were markedly hyperglycemic and weight loss appears to be the result of diabetes but is not an experimental protocol. C57BL / Ks db / db mice often develop diabetes and small amounts of weight begin to lose when the animals used in this test age (Coleman et al., 1978, supra). C57B1 / 6J ob / ob mice of similar age did not express significant hyperglycemia. These phenotypic differences were thought to be the result of genetic differences in strains involving mutations (C57B1 / 6J vs C57Bl / Ks) (Coleman et al., 1978, supra).

Failure to detect the truncated 105 amino acid protein predicted by the cDNA sequence of the OB gene in C57B1 / 6J ob / ob mice suggests that the mutant protein is either disrupted or untranslated. However, the possibility that the antiserum used cannot detect this cleaved protein cannot be ruled out. Observations of a 10-fold increase in the level of ob protein in db mice compared to wildtype suggest that the ob protein is overproduced if it is resistant to its effects. These data are associated with the study of OB mRNA. As mentioned, previous experiments have shown that mutations in the mouse db and rat fa genes located in homologous chromosomal portions result in overproduction of plasma-inhibiting plasma factors (Truett et al., 1991; see above). Coleman, 1978, supra; Hervey, 1959, supra). In both cases, mutant animals were resistant to the effects of OB proteins. This possibility is confirmed by the observation that OB protein does not affect body weight or feed intake when administered to db mice.

Obesity in humans may be associated with increased levels of OB protein in plasma in individuals that are relatively unresponsive to hormones. On the other hand, reduced expression of OB can also cause obesity, in which case the protein may appear at "normal" (ie, inappropriately low) levels. Thus, the level of OB protein in human plasma can be a marker for various forms of obesity. For small groups of thin subjects with BMI <25, low nanogram levels of circulating OB protein can be detected by ELISA. Significantly, various concentrations appeared, suggesting that the level of expression and / or sensitivity to proteins may play a role in determining body weight.

The site of action of the OB protein is unknown. Proteins affect both feed intake and energy expenditure, and this finding is consistent with clinical trials suggesting that alterations in both systems act to control body weight [Leibel et al., N. Engl. J. Med., 332: 621-628 (1995); Keesey et al., "Metabolic defense of the body weight set-point," in Association for Research in Nervous and Mental Disease, pp. 87-96, Stunkard and Stellar, eds., Raven Press, New York, (1984). The hypothalamus may be downstream of OB in the path of weight control, but may also have a direct effect on various organs.

Example 9: lesions of the hypothalamus and db  In mice with mutations at the locus OB  Increased expression of RNA in adipocytes

The gene product of the recently cloned mouse obesity gene ( OB ) plays an important role in regulating adipose tissue mass. OB RNA is specifically expressed in vivo by mouse adipocytes in each of several different adipocyte depots, including brown fat. It is also expressed in cultured 3T3-442A battery cells induced to differentiate. Mice with hypothalamic lesions and mouse mutants at db locus express 20-fold higher levels of OB RNA in adipose tissue. These data suggest that both the db gene and hypothalamus are downstream of the OB gene in a pathway that regulates adipose tissue mass, and are consistent with previous experiments suggesting that the db locus encodes the OB receptor. In mice with db / db and lesions, quantitative differences in the expression levels of OB RNA are associated with lipid content of adipocytes. Molecules that regulate the expression level of the OB gene in adipocytes may play an important role in determining body weight because they are molecules that mediate the effects of OB on their site of action.

Materials and methods

In situ hybridization

White adipose tissue from the same intraperitoneal section of wild type (wt) and db mice was simultaneously treated according to the modified method described in Richardson et al., Growth, Development & Aging, 56: 149-157 (1992). . Briefly, tissue was fixed in Bouin's solution at 4 ° C. for 2 hours. Thereafter, they were dehydrated by continuous treatment at 4 ° C. with increasing concentrations of ethanol from 10% to 100% for 5 minutes each. Tissues were further incubated at 65 ° C. with xylene (1 h) and paraffin (2 h). The embedded wt and db / db adipose tissues were sliced and mounted under the same conditions. Sections were baked at 65 ° C. for 1 hour, treated with xylene, and serially dilute at room temperature for 3 minutes from 100% to 50% using ethanol. Antisense RNA probe of OB gene was synthesized by in vitro transcription of linearized OB gene coding sequence upstream of a Sp6 RNA polymerase promoter. In situ hybridization was performed exactly as described in Schaeren-Wiemers, et al., Histochemistry, 100: 431-440 (1993).

RNA production and cell culture

Total RNA and Northern blots were prepared as described. Interstitial vascular cells and adipocytes are prepared according to Rodbell, and RNA from two fractions is described by Dani et al., Mol. Cell. Endocrinol., 63: 199-208 (1989); Rodbell, J. Biol. Chem. 239: 375-380 (19)). After sub-cloning, 3T3-F442 cells were grown in Dulbecco's modified Eagle's medium (defined as standard medium) containing 10% fetal bovine serum [Dani et al., "Molecular biology techniques in the study of adipocyte differentiation". ", in Obesity in Europe vol. 88, pp. 371-376, Bjorntorp and Rossner, Eds., John Libbey Company Ltd., London, England (1989). At confluence, cells were treated in standard medium supplemented with 2 nM triiodotyronine (T3) and 17 nM insulin. After 12 days, RNA was prepared as described above.

Gold Thioglucose Treatment (GTG)

Two month old female CBA / J mice were treated by single intraperitoneal injection of aurothioglucose (Sigma Catalog No. A0632) at a dose of 0.2 mg / g in saline. Control animals were injected with saline. Mice were weighed one month after treatment. Adipose tissue RNA was isolated from these treated animals that gained more than 20 grams in weight after GTG treatment.

result

Recently, the OB gene has been shown to be expressed in adipose tissue (Zhang et al., Nature, 372: 425-432 (1994)). Because adipose tissue consists of a number of cell types, including adipocytes, alloblasts, fibroblasts, and vascular cells, in situ hybridization is an epididymal fat pad from normal animals using sense and antisense OB riboprobes. Sections were performed [Richardson et al., 1992, supra; Wasserman, "The concept of the fat organ" in Rodahl, Issekutz, fat as a tissue " , pp. 22-92, McGraw Hill, New York (1964)]. All fat cells in sections, when using antisense probes. A positive signal could be detected at (labeled as Figure 30-Wt) when no antisense probe hybridized to sections of the brain, no signal (data not shown) from C57B1 / Ks db / db mice. hybridization of the antisense probe to sections of adipose tissues was significantly increased, and this is to identify the adipocyte specific expression of OB RNA and demonstrate a significant increase of adipocytes per, OB RNA levels in these animals (Figure 30 - db / represented in db) mouse mutant in db locus are extremely obese as part of the same syndrome in C57B1 / 6J ob / db as phenotypic found in mouse (see Bahary et al., 1990, supra).

OB RNA was not synthesized by adipose tissue stromal cells isolated from adipocytes. As expected, cells in the adipocyte fraction expressed OB RNA using Northern blot (FIG. 31). The same result was obtained using RT-PCR (data not shown). These data support the conclusion that only adipocytes express the OB gene. Data from cultured adipocytes also demonstrate this conclusion. In these tests, 3T3-F442A cells were cultured using conditions that induce lipid accumulation as part of a cellular program that induces differentiation into adipocytes. OB RNA did was not expressed in cells growing exponentially, it not expressed in the initial expression of the markers (markers) in the oil synthesis 3T3-F442A pre adipocyte differentiation of adipocytes in these cells of detectable levels of OB Expression of RNA was induced (FIG. 31) [Dani et al., J. Biol. Chem., 264: 10119-10125 (1989). The level of OB RNA is very sensitive to culture conditions, so no message was observed in late post-combination cells that were not exposed to insulin.

