NZ527891A - Markers linked to resistance - Google Patents

Abstract

A method of identifying and/or isolating a simple sequence repeat (SSR) comprises preparing a library of cDNA clones from a clover species, generating expressed sequence tags (ESTs) from the cDNA clones and identifying and/or isolating ESTs including SSRs. Also described are nucleic acid primers for amplifying nucleic acids molecules including the SSR. The SSR can be used for selecting a gene in clover breeding and testing clover seed batch purity.

Description

5278 9 1 | | -,-r>,rS£\f '""ofScTof NZ*"*" .r 7 4'. i AUb 2093 PATENTS FORM NO. 5 •luCElVED Fee No. 4: $250.00 PATENTS ACT 1953 COMPLETE SPECIFICATION MARKERS LINKED TO RESISTANCE l/WE AGRESEARCH LIMITED a New Zealand Company of 5th Floor, Tower Block, Ruakura Research Centre, East Street, Hamilton New Zealand and AGRICULTURE VICTORIA SERVICES PTY LIMITED an Australian Company of 475 Mickleham Road, Attwood, Victoria 3049, Australia hereby declare the invention, for which I/We pray that a patent may be granted to me/us, and the method by which it is to be performed to be particularly described in and by the following statement: 1 James & Wells Ref: 31392/14 1a MARKERS LINKED TO RESISTANCE The present invention relates to the identification and/or isolation of repeat sequences, more particularly simple sequence repeats (SSRs), preferably from clover species, and to the SSRs isolated thereby, their linkage to phenotypic traits 5 including resistance to pests and diseases and their use in marker assisted breeding.

Worldwide permanent pasture is estimated to cover 70% of agriculturally cultivated areas. A number of clover species are agronomically important pasture legumes. Examples include white clover (Trifolium repens L.), the predominant 10 legume of temperate pastures, red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum), Caucasian clover (Trifolium ambiguum), Kenya clover (Trifolium semipilosum) and Persian clover (Trifolium persicum). Many clover species have the potential to enhance pasture production systems and to significantly improve livestock production. Cultivars well adapted to specific 15 environments and management systems are needed to fulfil these tasks. Moreover, contemporary agriculture is faced with rapidly changing demands and therefore faster and more specific breeding methods are needed to improve cultivars.

White clover (Trifolium repens L.) is one of the most important legumes 20 grown in temperate pastures, due to its excellent nutritive value and ability to fix atmospheric nitrogen. It is an outbreeding, allotetraploid (2n = 4x =32) species with a high level of genetic heterogeneity. White clover cultivars that are well adapted to specific environments and management conditions can significantly enhance pasture production systems. Breeding aims for this species include 25 improved persistence, increased dry matter yield, improved competitive ability, higher stolon density, extended climatic suitability, improved disease resistance, higher digestibility and improved seed yield. More than six decades of plant breeding have resulted in significant genetic improvement of white clover, but most of the target traits are complex, making breeding costly and progress slow.

A basic prerequisite for any molecular breeding program is a robust set of polymorphic markers for the species under investigation. Among the large variety of marker systems available, simple sequence repeats (SSRs, also called microsatellites), are based on a 1-7 nucleotide core element, more typically a 1-4 5 nucleotide core element, that is tandemly repeated. The SSR array is embedded in complex flanking DNA sequences. Microsatellites are thought to arise due to the property of replication slippage, in which the DNA polymerase enzyme pauses and briefly slips in terms of its template, so that short adjacent sequences are repeated. Some sequence motifs are more slip-prone than others, giving rise to 10 variations in the relative numbers of SSR loci based on different motif types. Once duplicated, the SSR array may further expand (or contract) due to further slippage and/or unequal sister chromatid exchange. The total number of SSR sites in eukaryotic genomes is very high, such that in principle such loci are capable of providing tags for any linked gene.

SSRs are highly polymorphic due to variation in repeat number and are co- dominantly inherited. Their detection is based on the polymerase chain reaction (PCR), requiring only small amounts of DNA and suitable for automation. They are ubiquitous in eukaryotic genomes and have been found to occur every 21 to 65 kb in plant genomes. Consequently, SSRs are ideal markers for a broad range of 20 applications such as genome mapping, trait mapping and marker-assisted selection. However, in order to be of value as molecular markers, SSR loci must be identified, sequence characterised, primer pairs aimed at the specific locus designed and the markers screened for their ability to detect polymorphisms. To allow the detection of SSR linkage to phenotypic traits, suitable plant mapping 25 populations need to be generated that segregate for these phenotypic traits. Molecular markers allow for selection of desired traits based on genotype rather than phenotype and can therefore complement and accelerate plant breeding programs. They can also be used for early selection of traits that are not expressed during the juvenile phase such as persistence, competitive ability and 30 seed yield. Molecular markers have been successfully used for the construction of genetic linkage maps and for the identification and tagging of economically important genes and quantitative trait loci (QTL) in a large number of plant species. 3 In a first aspect, the present invention provides a method of identifying and/or isolating a SSR, said method including preparing cDNA libraries, generating a collection of expressed sequence tags (ESTs) from randomly selected cDNA clones and identifying clones in said collection including SSRs.

