NZ256232A

NZ256232A - Fusion molecule with one partner having the antigenic specificity of an anti-plasmodium antibody, antibodies thereof, plasmids and cell lines therefor, and pharmaceutical compositions

Info

Publication number: NZ256232A
Application number: NZ256232A
Authority: NZ
Inventors: Mitchell Stuart Gross; Martin Rosenberg; Jerald Charles Sadoff; Stephen Hoffman; Daniel R Sylvester; Yupin Charoenvit; Mark Hurle
Original assignee: Smithkline Beecham Corp; Us Army
Priority date: 1992-09-09
Filing date: 1993-09-08
Publication date: 1997-02-24
Also published as: KR950703573A; EP0659192A4; AU4851193A; CA2143417A1; WO1994005690A1; JPH08500979A; EP0659192A1; CN1087681A; ZA936260B

Description

<div class="application article clearfix" id="description"> New Zealand No. 256232 International No. PCT/US93/08435 Priority Dat«(s): £?.£( Compteto Specification Filed: Oaes: .,QL Swv.s.f Lo'f i!<& 3 .jz ^ PuWtetfk>n Date: .I.i.fl.?..®.. P.O. Journal No: (&}&. NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Title of Invention: Novel antibodies for conferring passive immunity against infection by a pathogen humans Name, address and nationality of applicant(s) as in international application form: co&to**tkW SMITHKLINE BEECHAM -€0RPr a Pennsylvania corporation of 709 Swedeland Road, King of Prussia, Pennsylvania 19406-2799, United States of America; iW.Wt A ■vwOfic/A ri^t-6o TUc S«,c re VoJ" ^ oC TlvA- AV*V«J-;<K>-*\ fo>.-VioAo^xrA (JL*.\\eck SV*t©o <at/> >-£-?«-feoa«vW^A. & *Tk«. S<tC.l-eAiOLf ^ 0C TU.O- , PftrvVevOjO^ , IA/&OU> r\.e}4r>*"s ( OC- 2.O03 I, iSVfN A*\«,S"iC<Xr-. Co<-f(?>-ocV.'o^> . I 256231 %VO 94/05690 PCT/US93/08435 NOVEL ANTIBODIES FOR CONFERRING PASSIVE IMMUNITY AGAINST INFECTION BY A PATHOGEN IN HUMANS Field of the Invention This invention relates generally to the field 5 of monoclonal and recombinant antibodies directed to epitopes on selected pathogens, e.g., a malaria parasite, methods for preparing and using, and compositions employing, these antibodies. Background of the Invention 10 Malaria is a severe and widespread disease, caused by various species of the protozoan parasite genus Plasmodium, including four species that infect man, e.g., P. falciparum, P. vivax, P. ovale and P. malariae [See, e.g., V. Enea et al.. Science. 225;628-630 (1984)]. 15 Malaria remains one of the most widespread and fatal diseases in the world today because of the lack of an effective vaccine and programs to control vector populations, as well as new drug-resistant strains. Generally, treatment of malaria relies heavily on 20 prophylactic drugs, such as the 4-aminoquinolines. However, for most cases, drug resistance by P. falciparum and the production of some undesirable side effects, have undermined the efficacy of these drug therapies. The focus of much research effort in the field 25 of malaria prophylaxis is the sporozoite form of the Plasmodium parasite, particularly the circumsporozoite (CS) protein [Clyde fital., Am. J. Trop. Med. Hvct.. £1:397 (1975); Rieckman al., Bull. WHO. 52(1) :261 (1979); and U. S. Patent 4,957,869]. The cloning and 30 characterization of the CS protein genes or fragments thereof of a number of Plasmodium species and recombinant expression thereof in E. coli or yeast host cells have been reported. The central repeat domain of the CS proteins is immunodominant, i.e., if one injects 1* WO 94/05690 PCI7US93/08435 , 2 sporozoites into an animal, the animal produces anti-repeat antibodies. The first anti-sporozoite candidate vaccine tested in man was based upon the repetitive epitopes found on the CS protein of P. falciparum 5 consisting of (AsnAlaAsnPro)37(AsnValAspPro)4 [SEQ ID NO: 1], which is invariant in a number of strains examined to date. Clinical trials utilizing a vaccine candidate, called R32tet32, consisting of NH2-Met-Asp~Pro-[ (Asn-Ala-Asn-Pro) 15 (Asn-Val-Asp-Pro) 2] 2-Leu-Arg-Arg-Thr-His-Arg-10 Gly-Arg-His-His-Arg-Arg-His-Arg-Cys-Gly-Cys-Trp-Arg-Leu-Tyr-Arg-Arg-His-His-Arg-Trp-Gly-Arg-Ser-Gly-Ser-COOH [ SEQ ID NO: 2], produced a protective response in a human volunteer against the sporozoite challenge [see, Ballou et ai., The Lancet. June 6, 1987, pp. 1277-1281; and 15 European Patent Publication No. 0192626, published August 27, 1986, incorporated herein by reference]. Numerous monoclonal antibodies (mAbs) directed toward proteins from various stages of the Plasmodium life cycle have been identified and shown to be effective 20 in passive transfer experiments in mice and monkeys [Y. Charoenvit et al.. J. Immunol.. 146(3):1020-1025 (1990)]. However, the use of antibodies for the treatment or prophylaxis of malaria may have disadvantages. The administration of murine or other animal antibodies to 25 humans may be limited by the adverse immune response of humans to the foreign antibody, e.g., rapid clearance and toxic side effects. Such immune responses in humans have been shown to be directed against both immunoglobulin constant and variable regions of murine antibodies. 30 Several techniques have been described which suggest alteration of murine (and other species) antibodies to reduce the occurrence of an immune response in a desired species, e.g., human, to the parent antibody [See, e.g., PCT Patent Publication No. PCT/W086/01533, 35 published March 13, 1986; British Patent Application No. •k „ PCT/US93/08435 fO 94/05690 GB2188638A, published October 7, 1987; Amit efe al- r Science. 232'-747-753 (1986); Queen fife al-/ Proc. Natl. Acad. Sci. USA. £6:10029-10033 (1989); PCT Patent Publication No. PCT/W090/07861, published July 26, 1990; 5 and Riechmann e£ al«» Nature. 332:323-327 (1988)]. While the prior art suggests possible experimental techniques, none show how to provide the combination of properties required for effective prevention of in vivo growth of P. falciparum. 10 There remains a need in the art for alternative methods of providing immunity against infection with selected pathogens, e.g., a malarial parasite, particularly for a prophylactic agent capable of providing effective short-term protection. is pmnmarY pf tfrg invention In one aspect, the present invention provides complementarity determining region (CDR) peptides from a monoclonal antibody directed against a selected epitope on a pathogen, as well as fragments and 20 analogs of these peptides. Preferably, the antibody is capable of binding an epitope of Plasmodium, particularly the CS repeat region epitope or a fragment thereof, e.g., murine anti-P. falciparum mAb NFS2. These CDRs retain the antigen binding specificity of the mAb from which 25 they were derived. Another aspect provides an isolated, naturally occurring or synthetic, humanized immunoglobulin light or heavy chain variable region amino acid sequence comprising one or more CDR sequences originating from the 30 light or heavy chain of such a selected antibody. In yet a further aspect, the invention provides a fusion protein comprising a first amino acid sequence derived from the variable light chain and/or heavy chain of an anti-Plasmodium antibody, an anti-Plasmodium CDR, a O 94/05690 PCT/US93/08435 i functional fragment or analog thereof. The first selected amino acid sequence is operatively linked or fused to a second selected amino acid sequence. These fusion proteins are characterized by the antigen binding 5 specificity of the mAb from which the first selected amino acid sequence is derived. A further aspect of the invention provides an engineered antibody with specificity for the selected Plasmodium epitope, e.g., P. falciparum repeat region. 10 In another aspect, the invention provides a P. falciparum antibody or fragment thereof produced by screening hybridoma products derived from any species immunoglobulin repertoires, or human or murine antibody combinatorial libraries, with the epitope of mAb NFS2. 15 In a further aspect, the present invention provides F^ fragments of the above-described engineered antibodies or anti-Plasmodium mAbs. As yet additional aspects, the invention provides nucleic acid sequences which encode the 20 proteins, peptides, antibodies and fragments described herein, as well as plasmids containing one or more of the sequences, host cells transformed therewith, and methods for producing the products of expression of these nucleotide sequences in host cells, e.g., mammalian 25 cells. Other aspects provided by the invention include a pharmaceutical composition and a prophylactic method for conferring passive immunity to a human anticipating exposure to a malarial parasite, comprising an effective 30 amount of at least one protein, antibody, peptide or fragment described herein and a pharmaceutically acceptable carrier or diluent. Other aspects and advantages of the present invention are described further in the following detailed 35 description of preferred embodiments thereof. 'wo 94/05690 PCT/US93/08435 Prief P3g<?riptA9n Pf the payings Fig. 1 illustrates the amino acid SEQ ID NO: 4 and nucleotide SEQ ID NO: 3 sequences of the naturally occurring light chain variable region of mAb NFS2. 5 Fig. 2 illustrates the amino acid SEQ ID NO: 6 and nucleotide SEQ ID NO: 5 sequences of a synthetic humanized light chain variable region Pfhzlcl-1 containing amti-Plasmodium CDRs SEQ ID NOs: 21-26. The CDRs are underlined. 10 Fig. 3 illustrates the amino acid SEQ ID NO: 8 and nucleotide SEQ ID NO: 7 sequences of synthetic humanized light chain variable region Pfhzlcl-2. Fig. 4 illustrates the amino acid SEQ ID NO: 10 and nucleotide SEQ ID NO: 9 sequences of the naturally 15 occurring heavy chain variable region of mAb NFS2. Fig. 5 illustrates the amino acid SEQ ID NO: 12 and nucleotide SEQ ID NO: 11 sequences of a synthetic humanized heavy chain variable region Pfhzhc2-4. Fig. 6 illustrates the amino acid SEQ ID NO: 14 20 and nucleotide SEQ ID NO: 13 sequences of synthetic humanized heavy chain variable region Pfhzhc2-3. Fig. 7 is a schematic drawing of plasmid Pfhzhc2-3-Pcd employed to express a synthetic anti-Plasmodium heavy chain in mammalian cells. The plasmid 25 contains a beta lactamase (Beta-lac) gene, an SV40 origin of replication (SV40), a cytomegalovirus promoter sequence (CMV), the synthetic heavy chain Pfhzhc2-3 SEQ ID NO: 13, a poly A signal from bovine growth hormone (BGH), a betaglobin promoter (beta glopro), a 30 dihydrofolate reductase gene (DHFR) , and another BGH sequence poly A signal in a pUC19 background. Fig. 8 is a schematic drawing of plasmid Pfhzlcl-l-Pcn employed to express a synthetic light chain in mammalian cells. The plasmid differs from that of 35 Fig. 7, in that it contains the synthetic humanized light WO 94/05690 PCT/ US93/08435 ' chain Pfhzlcl-1 SEQ ID NO: 5 rather than the heavy chain, and a neomycin gene (Neo) in place of DHFR. Fig. 9 illustrates the nucleotide SEQ ID NO: 42 and amino acid SEQ ID NO: 43 sequences of a synthetic 5 humanized heavy chain variable region Pfhzhc2-6. Detailed Description of the Invention The present invention provides prophylactic agents capable of conferring a short duration, protective 10 immune state against infection of humans by selected pathogens in the immunized human, e.g., for epidemic control and for use by those anticipating exposure to the pathogen. Recombinant or engineered antibodies, preferably chimeric, humanized or human monoclonal 15 antibodies, are capable of use as such passive protective proteins. These proteins in a prophylactic composition may be administered before anticipated exposure to the pathogen and would not recpaire daily regimens of follow-up doses to mediate the short term protection. 20 While the following description refers specifically to antibodies capable of conferring passive protection to the sporozoite form of the pathogen, P. falciparum, a causative agent of malaria in humans, the invention described herein is not limited to any 25 particular stage of that pathogen nor to that pathogen alone. The teachings of the present invention permit one skilled in the art to construct other recombinant antibodies directed to other selected pathogens, e.g., other species of Plasmodium, including the blood stages, 30 liver stages, or gametocyte stages. Antibodies of the invention directed against the circumsporozoite CS gene of the other human infective parasites, e.g., P. malarias, P. vivax and P. ovale, may also be constructed according to this invention to provide passive transfer 35 proteins useful against these parasitic infections. WO 94/05690 PCT/US93/08435 Similarly, passive therapy agents prepared according to the invention may involve other infective agents, viruses, bacteria and the like. Additionally, such antibodies may also be useful as therapeutic agents for 5 the treatment of acute stages of infections. I. Definitions "First fusion partner" refers to a nucleic acid sequence encoding an amino acid sequence, which can be all or part of an immunoglobulin heavy chain, a light 10 chain, functional fragment thereof including the variable region from one or both chains and CDRs therefor, or an analog thereof, having the antigen binding specificity of a selected high titer antibody, preferably the murine antibody, NFS2. 15 "Second fusion partner" refers to another nucleotide sequence encoding a protein or peptide to which the first fusion partner is fused in frame or by means of an optional conventional linker sequence. Such second fusion partner is preferably heterologous to the 20 first fusion partner. A second fusion partner may include a nucleic acid sequence encoding a second antibody region of interest, e.g., all or part of an appropriate human constant region or framework region. "Fusion molecule" refers to the product of a 25 first fusion partner operatively linked to a second fusion partner. "Operative linkage" of the fusion partners is defined as an association which permits expression of the antigen specificity of the anti-P. falciparum sequence (the first fusion partner) from the 30 donor antibody as well as the desired characteristics of the second fusion partner. For example, a nucleic acid sequence encoding an amino acid linker may be optionally used, or linkage may be via fusion in frame to the second fusion partner. WO 94/05690 PCT/US93/08435 i 8 "Fusion protein" refers to the protein encoded by the fusion molecule, which may be obtained by expression of the fusion molecule in a selected host cell. Such fusion proteins may be engineered antibodies, 5 e.g., chimeric or humanized antibodies, or any of the antibody regions identified herein fused to immunoglobulin or non-immunoglobulin proteins and the like. "Donor antibody" refers to an antibody 10 (polyclonal, monoclonal or recombinant) which contributes its naturally-occurring or modified variable light and/or heavy chains, variable regions thereof, CDRs thereof or other functional fragments thereof to a first fusion partner, so as to provide the fusion molecule and fusion 15 protein, with the antigenic specificity characteristic of the donor antibody. One donor antibody suitable for use in this invention is murine mAb NFS2 and others are described below. "Acceptor antibody" refers to an antibody 20 (polyclonal, monoclonal or recombinant) heterologous to the donor antibody, but homologous to the patient (human or other mammal) to be treated, which contributes all or any portion of the sequences of its variable heavy and/or light chain framework regions and/or its heavy and/or 25 light chain constant regions to a second fusion partner. Preferably a human antibody is the acceptor antibody. "CDRs" are defined as the complementarity determining region amino acid sequences of an antibody which are the hypervariable regions of the heavy and 30 light chains. CDRs provide the majority of contact residues for the binding of the antibody to the antigen or epitope. CDRs of interest in this invention are derived from donor antibody variable heavy and light chain sequences, and include functional fragments and 35 analogs of the naturally occurring CDRs, which share or WO 94/05690 PCT/US93/08435 retain the sane antigen binding specificity as the donor antibody from which they were derived. By "sharing the antigen binding specificity" it is meant, for example, that although mAb NFS2 may be 5 characterized by a certain level of antigen affinity, and a CDR encoded by a nucleic acid sequence of NFS2 in an appropriate structural environment may have a lower affinity, it is expected that CDRs of NFS2 in such environments will nevertheless recognize the same 10 epitope(s) as NFS2. A "functional fragment" is a partial CDR sequence or partial heavy or light chain variable sequence which retains the same antigen binding specificity as the antibody from which the fragment was 15 derived. An "analog" is an amino acid or peptide sequence modified by replacement of at least one amino acid, modification or chemical substitution of an amino acid, which modification permits the amino acid sequence 20 to retain the biological characteristics, e.g., antigen specificity, of the unmodified sequence. An "allelic variation or modification" is an alteration in the nucleic acid sequence encoding the amino acid or peptide sequences of the invention. Such 25 variations or modifications may be due to degeneracies in the genetic code or may be deliberately engineered to provide desired characteristics. These variations or modifications may or may not result in alterations in any encoded amino acid sequence. 