Hybridization tests show that OB RNA is expressed in vivo in several different fat reservoirs, including epididymis, cervical connective tissue, abdomen, perimeter kidney, and inguinal fat pad (FIG. 32A). The exact level of expression in each reservoir was somewhat variable, but the inguinal and cervical connective tissue fats expressed lower levels of OB RNA. OB RNA is also expressed in brown adipose tissue, but the expression level is about 50-fold lower in brown fat compared to other adipose tissues. These quantitative differences correlate roughly with the difference in cell size between the various reported adipocyte reservoirs (Johnson et al., J. Lipid Res., 13: 2-11 (1972)). The amount of OB RNA in brown fat is not affected by cold exposure (FIG. 32B). In this experiment, the level of uncoupled protein RNA (UCP) increased in brown fat after cold exposure, but the level of ob RNA did not change [Jacobsson et al., J. Biol. Chem., 260: 16250-16254 (1985). In the fusions, these data demonstrate that all adipocytes can produce OB RNA, indicating that the level of expression in different adipose reservoirs is variable. These data support the possibility that the level of encoded protein may be correlated with total adipose tissue mass.

Levels of OB RNA were measured in db / db mice and mice with hypothalamic lesions. Lesions of the hypothalamus (VMH) during ablation cause obesity as part of a syndrome similar to that seen in ob / ob and db / db mice (Bray et al., Metabolism, 24: 99-117 (1975)). By-product experiments support that these lesions induce overexpression of blood-derived factors that inhibit feed intake and body weight (Hervey, 1959, supra). Similar results are seen when mouse mutants in the db locus are by-produced for normal mice, suggesting that the OB receptor can be encoded by the db locus (Coleman et al., 1978, supra). Thus, obesity due to VMH lesions and db mutations may be the result of resistance to the effects of OB proteins. If so, a secondary increase in the level of OB RNA in adipose tissue can be expected.

Hypothalamic lesions were induced in female CBA mice using chemical gold thioglucose (GTG) [Debons et al., Fed. Proc., 36: 143-147 (1977). This treatment results in specific hypothalamic lesions mainly in the hypothalamus (VMH) during abdominal measurement, which later develops into obesity within a few weeks. Typically, one intraperitoneal injection of 0.2 mg of GTG per gm body weight causes the development of obesity within 4 weeks. One month old female CBA / J mice (20-25 grams) were treated with GTG and the subsequent weight gain of treated and control animals is shown (Table 2). Adipose tissue RNA was prepared from db / db mice and from these GTG treated animals with an increase of> 20 gm. Northern blots showed a 20-fold increase in OB RNA levels in db / db and GTG-treated mice at 2 months of age compared to normal animals (FIG. 33).

Two month old female CBA / J mice were treated with gold thioglucose (GTG). Gold thioglucose (Sigma A0632) was administered intraperitoneally at a dose of 2.0 mg / g as a saline solution. Body weights of control and injected animals were recorded before and 1 month after injection. Five animals were placed in the cages, and the feed was freely eaten. The amount of body weight gained 1 month after injection is shown in Table 2. Animals gaining more than 20 g body weight one month after injection were selected for further testing.

Review

The gene product of the mouse OB gene can circulate in mouse and human plasma, where it can act to regulate adipose tissue mass. Further testing of OB's expression control and mechanism of action has an important relationship in understanding the physiological pathways that control body weight.

This example shows that the OB gene product is exclusively expressed by adipocytes in all adipose tissue depots. This result is consistent with the possibility that the protein product of the OB gene correlates with lipid accumulation in the body. In addition, OB RNA is up-regulated 20-fold in db mice and mice with hypothalamic lesions. Since adipocyte cell sizes increase approximately 5-fold in these animals, the actual increase in the level of OB RNA per cell in these animals appears to be much greater than 20-fold (see Figure 30) (Debons et al., 1977) . , See above). These data are consistent with the hypothesis that the ob gene and hypothalamus are located downstream of OB in the weight control pathway, and that the OB receptor is encoded at the db locus [Coleman et al., Diabetologia 14: 141-148 (1978)]. . Molecular cloning of the OB receptor and / or db gene can restore this tissue. Increasing OB RNA levels in db / db and GTG-treated mice also suggest non-autonomous function of the OB gene product in adipocytes [Ashwell et al., Proc. R. Soc. Lond., 195: 343-353 (1977); Ashwell et al., Diabetologia, 15: 465-470. In other words, if the encoded protein acts directly on adipocytes to inhibit growth or differentiation, overexpression of the wild type OB gene in GTG treated mice can result in a lean phenotype.

The most rigorous explanation of these data is that OB proteins act as endocrine signaling molecules secreted by adipocytes and act directly or indirectly on the hypothalamus. Direct impact on the hypothalamus requires the presence of a mechanism by which the OB gene product passes across the blood brain barrier. Mechanisms involving periventricular organs and / or specific transporters can allow molecules of the size encoded by the OB gene to access the brain [Johnson et al., FASEB J., 7: 678- 686 (1983); Baura et al., J. Clin. Invest., 92: 1824-1830 (1993); Pardridge, Endocrine Reviews, 7: 314-330 (1986)]. However, this hypothesis had to be carefully considered until a means of allowing proteins to cross the blood brain barrier was identified. In addition, it may be necessary to assess the possible effects on other target organs.

The adipocyte signal (s) responsible for quantitative changes in the expression level of the OB gene are not yet known, but correlate with differences in adipocyte cell size. Adipocytes from db / db mice are five times larger than adipocytes from normal mice with a cell size of approximately 1.0 μg lipid / cell (Johnson et al., 1972, supra). Previous evidence suggests that adipocyte lipid content and / or size are important parameters in determining body weight [Faust et al., Am. J. Physiol., 235: 279-286 (1978); Faust et al., Science, 197: 393-396 (1977). Each adipocyte expressed low levels of OB RNA, which further increased in proportion to cell size. In addition, cell size is not a recognized parameter and may only correlate with intracellular signals that increase expression of OB genes in adipocytes from db / db and VMH-lesioned mice. In any case, the components of the signal transduction pathway that control the synthesis of OB RNA appear to be important in determining body weight. Genetic and environmental influences that reduce the level of expression of OB can act to increase body weight because they can have an effect on reducing susceptibility to encoded proteins. Specific molecules that regulate the expression level of the OB gene are not yet known and await the determination of the level (s) of gene regulation leading to quantitative changes in the level of the OB RNA and examination of regulatory elements of the OB gene. The identification of molecules that regulate the expression of OB genes in adipocytes and molecules that mediate the effects of encoded proteins on their site of action can contribute significantly to understanding the physiological mechanisms that control weight.

Example 10 RNA Expression Pattern of Chromosome 7 and Mapping on Physical, Cytogenetic and Genetic Mapping

OB RNA is expressed at high levels in human adipose tissue and at substantially lower levels in the placenta and heart. The human OB gene is located on large yeast artificial chromosome (YAC) contigs derived from chromosome 7q31.3. In addition to identifying the relative positions of genes based on mouse-human comparison mapping, this test identified eight established microsatellite markers in close physical proximity to the human OB gene. Because mutations in mouse OB can lead to syndromes very similar to pathological obesity in humans, these genetic markers are an important tool for testing the possible role of the OB gene in inherited forms of human obesity.