More specifically, the present invention provides a method of identifying and/or isolating a simple sequence repeat (SSR), said method including preparing a library of cDNA clones from a plant species, generating expressed sequence tags (ESTs) from said cDNA clones, and identifying and/or isolating ESTs including SSRs. cDNA libraries representing mRNAs from various organs and tissues are prepared. The cDNA libraries may be prepared by any of many methods available. The cDNAs may be introduced into plasmid vectors by any of many methods available.

Once the cDNA inserts are in plasmid vectors, plasmid DNAs may be 15 prepared from randomly picked bacterial colonies containing recombinant plasmids, or the insert cDNA sequences may be amplified, for example via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs may be sequenced, for example in dye-terminator sequencing reactions to generate partial cDNA sequences 20 (expressed sequence tags or "ESTs"). The resulting ESTs are analyzed and SSRs are identified in ESTs by any of many methods available.

The method of the present invention has the advantage that because the SSRs are EST-derived, they must be gene-associated.

By a "SSR" is meant a nucleotide sequence including two or more 2-7, preferably 2-6, more preferably 2-4, repeated nucleotide core elements, at least two of said repeated nucleotide core elements being tandemly repeated. 4 Preferably, the nucleotide core element is repeated at least three, more preferably at least four and most preferably at least five times.

By "expressed sequence tag" is meant a partial DNA sequence from randomly selected cDNA clones.

Preferably the method of the present invention includes identifying and/or isolating said SSR from a clover species.

The clover species may be of any suitable type, including white clover, red clover, subterranean clover, Caucasian clover, Kenya clover and Persian clover. Preferably the clover species is white clover.

The clones including SSRs may be identified by any suitable technique.

Preferably, clones including SSRs are identified by sequence analysis.

Preferably, said library of ESTs is prepared by a method including preparing a library of cDNA inserts in suitable vectors and sequencing said cDNA inserts to generate said library of ESTs.

In a second aspect of the present invention there is provided a substantially isolated nucleic acid molecule including a SSR produced by the method of the present invention.

Preferably said nucleic acid molecule is from a clover species.

In a preferred embodiment, the nucleic acid molecule according to the 20 invention consists essentially of the SSR.

The nucleic acid molecule may be of any suitable type and includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof.

The term "isolated" means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid fragment present in a living plant is not isolated, but the same nucleic acid fragment separated from some or all of the coexisting materials in the natural system, is isolated. Such nucleic acid fragments could be part of a vector and/or such nucleic acid fragments could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment.

In a further preferred form of this aspect of the invention, the SSR is from a clover species and includes one or more of the following sequences: [AC]„ [CAC]n [AAGAJn [AG]n [CAG]n [AGAA]n [AT]n [CAT]n [ATTAJn c 1— O [CCA]n [ATTC]n [GA]n [CTT]n [GAATJn [TA]n [GAA]n [TATC]n [TC]n [GAT]n [TATT]n [AAC]n [GGT]n [TCTT]n [AAG]n [GTG]n [TGTT]n [AAT]n [GTT]n [TTAA]n [ACAJn [TCA]n [TTCA]n [ACC]n [TCT]n [TTCT]n [AGA]n [TGA]n LI 1 1 A]n [ATC]n [TGG]n U 1 1 C]n [ATG]n [TGT]n [AAAAC]n [ATT]n [TTC]n [AAAAG]n [CAA]n [AAAC]n [AAAAT]n [AAATTJn [TTCTC]n [TTTTC]n [ATATC]n [TTGAG]n [TTTTG] [ATTTT] [TTTGT] [TTCAA]n [TTTTA]n wherein n is the number of repeats and is a number between 2 and approximately 60, more preferably between approximately 5 and approximately In a further aspect of the present invention a nucleic acid primer suitable for amplifying a SSR in a clover species.

In a particularly preferred embodiment of this aspect of the invention the primer is from a clover series and may include one or more of the following nucleotide sequences: '-ATGATAGTGTCGGTGTTGTTGC-3' (SEQ ID NO: 1) '-AGAGAGAAGAAAGAAGTCTCTGAAGG-3' (SEQ ID NO: 2) '-TCATCTTCATCAACAGTTTCCG-3' (SEQ ID NO: 3) '-CTT CCCTT CTAT CT CT CAT GTTAACC-3' (SEQ ID NO: 4) '-CAT CT CTT CACAACT CAAAACCC-3' (SEQ ID NO: 5) -ATTTCCTCACGCTCATGACC-3' (SEQ ID NO: 6) '-AACCAACAAGCCATTTTTGC-3' (SEQ ID NO: 7) '-ATGGATCAATAGCACAAGATACTCC-3' (SEQ ID NO: 8) '-TAATTCAGCCAAACCGAAGC-3' (SEQ ID NO: 9) .

'-TTGGAGTGTTGAGATGAAGGG-3' (SEQ ID NO: 10) 7 '-ACGCTCACTTGCGTCCTATT-3' (SEQ ID NO: 11) '-TGAAGCTCCATTTGATTCCC-3' (SEQ ID NO: 12) -AACAAAACTCCGCACGTTTT-3' (SEQ ID NO: 13) '-AGCTTCGTTTTTAGGTGCGA-3' (SEQ ID NO: 14) 5 5-GGAACTGAAACCCAAGCAAA-3' (SEQ ID NO: 15) '-T CT CAT CTAT CTTCAAGCTAT GCG-3* (SEQ ID NO: 16) The present invention also provides a library of ESTs enriched for SSRs, preferably from a clover species.