30 An "engineered antibody" is a type of fusion protein, i.e., a synthetic antibody (e.g., a chimeric or humanized antibody) in which a portion of the light and/or heavy chain variable domains of a selected acceptor antibody is replaced by analogous parts of CDRs 35 from one or more donor antibodies which have specificity WO 94/05690 PCT/US93/08435 , 10 for the selected epitope. These engineered antibodies nay also be characterized by alteration of the nucleic acid sequences encoding the acceptor antibody light and/or heavy variable domain framework regions in order 5 to retain donor antibody binding specificity. These antibodies can comprise immunoglobulin constant regions and variable framework regions from the acceptor antibody, and one or more CDRs from the Plasmodium donor antibodies described herein. Preferably the engineered 10 antibodies of the invention will be produced by recombinant DNA technology. "Chimeric antibody" refers to a type of engineered antibody which contains naturally-occurring variable region light chain and heavy chains (both CDR 15 and freunework regions) derived from a non-human donor mAb in association with light and heavy chain constant regions derived from a human (or other heterologous animal) acceptor mAb. "Humanized antibody" refers to an engineered 20 antibody having its CDRs and/or other portions of its light and/or heavy chain variable domain framework regions derived from a non-human donor immunoglobulin, the remaining immunoglobulin-derived parts of the molecule being derived from one or more human 25 immunoglobulins. Such antibodies can also include engineered antibodies characterized by a humanized heavy chain associated with a donor or acceptor unmodified light chain or a chimeric light chain, or vice versa. "Effector agents" refers to non-protein carrier 30 molecules to which the fusion proteins, and/or natural or synthetic light or heavy chain of the donor antibody or other fragments of the donor antibody may be associated by conventional means. Such non-protein carriers can include conventional carriers used in the diagnostic 35 field, e.g., polystyrene or other plastic beads, *>r other •u 094/05690 PCT/US93/08435 11 non-protein substances useful in the medical field and safe for administration to humans and animals. Other effector agents may include a macrocycle, for chelating a heavy metal atom, or a toxin, such as ricin. Such 5 effector agents are useful to increase the half-life of the anti-Plasffiodium derived amino acid sequences or to add to its properties. II. Anti-Plasmodium Antibodies For use in constructing the recombinant 10 antibodies of this invention as it relates to malaria-causing pathogens, non-human species may be employed to generate a desirable donor antibody upon presentment with an antigen from a Plasmodium strain capable of infecting humans. Conventional hybridoma techniques are employed 15 to provide a hybridoma cell line secreting a non-human mAb to the selected antigen. As one example, the murine mAb, NFS2, has been identified as a desirable antibody which may be employed for use in developing a chimeric or humanized antibody of this invention. 20 Murine igG mAb NFS2 is characterized by an antigen binding specificity to the repeat region of the P. falciparum CS protein. In in vitro assays, it prevented invasion of sporozoites into human hepatocytes or hepatoma cells. Analogous antibodies in the mouse 25 model have conferred passive protection against malaria. The production of mAb NFS2 is described in detail in Example l below. This invention is not limited to the use of the illustrative NFS2 mAb or its hypervariable sequences. 30 Wherever in the following description the donor mAb is identified as NFS2, this designation is made for simplicity of description only. Other anti-Plasmodium antibodies may be substituted therefor. Suitable antibodies include, for example, the murine mAb 2A10, 35 which is directed against the CS repeat protein or other WO 94/05690 PCT/US93/08435 . 12 mAfcs described in R. A. Wirtz et al. Bull WHO. 65:39-45 (1987) . Antibodies produced in other animals protected by immunization with sporozoites or a protective epitope 5 of a selected Plasmodium species may be similarly employed in this invention as a source of protective Huti-Plasmodium sequences. For example, the P. falciparum CS protein repeat region protein R32tet32 NH2-Met-Asp-Pro-[(Asn-Ala-10 As n-Pro) lb (Asn-Va 1-Asp-Pr o) x ] 2-Leu-Arg-Arg-Thr-His-Arg-Gly-Arg-His-His-Arg-Arg-His-Arg-Cys-Gly-Cys-Trp-Arg-Leu-Tyr-Arq-Arg-His-His-Arg-Trp-Gly-Arg-Ser-Gly-Ser-COOH SEQ ID NO: k. may be employed to elicit both human and murine mAbs with binding specificity therefor. This repeat 15 region protein is a suitable target for screening for neutralizing antibodies useful in prophylactic agents against malarial infection. Similarly, the epitope to which NFS2 is responsive, and analogs thereof, may be useful in the 20 screening and development of additional P. falciparum antibodies, for use in the development of prophylactic compositions for short-term protection of humans against malaria. Other epitopes of interest include non-repetitive flanking region epitopes, other repeat domains 25 or various liver, and blood and sexual stage epitopes of Plasmodium species. Knowledge of these epitopes enables one of skill in the art to define synthetic, and to identify naturally-occurring, peptides which would be suitable to confer passive or active immunity against P. 30 falciparum or other Plasmodium species. This knowledge also permits the production of mAbs useful in the prophylaxis of malarial infection in humans. For example, other P. falciparum antibodies may be developed by screening hybridomas or other 35 combinatorial libraries, or antibody phage displays [W. WO 94/05690 PCT/US93/08435 13 D. Huse et al.. science. 246:1275-1281 (1988)] using the murine mAb epitope described herein. A collection of antibodies, including hybridoma products or antibodies derived from any species immunoglobulin repertoire may be 5 screened in a conventional competition assay, such as described in the examples below, with one or more epitopes described herein. Antibodies such as those described above, including those generated against a desired epitope and 10 produced by conventional techniques, including without limitation, genes encoding murine mAbs, human mAbs, and combinatorial antibodies, may be useful as donor antibodies, as sources of antibody fragments, as well as in prophylactic compositions against P. falciparum in 15 humans. Preferably, the antibodies developed in response to Plasmodium, particularly P. falciparum, epitopes may be useful as donors of desirable variable heavy and/or light chain amino acid sequences, or functional fragments thereof (e.g., CDRs) useful in the development of fusion 20 proteins, including engineered antibodies. Thus, the invention may utilize a donor antibody, other than NFS2, which is capable of binding to the P. falciparum peptide consisting essentially of the amino acid sequence of the repeat protein and analogs thereof. 25 Additionally, the mAbs identified herein, other mAbs which are developed and are responsive to the use of the sporozoites, R32tet32 [SEQ ID NO: 2] or the repeat epitopes identified herein may be further altered or manipulated to impart additional desirable prophylactic 30 characteristics. III. Antibody Fragments, Amino Acid and Nucleotide Sequences The present invention provides isolated naturally-occurring or synthetic variable light chain and 35 variable heavy chain sequences derived from mAb NFS2, as wo 94/05690 PCT/US93/08435 256232 14 well as CDRs and fragments therefrom, which may be employed in the design of fusion proteins (including engineered antibodies) which are characterized by the antigen binding specificity of this mAb. 5 The naturally-occurring variable heavy chain of NFS2 is characterized by the anir.o acid and encoding nucleic acid sequences illustrated in Fig. 4 [SEQ ID NOS: 9 and 10] . This chain is characterised by CDRs having the following nucleotide and predicted amino acid 10 sequencesi CDR 1 is characterized by the sequence: AGCTATGCCATGTCT SEQ ID NO: 32 SerTyrAlaMetSer SEQ ID NO: 33. The naturally occurring CDR 2 nucleic acid and amino acid sequences are SEQ ID NOS: 17 and 18, respectively: 15 GAAATTAGTGATGGTGGTAGTTACACCTACTATCCAGACACTGTGACGGGC GlulleSerAspGlyGlySerTyrThrTyrTyrProAspThrValThrGly. The naturally-occurring CDR 3 has the nucleic acid and amino acid sequences SEQ ID NOS: 19 and 20, respectively: CTCATCTACTATGGTTACGACGGGTATGCTATGGACTAC 20 LeuIleTyrTyrGlyTyrAspGlyTyrAlaMetAspTyr. Synthetic humanized variable heavy chains of NFS2 are characterized by the amino acid and encoding nucleic acid sequences illustrated in Fig. 5 [SEQ ID NOS: 11 and 12] and Fig. 6 [SEQ ID NOS: 13 and 14]. In both 25 synthetic chains, the CDRs have the following nucleotide and predicted amino acid sequences. - Nucleotide changes were made in CDR 1 from the naturally occurring CDRs, and are indicated by underlining. Synthetic CDR l is characterized by the sequence: 3 0 AGCTATGCCATGAGC SEQ ID NO: 15 SerTyrAlaMetSer SEQ ID NO: 16. The synthetic CDR 2 nucleic acid and amino acid sequences are identical to the naturally-occurring sequences SEQ ID NOS: 17 and 18, respectively. The synthetic CDR 3 has 3 5 the same nucleic acid and amino acid secruences as does WO 94/05690 PCT/US93/08435 15 the naturally occurring CDR 3 SEQ ID NOS: 19 and 20, respectively. The naturally occurring variable light chain of NFS2 is characterized by the amino acid sequence and 5 encoding nucleic acid sequence of Fig. 1 [SEQ ID NOS: 3 and 4]. This chain is further characterized by CDRs having the following nucleotide and amino acid sequences. CDR 1 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 34 and 35, respectively: 10 AAGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAATTACTTGGCC LysSerSerGlnSerLeuLeuTyrSerSerAsnGinLysAsnTyrLeuAla. CDR 2 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 36 and 37, respectively: TGGGCATCCACTAGGGAATCT 15 TrpAlaSerThrArgGluSer. CDR 3 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 38 and 39, respectively: CAGCAATATTATAGCTATCCTCGGACG GlnGlnTyrTyrSerTyrProArgThr. 20 A synthetic humanized variable light chain of NFS2'is characterized by the amino acid and encoding nucleic acid sequences illustrated in Fig. 2 [SEQ ID NOS: 5 and 6] . This chain is characterized by CDRs having the following predicted amino acid sequences and encoded by 25 the illustrated nucleotide sequences. Nucleotide changes were made in the three CDRs from the naturally occurring corresponding CDRs, and are indicated by underlining. Synthetic CDR 1 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 21 and 22, respectively: 30 A£.GAGCTCTCAGAGCCTTTTATACTCGAGCAATCAAAAGAATTACTTGGCC LysSerSerGlnSerLeuLeuTyrSerSerAsnGlnLysAsnTyrLeuAla. Synthetic CDR 2 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 23 and 24, respectively: TGGGCGTC&ACTAGGGAATCT 35 TrpAlaSerThrArgGluSer. WO 94/0S690 A T/US93/08435 v 16 Synthetic CDR 3 is characterized by the amino acid sequences SEQ ID NO: 26 and encoding nucleotide sequences SEQ ID NO:25, respectively: CAGCAATATTATAGCTATCCfiCGGACG 5 GlnGlnTyrTyrSerTyrProArgThr. Another synthetic humanized variable light chain of NFS2 is characterized by the amino acid and encoding nucleic acid sequences illustrated in Fig. 3 [SEQ ID NOS: 7 and 8]. This chain is characterized by 10 identical CDRs 1 and 3 as in the Fig. 2 synthetic sequences. However, a nucleotide change was made in the CDR 2 from both the naturally occurring corresponding CDR 2, and the Fig. 2 synthetic CDR 2. Double underlining is employed to indicate the change from the Fig. 2 synthetic 15 sequences. Synthetic CDR 2 is characterized by the nucleic acid and,amino acid sequences SEQ ID NOS: 40 and 41, respectively: TGGGCfiTCgACTAGGGAATCT TrpAlaSerThrArgGluSer. The present invention also includes the use of 20 F^ fragments or F(ab.)2 fragments. A F^ fragment contains the entire light chain and amino terminal portion of the heavy chain; and a F(ab,)2 fragment is the fragment formed by two F^ fragments bound by disulfide bonds. MAb NFS2 and engineered antibodies derived 25 therefrom and described below provide sources of F^ fragments and F^ab.j2 fragments which can be obtained by conventional means, e.g. cleavage of the mAb with the appropriate proteolytic enzymes, papain and/or pepsin, or by recombinant methods. The F^ fragments or F(ab,)2 30 fragments may be derived from any of the mAbs described above, as agents protective in vivo against infection by malarial rathogens, particularly P. falciparum. The variable chain peptide sequences of murine mAb NFS2, its variable chain peptide sequences and CDRs, 35 functional fragments, F^ fragments, and analogs thereof, and the nucleic acid sequences encoding them, may be WO 94/05690 PCT/US93/08435 17 useful in obtaining various fusion molecules encoding desired fusion proteins, particularly engineered antibodies, and in methods for preparing and administering pharmaceutical compositions containing 5 them. The nucleic acid sequences of the invention, or fragments thereof, encoding the variable light chains and heavy chain peptide sequences or CDR peptides, or functional fragments thereof are used in unmodified form 10 or are synthesized to introduce desirable modifications. The isolated naturally-occurring or synthetic nucleic acid sequences, which are derived from mAB NFS2 or from other desired anti-Plasmodium antibodies, may optionally contain restriction sites to facilitate insertion or 15 ligation into a suitable nucleic acid sequence encoding a desired antibody framework region, ligation with mutagenized CDRs, or fusion with a nucleic acid sequence encoding a selected second fusion partner. Taking into account the degeneracy of the 20 genetic code, various coding sequences may be constructed which encode the variable heavy and light chain amino acid sequences, and CDR sequences of the invention, e.g., Figs. 1-6 [SEQ ID NOS: 3-26], and functional fragments and analogs thereof which share the' antigen specificity 25 of the donor antibody. The isolated or synthetic nucleic acid sequences of this invention, or fragments thereof, encoding the variable chain peptide sequences or CDRs or functional fragments thereof can be used to produce fusion proteins, i.e. chimeric or humanized antibodies, 30 or other engineered antibodies of this invention, when operatively combined with a second fusion partner. These sequences are also useful for mutagenic insertion of specific changes within the nucleic acid sequences encoding the CDRs or framework regions, and for 35 incorporation of the resulting modified or fusion nucleic WO 94/05690 PCT/US93/08435 \ 18 acid sequence into a vector for expression. For example, silent nucleotide substitutions may be made in the nucleotide sequences encoding the CDRs to create restriction enzyme sites to facilitate insertion of the 5 mutagenic frameworks, or to modify the selected freuaeworks at nucleotide positions analogous to those of the donor antibody. Such mutations may include those inserted for the purpose of contributing to higher antigen binding affinity. 