Materials and methods

Northern Blot Analysis

Total RNA was prepared from adipose tissue using the method of Chirgwin et al., Biochem., 18: 5294-5299 (1979). Northern blots, radiolabels and hybridizations were performed as described in Zhang et al., 1994, supra. Northern blots of polyA ⁺ RNA (human MTN, human MTN II and human fetal MTN II) were obtained from CloneTech (CLONETECH, Palo Alto, Calif.) As the PCR probes used to generate radiolabeled human actin probes.

STS Development

Sequence tagged-site (STS) -specific PCR tests are essentially described in Green et al., PCR Methods Applic., 1991; Green et al., Genomics, 11: 548-564 (1991) Green, "Physical mapping of human chromosomes: generation of chromosome-specific sequence-tagged sites", in Methods in Molecular Genetics Vol. 1, Gene and Chromosome Analysis (Part A), pp. 192-210, Adolph ed., Academic Press, Inc., San Diego (1993); Green et al., Hum. Mol. Genet., 3: 489-501 (1994), developed and optimized, each STS prefixed with 'sWSS'. Followed by naming using unique numbers The details of the 19 STSs reported in the present invention are given in Table 3, and additional information (e.g. PCR reaction conditions, complete DNA sequences) is provided by GenBank ( GenBank) and / or Genome Data Base (GDB) In the case of microsatellite-specific STSs, Ollie used in PCR testing Nucleotide primers (Table 3) correspond to those used for genotyping (Table 4), or are designed using DNA sequences available from GenBank (most often using a computer program OSP). (Hillier et al., PCR Methods Applic., 1: 124-128 (1991)) Table 3 describes STSs in YAC contigs containing human OB genes.

Nineteen chromosome 7-specific STSs (FIG. 35) are shown that are located in the YAC contigs containing the human OB gene. In each case, the designated 'sWSS' name, corresponding alias, GDB-specified locus name, STS source, PCR primer sequence, STS size and GDB identification number are described. Sources of STSs are as follows: 'YAC terminus (separate insert terminus of YAC) (Green, 1993, supra),' lambda clone '(random chromosome 7-specific lambda clone) (Green et al. , 1991, supra; Green, 1993, supra), 'gene marker' (microsatellite markers, see Table 2) (Green et al., 1994, supra), 'YAC insert' (from the yac insert) Random segments), and 'genes' (gene-specific STS). Since the detection of YACs containing genetic markers does not require amplification of the polymorphic tract itself, the PCR primers used to identify YACs in the case of some genetic marker-specific STSs (described in this table). Is different from that used to perform genotyping. Except for sWSS494, sWSS883, sWSS1529 and sWSS2619 (50 ° C used), sWSS999 and sWSS1174 (60 ° C used) and sWSS808 (65 ° C) all designated PCR tests all have annealing temperatures of 55 ° C. Was used. Further details regarding the STS-specific PCR test are available at GDB.

Eight microsatellite markers (FIG. 35) that are located in the YAC contigs containing the human OB gene are shown. In each case, the marker name (as aliased in Table 3), the form of the microsatellite motif (tetranucleotide-'tetra 'repeat unit or (CA) _n repeat unit), GDB-specified locus name, PCR- Primer sequences used for basic genotyping, and GDB identification numbers are shown. Further details regarding PCR testing and polymorphisms are available from GDB.

Human OB -specific STS (sWSS2619) was designed using DNA sequences obtained from the 3 'untranslated portion of cDNA. Human Pax 4-specific STS (sWSS808) was developed using the following strategy. Oligonucleotide Primers Specific to the Mouse Pax 4 Gene (GGCTGTGTGAGCAAGATCCTAGGA) (SEQ ID NO: 63) and (GGGAGCCTTGTCCTGGGTACAAAG) (SEQ ID NO: 93) (Walther et al., 1991, Genomics 11: 424-434) (1991) ] Was used to amplify a 204-bp fragment from human genome DNA (this was the same size product as that generated from mouse genome DNA). Since a similar size (200-bp) product was also amplified from yeast DNA, this PCR test was not suitable for identifying the corresponding YACs. However, DNA sequencing of PCR products generated from human DNA showed substitutions at 20 positions among the 156 bases analyzed (data not shown). This human-specific sequence was used to design a new primer (TTGCCAGGCAAAGAGGGCTGGAC) (SEQ ID NO: 64) and was used with the first of the above mouse Pax 4-specific primers (see Table 3). The resulting human Pax 4-specific PCR test did not amplify the main product from yeast DNA and was therefore used to identify the corresponding YACs.

Identification of YACs by PCR-Based Screening

Most of the YACs shown in FIG. 35 are derived from a collection of very abundant clones for human chromosome 7 DNA ('chromosome 7 YAC resources') (Green et al., 1995, see above) using PCR-based screening strategies . Green et al., 1995, supra; Greena et al., Proc. Natl. Acad. Sci. USA, 87: 1213-1217 (1990). In some cases, the clones were CEPH [Dausset et al., Behring Inst. Mitt., 91: 13-20 (1992); Albertsen et al., Proc. Natl. Acad. Sci. USA, 87: 4256-4260 (1990) or ICI [Anand et al., Nucl. Acids Res., 17: 3425-3433 (1989); Anand et al., Nucl. Acids Res. 18: 1951-1956 (1990), which was isolated by PCR-based screening (Greena et al., 1990, supra) of the total human genome YAC library available. Each YAC is named using the prefix 'yWSS' followed by a unique number.

Results and review

Examination of tissue expression of the human OB gene by Northern blot analysis revealed that OB RNA is expressed at high levels in human adipose tissue and at much lower levels in the placenta and heart (FIG. 34). The size of the RNA (about 4.5 kb) was equivalent in each of the expression tissues as well as in humans and mice. In these tests, 5-fold larger signals were seen in 10 μg total adipose tissue RNA as in 2 μg polyA ⁺ placental RNA. 5-fold smaller signals were seen in polyA ⁺ RNA from the heart as compared to the placenta. The level of OB RNA is estimated to be about 250-fold lower in the placenta than in adipose tissue. In this experiment, OB RNA was not detected in any other tissue analyzed, including brain, lung, liver, skeletal muscle, kidney and pancreas. Further experiments did not show OB RNA in the spleen, thymus, prostate, testes, ovary, small intestine, large intestine, peripheral blood leukocytes or the brain, liver or kidney of the fetus (data not shown). OB is likely to be expressed at undetectable levels (by Northern blot analysis) in these latter tissues or in other tissues not tested. The pattern of expression observed in humans is somewhat different than in mice in which OB RNA is detected almost exclusively in adipose tissue.

Comparative mapping of OB gene parts within mouse and human genomes. The mouse OB gene is located on proximal chromosome 6 in a portion homologous to part of human chromosome 7q. Genes in this segment include (proximal to distal): Met tumor gene, cystic fibrosis transmembrane conductance regulator ( Cftr ), paired box-containing gene 4 ( Pax 4) , OB , and carboxypeptidase A ( Cpa ) (Zhang et al., 1994, supra; Friedman et al., 1991, supra). In mice, genetic mapping was used to demonstrate that Pax 4 is tightly linked to ob [Walther et al., 1991, supra; Zhang et al., 1994, supra. The physical spacing between OB and Pax 4 was found to be approximately 1 megabase pairs (Mb) (Zhang et al., 1994, supra). Based on these comparative mapping tests, the human OB gene was expected to be located between Pax 4 and CPA on chromosome 7q. In addition, human CFTR [Heng et al., Cell Genet., 62: 108-109 (1993)] and Pax 4 [Tamura et al., Cytogenet. Cell Genet., 66: 132-134 (1994), was located at 7q31.3 and 7q32 by fluorescent in situ hybridization (FISH), therefore the most likely cytogenetic position of the human OB gene is 7q31.3-q32. Adjacent to the boundary.