The SSRs of the present invention have a number of uses including 10 selection of genes in clover breeding and breeding in other and legume species (such as pea and soybean).

Accordingly, in a further aspect of the present invention there is provided a method of selecting for a gene in legume breeding, said method including identifying a SSR according to the present invention that is closely associated with 15 said gene and selecting for said SSR in said breeding.

By "closely associated" is meant that the SSR and the gene are preferentially coinherited. Preferably the SSR and the gene have a genetic map distance of approximately 5 cM or less.

Preferably the legume is a clover, including white clover, red clover, 20 subterranean clover, Caucasian clover, Kenya clover and Persian clover, more preferably white clover.

The gene may be of suitable type. Preferably the gene is capable of but not limited to influencing disease resistance including clover root knot nematode (RKN) resistance and clover cyst nematode resistance. 8 The principle used for the selection of valuable agronomic genes in breeding programs is the association between a polymorphic genetic marker (e.g. an SSR locus) and a target gene nearby on the same chromosome. This leads to the phenomenon of genetic linkage, so that the marker and the linked gene are 5 preferentially coinherited. The degree of linkage which is required depends on the exact nature of the breeding program. In practice, a map distance of 5 cM (corresponding to 5% recombination leading to disassociation of the target gene and the marker) or less is preferred.

Associations between markers and target genes may be established by the 10 construction of a genetic map using a large number of polymorphic genetic markers in a cross showing variation for one or more physical characters. Appropriate analysis may locate the relevant target genes. The closely linked markers may then act as selection "tags" for the transfer of the target genes into unimproved germplasm.

In the particular case of resistance to clover root knot nematode, caused by the nematode pathogen Meloidogyne trifoliophila a cross may be made between parents which are respectively resistant and susceptible to this pathogen. A population showing variation for the character may then be used for genetic mapping with SSR markers. The most closely linked markers to the gene or genes 20 for root knot nematode resistance (ideally one on either side) may then be used for selection of the gene in a donor cross.

In the particular case of clover root knot nematode (RKN) resistance, a cross may be made between parents which are respectively resistant and susceptible to this pathogen. A population showing variation for the character may 25 then be used for genetic mapping with SSR markers. The most closely linked markers to the gene for RKN resistance (ideally one on either side) may then be used for selection of the gene in a donor cross. The same principle may be used for resistance to clover cyst nematode (Heterodera trifolii).

Another aspect of DNA profiling relates to the use of SSR markers for detection of seed batch contamination with seed from an undesirable cultivar. The allele profile for nematode resistance may be discriminated, allowing detection of likely contaminated batches. Markers associated with root knot nematode or clover cyst nematode resistance may be used to screen for seed batch contamination.

Accordingly, in a further aspect of the present invention there is provided a method for testing the purity of legume seed batches, said method including assessing variation within said batch of a SSR according to the present invention.

Preferably the legume is a clover, including white clover, red clover, subterranean clover, Caucasian clover, Kenya clover and Persian clover, more preferably white clover.

The present invention will now be more fully described with reference to the accompanying Example and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above.

In the figures: Figure 1: Summary of various steps in contig creation Figure 2: White clover SSRs by type Figure 3: Distribution of clover SSR lengths Figure 4: Frequencies of white clover SSRs Figure 5: Linkage map of the TRKR locus in Kenya clover (Trifolium semipilosum) and the associated region in a white clover linkage map Figure 6: Linkage map of the TRKR locus in white clover (Trifolium repens) EXAMPLE 1 Preparation of cDNA libraries, isolation and sequencing of cDNAs containing SSRs from white clover (Trifolium repens) cDNA libraries representing mRNAs from various organs and tissues of white clover (Trifolium repens) CV Huia were prepared. The characteristics of the libraries are described in Table 1.

TABLE 1 cDNA libraries from white clover (Trifolium repens) Library Organ/Tissue 01 wc Whole seedling, light grown 02wc Nodulated root 3, 5, 10, 14, 21 and 28 day-old seedlings 03wc Nodules pinched off roots of 42 day-old rhizobium inoculated white clover 04wc Nodulated white clover cut leaf and stem collected after 0, 1,4, 6, 14, h after cutting 05wc Non-nodulated inflorescences: >50% open, not fully open and fully open 06wc Dark grown etiolated 07wc Inflorescence - very early stages, stem elongation, <15 petals, 15-20 petals 08wc Seed frozen at -80°C, imbibed in dark overnight at 10°C 09wc Reproductive stolon tips 10wc Alfalfa mosaic virus (AMV) infected leaf 11wc White clover mosaic virus (WCMV) infected leaf 12wc Phosphorus starved plants 13wc Vegetative stolon tip 14wc Reproductive Stolon tip 15wc Senescing stolon 16wc Senescing leaf 11 The cDNA libraries may be prepared by any of many methods available. For example, total RNA may be isolated using the Trizol method (Gibco-BRL, USA) or the RNeasy Plant Mini kit (Qiagen, Germany), following the manufacturers' instructions. cDNAs may be generated using the SMART PCR 5 cDNA synthesis kit (Clontech, USA), cDNAs may be amplified by long distance polymerase chain reaction using the Advantage 2 PCR Enzyme system (Clontech, USA), cDNAs may be cleaned using the GeneClean spin column (Bio 101, USA), tailed and size fractionated, according to the protocol provided by Clontech. The cDNAs may be introduced into the pGEM-T Easy Vector system 1 (Promega, 10 USA) according to the protocol provided by Promega. The cDNAs in the pGEM-T Easy plasmid vector are transfected into Escherichia coli Epicurian coli XL10-Gold ultra competent cells (Stratagene, USA) according to the protocol provided by Stratagene.