10 XV. Fusion Molecules and Fusion Proteins Fusion molecules of this invention can encode engineered antibodies, chimeric antibodies and humanized antibodies. A desired fusion molecule may contain a first fusion partner encoding an amino acid sequence 15 having the antigen specificity of a Plasmodium antibody directed against the amino acid sequence of the repeat protein and analogs thereof, operatively linked to a second fusion partner. Desirably the source of the first fusion partner is a selected mAb, e.,g., mAb NFS2, the 20 source.of nucleic acid sequences of Figs. 1 [SEQ ID NO: 3] and 4 [SEQ ID NO: 9]. A fusion molecule may encode an amino acid sequence for a naturally occurring variable heavy chain sequence of Fig. 4 [SEQ ID NOS: 9 and 10], a functional 25 fragment or analog thereof, a naturally occurring variable light chain sequence of Fig. 1 [SEQ ID NO: 3 and 4], a functional fragment or analog thereof, or one or more NFS2 CDRs [SEQ ID NO: 15-26]. Another exemplary fusion molecule may encode a synthetic variable heavy 30 and/or light chain from the donor mAb, such as those of Figs. 2 [SEQ ID NOS: 5 and 6], 3 [SEQ ID NOS: 7 and 8], 5 [SEQ ID NOS: 11 and 12], and 6 [SEQ ID NOS: 13 and 14], having the antigen specificity of P. falciparum antibody. A desirable fusion molecule of this invention 35 may be characterized by encoding an amino acid sequence ♦VO 94/05690 PCT/US93/08435 19 containing at least one, and preferably all of the CDRs [SEQ ID NOS: 15-26] of the variable region of the heavy and/or light chains of the murine antibody NFS2, or a functional fragment or analog thereof. 5 The second fusion partners are defined above, and may include a sequence encoding a peptide, protein or fragment thereof heterologous to the CDR-containing sequence having the antigen specificity of NFS2. One example is a sequence encoding a second antibody region 10 of interest and may optionally include a linker sequence. The resultihg fusion molecule may encode both anti-P. falciparum antigen specificity and the characteristic of the second fusion partner, e.g., a functional characteristic such as secretion from a 15 recombinant host, or a therapeutic characteristic if the fusion partner itself encodes a therapeutic protein, or additional antigenic characteristics, if the fusion partner encodes a protein having its own antigen specificity. 20 If the second fusion partner is derived from another antibody, e.g., any isotype or class of immunoglobulin freunework or constant region (preferably human), or the like, an engineered antibody is provided. Thus, for example, a fusion molecule of this invention 25 may comprise a complete antibody molecule, having full length heavy and light chains (Figs. 4 [SEQ ID NOS: 9 and 10] and 1 [SEQ ID NOS: 3 and 4]). For example, the invention includes isolated naturally-occurring or synthetic nucleic acid sequences, which may encode 30 variable region sequences, CDR peptides, fragments thereof derived from desired Plasmodium mAbs, any fragment of an engineered antibody, such as the F^ or F(ab*)2 fragment, a heavy chain dimer, or any minimal recombinant fragment thereof such as an Fv or a single-35 chain antibody (SCA) or any other sequence encoding a O 94/05690 PCT/US93/08435 20 protein with the same specificity as the selected mAb, e.g., the Plasmodium mAb NFS2. The first fusion partner may also be associated with effector agents as defined above, to which the first 5 fusion partner may be operatively linked by conventional means, e.g., attached to the NFS2 encoding nucleic acids by a covalent bridging structure. Fusion or linkage between the first fusion partners and the selected second fusion partner may be by 10 way of any suitable means, e.g., by conventional covalent or ionic bonds, protein fusions, or heterobifunctional cross-linkers, e.g., carbodiimide, glutaraldehyde, and the like. Where the first fusion partner is associated with an effector agent, non-proteinaceous, conventional 15 chemical linking agents may be used to fuse or join the anti-P. falciparum amino acid sequences to the effector Agent. Such techniques are known in the art and readily described in conventional chemistry and biochemistry texts. 20 Additionally, conventional inert linker sequences which simply provide for a desired amount of space between the fusion partners or between the first fusion partner and the effector agent may also be constructed into the fusion molecule. The design of such 25 linkers is well known to those of skill in the art. Expression of such fusion molecules results in fusion proteins of this invention. One particularly desirable type of fusion protein includes the engineered antibody in which, at a minimum, fragments of the 30 variable heavy and/or light domains of an acceptor mAb have been replaced by analogous parts of the variable light and/or heavy chains from one or more donor monoclonal antibodies, which include the Plasmodium mAbs described herein, such as NFS2. O94/05690 PCT/US93/08435 21 One example of a particularly desirable engineered antibody is a humanized antibody, in which CDRs from a desired donor murine mAb. are inserted into the framework regions of a human antibody. A preferred 5 donor antibody is one directed against a Plasmodium epitope, preferably one specific for the repeat region epitope of P. falciparum. A particularly preferred donor antibody has all or a portion of the variable domain amino acid sequences of KFS2. In these humanized 10 antibodies one, two or preferably three CDRs from the Plasmodium antibody heavy chain and/or light chain variable regions are inserted into the freunework regions of a selected human antibody, replacing the native CDRs of that latter antibody. 15 Preferably, the variable domains in both human heavy and light chains have been altered by CDR replacement. This engineered humanized antibody thus preferably has the structure of a natural human antibody or a fragment thereof. Such humanized antibodies may or 20 may not also include minimal alteration of the acceptor mAb light and/or heavy variable domain framework region in order to retain donor mAb binding specificity. The humanized antibody possesses the combination of properties required for effective prevention and 25 treatment of infectious P. falciparum disease in animals or man. The remainder of the engineered antibody may be derived from any suitable acceptor human immunoglobulin. A suitable human antibody may be one selected from a 30 conventional database, e.g., the Kabat database, Los Alamos database, and Swiss Protein database, by homology to the nucleotide and amino acid sequences of the donor antibody. A human antibody characterized by a homology to the framework regions of the donor antibody (on an 35 amino acid basis) may be suitable to provide a heavy WO 94/05690 PCT/US93/08435> 22 chain constant region and/or a heavy chain variable framework region for the insertion of the donor CDRs. A suitable acceptor antibody capable of donating light chain constant or variable framework regions may be' 5 selected in a similar manner. It should be noted that the acceptor antibody heavy and light chains are not required to originate from the same human antibody. Desirably, the heterologous framework and constant regions are selected from the human 10 Immunoglobulin classes and isotypes, such as IgG (subtypes 1 through 4), IgM, IgA and IgE. However, the acceptor antibody need not comprise only human Immunoglobulin protein sequences. For instance, a gene may be constructed in which a DNA sequence encoding part 15 of a human immunoglobulin chain is fused to a DNA sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule. As one example, an engineered antibody may be encoded by a synthetic nucleic acid sequence encoding 20 CDRs of the variable light chain region of NFS2 or a functional fragment thereof in place of at least a part of the nucleic acid sequence encoding the light chain variable region of an acceptor mAb, and a nucleic acid sequence encoding CDRs of the variable heavy chain region 25 of NFS2 or a functional fragment thereof in place of at least a part of the nucleic acid sequence encoding the heavy chain variable region of an acceptor mAb, such as a human antibody. The resulting humanized antibody is characterized by the antigen binding specificity of mAb 30 NFS2. Alternatively, the engineered antibody (or the other monoclonal antibodies) of the invention may have attached to it an effector or reporter molecule. Alternatively, the procedure of recombinant DNA 35 technology may be used to produce an engineered antibody WO 94/05690 PCT/US93/08435 23 of the invention in which the Fc fragment or CH3 domain of a complete antibody molecule has been replaced by an enzyme or toxin molecule. It will be understood by those skilled in the 5 art that such an engineered antibody may be further modified by changes in variable domain amino acids without necessarily affecting the specificity of the donor antibody. It is anticipated that heavy and light chain amino acids may be substituted by other amino acids 10 either in the variable domain frameworks or CDRs or both. Such engineered antibodies can be effective in prevention of productive malaria (e.g., by P. falciparum) infection in humans. Additionally, the invention provides fusion 15 proteins which are chimeric antibodies, as defined above. Such antibodies differ from the humanized antibodies described above by providing the entire donor antibody heavy chain and light chain variable regions, including freunework regions, e.g., Figs, l [SEQ ID NOS: 3 and 4] 20 and 4 [SEQ ID NOS: 9 and 10], fused to acceptor constant regions for both chains. V. Production of Proteins and Antibodies A fusion molecule, recombinant antibody or fusion protein of this invention is desirably constructed 25 by recombinant DNA technology using genetic engineering techniques. The same or similar techniques may also be employed to generate other embodiments of this invention, e.g., to construct the chimeric or humanized antibodies, the synthetic light and heavy chains, the CDRs, and the 30 nucleic acid sequences encoding them, as above mentioned. A specific embodiment of the compositions of this invention is set out in Example 3 below using the CDRs of murine NFS2 and one or more selected human antibody light and heavy chain framework regions. 35 Briefly described, a hybridoma producing the murine WO 94/05690 PCT/US93/08435 - 24 antibody NFS2 is conventionally cloned, and the cDNA of its heavy and light chain variable regions is obtained by techniques known to one of skill in the art, e.g., the techniques described in Sambrook £t al., Molecular 5 Cloning (A Laboratory Manual). 2nd edition, Cold Spring Harbor Laboratory (1989). The variable regions of the NFS2 are obtained using PCR primers, and the CDRs are identified using a known computer database, e.g, Kabat, for comparison to other antibodies. 10 Homologous framework regions of a heavy chain variable region from a human antibody were identified using the same databases, e.g., Kabat, and a human antibody having homology to NFS2 was selected as the acceptor antibody. The sequences of synthetic heavy 15 chain variable regions containing the NFS2 CDRs within the human antibody frameworks were designed with optional nucleotide replacements in the framework regions for restriction sites. This designed sequence was synthesized by overlapping oligonucleotides, amplified by 20 polymerase chain reaction (PCR), and corrected for errors. A suitable light chain variable framework region was designed in a similar manner, resulting in two synthetic light chain variable sequences containing the 25 NFS2 CDRs. See, Figs. 2 [SEQ ID NOS: 5 and 6] and 3 [SEQ ID NOS: 7 and 8]. As stated above, the source of the light chain is not a limiting factor of this invention. These synthetic variable light and/or heavy chain sequences and the CDRs of mAb NFS2, and their 30 encoding nucleic acid sequences, are employed in the construction of fusion proteins and engineered antibodies, preferably humanized antibodies, of this invention, by the following process. By conventional techniques, a DNA sequence is obtained which encodes the 35 donor antibody variable heavy or light chain regions, WO 94/05690 PCT/US93/08435 25 wherein at least the CDRs and those minimal portions of the acceptor mAb light and/or heavy variable domain freunework region required in order to retain donor mAb binding specificity as well as the remaining 5 imntunoglobulin-derived parts of the antibody chain derived from a human immunoglobulin. A conventional expression vector or recombinant plasmid is produced by placing these sequences encoding the fusion protein in operative association with 10 conventional regulatory control sequences capable of controlling the replication and expression in, and/or secretion from, a host cell. Such regulatory sequences may be readily selected by one of skill in the art eind are not intended as a limitation of the present 15 invention. Regulatory sequence include promoter sequences, e.g., CMV promoter, and signal sequences which can be derived by one of skill in the art from antibodies. A first vector can contain a sequence encoding 20 a light chain-derived polypeptide. Similarly, a second expression vector is produced having a similar DNA sequence which encodes a complementary antibody light or heavy chain. Preferably at least the CDRs (and those minimal portions of the acceptor mAb light and/or heavy 25 variable domain framework region required in order to retain donor mAb binding specificity) of the variable domain are derived from a donor antibody and the remaining immunoglobulin-derived parts of the antibody chain are derived from a human immunoglobulin in these 30 vectors. Preferably this second expression vector is identical to the first, with the exception of the coding sequences and selectable markers, to ensure that each polypeptide chain is functionally expressed. In another alternative, a single vector of the 35 invention may be used, the vector including the sequence WO 94/05690 PCT/US93/084351 26 encoding both light chain and heavy chain-derived polypeptides. The DNA in the coding sequences for the light and heavy chains may comprise cDNA or genomic DNA or both. 5 A selected host cell is co-transfected by conventional techniques with both the first and second vectors (or the single vector) to create the transfected host cell of the invention comprising both the recombinant or synthetic light and heavy chains. The 10 transfected cell is then cultured by conventional techniques to produce the engineered antibody of the invention. The humanized antibody which includes the association of both the recombinant heavy chain and/or light chain is screened from culture by appropriate 15 assay, such as an ELXSA assay followed by the Inhibition of Sporozoite Invasion (ISI) assay described in the examples below. Similar conventional techniques may be employed to construct other fusion proteins of this invention. 