Mapping of OB Genes on Human Chromosome 7

A collection of very rich YAC clones rich in human chromosome 7 DNA was selected using STS (sWSS2619), which amplifies the small segment of the non-toxin portion of the human OB gene (Green et al., 1995a, Genomics 25: 170-). 183), nine YACs were identified (yWss691, yWSS1332, yWSS1998, yWSS2087, yWSS3319, yWSS3512, yWSS4875, yWSS4970 and yWSS5004). To demonstrate that these YACs contain the true human OB gene, two additional experiments were performed. First, each YACs were tested using a second human OB -specific PCR test, all of which were confirmed to be positive (data not shown). Second, yeast DNA from each clone was digested with Eco RI and analyzed by gel-transfer hybridization using human OB cDNA-derived probes. In all cases, a single hybridization band appeared; This band was the same size in the P1 clone known to contain the YACs and the human OB gene (data not shown).

Computer program Segmap (SEGMAP) (Green and Green, 1991, supra) and other YAC-basic STS-content data generated for chromosome 7 by the inventors (Green et al., 1991, supra); Green et al., 1994, supra; Green et al., 1995, supra), confirmed that the human OB gene is present in the YAC contigs shown in FIG. 35. Specifically, this contig consists of 43 overlap YACs and 19 uniquely ordered STSs. Details of each of the 19 STSs are given in Table 3. In addition to OB -specific STS, Contig also contains STS specific for the human Pax 4 gene (sWSS808) (Tamura et al., 1994, supra; Stapleton et al., 1993, Nature Genet. 3: 292-298), It contains seven STSs derived from chromosome 7-specific YACs, two STSs derived from chromosome 7-specific lambda clones, and importantly eight microsatellite-specific STSs. Further details on these eight genetic markers, including the sequence of primers used for genotyping, are presented in Table 2. Here, there is excessive YAC-basic connectivity throughout the contig (ie there are two or more YACs connecting each of the adjacent pairs of STSs), which indicates the relative order of the STSs shown in FIG. 35. Strong support.

As shown in FIG. 35, the expected orientation of the human OB -containing YAC contigs is the largest STS in which sWSS1734 is isotopic (ie, closest to CFTR), while sWSS2367 is the largest STS that is terminally ie (ie, CPA). Closest). This orientation is remarkably based on comparative mapping data that Pax 4 is proximal and OB is distal in synthenic blocks present in mouse and human DNA (Zhang et al., 1994) . , See above). The OB gene is located close to the terminal terminal of the contig based on the arrangement of the OB -specific STS (sWSS2619).

While the contigs shown in FIG. 35 are inferred by segmaps without considering the YAC size (in which STSs are represented equidistantly relative to each other), similar analysis of data by segmaps considering the YAC size is The total size of the parts covered thereby was just over 2 Mb (data not shown). That is, the eight microsatellite-specific STSs (Table 4) are all contained within the genome interval over approximately 2 Mb, while the three closest to the terminal termini of the contigs (sWSS1392, sWSS1148 and sWSS2367) are particularly OB genes. Proximity to itself (possibly within a gap as small as about 500 kb). Indeed, all three of the latter STSs are present in at least one of the human OB -containing YACs. Here, the distance between human Pax 4 (sWSS808) and ob (sWSS2619) is estimated to be approximately 400 kb, whereas this portion is expected to span about 1 Mb in mice (Zhang et al., 1994, See above). Finally, three of the YACs in the contigs (yWSS691, yWSS999 and yWSS2935) were also analyzed by FISH and each was found to hybridize exclusively to 7q31.3. One of these YACs (yWSS691) contains OB -specific STS, while the other two clones contain Pax 4-specific SRS. The latter result is generally consistent with the previous cytogenetic designation of human Pax 4 for 7q32 (Tamura et al., 1994, supra). Based on these data, the human OB gene can be assigned to cytogenetic band 7q31.3.

Example 11 Human OB Polypeptides are Biologically Active in Mice

Groups of 10 ob / ob mice were treated by intraperitoneal injection of 10 μg / g / day recombinant (bacterial) human and murine OB polypeptide or saline. After 4 days, the group receiving saline increased 0.3 g. The group receiving rat OB lost 3.2 g. The group receiving human OB lost 2 g (p <0.01 compared to the saline control). These groups were also tested for feed intake. Data on feed intake is presented in Table 5; Data on body mass is presented in Table 6.

These data explain that human OB is biologically active in mice.

Example 12 High doses of OB affect wild type mice

Wild-type mice (C57B16J + /?) Were treated with intraperitoneal injection of recombinant mouse OB at 10 μg / g / day and body mass was measured every 4 days. The results are shown in Table 7.

These data explain that OB affects body mass in wild-type as well as ob / ob mice, although much smaller.

Example 13: OB Polypeptides Administered by Continuous Pump Injection

This example demonstrates that continuous infusion of OB polypeptide causes weight loss in normal mice. Normal (non-obese) mice received rat ob polypeptides via osmotic pump injection. A dose of 0.5 mg protein / kg body weight / day resulted in a 4.62% loss (+/- 1.34%) from baseline body weight by day 6 of infusion.

Materials and methods

animal

In this example, wild type (+ / +) C57B16 mice were used. Mice were mono-received and maintained under human conditions. Mice were 8 weeks old at the start of time and the animals had stabilized weight. Ten mice were used for each cohort (vehicle versus protein).

Feed Salary and Weight Measurement

Mice were given pulverized rodent feed (PMI Feeds, Inc.) in Allentown Caging and Equipment, which allowed them to more accurately and sensitively measure feed intake than using routine block food. . Body weights were measured at the same time (2 pm) daily for a period of 6 days. Body weight on day before infusion was defined as base weight.

rat  OB  Cloning of DNA

this. Cloning of mouse OB DNA for expression in E. coli was performed as follows. DNA sequences deduced from published peptide sequences shown in Zhang et al., 1994, supra, ie Example 1, above. E. coli was decoded inversely using the optimal codons. The terminal cloning site was from Xba I to Bam HI. Ribosome binding enhancers and strong ribosomal binding sites were included in front of the coding portion. Double DNA sequences were synthesized using standard techniques. The correct clone was identified by demonstrating the expression of the recombinant protein and the presence of the correct OB DNA sequence in the resident plasmid. The amino acid sequence (and DNA sequence) is as follows:

Recombinant murine met OB (double helix) DNA and amino acid sequences (SEQ ID NOS: 94 and 95):

Expression Vectors and Host Strains

The plasmid expression vector used to produce the protein was pCFM1656 (ATCC (American Type Culture Collection) Accession No. 69576). The DNA was linked to the expression vector pCFM1656 linearized by Xba I and Bam HI. E. coli host strain FM5 was transformed. this. E. coli FM5 cells are resistant to E. coli . E. coli K-12 strain was derived from Amgen Inc. (Thousand Oaks, Calif.) And described by Bachmann et al., Bacteriol. Rev., 40: 116-167 (1976)], integrated lambda phage inhibitor gene cI ₈₅₇ [Sussman et al., CR Acad. Sci., 254: 1517-1579 (1962). Vector production, cell transformation and colony selection were performed by standard methods such as those described in Sambrook et al., 1989, supra. Host cells were grown in LB medium.