Alternatively, the cDNAs may be introduced into plasmid vectors for first 15 preparing the cDNA libraries in Uni-ZAP XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA, USA). The Uni-ZAP XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into 20 precut pBluescript II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into E. coli DH10B cells according to the manufacturer's protocol (GIBCO BRL Products).

Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant plasmids, or the 25 insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Plasmid DNA preparation may be performed robotically using the Qiagen QiaPrep Turbo kit (Qiagen, Germany) according to the protocol provided by Qiagen. Amplified insert DNAs are sequenced in dye-terminator sequencing reactions to generate 30 partial cDNA sequences (expressed sequence tags or "ESTs"). The resulting ESTs are analyzed using an Applied Biosystems ABI 3700 sequence analyser. 12 EXAMPLE 2 Contig Creation Process The process of contig creation was the same for each species examined.

EST sequences were first masked against a database of vectors and 5 linkers (pgemtx.seq) used in the cloning of the ESTs. The sequences were then clipped to a contiguous region containing not more than 1% N. The remaining masked and clipped sequences with length > 0 were blasted using the BLASTN program against themselves (threshold -e 1.0e-10).

Sequences that did not yield significant hits to even themselves, due to 10 either being too short or because they are composed of low complexity sequence, where excluded from further processing.

Where hits did not have hits in the reverse direction - these were inserted to provide non-directional clone-to-clone hits for the clustering algorithm.

"Blast Clusters" of ESTs were created by recursively adding ESTs to a 15 cluster if the EST had a qualifying hit to any existing member of the cluster, (qualifying hit = blast hit with score >= 150 both ways, i.e. with the EST as the subject, and also with the EST as query), and finally (non-recursively) adding any remaining singletons to clusters if they had qualifying hits to cluster members, using a score of 115. "Blast Clustering" was done in an Oracle database using 20 PL/SQL. This resulted in many ESTs forming clusters of 2 or more members, leaving the remainder as un-clustered singletons.

For each cluster, all the masked and clipped sequences for that cluster were extracted from the SQL server database and processed by the "cap" contig assembly program. The following operational parameters where set for the cap 25 program. 13 #define OVERLEN 40 /* Minimum length of any overlap 7 #define PERCENT 0.95 /* Minimum identity percentage of any overlap 7 #define CUTOFF 76 /* cutoff score for overlap or containment 7 #define DELTA 8.5 /* Jump increment in check for overlap 7 #define MATCH 2 /* score of a match 7 #define MISMAT -6 /* score of a mismatch 7 #define LTMISM -3 /* light score of a mismatch 7 #define OPEN 0 /* gap open penalty 7 #define EXTEND 4 /* gap extension penalty */ #define LTEXTEN 2 /* light gap extension penalty */ #define POS5 20 /* Sequencing errors often occur before base #define P0S3 450 #define LINELEN 60 #define NAMELEN 10 #define TUPLELEN 4 POS5 7 /* Sequencing errors often occur after base POS3 */ /* length of one printed line, don't change 7 /* length of printed fragment name, don't change 7 /* Maximum length of words for lookup table 7 This process split clusters up into contigs (some of which were singletons). The cap output was parsed to extract the contig sequences, and the EST membership, using perl filters in the agfilter1.pl perl module.

This data was loaded into the SQL server database using our standard loading server. All ESTs that were not assigned to any cluster by the clustering procedure were assigned a dummy contig, consisting only of that EST. This means that ALL ESTs are a member of a contig. 14 The contig sequences were then extracted and an own-versus-own blast was run to check the level of redundancy. Own versus own blast hits were loaded back into the database. Figure 1 below summarises the contig creation process.

Homology searches where performed using BLASTX against the SWISS-PROT Release 39+ (12/2000) and the SP-TREMBL Release 15.0 (10/2000). The blast parameters where set to -e .000001 -v 200 -b 100.

Contig Naming Schema Two different naming schemes were applied to the contigs depending on 10 their contig membership For the contigs generated by cap from the "blast clustered" input files, the name was made up as: YYMMDDCSXXNNNNNMMM YYMMDD = date CSXX = the contig build number 15 NNNNN = the cluster number MMM = the within-group contig number assigned by cap • Those ESTs that did not initially cluster were assigned a 1 to 1 contig name for each EST.