20 Thus, the invention also includes a recombinant plasmid containing the coding sequence of the fusion molecule or engineered antibody of the invention. Such a vector is prepared by conventional techniques and suitably comprises the above-described DNA sequences and 25 a suitable promoter operatively linked to the DNA sequences which encode the engineered antibody. Such a vector is transfected into a mammalian cell via conventional techniques. Suitable vectors for the cloning and subcloning 30 steps employed in the methods and construction of the compositions of this invention may be selected by one of skill in the art. For example, the conventional pUC series of cloning vectors, may be used. One vector used is pUC19, which is commercially available from supply 35 houses, such as Amersham (Buckinghamshire, United WO 94/05690 PCT/US93/08435 27 Kingdom) or Pharmacia (Uppsala, Sweden). Additionally, any vector which is capable of replicating readily, has an abundance of cloning sites and marker genes, and is easily manipulated may be used for cloning. Thus, the 5 selection of the cloning vector is not a limiting factor in this invention. Similarly, the vectors employed for expression of the engineered antibodies according to this invention may be selected by one of skill in the art from any 10 conventional vector. The vectors also contain selected regulatory sequences which are in operative association with the DNA coding sequences of the immunoglobulin regions and capable of directing the replication and expression of heterologous DNA sequences in selected host 15 cells, such as CMV promoters. These vectors contain the above described DNA sequences which code for the engineered antibody or other fusion protein. Alternatively, the vectors may incorporate the selected immunoglobulin sequences modified by the insertion of 20 desirable restriction sites for ready manipulation. The expression vectors may also be characterized by marker genes suitable for amplifying expression of the heterologous DNA sequences, e.g., the mammalian dihydrofolate reductase gene (DHFR) or neomycin 25 resistance gene (neoR). Other preferable vector sequences include a poly A signal sequence, such as from bovine growth hormone (BGH), and the betaglobin promoter sequence (betaglupro). The expression vectors useful herein may be synthesized by techniques well known to 30 those skilled in this art. The components of such vectors, e.g. replicons, selection genes, enhancers, promoters, and the like, may be obtained from natural sources or synthesized by known procedures for use in directing the expression of the 35 recombinant DNA in a selected host. Other appropriate WO 94/05690 \ PCT/US93/08435 28 expression vectors of which numerous types are known in the art for mammalian, bacterial, insect, yeast, and fungal expression may also be selected for this purpose. Two exemplary expression vectors employed in 5 the following examples for expression of the synthetic heavy and light chain sequences are the mammalian vectors Pfhzhc2-3-Pcd and Pfhzlcl-l-Pcn (see Figs. 7 and 8) . However, this invention is not limited to the use of these illustrative pUC19-based vectors. 10 The present invention also encompasses a cell line transfected with a recombinant plasmid containing the coding sequences of the engineered antibodies or other fusion protein described by this invention. Host cells useful for the cloning and other manipulations of 15 these cloning'vectors are also conventional. However, most desirably, cells from various strains of E. coli are used for replication of the cloning vectors and other steps in the construction of the mAbs of this invention. Suitable host cells or cell lines for the 20 expression of the engineered antibody or other protein of the invention of this invention are preferably a eukaryotic cell, and most preferably a mammalian cell, such as a CHO cell or a myeloid cell. Other primate cells may be used as host cells and, most desirably, 25 human cells are used, thus enabling the protein to be modified with human glycosylation patterns. Alternatively, other eukaryotic cell lines may be employed. The selection of suitable mammalian host cells and methods for transformation, culture, amplification, 30 screening and product production and purification are known in the art. See, e.g., Sambrook , cited above. Bacterial cells may prove useful as host cells suitable for the expression of the recombinant mAbs of 35 the present invention. However, due to the tendency of WO 94/05690 PCT/US93/08435 29 proteins expressed in bacterial cells to be in an unfolded or improperly folded form or in a non-glycosylated form, any recombinant mAb produced in a bacterial cell would have to be screened for retention of 5 antigen binding ability. If the protein expressed by the bacterial cell was produced in a properly folded form, that bacterial cell would be a desirable host. For example, various strains of E. coli used for expression are well-known as host cells in the field of 10 biotechnology. Various strains of B. subtllis, Streptomyces, other bacilli and the like may also be employed in this method. Where desired, strains of yeast cells known to those skilled in the ait are also available as host 15 cells, as well as insect cells and viral expression systems. See, e.g. Killer al., Genetic Engineering. £: 277-298, Plenum Press (1986) and references cited therein. The general methods by which the vectors of the 20 invention may be constructed, transfection methods required to produce the host cells of the invention, and culture methods necessary to produce the fusion protein, and preferably an engineered f.ntibody of the invention from such host cell are all conventional techniques. 25 Likewise, once produced, the fusion proteins, preferably the engineered antibodies of the invention, may be purified from the cell culture contents according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column 30 chromatography, gel electrophoresis and the like. Such techniques Eire within the skill of the art and do not limit this invention. The engineered antibody is then examined for in vitro activity by use of an assay appropriate for the 35 selected pathogen. Presently conventional ELISA assay WO 94/05690 PCT/US93/08435 t 30 formats are employed to assess qualitative and quantitative binding of the engineered antibody to the R32tet32 epitope [SEQ ID NO: 2]. The ISI assay described in Example 6 may also be employed. A similar assay, the 5 inhibition of hepatocyte invasion assay (ILSDA), may be performed [S. Mellouk §& si., Bull. WHO. Suppl. 68:52-58 (1990)]. Additionally, assays currently being developed in the SCID mouse model may also be used to verify efficacy prior to subsequent human clinical studies 10 performed to evaluate the persistence of the engineered antibody in the body despite the usual clearance mechanisms. The examples below demonstrate the method for constructing the humanized antibodies derived from the 15 murine mAb NFS2. Following the procedures described for humanized antibodies prepared from this antibody, one of skill in the art may also construct humanized antibodies from other malarial antibodies, variable region sequences and CDR peptides described herein. Engineered antibodies 20 can be produced with variable region frameworks potentially recognized as "self" by recipients of the altered antibody. Minor modifications to the variable region frameworks can be Implemented to effect large increases in antigen binding without appreciable 25 increased immunogenicity for the recipient. Such engineered antibodies can effectively passively protect a human against P. falciparum infection,. VI. Therapeutic/Prophylactic Uses The fusion proteins, particularly the 30 engineered antibodies described above, functional fragments, analogs and the other protein or peptides described herein may be employed as prophylactic agents, capable of conferring short-term passive immunity to infection by the pathogen from which the original 35 antigenic substance derives, e.g., P. falciparum, to a too 94/05690 PCT/US93/08435 31 subject. The protective effect conferred by the use of the engineered antibodies of this invention is produced by binding of the immunoglobulin to the pathogen and the subsequent removal of this bound complex by the normal 5 function of macrophages. Thus, the engineered antibodies of the present invention, when in preparations and formulations appropriate for prophylactic use, ire highly desirable for persons anticipating short-term exposure to the pathogen, e.g., travelers, tourists, or military 10 personnel anticipating travel in endemic areas. Therefore, this invention also relates to a method of prophylactic treatment of human P. falciparum infection in a human in need thereof which comprises administering an effective, protective dose of antibodies 15 including one or more of the engineered antibodies or other fusion proteins described herein, or fragments thereof, to a human anticipating exposure to a species of Plasmodium. The fusion proteins, including the engineered 20 antibodies or fragments thereof of this invention, may also be used in conjunction with other antibodies, particularly human mAbs reactive with other epitopes responsible for the disease against which the engineered antibody of the invention is directed. Similarly mAbs 25 reactive with other epitopes responsible for the disease in a selected animal against which the antibody of the invention is directed may also be employed in veterinary compositions. Any antibody that is capable of operating without interfering with the Plasmodium antibody of this 30 invention, e.g., antibodies to other malaria stages or to different epitopes, are useful in these compositions. The prophylactic agents of this invention are believed to be desirable to confer protection to exposure to the pathogen for from about 4 days to about 8 weeks, 35 without requiring booster dosages of the agent. This iVO 94/05690 PCT/US93/08435 , 32 definition of 1 short-term* relates to the relative duration of the recombinant antibodies of the present invention in the human circulation. The mode of administration of the prophylactic 5 agent of the invention may be any suitable route which delivers the agent to the host. The fusion proteins, including the engineered antibodies, and fragments thereof, and pharmaceutical compositions of the invention are particularly useful for parenteral administration, 10 i.e., subcutaneously, intramuscularly or intravenously. However, the agent is preferably administered by intramuscular injection. Prophylactic agents of the invention may be prepared as pharmaceutical compositions containing an 15 effective amount of the engineered antibody of the invention as an active ingredient in a nontoxic and sterile pharmaceutical^ acceptable carrier. In the prophylactic agent of the invention, an aqueous suspension or solution containing the engineered 20 antibody, preferably buffered at physiological pH, in a form ready for injection is preferred. The compositions for parenteral administration will commonly comprise a solution of the engineered antibody of the invention or a cocktail thereof dissolved in an acceptable carrier, 25 preferably an aqueous carrier. A variety of aqueous carriers may be employed, e.g., saline, glycine, and the like. These solutions «*re sterile and generally free of particulate matter. These solutions may be sterilized by conventional, well known sterilization techniques. The 30 compositions may contain pharmaceutical^ acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, etc. The concentration of the antibody of the invention in such pharmaceutical formulation can d «V( >*4/05690 PCT/US93/08435 33 vary widely, i.e., from less than about 0.5%, usually at or at least about 1% to as much as 15 or 20% by weight and will be selected primarily based.on fluid volumes, viscosities, etc., according to the particular mode of 5 administration selected. Thus, a pharmaceutical composition of the invention for parenteral, e.g., intramuscular injection, could be prepared to contain 1 mL sterile buffered water, and between about 50 to about 100 mg of an engineered 10 antibody of the invention. Similarly, a pharmaceutical composition of the invention for intravenous infusion could be made up to contain 250 ml of sterile Ringer's solution, and 150 mg of an engineered antibody of the invention. Actual methods for preparing parenterally 15 administrablft compositions are well known or will be apparent to those skilled in the art and are described in more detail in, for example, Remington's Pharmaceutical Science. 15th ed., Mack Publishing Company, Easton, Pennsylvania. 20 It is preferred that the prophylactic agent of the invention, when in a pharmaceutical preparation, be present in unit dose forms. The appropriate therapeutically effective dose can be determined readily by those of skill in the art. To effectively prevent P. 25 falciparum infection in a human or other animal, one dose of approximately l mg/kg to approximately 20 mg/kg of a protein or an antibody of this invention should be administered parenterally, preferably intramuscularly (i.m.) and possibly intravenously (i.v.). Such dose may 30 be repeated at appropriate intervals during exposure. The antibodies, engineered antibodies or fragments thereof described herein can be lyophilized for storage and reconstituted in a suitable carrier prior to use. This technique has been shown to be effective with WO 94/05690 PCT/US93/08435 v 34 conventional immunoglobulins and art-known lyophilization and reconstitution techniques can be employed. Single or multiple administration? of the pharmaceutical compositions can be carried out with 5 dosage levels and pattern being selected by the treating physician. In any event, the pharmaceutical composition of the invention should provide a quantity of the engineered antibodies of the invention sufficient to effectively prevent infection. 10 The following examples illustrate the construction of exemplary engineered antibodies and expression thereof in suitable vectors and Host cells, and are not to be construed as limiting the scope of this invention. All amino acids are identified by 15 conventional codas or by full name, unless otherwise indicated. All restriction enzymes, plasrai&s, and other reagents and materials were obtained from commercial sources unless otherwise indicated. All general cloning, ligation ar d other recombinant DNA methodology were as 20 performed in Sambrook al.. cited previously, or the first edition thereof. Example I - PegpriptApn pt Promptjon pf yyp;, Murine IgG mAb NFS2 was made by repeated injection of P. falciparum sporozoites into mice followed 25 by B cell fusion with a myeloma cell line. The murine mAb NFS2 is characterized by an antigen binding specificity to the repeat region of the P. falciparum CS protein. Specifically, the NFS2 mAb uiuds to the epitope, Pro Asn Ala Asn Pro Asn SEQ ID NO; 27. It is 30 possible that the antibody also binds to a larger, or overlapping epitope on the repeat region. /VO 94/05690 PCT/US93/08435 35 This murine mAb, in in vitro assays, prevented invasion of sporozoites into human hepatocytes and hepatoma cells. Analogous antibodies in the mouse model have conferred passive protection against: malaria and 5 have been observed to be highly potent [see, e.g., R. A. Wirtz et al.. Bull WHO. ££:39-45 (1987), incorporated herein by reference]. This antibody is available from the U. S. Naval Medical Research Institute. Example 2 - Cloning and Sequencing of NFS2 10 Cytoplasmic RNA was prepared by the method of Favaloro st al., Meth. Enzvmol.. 