Administration of Proteins or Vehicles

In this experiment, recombinant mouse OB polypeptide was generally used at a concentration of about 0.9 mg / ml phosphate buffered saline, pH 7.4. The amino acid sequence (and DNA sequence) used is shown directly above. Protein or vehicle (phosphate buffered saline, pH 7.4) was administered by osmotic pump injection. Alzet osmotic minipumps (Alza, Palo Alto, Calif., Model No. 1007D) were surgically placed in the subcutaneous pockets of the scapula area in each mouse. The pump was adjusted to administer 0.5 ml of protein in solution per hour for a dose of 0.5 mg protein / kg body weight / day. Control animals were injected with phosphate buffered saline (pH 7.4) through an Alzate Osmotic Minipump.

Fermentation process. Proteins were prepared using a 3-phase fermentation protocol known as the fed-batch method. Medium composition is described below.

Batch. Nitrogen and phosphate sources were sterilized in a fermentation vessel (Biolafitte, 12 liter volume) (by raising the temperature to 122 ° C. at 18-20 psi for 35 minutes). After cooling, carbon, magnesium, vitamins and trace metal sources were aseptically added. 500 ml of the recombinant mouse protein-producing bacteria (grown in LB broth) overnight (16 hours or longer) were added to the fermentor.

Feed I. Feed I was added to the culture after reaching between 4.0-6.0 OD ₆₀₀ . Glucose was added at a speed limit to control growth rate (μ). An automated system (called the Distributive Control System) was programmed to have a growth rate of 0.15 generation hr ⁻¹ .

Feed II. When the OD reached 30, the temperature was slowly raised to 42 ° C. and changed to feed II, which is described later. Thereafter, the fermentation was continued for 10 hours while taking samples every 2 hours. After 10 hours, the contents of the fermentor were cooled down to 20 ° C. and collected by centrifugation.

Badge composition:

Batch: 10 g / L Yeast Extract

5.25 g / L (NH ₄ ) ₂ SO ₄

3.5 g / LK ₂ HPO ₄

4.0 g / L KH ₂ PO ₄

          5.0 g / L glucose

1.0 g / L MgSO _{4 7} H ₂ O

          2.0 ml / L Vitamin Solution

          2.0 ml / L Trace Metal Solution

          1.0 ml / L P2000 Antifoam

  Feed I: 50 g / L Bakto-Tryptone

           50 g / L Yeast Extract

          450 g / L glucose

8.75 g / L MgSO ₄ 7H ₂ O

          10 ml / L vitamin solution

          10 ml / L trace metal solution

 Feed II: 200 g / L Bacterium-Tryptone

          100 g / L Yeast Extract

          110 g / L glucose

Vitamin Solution (Batch, Feed I): 0.5 g biotin, 0.4 g folic acid and 4.2 g riboflavin were dissolved in 450 ml H ₂ O and 3 ml 10 N NaOH and H ₂ O was added to make 500 ml. . 14 grams of pyridoxine-HCl and 61 grams of niacin were dissolved in 150 mL of H ₂ O and 50 mL of 10 N NaOH, and H ₂ O was added to make 250 mL. 44 grams of pantothenic acid were dissolved in 200 mL of H ₂ O and adjusted to 250 mL. Three solutions were combined to make a total volume of 10 liters.

Trace Metal Solution (Batch, Feed I):

Ferric Chloride (FeCl ₃ · 6H ₂ O): 27 g / L

Zinc chloride (ZnCl ₂ · 4H ₂ O): 2 g / L

Cobalt Chloride (CoCl ₂ · 6H ₂ O): 2 g / L

Sodium molybdate (NaMoO ₄ 2H ₂ O): 2 g / L

Calcium chloride (CaCl ₂ · 2H ₂ O): 1 g / L

Copper Sulfate (II) (CuSO ₄ · 5H ₂ O): 1.9 g / L

Boric acid (H ₃ BO ₃ ): 0.5 g / L

Manganese Chloride (MnCl ₂ · 4H ₂ O): 1.6 g / L

Sodium Citrate Dihydrate: 73.5 g / L

Purification Method for Rat OB Polypeptides

Purification was carried out in the following steps (unless otherwise stated, the following steps were carried out at 4 ° C.):

1. Cell Paste: E. coli cell paste was suspended in 5-fold volume of 7 mM EDTA, pH 7.0. Cells in EDTA were further disrupted by two passages through a microfluidizer. Crushed cells were centrifuged at 4.2 k rpm for 1 hour in a Beckman JB-6 centrifuge with J5-4.2 rotor.

2. Inclusion Body Wash # 1: The supernatant obtained above was removed and the pellet was resuspended in 5 volumes of 7 mM EDTA, pH 7.0 and homogenized. This mixture was centrifuged as in step 1.

3. Inclusion Body Wash # 2: The supernatant obtained above was removed and the pellet was resuspended and homogenized in 10 volumes of 20 mM Tris, pH 8.5, 10 mM DTT and 1% deoxycholate. This mixture was centrifuged as in step 1.

4. Inclusion Body Wash # 3: The supernatant obtained above was removed and the pellet was resuspended in 10-fold volume of distilled water and homogenized. This mixture was centrifuged as in step 1.

5. Re-overlap: The pellet was re-overlaid with 15 volumes of 10 mM HEPES, pH 8.5, 1% sodium sarcosine (N-lauryl sarcosine) at room temperature. After 60 minutes, the solution was brought to 60 mM copper sulfate and then stirred overnight.

6. Removal of Sarcosine: The re-overlap mixture was diluted with 5 volumes of 10 mM Tris buffer, pH 7.5 and centrifuged as in step 1. The supernatant was collected and mixed for 1 hour with 20-50 mesh Dowex 1-X4 resin (to 0.066% of the total volume of the diluted superposition mixture) in chloride form. This mixture was poured into a column and the eluate was collected. Removal of sarcosine was confirmed by HPLC.

7. Acid Precipitation: The eluate obtained from the previous step was collected, the pH was adjusted to pH 5.5 and then incubated for 30 minutes at room temperature. This mixture was centrifuged as in step 1.

8. Cation Exchange Chromatography: The pH of the supernatant obtained in the previous step was adjusted to pH 4.2 and loaded on CM Sepharose Fast Flow. A 20 column volume saline gradient was used with 20 mM NaOAc, pH 4.2, NaCl from 0 M to 1.0 M.

9. HIC chromatography: The CM Sepharose pool of the peak fraction (identified by ultraviolet analysis) obtained in the above step was adjusted to 0.2 M ammonium sulfate. As a reverse salt gradient of 20 column volumes, 5 mM NaOAc, pH 4.2, containing 0.4 M to 0 M ammonium sulfate was used. This material was concentrated and diafiltered into PBS.

result

Shown below is the percentage of difference from baseline body weight in C57B16J mice (8 weeks old):

As shown, animals that received OB polypeptides at the end of the 6-day continuous infusion regime lost 4% of their body weight relative to baseline. This is substantially faster weight loss compared to that observed with intraperitoneal (i.p.) injections. In wild-type (normal) mice injected daily with an intraperitoneal injection of the recombinant rat OB polypeptide at a dose of 10 mg / kg daily, only 2.6-3.0% of body weight loss was observed at the end of the 32-day syringe interval, which was one of the dosing schedules. Even at that time, it was not more than 4% (data not shown). This data shows that 20-fold less dose (0.5 mg / kg vs. 10 mg / kg) obtained more weight loss within a shorter period by continuous infusion.