The Contig name was based on the clone ID of the EST: 20 YMMDDCS06CCCCCCLL YYMMDD = Clone date CCCCCC = first 6 characters of clone id CSXX = contig build LL = Library code number EXAMPLE 3 Identification of SSRs The strategy used to locate SSRs is based on the micro-satellite detection program Sputnik. Sputnik is available from http://rast.abajian.com/sputnik/. Sputnik 5 is a C language program that searches DNA sequence files in Fasta format for microsatellite repeats. A sequence file is specified on the command line and the resulting hits are written to stdout along with their position in the sequence, length, and a score determined by the length of the repeat and the number of errors.

Sputnik uses a recursive algorithm to search for repeated patterns of 10 nucleotides of length between 2 and 5. Insertions, mismatches and deletions are tolerated but affect the overall score. It does not search against a "library" of known microsatellites. Instead it reads through the entire sequence, assumes the existence of a repeat at every position, compares subsequent nucleotides and applies a simple scoring rule. If the resulting score rises above a preset threshold, 15 the region along with its position and score is written out. If the score falls below a cut-off threshold, the search is abandoned and begun again at the next nucleotide. Each nucleotide that matches the value predicted (by assuming a repeat) adds to the score. Each "error" subtracts from the score. When an error is encountered, the three possible kinds of errors (mismatch, insertion and deletion) are assumed 20 and recursive calls to the comparison routine are made. If the resulting score from one of these is above the cut-off threshold, it is returned and the best of three pursued.

At each base dimer through to pentamer SSRs are considered. Single nucleotide repeats are not considered due to the abundance of poly-A sequences 25 in ESTs. Also common sequencing errors can lead to large polynucleotide tracts that do not represent the genomic sequence.

To take advantage of file parsing and sequence manipulation features of the biojava libraries (www.bioiava.ora) the core algorithm of the Sputnik program was re-implemented in the Java 1.2 programming language. The resulting 16 program was named SSR. The SSR program generates two outputs. One is a csv file describing the properties of each SSR (length, type, score etc). This file is named SSR.csv. The second output is a file suitable for input into Primer called primer.seq.

PCR Primer Design Primers where designed using the program C language program Primerl freely available at http://www-genome.wi.mit.edu/ftp/distribution/software/. Output from SSR was used as input to Primer for the purposes of primer design. Primers where designed to meet the following conditions: EXAMPLE 4 Condition Value Optimal Length 20 Minimum Length 18 Maximum Length 26 Optimum Tm 60 °C Minimum Tm 57 °C Maximum Tm 63 °C Minimum GC% 40 Maximum GC% 60 Salt Concentration 50 mM 17 DNA Concentration 50 nM Product Size Range 100-250 Primers where not allowed to cover sections of sequence containing ambiguous sequence. SSRs less than 30 nucleotides from one end of a contig were excluded due to the difficulty of finding suitable primers.

EXAMPLE 5 Mapping Population Genotypes White Clover Population Development White clover (Trifolium repens) is an out-crossing allotetraploid forage legume (2n=4x=32). It is functionally a diploid with duplicated genomes and loci. Most natural and selected plant populations are highly heterozygous and 10 heterogeneous.

A population suitable for genetic analysis of microsatellites in white clover may be developed by controlled cross pollination between two highly heterozygous genotypes; a design termed double-pseudo testcross. Analysis of the resulting Fi full sib progeny will describe the inheritance of and genetic linkage 15 among microsatellite loci.

Microsatellite marker data scored as individual peaks will exhibit segregation ratios in the Fi progeny of either 1:0 (fixed in one or both parents), 1:1 (heterozygous in one parent, absent in other), or 3:1 (heterozygous in both parents or heterozygous duplicate loci in one parent) in the absence of 20 segregation distortion. Markers scored on a per locus basis may exhibit up to 8 alleles in one population (2 parents x 2 chromosomes x 2 genomes); and are described as informative in either one or both parents; and in one or both genomes. Linkage analysis from these markers is performed in each parent individually, using all markers informative in that parent. A consensus map may 25 then be created using those microsatellite markers informative in both parents. 18 Data from such a population may be used to develop genetic linkage maps, to identify the location of single gene and quantitative trait loci, for marker assisted selection, as a springboard for map based cloning, and for DNA fingerprinting of individual plants and plant populations. This same population design and analysis 5 may be used for microsatellite marker analysis in other legumes and plant species.

Development of Kenya clover phenotypic data A pair cross was made between a clover root-knot nematode (CRKN) resistant and CRKN susceptible genotype of the T. semipilosum cultivar 'Safari' to 10 create a Fi progeny. Ninety-two Fi seeds were sown singly in 60-mm-diameter plastic pots of peat-based potting mix. After 18 days, the seedlings were inoculated around the roots with about 2,000 CRKN eggs in a 3-ml aqueous suspension. Roots were washed free of potting mix 6.5 weeks after inoculation and the degree of galling assessed visually. All individuals were checked 15 subsequently as rooted cuttings for their reaction to CRKN inoculum applied as above. Designation of an individual as resistant or susceptible was made on a mean of the three independent assessments.

EXAMPLE 6 Isolation of Genomic DNA Genomic DNA can be isolated from white clover leaf tissue using a CTAB/chloroform extraction procedure based on that of Doyle and Doyle (1990).