65:718-749 (1980) from NFS2, and hybridoma cell lines. The following primers were used in the synthesis of Ig heavy (VH) and light (VL) chain variable region cDNAs, respectively. The VL 15 primers, #2580 and #2789, extended from Hindu through Xbal and were made to conserved regions of murine RNA. Biasiiii #2580: 5'CCAGATGTAAGCTTCAGCTGACCCAGTCTCCA3' SEQ ID NO: 28 20 PVUII Xfrfl X MS3L. #2789: 5 • CATCTAGATGGCGCCGCCACAGTACGTTTGATCTCCAGCTTGGTCCC3 ' SEQ ID NO: 29 The VH primers, #2621 and #2853, extended from 25 Kpnl through PstI and were made to conserved regions of murine RNA. #2621: 51GGGGTACCAGGTCCA(A/G) CT (G/T) CTCGAGTC (A/T) GG3 » SEQ ID NO: 30 30 PstI #2853: 5' GCCTGCAGCTAGCTGAGGAGACGGTGACCGTGGTCCCTTGG- Nhel CCCCAG3 * SEQ ID NO: 31 PCR, as described by Saiki fit al., Science. 35 239:487-491 (1988), was performed on the RNA template. For the PCR, the primers used were identified above. For WO 94/05690 PCT/US93/08435 36 PCR amplification of VH, DNA/primer mixtures consisted of 5 Ml RNA and 0.5 jiM of the primers/ For PCR amplifications of VL, DNA/primer mixtures consisted of 5 Hi RNA and 0.5 fiVL of the primers. To these mixtures was 5 added 250 fM each of dATP, dCTP, dGTP and dTTP, 10 mM Tris-HCl pH 8.3, 50 mM KC1, 1.5 mM MgCl2, 0.01% (w/v) gelatin, 0.01% (v/v) Tween 20, 0.01% (v/v) Nonidet P40 and 5 units AmpliTaq [Cetus]. Samples were subjected to 25 thermal cycles of PCR at 94°C, 30 seconds; 55°C, 30 10 seconds; 72°C, 45 seconds; ending with 5 minutes at 72°C. For cloning and sequencing, amplified VH DNA was purified on a low melting point agarose gel and by Elutip-d colvimn chromatography [Schleicher and Schuell-Dussel, Germany] and cloned into pUC18 [New England Biolabs]. The general 15 cloning and ligation methodology was as described in Maniatis al., cited above. VH DNA was cloned as KpnI-PstI fragment? into similarly-digested pUC18. VL DNA was cloned as Hindlll-Xbal fragments into pUC18 digested with the same enzymes. 20 Representative clones were sequenced by the dideoxy method [Sanger e£ » Proc. Natl. Acad. Sci. USA. 71:5463-5467 (1977)] using T7 DNA polymerase [US Biologicals]. From the sequences of NFS2 VH and VL domains, the CDR sequences were elucidated in accordance 25 with the methodology of Kabat gt &1., in "Sequences of Proteins of Immunological Interest", US Dept of Health and Human Services, US Government Printing Office (1987) utilizing computer assisted alignment with other VH and VL sequences. The CDRs of the heavy and light chains of 30 NFS2 are listed above and identified herein as SEQ ID NOS: 15-20 and 21-26. WO 94/05690 PCT/US93/08435 37 Example 3 - Humanized Antibodies The following example describes the preparation of an exemplary engineered antibody.. Similar procedures may be followed for the development of engineered 5 antibodies, using other Plasmodium antibodies or other anti-pathogen antibodies developed by conventional means. The source of the donor CDRs utilized to prepare these engineered antibodies was the murine mAb, NFS2, described in Examples 1 and 2 above. The sequenced 10 NFS2 variable freunework regions were employed to again search through the Kabat database to identify homologous freunework regions of a human antibody. The framework region of an antibody obtained from a human SLE patient B-cell hybridoma cell line 18/17 [H. Dersimonian et al., 15 J. Immunol.. 139:2496-2501 (1987)] was determined to be approximately 80% homologous to the NFS2 variable heavy chain framework region. Given the murine NFS2 CDRs (Example 2) and the sequence of the human antibody 18/17, a synthetic heavy 20 chain variable region was made, and PCR performed to fill in and amplify DNA. The NFS2 CDR sequences and the 18/17 Vjj framework regions were synthesized by the following overlapping oligonucleotides: SEQ ID NO: 44 : TAGTGAAGAATTCGAGGACGCCAGCAACATGGTGTTGCAGAC 2 5 CCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGCCTACGGGGAGGTGCAG (Base 1-97); SEQ ID NO: 4 5: GCTAGCGGATTCACCTTTAGCAGCCATGTCGGACCCCCCAGG GACTCTGAGAGGACACGTCGATCGCCTAAGTGGAAATCCTATGCCATGAGCTGGG TCCGCCAGGCTCCAGGGAAAGGTCTAGAGTGGGTCTCAGAAATCTTTATAGTGAT 30 GGTGGTAGTTAC (Base 158-259); SEQ ID NO:46: GAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAG GACACGTCTCTGTTAAGGTTCTTGTGCGACATAGACGTTTACTGCAGTATATTAC TGTGCGAAACTCATCTACTATGGTTACGACGGGTATGCTATGGACTAGCTGCCCA TACGATACCTGATC (Base 316-421); 35 SEQ ID NO: 47: TTCTTGAAAGCTTGGGCCCTTGGTACTAGCTGAGCTCACGG WO 94/05690 PCT/US93/08435 ; 38 TGACCAGGGTACCCTGGCCCCAGTAGTCCATAGCATACCCGTCG (Base 484-400) ; SEQ ID NO: 48: CATTTGCAGATACAGCGTGTTCTTGGAATTGTCTCTGGATA TCGTGAACCGGCCCGTCACAGTGTCTGGATAGTAGGTGTAACTACCACCATCACT 5 AATTTC (Base 337-236); SEQ ID NO:49: CTAAAGGTGAATCCGCTAGCTGCACAGGAGAGTCTCAGGGA CCCCCCAGGCTGTACCAAGCCTCCCCCAGACTCGAGCAGCTGCACCTCCCCGTAG GCACC (Base 177-77). These primers are annealed together and DNA is 10 filled in using Tag polymerase, followed by PCR amplification using the following 51 primer: SEQ ID NO:50: CCGCGAATTCGAGGACGCCAGCAAC and 3' primer: SEQ ID NO:51: CCGCAAGCTTGGGCCCTTGGTACTAGCT. 15 Any errors in the mapped sequence which were inserted by PCR were corrected. In addition, conservative nucleotide replacements were placed in the freunework regions to introduce selected restriction sites suitable for enzymatic cleavage. These alterations in 20 the framework regions are indicated by boxes in the sequences of Figs. 2 [SEQ ID NOS: 5 and 6], 3 [ SEQ ID NOS: 7 and 8], 5 [SEQ ID NOS: 11 and 12] and 6 [SEQ ID NOS: 13 and 14]. Additionally, most murine and human antibodies have a basic residue before CDR3. Because the 25 variable heavy chain of NFS2 has a non-basic residue Ser before CDR3 [SEQ ID NOS: 19-20 and 25 and 26], the acceptor basic residue (Lys) before CDR3 was deleted and replaced with Ser to create heavy chain Pfhzhc2-3. Two synthetic heavy chain variable regions were 30 obtained, namely, Pfhzhc2-3 SEQ ID NOS: 13 and 14, and Pfhzhc2-4 SEQ ID NOS: 11 and 12. These sequences are described in detail in Figs. 5 and 6. Each of these synthetic heavy chain variable regions is characterized by one or two nucleotide, or amino acid, differences. 35 For example, Pfhzhc2-3 [SEQ ID NOS: 13 and 14] has a Ser <VO 94/05690 PCT/US93/08435 39 at position 98; and Pfhzhc2-4 [SEQ ID NOS: 11 and 12] has a Lys at position 98. Otherwise, these heavy chain variable regions are identical. For a suitable light chain variable freunework 5 region, the NFS2 light chain CDRs and the light chain variable framework sequence of the human antibody identified in H. G. Klobeck gt al., Nucl. Acids Res.. 12.: 6515-6529 (1985) were used to make a suitable synthetic light chain sequence by the same methods. The 10 oligonucleotides used were as follows. SEQ ID NO:52: TAAGCGGAATTCGTAGTCGGATATCGTGATGACCCAGTC TCCAGACTCGCTAGCTGTGTCTCTGGGCGAGAGGGC (Base 1-75); SEQ ID NO:53: TTACTTGGCCTGGTATCAGCAGAAACCCGGGCAGTCTCC TAAGTTGCTCATAGTTTTCTTAATGAACCGGACTTACTGGGCGTCAACTAG (Base 15 130-198); SEQ ID NO:54: GACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAA GATGTGGCAGTATACTACTGCTGTCTAAAGTGTCAGCAATATTATAGCTATCC (Base 241-321); SEQ ID NO: 55: CAGTTGGAAAGCTTGGCGCCGCCACAGTACGTTTGATCTCCA 20 CCTTGGTCCCTCCGCCGAACGTCCGCGGATAGCTATAATATTGC (Base 389-304); SEQ ID NO:56: GTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGG TCAGGTACCCC&GATTCCCTAGTTGACGCC (Base 252-187) ; SEQ ID NO: 57: CAGGCCAAGTAATTCTTTTGATTGCTCGAGTATAAA 25 AGGCTCTGAGAGCTCTTGCAGTTGATGGTGGCCCTCTCGCCC (Base 141-64) . As described above, the primers were annealed together and DNA filled in using Taq polymerase, followed by PCR amplifcation with the following 5' SEQ ID NO:58: GCGGAATTCGTAGTCGGATATCGTGATGAC and 3' SEQ ID NO:59: 30 TGGAAAGCTTGGCGCCGCCACAGTACGTTTGATC primers. Two synthetic light chain variable sequences containing the NFS2 CDRs were designed and synthesized as described above for the synthetic heavy chains and referred to as Pfhzlcl-1 SEQ ID NOS: 5 and 6, and ®tVO 94/05690 \ PCT/US93/08435 40 Pfhzlcl-2 SEQ ID NOS: 7 and 8. These two sequences differed in amino acid sequence at only one amino acid position, 49. Pfhzlcl-1 [SEQ ID NOS: 5 and 6] has a Ser at position 49; Pfhzlcl-2 [SEQ ID NOS: 7 and 8] has a Pro 5 at the same position. These synthetic variable light and/or heavy chain sequences are employed in the construction of an exemplary humanized antibody. It is expected that any of the synthetic heavy chains will successfully associate 10 with any of the synthetic light chains to produce a useful humanized antibody. To produce a humanized antibody, for the heavy chain variable sequence Pfhzhc2-3 [SEQ ID NO: 13 and 14] (Fig. 6), the following signal sequence was synthesized 15 onto this variable region: SEQ ID NOS: 60: ATGGTGTTGCAG ACCCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGCCTAC, Which encodes SEQ ID N0:61r HetValLeuGlnThrGlnValPhelleSerLeu LeuLeuTrpIleSerGlyAlaTyr. For the synthetic light chain variable sequence Pfhzlcl-1 [SEQ ID NO: 5 and 6] (Fig. 20 2) , the construct is digested with EcoRI and EcoRV, and the same signal sequence was ligated onto the variable sequence. Other signal sequences are well known to those of skill in the art and may be substituted for this exemplary sequence. 25 Selected constant regions of the human IgGx antibodies selected for the heavy and light chain were synthesized and confirmed by PCR. These constant region sequences were then inserted into pUC19-based expression vectors. The above-described synthetic variable 30 constructs, containing the signal and variable regions of the light and heavy chains, were thereafter inserted into these pUC19-based expression vectors containing CMV promoters and the constant regions and fused in frame to the previously inserted human heavy and light chain ®WO 94/05690 PCT/US93/08435 41 constant regions by conventional methods [Maniatis al.. cited above]. Thus, after insertion of the synthetic variable regions into these expression vectors, the plasmids shown in Figs. 7 and 8, resulted. These 5 plasmids were then co-transfected into a selected host cell and, following incubation, the media was assayed for antibody activity via ELISA as described in Example 4 below. Using similar techniques, another exemplary 10 humanized antibody is constructed using the synthesized heavy chain sequence Pfhzhc2-3 [SEQ ID NO:13 and 14] (Fig. 6) and the synthetic light chain sequence Pfhzlcl-2 [SEQ ID NO:7 and 8]. Example 4 - A High Affinity Humanized Antibody 15 The amino acid differences in the variable regions of the frameworks of the original murine antibody NSF2 described in Examples 1 and 2 and the Pfhzhc2.3 were determined, and several changes were made to increase the level of conservation of the original antibody 20 conformation. At amino acid position 49, the Ser of the humanized heavy chain Pfhzhc2.3 was changed to Ala, which is the amino acid found at this position in the native murine NSF2. The replacement employed conventional 25 genetic engineering technology, e.g., by making a synthetic DNA fragment containing the appropriate nucleotide changes to alter the amino acid. A fragment of Pfhzhc2.3 was digested with Xbal and EcoRV and the synthetic fragment bearing the nucleotide change encoding 30 Ala in place of a Ser codon, is inserted to make the amino acid replacement. The resulting synthetic heavy chain was termed Ffhzhc2.6. This synthetic heavy chain was expressed as previously described for the Pfhzhc2.3 synthetic heavy ®wo 94/05690 PCT/US93/08435 * 42 chain. The expression plasmid for this humanized heavy chain sequence is essentially identical to the expression plasmid illustrated in Fig. 7, with the exception of the single amino acid difference described previously. 5 Similarly, humanized antibodies consisting of the Pfhzhc2.6 heavy chain and Pfhzlcl.l light chain and the Pfhzhc2.6 heavy chain and the Pfhzlcl.2 light chain were assembled via co-transfection of mammalian cells and assayed for antibody activity by ELISA, as described in 10 Example 5 below. Other high affinity antibodies specific for P. falciparum can be developed using a similar method designed to achieve minimal variable region framework modifications. The method involves the following order 15 of steps of alteration and testing: (1) In addition to the alteration at amino acid position 49, other individual framework amino acid residues known to be critical for interaction with CDRs are compared in the primary antibody and the engineered 20 CDR-replacement antibody. For example, heavy chain amino acid residue (Kabat numbering; see Kabat fit al*, cited above) is compared in the primary (donor) and engineered antibodies. A residue at this position is thought to interact with the invariant heavy chain CDR residue at 25 position 94 (Lys-basic) via a salt bridge. If an amino acid is in the framework of the donor antibody but not in the freunework of the engineered antibody, then an alternative heavy chain gene comprising the engineered antibody is produced. In the reverse 30 situation whereby the engineered antibody framework comprises a residue at one position but the donor antibody does not, then an alternative heavy chain gene comprising the original amino acid at that position is reproduced. Prior to any further analysis, alternative 94/05690 PCT/US93/08435 43 plasmids produced on this basis are tested for production of high affinity engineered antibodies. (2) Framework amino acids within four residues of the CDRs as defined according to Kabat (see Kabat e£ 5 al*/ cited above) are compared in the primary antibody and engineered CDR-replacement antibody. Where differences are present, then for each region the specific amino acids of that region are substituted for those in the corresponding region of the engineered 10 antibody to provide a small number of engineered genes. Alternative plasmids produced on this basis are then tested for production of high affinity antibodies. (3) Framework residues in the primary and engineered CDR-replacement antibodies are compared and 15 residues with major differences in charge, size or hydrophobicity are highlighted. Alternative plasmids are produced on this basis with the individual highlighted amino acids represented by the corresponding amino acids of the primary antibody and such alternative plasmids are t 20 tested for production of high affinity antibodies. Example 5: ELISA Assays Expression of the synthetic heavy chain and light chain sequences were tested by transiently transfecting the plasmid DNAs into monkey COS cells. The 25 following results are reported for Pfhzhc2-3 and Pfhzlcl-1. Ten micrograms of the plasmids are mixed together and ethanol precipitated. The DNAs are dissolved in Tris buffered saline (TBS) and mixed with DEAE-dextran (400 Hg/Ta.1 final concentration)/chloroquine (0.1 mm), added to 30 3-4 x 105 COS cells grown in T25 flask, incubated for 4 hours at 37 °C. Cells were shocked with 10% DMSO in phosphate buffered saline (PBS) for 1-2 minutes and after washing with PBS, cells were incubated in the presence of serum free growth medium. Media were collected 72 hours rO 94/05690 PCT/US93/08435 , 44 post transfection (day 3 sample) and fresh media were added which were collected 120 hours post transfection (referred to as day 5 sample). To compare the binding affinity of various 5 antibodies, i.e., chimeric and humanized, large scale COS transfections were performed as described above. For each antibody, 200 /ig heavy chain plasmid and 200 fig light chain plasmid DNAs were used to transfect a total of 2.5 x 107 COS cells. The media collected (day 3 and 10 day 5) were pooled, assayed for antibody expression using Fc capture ELISA. The media were concentrated using Amicon to 6 ml. Amount of antibody in the pooled media varied from 9 mg/ml to 25 mg/ml. These concentrated samples were used to compare binding affinities via the 15 ISI and ILSDA assays.