The results presented here are statistically significant, e.g. p <.0001-4.62%.

Example 14 Cloning and Expression of Recombinant Human OB Polypeptide Homolog

This example provides compositions and methods for the preparation of homologous recombinant human versions of OB polypeptides.

OB human variants of DNA was also prepared from the 20 codon substitutions design duplex DNA replaces a part between the (synthetic oligonucleotide prepared from the nucleotide) with Mlu I and Bam HI sites by rat OB DNA, as in Example 13. The codons for arginine at mouse maturation position 35 and leucine at mouse maturation position 74 were unchanged. The Mlu I site is shown below the solid line in the following sequence. This DNA was inserted into the pCFM 1656 vector (ATCC Accession No. 69576) in the same manner as the recombinant murine protein as described above.

Recombinant human met OB (double-helix) DNA and amino acid sequences (SEQ ID NOS: 96 and 97)

Fermentation

Fermentation of the host cell to produce a recombinant human OB polypeptide was carried out using the conditions and compositions as described above for the recombinant murine material. The results were analyzed for yield (grams / liter) and corrective agent of recombinant human OB material (and small amount of bacterial protein) and correlated to analyze bacterial expression:

Purification of Recombinant Human ob Polypeptides

Recombinant human protein can be purified using a method similar to that used to purify recombinant mouse protein as in Example 13. To prepare a recombinant human OB polypeptide, step 8 was performed by adjusting the pH of the supernatant from step 7 to pH 5.0 and loading it onto a CM Sepharose high flow column. A 20 column volume gradient was performed with 20 mM NaOAc, pH 5.5, NaCl from 0 M to 0.5 M. Step 9 was performed by diluting the CM Sepharose pool 4-fold with water and adjusting the pH to 7.5. This mixture was made of 0.7 M ammonium sulfate. A 20 column volume reverse salt gradient was performed with 5 mM NaOAc, pH 5.5, 0.2 M to 0 M ammonium sulfate. Alternatively, the above steps were the same.

Example 15 Dose Response Test

Further testing was to demonstrate that there was a dose response to continuous administration of OB protein. In this test, wild-type mice (non-obesity, CD-1 mice, body weight 35-40 g) were administered recombinant mouse OB protein using methods similar to Examples 12 and 13. The results were as follows (% weight loss compared to baseline measured as described above):

As shown, increasing the dose from 0.03 mg / kg / day to 1 mg / kg / day increased weight loss from 3.5% to 7.5%. It is also noteworthy that the dose of 1 mg / kg / day on day 14 caused a 14% loss of body weight.

Example 16: ob / ob Effect of Leptin on Gymnastics in Mice

16 week old C57B1 / 6J ob / ob mice were treated with or without 5 μg / g / day of rat leptin or vehicle for 33 days. In the second experiment, 7 week old ob / ob mice were treated with 10 μg / g / day of human leptin, mouse leptin or vehicle for 12 days. Mice were sacrificed and total body weight, gymnastics, insulin levels and glucose levels were assessed. Data from these experiments are listed in Table 11.

The gymnastic data show the effect of leptin on three body matters: fat mass, net mass and water mass. These data indicate that leptin significantly reduces body fat mass and has a marginal effect on net mass. However, the effect on net mass is not statistically significant.

Comparison of insulin and glucose levels in leptin treated and control (untreated) mice indicates that leptin alleviates these symptoms of diabetes by reducing blood sugar and insulin levels.

Example 17 High Dose Effect of Leptin on Wild-type Mice

Lean controls of ob / ob mice (C57B1 / 6J +/-) were injected intraperitoneally with 10 μg / g of rat leptin or vehicle (PBS) once a day and then body weight and feed intake were measured over the next two weeks. There was a significant decrease in body weight and a significant decrease in feed intake during the first week after 4 days. However, after a week the level of feed intake became indistinguishable between the two groups of mice. At the end of two weeks the animals were sacrificed and the gymnastics determined. The results of the gymnastics analysis are shown in Table 12. This data is presented in contrast to the reduction of body fat in leptin-treated and PBS-treated animals.

The second experiment showed the effect of intraperitoneal injection of 12.5 μg / g rat leptin twice daily on wild type C57B1 / 6J mice. There was a significant decrease in body weight and feed intake associated with twice daily injections of the polypeptide. In the case of this experiment, the animals were placed in metabolic chambers. The feed consisted of a powdered Purina # 5001 chow diet. This diet was different from previous experiments using a diet consisting of chow diet, tapioca and water. Thus, the feed used in the metabolic chamber had a higher calorie content, which explains why the amount of feed consumed differs from that of animals using a water-containing diet.

The following provides a list of references to the above description, in particular experimental methods and reviews.

The present invention can be embodied in other forms or carried out in other ways without departing from its significance or essential features. Accordingly, the technical details of the invention are to be considered in all respects as illustrative and not restrictive, the scope of the invention being indicated by the appended claims, and all changes that come within the meaning and range of equivalency thereof are included herein. Interpreted

Numerous references have been cited throughout this specification, each of which is incorporated herein by reference in its entirety.

The claimed invention can be practiced according to the above specification and readily available references and starting materials. Nevertheless, on August 9, 1995, Applicant issued the following deposits in accordance with the provisions of the Budapest Treaty on the International Acceptance of Microbial Deposits for Patent Procedures: ATCC (American Type Culture Collection, 12301 Parklawn Drive, Rockville). , MD, 20852-1178, USA): E. coli carrying the plasmid pETH14. E. coli H14, Accession No. 69880; And E. carrying plasmid pETM9. E. coli M9, Accession No. 69879.

Claims (67)