Using mortar and pestle, fresh leaf tissue (3-4 g) can be ground to a fine powder in liquid nitrogen, transferred to a 50 mL polypropylene tube and stored at -80°C until required. Ground leaf tissue is incubated for 60 minutes at 65°C in 30 25 mL of pre-heated 2xCTAB buffer (2% CTAB; 1.4 M NaCI; 20 mM EDTA [disodium salt]; 100 mM Tris; pH 8.0) containing 300 j^L p-mercaptoethanol and 0.033 g mL"1 polyvinylpyrrolidine (MW 44 000). Tubes contents are mixed by inversion several times, every 10 minutes. 19 Twenty mL (2/3 volume) of cold (-20°C) chloroform/octan-1-ol (24:1 v/v) is then added and the tubes inverted continuously for 5 minutes, before being centrifuged for 10 minutes at 2500 g at 4°C. The aqueous upper phase is transferred to a fresh 50 mL tube, to which a 2/3 volume of chloroform/octan-1-ol 5 has been added. Centrifugation is then repeated as above, and the aqueous upper phase was transferred to a fresh 50 mL tube. A 2/3 volume of absolute propan-2-ol is added, and the tube contents are inverted several times to precipitate the nucleic acids.

Tubes are centrifuged for 10 min at 3500 g at 4 °C, and the supernatant 10 discarded. The pellet is then covered with 500 |aL 75% ethanol, dislodged by flicking, and then resettled by brief centrifugation. This step is repeated and the pellet air-dried at room temperature for 20 min. The pellet is then resuspended by incubating in 500 joL TE buffer (10 mM Tris; 1 mM EDTA (disodium salt); pH 8.0) with 1 |xL RNase A (10 mg mL"1), at 37°C for 60 minutes.

The resuspended DNA is transferred to a 1 mL tube and 165 |j.L of 5M NaCI added. The tube contents are mixed well by shaking for 2 minutes, to precipitate carbohydrate. Tubes are then centrifuged for 10 minutes at 16600 g at 4°C and the supernatant is transferred to a 2 mL tube. Fifty |^L of 3M NaOAc is then added, the tube contents mixed briefly, and then 1.10 mL of absolute ethanol is 20 added. Tubes are inverted several times to precipitate DNA and then centrifuged for 10 minutes at 16600 g at 4°C. The supernatant is removed and the pellet washed three times with 500 |aL of 75% ethanol. The pellet is finally dried for 30 minutes at room temperature, then resuspended in 1 mL TE buffer.

EXAMPLE 7 25 PCR Amplification and Electrophoresis All primers were supplied by Invitrogen (Carlsbad, California, USA). Forward primers were ordered with an M13 tail sequence at the 5' end (TGTAAAACGACGGCCAGT), to facilitate universal fluorescent labelling of PCR products by a fluorescent-labelled M13 primer (Schuelke 2000). Reverse primers were ordered with the sequence GTTTCTT at the 5' end to promote non-templated adenylation at the 3' end of the PCR product (Brownstein et al. 1996).

PCR amplifications were performed in a 10 (xL volume containing 10 ng of genomic DNA, 1.5 mM magnesium chloride, 1x PCR buffer (Invitrogen), 0.1 mM 5 each of dATP, dCTP, dGTP and dTTP, 0.0375 |xM forward primer and 0.15 ^M reverse primer, 0.15 |xM of FAM-labelled M13 tail primer and 0.3 U of Platinum Taq DNA polymerase (Invitrogen). PCR was carried out in an iCycler (BioRad, Hercules, California, USA) using the following profile: (1) 94°C for 4:00 minutes, (2) 30 cycles of: 94°C for 30 seconds, 55°C for 30 seconds and 72°C for 30 10 seconds, (3) 8 cycles of: 94°C for 30 seconds, 53°C for 30 seconds and 72°C for 30 seconds, (4) 72°C for 30 minutes (after Schuelke 2000).

PCR products were analysed on an ABI 3100 Genetic Analyser (Applied Biosystems, Foster City, California, USA), with analysis being conducted in a 96 well format. PCR products were diluted 1 in 5 in sterile MilliQ water. A 1 fj,L aliquot 15 of diluted product was added to 10 jitL of HI-DI formamide (Applied Biosystems) containing 0.2 ROX 400HD size standard (Applied Biosystems). Diluted products were denatured at 95°C in an iCycler for 5:00 minutes, and then placed on ice. They were then electrophoresed through a 50 cm capillary array in POP6 polymer (Applied Biosystems) on the ABI 3100, using the run module 20 GeneScan50_POP6_10s_inj (differing from the default GeneScan50_POP6 module by using a 10 second injection time).

Electropherograms were analysed using ABI Prism GeneScan software (v 3.7, Applied Biosystems). Genotype data was generated using ABI Prism Genotyper software (v 3.7, Applied Biosystems).