- The presence of humanized antibody in the medium of wells containing transfected clones is measured by conventional ELISA techniques. Micro-titer plates are coated overnight at 4°C with goat anti-human IgG (Fc 20 specific) antibodies [Sigma, St. Louis, MO] at 0.1 ng per well. After washing with PBS (pH 7.5), 50 nl of culture medium from the wells containing transfectants is added to each microtitre well for 2 hours at room temperature. The wells are then emptied, washed with PBS and 25 peroxidase-conjugated goat anti-human IgG antibodies [BioRad, Richmond, CA] are added at 50 fxL of a 1/1000 dilution per well. Plates are then incubated at room temperature for 1 hour. The wells are then emptied and washed with PBS. 100 nl 2.2'-azino-di[3-ethyl-30 benzthiazoline sulfonate(6)] are added per well. Reactions were allowed to continue for 1 hour at room temperature. The absorbance at 405 nm is then measured spectrophotometrically. The ability of the humanized antibody in the medium of wells containing transfected 35 clones to bind P. falciparum circumsporozoite protein was ®tvo 94/05690 PCT/US93/08435 45 measured by ELISA. Microtiter plates were coated overnight at 4°C with E. coli-produced R32tet32 at 0.1 jug per well. After washing with PBS, 50 nl of culture medium from the wells which contain transfectants is 5 added to each microtiter well for 2 hours at room temperature. The wells are then emptied, washed with PBS and peroxidase-conjugated goat anti-human IgG antibodies [BioRad, Richmond, CA] are added at 50 mL of a 1/1000 dilution per well. Plates are then incubated at room 10 temperature for 1 hour. The wells are then emptied and washed with PBS. 100 pi 2.2 '-azino-di[3-ethyl-benzthiazoline sulfonate(6) ] are added per well. Reactions were allowed to continue for 1 hour at room temperature. The absorbance at 405 nm is then measured 15 spectrophotometrically. In preliminary studies, an increase in affinity was observed for the humanized antibodies of Example 4, which contained the Pfhzhc2-6 heavy chain construct, as compared to the Pfhzhc2-3 heavy chain construct. 20 Example 6 - Construction of Chimeric Antibody A chimeric antibody of the invention was constructed essentially as described above. A chimeric antibody contains the native murine NSF2 variable framework and CDR regions on the human constant regions 25 selected for the heavy chain [H. Dersimonian gfc al., J. Immunol.. 139:2496-2501 (1987) and light chain [Klobeck Sfc-al., NUClr Acids, Res,, Us6515-6529 (1985)], with the exception that the variable regions were obtained by PCR of the RNA of the murine antibody obtained from the NFS2 30 hybridoma and the entire constant regions of the human IgG-L antibodies were synthesized by overlapping oligonucleotides and amplified by PCR. Any errors which were inserted by PCR were corrected. The resulting WO 94/05690 PCT/US93/08435i 46 chimeric heavy chain and chimeric light chain were expressed as described above for the humanized antibody. This chimeric antibody is advantageous in that it is characterized by activity substantially identical 5 to that of the native murine antibody, but contains enough human sequences that it is anticipated to be useful in human therapy. Example 7 - isi Assay The Inhibition of Sporozoite Invasion assay is 10 performed as described in M. R. Hollingdale et sJL., J. Immunol.. 132:909-913 (1984) to be used to assess neutralizing effect against live P. falciparum sporozoites. In the ISI assay, the human hepatoma cloned cell line HepG2-A162 was grown to near confluency on 1% 15 C02 glass cover slips in HEM and 10% bovine fetal serum. Antisera or purified antibodies were diluted in culture medium (see table below) and added to the cell cultures. 30,000 P.. falciparum sporozoites isolated from dissected moig^uito salivary glands are counted, diluted and added 20 to each cell culture. The cultures are incubated at 37°C for 2.5 hours, rinsed with PES, and fixed with methanol. Fixed cultures are reacted in an immunoperoxidase antibody assay using a labelled mAb which recognizes the P. falcipsirum CS protein to visualize invaded 25 sporozoites. Then, the number of invading sporozoites are counted by phase microscopy at 400x. The ISI is the percent reduction in invasion in the presence of the test antibody, the humanized antibody, as compared to a control (i.e. non-related) antibody. The assay ranks 30 antibodies in order according to their relative potency. The following table provides the results performed on the chimeric and synthetic antibodies described previously. Values given are percent inhibition and are the average of 2-3 independent assays. 94/05690 PCT/US93/08435 47 flWDT^rV nf T-?I Studies In /ig/ml: 20. _3JL_ 5^0 2^0 i^o £LJL Chimeric 99 98.5 98 88 83 50 5 PfHzhc2-3/lcl-l 92 75.5 60 PfHzhc2-3/lcl-2 85 80.0 0 PfHzhc2-6/ld-l 90.0 75 53 0 PfHzhc2—6/lcl-2 87.0 65 1)0 0 10 Numerous modifications and variations of the present invention are included in the above-identified specification and are expected to be obvious to one of skill in the art. For example, recombinant antibodies capable of neutralizing pathogens other than P. 15 falciparum may be provided according to the teachings of this invention for the development of prophylactic agents capable of conferring passive immunity to other human diseases. Preferably, engineered antibodies capable of recognizing repeat regions on other malaria pathogens or 20 engineered antibodies to any region on the surface of any stages of the life-cycle of the Plasmodium species or capable of neutralizing any stage in the life cycle of the parasite, are desirable starting materials to develop passive immunity agents according to this invention. 25 Such modifications and alterations to the compositions and processes of the present invention are believed to be encompassed in the scope of the claims appended hereto. WO 94/05690 PCT/US93/08435 25 62 3 48 SEQUENCE LISTING (1) GENERAL INFORMATION: (i) APPLICANT: SmithKline Beecham, Corporation U. S. Government, Secretary of the Navy u. s. Government, secretary of the Army (ii) TITLE OF INVENTION: Novel Antibodies for Conferring Passive Immunity Against Infection by a Pathogen in Man (iii) NUMBER OF SEQUENCES: 61 (iv) CORRESPONDENCE ADDRESS: (A) ADDRESSEE: Howson and Howson (B) STREET: Box 457, 321 Norristown Road (C) CITY: Spring House (D) STATE: PA (E) COUNTRY: USA (F) ZIP: 19477 (v) COMPUTER READABLE FORM: (A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA: (A) APPLICATION NUMBER: (B) FILING DATE: (C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA: (A) APPLICATION NUMBER: US 07/941,654 (B) FILING DATE: 09-SEP-1992 WO 94/05690 PCT/US93/08435 49 (2) INFORMATION FOR SEQ ID NO:l: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 164 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn 15 10 15 Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala 20 25 30 Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn 35 40 45 Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro 50 55 60 Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn 65 70 75 Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala 80 85 90 Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn 95 100 105 Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro 110 115 120 Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn 125 130 135 Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Val 140 145 150 Asp Pro Asn Val Asp Pro Asn Val Asp Pro Asn Val Asp Pro 155 160 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 163 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown WO 94/05690 PCT/US93/08435 50 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Met Asp Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro 15 10 15 Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn 20 25 30 Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala 35 40 45 Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn 50 55 60 Ala Asn Pro Asn Val Asp Pro Asn Ala Asn Pro Asn Ala Asn Pro 65 70 75 Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn 80 85 90 Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala 95 100 105 Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn 110 115 120 Ala Asn Pro Asn Ala Asn Pro Asn Val Asp Pro Leu Arg Arg Thr 125 130 135 His Arg Gly Arg His His Arg Arg His Arg Cys Gly Cys Trp Arg 140 145 150 Leu Tyr Arg Arg His His Arg Trp Gly Arg Ser Gly Ser 155 160 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 339 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..339 WO 94/05690 PCT/US93/08435 51 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: GAT ATT CAG CTG ACC CAG TCT CCA TCC TCC CTA GCT GTG TCA 42 Asp lie Gin Leu Thr Gin Ser Pro Ser Ser Leu Ala Val Ser 15 10 GTT GGA GAG AAG GTT ACT ATG AGC TGC AAG TCC AGT CAG AGC 84 Val Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gin Ser 15 20 25 CTT TTA TAT AGT AGC AAT CAA AAG AAT TAC TTG GCC TGG TAC 126 Leu Leu Tyr Ser Ser Asn Gin Lys Asn Tyr Leu Ala Trp Tyr 30 35 40 CAG CAG AAA CCA GGG CAG TCT CCT AAA CTG CTG ATT TAC TGG 168 Gin Gin Lys Pro Gly Gin Ser Pro Lys Leu Leu lie Tyr Trp 45 50 55 GCA TCC ACT AGG GAA TCT GGG GTC CCT GAT CGC TTC ACA GGC 210 Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly 60 65 70 AGA GGA TCC GGG ACA GAT TTC ACT CTC ACC ATC AGC AGT GTG 252 Arg Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Val 75 80 AAG GCT GAA GAC CTG GCA GTT TAT TAC TGT CAG CAA TAT TAT 294 Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gin Gin Tyr Tyr 85 90 95 AGC TAT CCT CGG ACG TTC GGf GGA GGG ACC AAG CTG GAG ATC 336 Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu lie 100 105 110 AAA 339 Lys (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 113 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Asp lie Gin Leu Thr Gin Ser Pro Ser Ser Leu Ala Val Ser Val 1 5 10 15 WO 94/05690 PCT/US93/08435 Gly Glu Lys Val Tyr Ser Ser Asn Pro Gly Gin Ser Glu Ser Gly Val Asp Phe Thr Leu Val Tyr Tyr Cys Gly Gly Thr Lys Thr Met Ser 20 Gin Lys Asn 35 Pro Lys Leu 50 Pro Asp Arg 65 Thr lie Ser 80 Gin Gin Tyr 95 Leu Glu lie 110 52 Cys Lys Tyr Leu Leu lie Phe Thr Ser Val Tyr Ser Lys Ser Ser Gin Ser 25 Ala Trp Tyr Gin 40 Tyr Trp Ala Ser 55 Gly Arg Gly Ser 70 Lys Ala Glu Asp 85 Tyr Pro Arg Thr 100 Leu Leu 30 Gin Lys 45 Thr Arg 60 Gly Thr 75 Leu Ala 90 Phe Gly 105 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 339 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..339 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GAT ATC GTG ATG ACC CAG TCT CCA GAC TCG CTA GCT GTG TCT 42 Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser 15 10 CTG GGC GAG AGG GCC ACC ATC AAC TGC AAG AGC TCT CAG AGC 84 Leu Gly Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser 15 20 25 CTT TTA TAC TCG AGC AAT CAA AAG AAT TAC TTG GCC TGG TAT 126 Leu Leu Tyr Ser Ser Asn Gin Lys Asn Tyr Leu Ala Trp Tyr 30 35 40 WO 94/05690 PCT/US93/08435 53 CAG CAG AAA CCC GGG CAG TCT CCT AAG TTG CTC ATT TAC TGG 168 Gin Gin Lys Pro Gly Gin Ser Pro Lys Leu Leu lie Tyr Trp 45 50 55 i GCG TCA ACT AGG GAA TCT GGG GTA CCT GAC CGA TTC AGT GGC 210 Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly 60 65 70 AGC GGG TCT GGG ACA GAT TTC ACT CTC ACC ATC AGC AGC CTG 252 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu 75 80 CAG GCT GAA GAT GTG GCA GTA TAC TAC TGT CAG CAA TAT TAT 294 Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin Tyr Tyr 85 90 95 AGC TAT CCG CGG ACG TTC GGC GGA GGG ACC AAG GTG GAG ATC 336 Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu lie 100 105 110 AAA 339 Lys (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 113 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear « (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu 1 5 10 15 Gly Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser Leu Leu 20 25 30 Tyr Ser Ser Asn Gin Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys 35 40 45 Pro Gly Gin Ser Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg 50 55 60 Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr 65 70 75 WO 94/05690 PCT/US93/08435 • 54 Asp Phe Thr Leu Thr lie Ser Ser Leu Gin Ala Glu Asp Val Ala 80 85 90 Val Tyr Tyr Cys Gin Gin Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly 95 100 105 Gly Gly Thr Lys Val Glu lie Lys 110 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 339 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..339 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GAT ATC GTG ATG ACC CAG TCT CCA GAC TCG CTA GCT GTG TCT 42 Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser 1 5 10 CTG GGC GAG AGG GCC ACC ATC' AAC TGC AAG AGC TCT CAG AGC 84 Leu Gly Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser 15 20 25 CTT TTA TAC TCG AGC AAT CAA AAG AAT TAC TTG GCC TGG TAT 126 Leu Leu Tyr Ser Ser Asn Gin Lys Asn Tyr Leu Ala Trp Tyr 30 35 40 CAG CAG AAA CCC GGG CAG CCT CCT AAG TTG CTC ATT TAC TGG 168 Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu lie Tyr Trp 45 50 55 GCG TCG ACT AGG GAA TCT GGG GTA CCT GAC CGA TTC AGT GGC 210 Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly 60 65 70 AGC GGG TCT GGG ACA GAT TTC ACT CTC ACC ATC AGC AGC CTG 252 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr lie Ser Ser Leu 75 80 ^VVO 94/05690 PCT/US93/08435 55 CAG GCT GAA GAT GTG GCA GTA TAC TAC TGT CAG CAA TAT TAT 294 Gin Ala Glu Asp Val Ala Val Tyr Tyr Cys Gin Gin Tyr Tyr 85 90 95 AGC TAT CCG CGG ACG TTC GGC GGA GGG ACC AAG GTG GAG ATC 336 Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu lie 100 105 110 AAA. 339 Lys (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 113 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: Asp lie Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser Leu 1 5 10 15 Gly Glu Arg Ala Thr lie Asn Cys Lys Ser Ser Gin Ser Leu Leu 20 25 30 Tyr Ser Ser Asn Gin Lys Asn Tyr Leu Ala Trp Tyr Gin Gin Lys 35 40 45 Pro Gly Gin Pro Pro Lys Leu Leu lie Tyr Trp Ala Ser Thr Arg 50 55 60 Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr 65 70 75 Asp Phe Thr Leu Thr lie Ser Ser Leu Gin Ala Glu Asp Val Ala 80 85 90 Val Tyr Tyr Cys Gin Gin Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly 95 100 105 Gly Gly Thr Lys Val Glu lie Lys 110 WO 94/05690 PCT/US93/08435 . 