Obesity having an amino acid sequence represented by SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6, and having about 145 to about 167 amino acids that can modulate the weight of the animal ( OB) an allelic variant or analogue comprising a polypeptide, or a fragment thereof that can modulate body weight. The immunogenic fragment of claim 1, wherein the OB polypeptide is. Val-Pro-Ile-Gln-Lys-Val-Gln-Asp-Asp-Thr-Lys-Thr-Leu-Ile-Lys-Thr (SEQ ID NO: 18); Leu-His-Pro-Ile-Leu-Ser-Leu-Ser-Lys-Met-Asp-Gln-Thr-Leu-Ala (SEQ ID NO: 19); Ser-Lys-Ser-Cys-Ser-Leu-Pro-Gln-Thr-Ser-Gly-Leu-Gln-Lys-Pro-Glu-Ser-Leu-Asp (SEQ ID NO: 20); And Ser-Arg-Leu-Gln-Gly-Ser-Leu-Gln-Asp-Ile-Leu-Gln-Gln-Leu-Asp-Val-Ser-Pro-Glu-Cys (SEQ ID NO: 21) Immunogenic fragment of an OB polypeptide selected from. The method of claim 1, wherein the amino acids 53, 56, 71, 85, 89, 92, 95, 98, 110, 118, 121, 122, 126, 127, 128, 129, 132, 139, 157, 159, 163, and 166. A human OB polypeptide analog wherein one or more amino acids selected from the group consisting of 166 (according to numbering of SEQ ID NO: 4) are substituted with other amino acids. The human OB polypeptide analog of claim 4, wherein the substitution is by a branched amino acid of the mouse OB polypeptide set forth in SEQ ID NO: 2. The human OB polypeptide analog of claim 4, wherein the substitution is by alanine. The process of claim 4, wherein (a) the serine residue at position 53 (according to numbering of SEQ ID NO: 4) is substituted with glycine, alanine, valine, cysteine, methionine, or threonine; (b) the serine residue at position 98 (according to numbering of SEQ ID NO: 4) is substituted with glycine, alanine, valine, cysteine, methionine, or threonine; (c) the arginine residue at position 92 (according to numbering of SEQ ID NO: 4) is a group consisting of a polypeptide substituted with asparagine, lysine, histidine, glutamine, glutamic acid, aspartic acid, serine, threonine, methionine, or cysteine Human OB polypeptide analogs selected from. The human OB polypeptide analog of claim 1 having 83% or more amino acid sequence homology to a human OB polypeptide having an amino acid sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 5. The process of claim 1, wherein (a) one or more aspartic acid residues are replaced by glutamic acid; (b) one or more isoleucine residues are substituted by leucine; (c) one or more glycine or valine residues are substituted by alanine; (d) one or more arginine residues are substituted by histidine; (e) one or more tyrosine or phenylalanine residues are replaced by tryptophan; (f) one or more residues at positions 121 through 128 (according to numbering of SEQ ID NO: 4) are substituted by glycine or alanine; (g) a human OB poly selected from the group consisting of a polypeptide at which one or more residues at positions 54 to 60 or 118 to 166 (according to the numbering of SEQ ID NO: 4) are substituted by lysine, glutamic acid, cysteine or proline Peptide analogues. The method of claim 1, 2, 4, 5 or 8, which comprises: (a) a polypeptide from which residues 1 to 21 are deleted; And (b) has methionine at position 21, has a glycine-serine-histidine-methionine sequence SEQ ID NO: 38 at positions 18-21, or a methionine-glycine-serine-serine-histidine at positions 1-21; The polypeptide of (a) above having a -histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98) OB polypeptide selected from the group consisting of: The method of claim 1, 2, 4, 5 or 8, which comprises: (a) a polypeptide from which residues 1 to 21 are deleted; And (b) has a leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26) at positions 14-21 or a glutamic acid-alanine-glutamic acid-alanine sequence (positions 18-21) SEQ ID NO: 27) or have a leucine-glutamic acid-lysine-arginine sequence at positions 18 to 21 (SEQ ID NO: 28) or a methionine-glycine-serine-serine-histidine-histidine at positions 2 to 21; Have a histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99), or glycine-serine- at positions 18-21 An OB polypeptide selected from the group consisting of the polypeptide of (a) above having a proline sequence. 10. The composition of claim 6, 7, 8 or 9, comprising: (a) a polypeptide from which residues 1 to 21 are deleted; And (b) has methionine at position 21, has a glycine-serine-histidine-methionine sequence (SEQ ID NO: 38) at positions 18-21, or a methionine-glycine-serine-serine-histidine at positions 1-21; Have a histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98) or leucine at positions 14-21 Have a glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26) or a glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27) at positions 18-21; Have a leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28) at positions 18 to 21, or a methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine at positions 2 to 21; -Serine-glycine-leucine-valine-proline-argin An OB polypeptide selected from the group consisting of the polypeptide of (a) having a nin-glycine-serine-proline sequence (SEQ ID NO: 99) or having a glycine-serine-proline sequence at positions 18-21. 2. A polypeptide according to claim 1 comprising: (a) a polypeptide having one or more residues deleted at positions 121-128; (b) a polypeptide from which residues 1-116 are deleted; (c) a polypeptide from which residues 1-21 and 54 to 167 are deleted; (d) a polypeptide from which residues 1-60 and 117-167 are deleted; (e) a polypeptide from which residues 1-60 are deleted; (f) a polypeptide from which residues 1-53 are deleted; (g) analogs of (a) above which residues 1-21 are deleted; And (h) (1) methionine, (2) glycine-serine-histidine-methionine sequence (SEQ ID NO: 38), (3) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine -Serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98), (4) leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (5) glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27), (6) leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (7) methionine -Glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99) and (8) A phase having an N-terminal amino acid or amino acid sequence selected from the group consisting of glycine-serine-proline sequences A human OB polypeptide cleavage analog selected from the group consisting of analogs of groups (a) to (g), wherein the numbering is according to the numbering of SEQ ID NO: 4. Recombinant OB polypeptide according to any one of the preceding claims. A chemically synthesized OB polypeptide according to any one of claims 1 to 13. A derivative of an OB polypeptide according to any one of claims 1 to 15, to which one or more chemical moieties are attached. The derivative of claim 16 wherein the chemical moiety is a water soluble polymer. 18. The derivative of claim 17, wherein the water soluble polymer is polyethylene glycol. 19. The mono-, di-, tri- or tetra-pezylated derivative of claim 18. 20. The N-terminal phenylated derivative of claim 19. The derivative of claim 20 which is an OB polypeptide having amino acid residues 22 to 167 of SEQ ID NO: 4, or residues 22 to 166 of SEQ ID NO: 6. The derivative of claim 20 which is an OB polypeptide having the amino acid sequence of residues 22 to 167 of SEQ ID NO: 4 or residues 22 to 166 of SEQ ID NO: 6 and having methionine at position 21. 21. An isolated nucleic acid molecule encoding an OB polypeptide according to any one of claims 1, 2 to 5, 8 and 10. An isolated nucleic acid molecule encoding an OB polypeptide according to any one of claims 6, 7, 9, 11, 12 and 13. (a) the DNA molecule or fragment thereof set forth in SEQ ID NOS: 1 and 3; (b) hybridization to the DNA molecule described in (a) may comprise a DNA molecule or a hybridizable fragment thereof; And (c) a OB polypeptide selected from the group consisting of DNA molecules encoding expression for amino acid sequences encoded by the DNA molecules of (a) and (b), and having a biological activity of modulating body weight in mammals DNA molecule for use in providing expression of a. 26. The DNA molecule of claim 25 which is the human genome DNA molecule of SEQ ID NOS: 22 and 24. The method of claim 23, further comprising: (a) SEQ ID NO: 2; (b) amino acids 22-167 of SES ID NO: 2; (c) SEQ ID NO: 4; (d) amino acids 22 to 167 of SEQ ID NO: 4; (e) SEQ ID NO: 5; (f) amino acids 22 to 166 of SEQ ID NO: 5; (g) SEQ ID NO: 6; (h) amino acids 22-166 of SEQ ID NO: 6; And (i) (1) methionine, (2) glycine-serine-histidine-methionine sequence (SEQ ID NO: 38), and (3) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine- (B) having an N-terminal amino acid or amino acid sequence selected from the group consisting of histidine-serine-serine-glycine-leucine-valine-proline-arginine-glycine-serine-histidine-methionine sequence (SEQ ID NO: 98), A DNA molecule encoding a polypeptide having an amino acid sequence selected from the group consisting of amino acid sequences described as amino acid sequences of (d), (f) or (h). 