EXAMPLE 8 Microsatellite data and Trait Linkage Analysis DNA of the resistant and susceptible parent genotypes, and bulked resistant and susceptible progeny DNA samples (n=12/bulk) were screened with 21 SSRs under PCR conditions developed for SSR analysis in white clover as described in example 7. SSRs that were polymorphic and present in the resistant parent and polymorphic in the bulk samples were genotyped in the progeny as described in example 7. Linkage phase and recombination fractions were calculated, and used to estimate a linkage map at the locus, designated TRKR [Figures 5 and 6]. 004352858 22 Table 2. SSRs linked at the locus TRKR, including PCR primer sequence and motif characteristics SSR SSR SSR SSR Number Name Type motif SSR Sequence ID SSR Oligos (Forward and Reverse) 1 prs090 TRIMER ctt 010404CS0700566002-523 ATGATAGTGTCGGTGTTGTTGC AGAGAGAAGAAAGAAGTCTCTGAAGG 2 prs247 TRIMER aag 010404CS0700806001 -487 T CAT CTT CAT CAACAGTTT CCG CTT CCCTT CTAT CT CT CAT GTT AACC 3 prs261 TRIMER ctt 000809CS07 G7542AD6-184 CAT CT CTT CACAACT CAAAACCC ATTT CCT CACGCT CAT GACC 4 prs287 TRIMER tag 010404CS0704454001 -373 AACCAACAAGCCATTTTTGC AT GGAT CAAT AGCACAAGAT ACT CC prs592 TRIMER ttc 001122CS07A92701DE-259 TAATTCAGCCAAACCGAAGC TTGGAGTGTTGAGATGAAGGG 6 prs655 TRIMER cag 000830CS07F8AF3BD6-496 ACGCTCACTTGCGTCCTATT T GAAGCT CCATTT GATT CCC 7 prs681 TRIMER tea 010404CS0700758001 -269 AACAAAACT CCGCACGTTTT AGCTTCGTTTTTAGGTGCGA 8 prs721 TRIMER acc 000915CS07C7FB1MD5-477 GGAACT GAAACCCAAGCAAA T CT CAT CTAT CTT CAAGCT AT GCG 004352858 23 EXAMPLE 9 Utilisation of microsatellites for MAS Marker-assisted selection (MAS), a process which utilises one or more SSRs to trace the inheritance of a locus in segregating populations, may be 5 undertaken following linkage analysis. SSRs linked to a trait may be utilised to screen plant populations resulting from cross hybridisation between the genotype containing the markers and trait (the donor plant) and a genotype lacking that trait (the recipient plant). It is preferred that markers are polymorphic within and between plants, are closely (<10 cM) linked with the trait locus, and are indicated 10 by linkage analysis to flank the trait locus. Linked markers may be used to screen populations for the presence of the trait in specific individuals. Plants with the markers and trait may then be repeatedly crossed to the recipient genotype and selected for presence of the SSR marker(s). After several cycles of crossing and selection, a plant will be produced that is substantially equivalent to the original 15 recipient, except for the addition of the trait locus and SSRs utilised to introgress that locus.

EXAMPLE 10 Utilisation of microsatellites for Map Based Cloning When it is not possible to introgress a resistance gene into white clover 20 from related species, or to use MAS to breed a resistance gene into elite white 24 Methods for constructing large insert libraries are now routine for those familiar with the art (Wang et al, 1995, The Plant Journal 7:525). Large insert libraries may be constructed form resistant parental plant lines to allow map based cloning. The BAC library, can be was spotted onto high density filters. The set of 5 filters can then probed with a linked marker to identify BAC clones associated with this marker. With these materials and information an artesian can begin chromosome walking and sequence BAC clones to identify resistance gene candidates. Candidate resistance genes identified by this process can be transformed into susceptible clover species and transgenic lines inoculated to 10 identify the resistance gene. The cloned Resistance gene can then be transformed into elite white clover cultivars by those skilled in the art to produce transgenic lines with resistance to clover root knot or clover cyst nematode pests.

References Documents referred to herein are for reference purposes only and the 15 inclusion of such references should not be taken as an indication that the references form part of the common general knowledge in the art in Australia or elsewhere, nor that they would have been ascertained, understood and regarded as relevant to the invention disclosed herein by a person skilled in the art at the priority date.

Brownstein, M.J.; Carpten, J.D. and Smith, J.R. 1996. Modulation of non- templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. BioTechniques 20 (6): 1004-1010.

Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.

It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features. 21/02 05 MON 11:02 FAX 61 3 9288 1567 004452086 FREEHILLS PATENT & TRADE B 004 26

Claims (23)

CLAIMS:

1. A method of identifying and/or isolating a simple sequence repeat (SSR), said method including preparing a library of cDNA clones from a clover species, 5 generating expressed sequence tags (ESTs) from said cDNA clones, and identifying and/or isolating ESTs including SSRs.