9 56 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 354 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..354 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: CTC GAG TCT GGG GGA GGC TTA GTG AAG CCT GGA GGG TCC CTG Leu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu 15 10 42 AAA ATC TCC TGC GCA GCC TCT GGA TTC ACT TTC AGT AGC TAT Lys lie Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 15 20 25 84 GCC ATG TCT TGG GTT CGC CAG TCT CCA GAG AAG AGG CTG GAG Ala Met Ser Trp Val Arg Gin Ser Pro Glu Lys Arg Leu Glu 30 35 40 126 TGG GTC GCA GAA ATT AGT GAT GGT GGT AGT TAC ACC TAC TAT Trp Val Ala Glu lie Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr 45 50 55 168 CCA GAC ACT GTG ACG GGC CGA TTC ACC ATC TCC AGA GAC AAT Pro Asp Thr Val Thr Gly Arg Phe Thr lie Ser Arg Asp Asn 60 65 70 210 GCC AAG AAC ACC CTA TAC CTG GAA ATG AGC AGT CTG AGG TCT Ala Lys Asn Thr Leu Tyr Leu Glu Met Ser Ser Leu Arg Ser 75 80 252 GAG GAC ACG GCC ATG TAT TAC TGT GCA AGC CTC ATC TAC TAT Glu Asp Thr Ala Met Tyr Tyr Cys Ala Ser Leu lie Tyr Tyr 85 90 95 294 GGT TAC GAC GGG TAT GCT ATG GAC TAC TGG GGT CAA GGA ACC Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp Gly Gin Gly Thr 100 105 110 336 TCA GTC ACC GTC TCC TCA Ser Val Thr Val Ser Ser 115 354 WO 94/05690 PCT/US93/08435 57 (2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 118 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: Leu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Lys 15 10 15 lie Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met 20 25 30 Ser Trp Val Arg Gin Ser Pro Glu Lys Arg Leu Glu Trp Val Ala 35 40 45 Glu lie Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val 50 55 60 Thr Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Asn Thr Leu 65 70 75 Tyr Leu Glu Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr 80 85 90 Tyr Cys Ala Ser Leu lie Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met 95 100 105 Asp Tyr Trp Gly Gin Gly Thr Ser Val Thr Val Ser Ser 110 115 (2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 389 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..366 IWO 94/05690 PCT/US93/08435 , 58 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: GAG GTG CAG CTG CTC GAG TCT GGG GGA GGC TTG GTA CAG CCT 42 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro 15 10 GGG GGG TCC CTG AGA CTC TCC TGT GCA GCT AGC GGA TTC ACC 84 Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 15 20 25 TTT AGC AGC TAT GCC ATG AGC TGG GTC CGC CAG GCT CCA GGG 126 Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly 30 35 40 AAA GGT CTA GAG TGG GTC TCA GAA ATT AGT GAT GGT GGT AGT 168 Lys Gly Leu Glu Trp Val Ser Glu lie Ser Asp Gly Gly Ser 45 50 55 TAC ACC TAC TAT CCA GAC ACT GTG ACG GGC CGG TTC ACG ATA 210 Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr lie 60 65 70 TCC AGA GAC AAT TCC AAG AAC ACG CTG TAT CTG CAA ATG AAC 252 Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 75 80 AGC CTG AGA GCC GAG GAC ACT GCA GTA TAT TAC TGT GCG AAA 294 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys 85 90 95 CTC ATC TAC TAT GGT TAC GAC GGG TAT GCT ATG GAC TAC TGG 336 Leu lie Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp 100 105 110 GGC CAG GGT ACC CTG GTC ACC GTG AGC TCA GCTAGTACCA 376 Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 AGGGCCCAAG CTT 389 (2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein tVO 94/05690 PCT/US93/08435 59 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly 1 5 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ser Glu lie Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr 50 55 60 Pro Asp Thr Val Thr Gly Arg Phe Thr lie Ser Arg Asp Asn Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 80 85 90 Thr Ala Val Tyr Tyr Cys Ala Lys Leu lie Tyr Tyr Gly Tyr Asp 95 100 105 Gly Tyr Ala Met Asp Tyr Trp Gly Gin Gly Thr Leu Val Thr Val 110 115 120 Ser Ser (2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 389 base pairs (B) TYPE: nucleic acid (C) STRANDEDNES3: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..366 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: GAG GTG CAG CTG CTC GAG TCT GGG GGA GGC TTG GTA CAG CCT 42 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro 1 5 10 GGG GGG TCC CTG AGA CTC TCC TGT GCA GCT AGC GGA TTC ACC 84 Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 15 20 25 WO 94/05690 PCT/US93/08435 60 TTT AGC AGC TAT GCC ATG AGC TGG GTC CGC CAG GCT CCA GGG 126 Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly 30 35 .40 AAA GGT CTA GAG TGG GTC TCA GAA ATT AGT GAT GGT GGT AGT 168 Lys Gly Leu Glu Trp Val Ser Glu lie Ser Asp Gly Gly Ser 45 50 55 TAC ACC TAC TAT CCA GAC ACT GTG ACG GGC CGG TTC ACG ATA 210 Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr lie 60 65 70 TCC AGA GAC AAT TCC AAG AAC ACG CTG TAT CTG CAA ATG AAC 252 Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 75 80 AGC CTG AGA GCC GAG GAC ACT GCA GTG TAT TAC TGT GCA TCT 294 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser 85 90 95 CTC ATC TAC TAT GGT TAC GAC GGG TAT GCT ATG GAC TAC TGG 336 Leu lie Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp 100 105 110 GGC CAA GGT ACC CTG GTC ACC GTG AGC TCA GCTAGTACCA 376 Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 AGGGCCCAAG CTT 389 (2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14: Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly 15 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu 35 40 45 iWO 94/05690 PCT/US93/08435 61 Glu Trp Val Ser Glu lie Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr 50 55 60 Pro Asp Thr Val Thr Gly Arg Phe Thr lie Ser Arg Asp Asn Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 80 85 90 Thr Ala Val Tyr Tyr Cys Ala Ser Leu lie Tyr Tyr Gly Tyr Asp 95 100 105 Gly Tyr Ala Met Asp Tyr Trp Gly Gin Gly Thr Leu Val Thr Val 110 115 120 Ser Ser (2) INFORMATION FOR SEQ ID NO:15: (1) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) i (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15: AGCTATGCCA TGAGC 15 (2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16: Ser Tyr Ala Met Ser 1 5 WO 94/05690 PCT/US93/08435 \ ¥ 62 (2) INFORMATION FOR SEQ ID NO: 17: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17: GAAATTAGTG ATGGTGGTAG TTACACCTAC TATCCAGACA CTGTGACGGG C 51 (2) INFORMATION FOR SEQ ID NO: 18: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18: Glu lie Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr 15 10 Val Thr Gly (2) INFORMATION FOR SEQ ID NO: 19: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19: CTCATCTACT ATGGTTACGA CGGGTATGCT ATGGACTAC 39 WO 94/05690 PCT/US93/08435 0 63 (2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:20: Leu lie Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr 15 10 (2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21: AAGAGCTCTC AGAGCCTTTT ATACTCGAGC AATCAAAAGA ATTACTTGGC C 51 (2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: Lys Ser Ser Gin Ser Leu Leu Tyr Ser Ser Asn Gin Lys Asn 15 10 Tyr Leu Ala 15 £ WO 94/05690 PCT/US93/08435 ■ 64 (2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:23: TGGGCGTCAA CTAGGGAATC T 21 (2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:24: Trp Ala Ser Thr Arg Glu Ser 1 5 (2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: CAGCAATATT ATAGCTATCC GCGGACG 27 (2) INFORMATION FOR SEQ ID NO:26: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown 0) /VO 94/05690 PCT/US93/08435 65 (ii) MOLECUL3 TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: Gin Gin Tyr Tyr Ser Tyr Pro Arg Thr 1 5 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: Pro Asn Ala Asn Pro Asn 1 5 (2) INFORMATION FOR SEQ ID NO:28: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28: CCAGATGTAA GCTTCAGCTG ACCCAGTCTC CA 32 (2) INFORMATION FOR SEQ ID NO:29: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) WO 94/05690 PCT/US93/08435, 66 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 29: CATCTAGATG GCGCCGCCAC AGTACGTTTG ATCTCCAGCT TGGTCCC 47 (2) INFORMATION FOR SEQ ID NO:30: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 30: GGGGTACCAG GTCCARCTKC TCGAGTCWGG 30 (2) INFORMATION FOR SEQ ID NO: 31: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 31: GCCTGCAGCT AGCTGAGGAG ACGGTGACCG TGGTCCCTTG GCCCCAG 47 (2) INFORMATION FOR SEQ ID NO: 32: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 32: AGCTATGCCA TGTCT 15 WO 94/05690 PCT/US93/08435 67 (2) INFORMATION FOR SEQ ID NO: 33: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:33: Ser Tyr Ala Met Ser 1 5 (2) INFORMATION FOR SEQ ID NO: 34: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:34: AAGTCCAGTC AGAGCCTTTT ATATAGTAGC AATCAAAAGA ATTACTTGGC C 51 (2) INFORMATION FOR SEQ ID NO:35: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35: Lys Ser Ser Gin Ser Leu Leu Tyr Ser Ser Asn Gin Lys Asn 15 10 Tyr Leu Ala 15 Iwo 94/05690 68 (2) INFORMATION FOR SEQ ID NO:36: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36: TGGGCATCCA CTAGGGAATC T (2) INFORMATION FOR SEQ ID NO:37: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:37: Trp Ala Ser Thr Arg Glu Ser 1 5 (2) INFORMATION FOR SEQ ID NO:38: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:38: CAGCAATATT ATAGCTATCC TCGGACG PCT/US93/08435 i 21 WO 94/05690 69 (2) INFORMATION FOR SEQ ID NO:39: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39 Gin Gin Tyr Tyr Ser Tyr Pro Arg Thr 1 5 (2) INFORMATION FOR SEQ ID NO:40: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40 TGGGCGTCGA CTAGGGAATC T (2) INFORMATION FOR SEQ ID NO:41: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:41 Trp Ala Ser Thr Arg Glu Ser l 5 0WO 94/05690 PCT/US93/08435 ■ ¥ 70 (2) INFORMATION FOR SEQ ID NO:42: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 366 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..366 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:42: GAG GTG CAG CTG CTC GAG TCT GGG GGA GGC TTG GTA CAG CCT 42 Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro 1 5 10 GGG GGG TCC CTG AGA CTC TCC TGT GCA GCT AGC GGA TTC ACC 84 Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 15 20 25 TTT AGC AGC TAT GCC ATG AGC TGG GTC CGC CAG GCT CCA GGG 126 Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly 30 35 40 AAA GGT CTA GAG TGG GTC GCA GAG ATC TCT GAT GGT GGT AGT 168 Lys Gly Leu Glu Trp Val Ala Glu lie Ser Asp Gly Gly Ser 45 50 55 TAC ACC TAC TAT CCA GAC ACT GTG ACG GGC CGG TTC ACG ATA 210 Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr lie 60 65 70 TCC AGA GAC AAT TCC AAG AAC ACG CTG TAT CTG CAA ATG AAC 252 Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn 75 80 AGC CTG AGA GCC GAG GAC ACT GCA GTG TAT TAC TGT GCA TCT 294 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser 85 90 95 CTC ATC TAC TAT GGT TAC GAC GGG TAT GCT ATG GAC TAC TGG 336 Leu lie Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp 100 105 110 GGC CAA GGT ACC CTG GTC ACC GTG AGC TCA Gly Gin Gly Thr Leu Val Thr Val Ser Ser 115 120 366 Vo 94/05690 PCT/US93/08435 71 (2) INFORMATION FOR SEQ ID NO:43: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43: Glu Val Gin Leu Leu Glu Ser Gly Gly Gly Leu Val Gin Pro Gly 15 10 15 Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser 20 25 30 Ser Tyr Ala Met Ser Trp Val Arg Gin Ala Pro Gly Lys Gly Leu 35 40 45 Glu Trp Val Ala Glu lie Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr 50 55 60 Pro Asp Thr Val Thr Gly Arg Phe Thr lie Ser Arg Asp Asn Ser 65 70 75 Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser Leu Arg Ala Glu Asp 80 • 85 90 Thr Ala Val Tyr Tyr Cys Ala Ser Leu lie Tyr Tyr Gly Tyr Asp 95 100 105 Gly Tyr Ala Met Asp Tyr Trp Gly Gin Gly Thr Leu Val Thr Val 110 115 120 Ser Ser (2) INFORMATION FOR SEQ ID NO: 44: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 97 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) WO 94/05690 PCT/US93/08435 72 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:44: TAGTGAAGAA TTCGAGGACG CCAGCAACAT GGTGTTGCAG ACCCAGGTCT 50 TCATTTCTCT GTTGCTCTGG ATCTCTGGTG CCTACGGGGA GGTGCAG 97 (2) INFORMATION FOR SEQ ID NO:45: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 164 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:45: GCTAGCGGAT TCACCTTTAG CAGCCATGTC GGACCCCCCA GGGACTCTGA 50 GAGGACACGT CGATCGCCTA AGTGGAAATC CTATGCCATG AGCTGGGTCC 100 GCCAGGCTCC AGGGAAAGGT CTAGAGTGGG TCTCAGAAAT CTTTATAGTG 150 ATGGTGGTAG TTAC 164 (2) INFORMATION FOR SEQ ID NO:46: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 164 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:46: GAACACGCTG TATCTGCAAA TGAACAGCCT GAGAGCCGAG GACACGTCTC 50 TGTTAAGGTT CTTGTGCGAC ATAGACGTTT ACTGCAGTAT ATTACTGTGC 100 GAAACTCATC TACTATGGTT ACGACGGGTA TGCTATGGAC TAGCTGCCCA 150 TACGATACCT GATC 164 £ \VO 94/05690 PCT/US93/08435 73 (2) INFORMATION FOR SEQ ID NO:47: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 85 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47: TTCTTGAAAG CTTGGGCCCT TGGTACTAGC TGAGCTCACG GTGACCAGGG 50 TACCCTGGCC CCAGTAGTCC ATAGCATACC CGTCG 85 (2) INFORMATION FOR SEQ ID NO:48: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 102 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48: CATTTGCAGA TACAGCGTGT TCTTGGAATT GTCTCTGGAT ATCGTGAACC 50 GGCCCGTCAC AGTGTCTGGA TAGTAGGTGT AACTACCACC ATCACTAATT TC 102 (2) INFORMATION FOR SEQ ID NO:49: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 101 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49: CTAAAGGTGA ATCCGCTAGC TGCACAGGAG AGTCTCAGGG ACCCCCCAGG 50 CTGTACCAAG CCTCCCCCAG ACTCGAGCAG CTGCACCTCC CCGTAGGCAC C 101 |W0 94/05690 PCT/US93/08435 ; 74 (2) INFORMATION FOR SEQ ID NO:50: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50: CCGCGAATTC GAGGACGCCA GCAAC 25 (2) INFORMATION FOR SEQ ID NO:51: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:51: CCGCAAGCTT GGGCCCTTGG TACTAGCT 28 (2) INFORMATION FOR SEQ ID NO:52: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 75 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52: TAAGCGGAAT TCGTAGTCGG ATATCGTGAT GACCCAGTCT CCAGACTCGC 50 TAGCTGTGTC TCTGGGCGAG AGGGC 75 JlVO 94/05690 PCT/US93/08435 75 (2) INFORMATION FOR SEQ ID NOS53: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 90 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53: TTACTTGGCC TGGTATCAGC AGAAACCCGG GCAGTCTCCT AAGTTGCTCA 50 TAGTTTTCTT AATGAACCGG ACTTACTGGG CGTCAACTAG 90 (2) INFORMATION FOR SEQ ID NO:54: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 93 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:54: GACAGATTTC ACTCTCACCA TCAGCAGCCT GCAGGCTGAA GATGTGGCAG 50 TATACTACTG CTGTCTAAAG TGTCAGCAAT ATTATAGCTA TCC 93 (2) INFORMATION FOR SEQ ID NO:55: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 86 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) WO 94/05690 PCT/US93/08435 ; 76 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 55: CAGTTGGAAA GCTTGGCGCC GCCACAGTAC GTTTGATCTC CACOTTOSO'C 50 CCTCCGCCGA ACGTCCGCGG ATAGCTATAA TATTGC 86 (2) INFORMATION FOR SEQ ID NO: 56: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 66 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56: GTGAAATCTG TCCCAGACCC GCTGCCACTG AATCGGTCAG GTACCCCAGA 50 TTCCCTAGTT GACGCC 66 (2) INFORMATION FOR SEQ ID NO:57: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 78 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57: CAGGCCAAGT AATTCTTTTG ATTGCTCGAG TATAAAAGGC TCTGAGAGCT 50 CTTGCAGTTG ATGGTGGCCC TCTCGCCC 78 (2) INFORMATION FOR SEQ ID NO: 58: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown Vo 94/05690 PCT/US93/08435 77 (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58: GCGGAATTCG TAGTCGGATA TCGTGATGAC 30 (2) INFORMATION FOR SEQ ID NO:59: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:59: TGGAAAGCTT GGCGCCGCCA CAGTACGTTT GATC 34 (2) INFORMATION FOR SEQ ID NO:60: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..57 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 60: ATG GTG TTG CAG ACC CAG GTC TTC ATT TCT CTG TTG CTC TGG 42 Met Val Leu Gin Thr Gin Val Phe lie Ser Leu Leu Leu Trp 1 5 10 ATC TCT GGT GCC TAC lie Ser Gly Ala Tyr 15 57 WO 94/05690 PCT/US93/08435 i 78 (2) INFORMATION FOR SEQ ID NO:61: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 61: Met Val Leu Gin Thr Gin Val Phe lie Ser Leu Leu Leu Trp lie 15 10 15 Ser Gly Ala Tyr </div>