28. The composition of claim 27, wherein: (1) leucine-glutamic acid-lysine-arginine-glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 26), (2) glutamic acid-alanine-glutamic acid-alanine sequence (SEQ ID NO: 27 ), (3) leucine-glutamic acid-lysine-arginine sequence (SEQ ID NO: 28), (4) methionine-glycine-serine-serine-histidine-histidine-histidine-histidine-histidine-histidine-serine-serine-glycine- (B) having an N-terminal amino acid sequence selected from the group consisting of leucine-valine-proline-arginine-glycine-serine-proline sequence (SEQ ID NO: 99) and (5) glycine-serine-proline sequence DNA molecule encoding amino acid of (f) or (h). The DNA molecule of claim 23 comprising a sequence described by the protein coding sequence of SEQ ID NO: 3. The DNA molecule of claim 23 comprising a sequence described by the sequence encoding amino acids 22-167 of SEQ ID NO: 3. A detectably labeled nucleic acid molecule capable of hybridizing to the DNA molecule set forth in SEQ ID NO: 1 or SEQ ID NO: 3. A nucleic acid capable of hybridizing to an uncoded portion of an OB nucleic acid selected from the group consisting of an intron, a 5 'uncoded portion and a 3' uncoded portion. Oligonucleotide primers for amplifying human genome DNA encoding OB polypeptides. 32. The composition of claim 31 comprising: HOB 1gF 5'-CCCAAGAAGCCCATCCTG-3 '(SEQ ID NO: 29); HOB 1 gR 5'-GACTATCTGGGTCCAGTGCC-3 '(SEQ ID NO: 30); HOB 2gF 5'-CCACATGCTGAGCACTTGTT-3 '(SEQ ID NO: 31); And an oligonucleotide selected from the group consisting of HOB 2gR 5'-CTTCAATCCTGGAGATACCTGG-3 '(SEQ ID NO: 32). A vector containing a DNA molecule according to any one of claims 23 to 30. An expression vector containing a DNA molecule according to claim 23, 25, 29 or 30 operatively associated with an expression control sequence. An expression vector containing a DNA molecule according to claim 26 or 28 operatively associated with an expression control sequence. An expression vector containing a DNA molecule according to claim 24 operably linked to an expression control sequence. A single cell host transformed or transfected with the DNA molecule of claim 23 or 24 or the expression vector according to any one of claims 35 to 38. 40. The single cell host of claim 39 selected from the group consisting of bacteria, yeast, mammalian cells, plant cells, insect cells, and human cells in tissue culture fluid. 40. The method of claim 39, wherein, Escherichia coli (E. coli), Pseudomonas (Pseudomonas), Bacillus (Bacillus), streptomycin mouses (Streptomyces), yeasts, CHO, R1.1, BW, LM, COS 1, COS 7, BSC1 , Unicellular host selected from the group consisting of BSC40, BMT10 and Sf9 cells. The method of claim 39, wherein the saccharide with my process (Saccharomyces), a tooth blood (Pichia), Candida (Candida), Hanse Cronulla (Hansenula) and sat rulrop cis yeast host unicellular host is selected from the group consisting of (Torulopsis). Modified in vitro to allow high expression of the OB polypeptide using a homologous recombination method consisting of inserting an expression control sequence in close proximity to the OB polypeptide coding sequence and containing the OB polypeptide encoded DNA sequence Mammalian cells. The cell of claim 43, wherein the expression control sequence is an OB polypeptide expression control sequence and the homologous recombination method replaces the mutant OB polypeptide expression control sequence. The cell of claim 44, wherein the expression regulatory insert is not an OB polypeptide regulatory sequence. (a) culturing the cells according to any one of claims 39 to 45 under conditions providing expression of the OB polypeptide; (b) recovering the expressed OB polypeptide. 47. The method of claim 46, wherein the cells are bacteria or yeast. 48. The method of claim 46 or 47 further comprising: (c) chromatography the OB polypeptide on a Ni-chelating column; (d) purifying the OB polypeptide by gel filtration. 49. The method of claim 48, further comprising chromatography the OB polypeptide on a strong positive ion exchange column after step (c) and before step (d). An antibody specific for an OB polypeptide produced according to any one of claims 1 to 15 or by a method according to any one of claims 46 to 49. 51. The antibody of claim 50 which is a monoclonal or polyclonal antibody. The antibody of claim 51 labeled with a detectable label. An immortal cell line producing a monoclonal antibody according to claim 51. (a) conjugated to a carrier protein an OB polypeptide produced according to any one of claims 1 to 15 or by a method according to any one of claims 46 to 49; (b) immunizing the host animal with the OB polypeptide fragment-carrier protein conjugate of step (a) in admixture with an adjuvant; (c) obtaining an antibody specific for the OB polypeptide, comprising obtaining an antibody from an immunized host animal. (a) contacting a sample suspected of containing an OB polypeptide with an antibody that specifically binds to the OB polypeptide under conditions that enable the formation of a reaction complex containing the antibody and the OB polypeptide; (b) detecting the formation of a reaction complex consisting of the antibody and the OB polypeptide in the sample, wherein detection of the formation of the reaction complex suggests the presence of the OB polypeptide in the sample. How to measure the presence of OB polypeptide in The method of claim 55, wherein the antibody is bound to a solid phase support. (a) detecting the formation of a reaction complex in a biological sample according to the method of claim 55 or 56; (b) assessing the level of the OB polypeptide in the biological sample, comprising assessing the amount of the reaction complex formed, wherein the amount of the reaction complex corresponds to the level of the OB polypeptide in the biological sample. . (a) assessing the level of OB polypeptide in a biological sample from a mammalian subject according to claim 57; (b) comparing the level detected in step (a) with the level of OB polypeptide present in normal or earlier subjects, where an increase in the level of OB polypeptide relative to normal Increased levels of OB polypeptide in mammalian subjects, including disease associated with reduced levels of OB polypeptide, and a decrease in OB polypeptide relative to normal levels indicates a disease associated with reduced levels of OB polypeptide). An in vitro method for detecting or diagnosing the presence of a disease associated with a reduced or reduced level. Assessing the level of the OB polypeptide in a series of biological samples obtained at various time points from a mammalian subject undergoing therapeutic treatment for a disease associated with an increased or decreased level of the OB polypeptide according to the method of claim 57. In vitro methods for monitoring the therapeutic treatment of a disease associated with increased or decreased levels of OB polypeptide in a mammalian subject. A pharmaceutical composition useful as a weight modulator, comprising an OB polypeptide and a pharmaceutically acceptable carrier produced according to any one of claims 1 to 15 or according to any one of claims 46 to 49. 61. The pharmaceutical composition of claim 60, for reducing the weight of the animal. An agent for weight gain in an animal, comprising an antagonist of the OB polypeptide and a pharmaceutically acceptable carrier produced according to any one of claims 1 to 15 or according to any one of claims 46 to 49. Pharmaceutical composition. 63. The group of claim 62, wherein the antagonist is comprised of an antibody that binds to or neutralizes the activity of the OB polypeptide, a fragment of the OB polypeptide that binds to but does not activate the OB polypeptide receptor, and a small molecule antagonist of the OB polypeptide. Pharmaceutical composition selected from. Claim 1 to 15 or OB polypeptide produced by a method according to any one of claims 46 to 49 containing an acceptable carrier and for improving body appearance for reducing the weight of the individual Cosmetic composition. Body appearance for increasing the weight of an individual containing an antagonist and an acceptable carrier of an OB polypeptide produced by a method according to any one of claims 1 to 15 or according to any one of claims 46 to 49. Improvement cosmetic composition. 66. The group of claim 65, wherein the antagonist is comprised of an antibody that binds to or neutralizes the activity of the OB polypeptide, a fragment of the OB polypeptide that binds to but does not activate the OB polypeptide receptor, and a small molecule antagonist of the OB polypeptide. Cosmetic composition selected from. A cosmetic method according to any one of claims 63 to 66, wherein the cosmetic composition according to any one of claims 63 to 66 is administered to the individual at a dosage sufficient to modulate the weight of the individual to the desired level.