2. A method according to claim 1 wherein said SSR includes at least two repeated core elements of 2-6 nucleotides, at least two of said repeated core elements being tandemly repeated. 10

3. A method according to claim 2 wherein said SSR includes at least three repeated core elements.

4. A method according to claim 3 wherein said SSR includes at least four repeated core elements.

5. A method according to claim 4 wherein said SSR includes at least 5 15 repeated core elements.

6. A method according to any one of claims 1 to 5 wherein said clover species is white clover.

7. A method according to any one of claims 1 to 6 wherein said SSR includes one or more sequences from the group consisting of: ■rc i tLLfcC rUAL^PROPERTY OFFICE 2 1 FEB 2005 ££CEivEo 21/02 '05 MON 11:02 FAX 61 3 9288 1567 FREEHILLS PATENT & TRADE 004452096 @1005 27 [AC]n [CTTJri IJGTT]n [AG]n [GAA]n fTTAAl [AT]„ [GAT]n [TTCAJn [CT]n [GGTjn IJTCT]n [GA]n [GTG]n [TTTA]„ [TA]n [GTT]n UTTCJn rrcin |JCA]n [AAAAC]n [AAC]n UCTJn [AAAAG]n [AAG]„ D"GA]n [AAAATJn [AAT]n [TGG]„ [AAATT]n [ACAJn [TGT]n [ATATC]n [ACC]n UTC]n [All 1 IJn [AGA]n [AAAC]n [TTCAA]n [ATC]n [AAGA]n [TTCTCJn [ATG]n [AGAA]„ [7TGAG]n [ATT]n [ATTA]n [TTTGTln [CAA]n [ATTC]n |TTTTA]n [CAC]n [GAATJn UTTTC]n [CAG]„ [TATCln [TTTTGJn [CAT]n n"ATT]n [CCA]n IJCTTln approximately 60.

8. A method according to claim 7 wherein n is a number between approximately 5 and approximately 25. 'NitLLZCTUALmVERTY OFFICE! 2 1 FEB 2005 I __ RECEIVEn I •05 WED 13:14 FAX 61 3 9288 1567 FREEHILLS PATENT & TRADE 28

9. A substantially isolated nucleic acid molecule including a SSR when identified and/or isolated by the method according to any one of claims 1 to 8.

10. A nucleic acid primer pair for amplifying a nucleic acid molecule which includes a SSR produced by the method according to any one of Claims 1 to 8, 5 the primer pair being designed on the basis of the cDNA from which the EST including the SSR was identified and/or isolated.

11. A nucleic acid primer according to claim 10 wherein said primer pair includes a pair of nucleotide sequences selected from the group consisting of; 5'-ATGATAGTGTCGGTGTTGTTGC-3' (SEQ ID NO: 1) and 10 5-AGAGAGAAGAAAGAAGTCTCTGAAGG-3' (SEQ ID NO: 2); 5'-T CAT CTT CATCAACAGTTT CCG-3' (SEQ ID NO: 3) and 5'-CTTCCCTTCTATCTCTCATGTTAACC-3' (SEQ ID NO: 4); 5'-CATCTCTTCACAACTCAAAACCC-3' (SEQ ID NO: 5) and 5'-ATTTCCTCACGCTCATGACC-3' (SEQ ID NO: 6); 15 5-AACCAACAAG CCA I I II I GC-3' (SEQ ID NO: 7) and 5-ATGGATCAATAGCACAAGATACTCC-3' (SEQ ID NO: 8); 5-TAATTCAGCCAAACCGAAGC-3' (SEQ ID NO: 9) and 5'-TTGGAGTGTTGAGATGAAGGG-3' (SEQ ID NO: 10); 5^ACGCTCACTTGCGTCCTATT-3' (SEQ ID NO: 11) and 20 5'-TGAAGCTCCATTTGATTCCC-3' (SEQ ID NO: 12); 5W\ACAAAACTCCGCACGTTTT-3' (SEQ ID NO: 13) and 5-AGCTTCGI I I I IAGGTGCGA-3' (SEQ ID NO: 14); and intellectual property office OF N.z. 17 AUG 2005 RECEIVED 004646756 intellectual property office Of M2 ~ 7 JUL 2005 29 " W f ' 5'-GGAACTGAAACCCAAGCAAA-3' (SEQ ID NO: 15) anT 5'-T CT CAT CTAT CTT CAAG CTATGCG-3' (SEQ ID NO: 16).

12. A library of clover expressed sequence tags (ESTs) enriched for SSRs identified and/or isolated by a method according to any one of claims 1 to 8. 5

13. A method of selecting for a gene in clover breeding said method including identifying a SSR that is closely associated with said gene by the method of any one of claims 1 to 8, and selecting for said SSR in said breeding.

14. A method according to claim 13 wherein said SSR and said gene have a genetic map distance of approximately 5 cM or less. 10

15. A method according to claim 13 wherein said clover is white clover.

16. A method according to claim 14 or 15 wherein said gene is capable of influencing disease resistance.

17. A method according to claim 16 wherein said disease is clover root knot nematode or clover cyst nematode. 15

18. A method of testing clover seed batch purity, said method including identifying a SSR by the method of any one of claims 1 to 8, and assessing variation within said batch of said SSR.

19. A method according to claim 18 wherein said clover is white clover.

20. A set of SSRs produced by a method according to any one of claims 1 to 8, 20 wherein the SSRs are closely associated with physical characters.

21. Use of an SSR from the set according to claim 20 to identify a relevant target gene in clover breeding.

22. A nucleic acid primer pair according to claim 10 or 11 wherein the SSR is closely associated with a physical character of the clover species. 30

23. A method of identifying and/or isolating a SSR substantially as hereinbefore described with reference to any one of the examples. intellectual property office Of \iL - 7 JUL 2005