Claims

<div class="application article clearfix printTableText" id="claims"> WO 94/05690 PCT/US93/08435 WHAT IS CLAIMED IS:

1. A fusion molecule comprising a first fusion partner nucleotide sequence encoding an amino acid sequence having the antigen specificity of a anti-Plasmodium antibody, operatively linked in frame to a second fusion partner nucleotide sequence.

2. The molecule according to claim 1 wherein said first fusion partner is a synthetic immunoglobulin variable region nucleotide sequence encoding an amino acid sequence comprising a complementarity determining region originating from a Plasmodium antibody, a fragment or allelic variation or modification thereof.

3. The molecule according to claim 2 wherein said second fusion partner is a heterologous immunoglobulin variable framework region.

4. The molecule according to claim 2 wherein said variable region nucleotide sequence is selected from the group consisting of a heavy chain variable region and a light chain variable region. 25 6,2 3 2

5. The molecule according to claim 4 selected from the group consisting of (a) a heavy chain nucleotide sequence of Fig. 5 (SEQ ID NO: 11); (b) a heavy chain nucleotide sequence of Fig. 6 (SEQ ID NO: 13); (c) a light chain nucleotide sequence of Fig. 2 (SEQ ID NO: 5) and Fig. 3 (SEQ ID NO: 7). (d) a light chain nucleotide sequence of Fig. 3 (SEQ ID NO: 7); and (e) functional fragments thereof. WO 94/05690 \ PCT/US93/08435 * 256 2 3 2 80

6. The molecule according to claim 4 wherein said first fusion partner nucleotide sequence comprises a sequence selected from the group consisting of (a) AGCTATGCCATGAGC: SEQ ID NO: 15; (b) GAAATTAGTGATGGTGGTAGTTACACCTACTATCCA GACACTGTGACGGGC: SEQ ID NO: 17; ( c ) CTCATCTACTATGGTTACGACGGGTATGCTATGGAC TAC: SEQ ID NO: 19; (d) AAGAGCTCTCAGAGCCTTTTATACTCGAGCAATCAA AAGAATTACTTGGCC: SEQ ID NO: 21; (e) TGGGCGTCAACTAGGGAATCT: SEQ ID NO: 23; (f) CAGCAATATTATAGCTATCCGCGGACG: SEQ ID NO: 25; (g) AGCTATGCCATGTCT: SEQ ID NO: 32; (h) AAGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAA AGAATTACTTGGCC: SEQ ID NO: 34; (i) TGGGCATCCACTAGGGAATCT: SEQ ID NO: 36; (j) CAGCAATATTATAGCTATCCTCGGACG: SEQ ID NO: 38; (k) TGGGCGTCGACTAGGGAATCT: SEQ ID NO: 41; and an allelic variation or modification thereof, characterized by the antigen specificity of murine NFS2, said nucleic acid sequence optionally containing restriction sites to facilitate insertion into a desired antibody framework region or a plasmid vector.

7. A synthetic immunoglobulin variable region nucleotide sequence encoding an amino acid sequence comprising a complementarity determining region originating from a Plasmodium antibody, a fragment or allelic variation or modification thereof. too 94/05690 PCT/US93/08435 256 2 32

8. A fusion protein comprising a first amino acid sequence derived from a Plasmodium antibody capable of binding an epitope on a selected Plasmodium species, said sequence having the antigen specificity of said antibody fused to a heterologous second amino acid sequence.

9. The fusion protein according to claim 8 wherein said first amino acid sequence comprises an amino acid sequence selected from the group consisting of: (a) a variable heavy chain sequence of said antibody; (b) a variable light chain sequence of said antibody; (c) a complementarity determining region of said antibody; and (d) a functional fragment of (a) through (c) .

10. The fusion protein according to claim 8 wherein said fusion protein is selected from the group consisting of (a) a complete engineered antibody, having full length heavy and light chains comprising at least fragments of the variable regions derived from said Plasmodium antibody; (b) the Faj, or (F^'Ja fragment of the engineered antibody of (a); (c) a dimer formed of heavy chains derived from the engineered antibody of (a); (d) an Fv fragment of the engineered antibody of (a); and (e) a single-chain antibody derived from the engineered antibody of (a); said protein having the same specificity as said Plasmodium antibody. PCT/US93/08435 ■ 25 6 2 3 2

11. An engineered P. falciparum antibody comprising a heavy chain comprising a complementarity determining region derived from the variable heavy chain region of a non-human P. falciparum monoclonal antibody.

12. The antibody according to claim 11 wherein said non-human CDRs are in operative association with one of the group consisting of (a) a selected human antibody heavy chain framework and constant regions; and (b) the heavy chain freunework from said antibody and a constant region from a selected human antibody.

13. The antibody according to claim 11 further comprising a light chain selected from the group consisting of (a) a light chain comprising a CDR derived from the variable light chain region of said monoclonal antibody in operative association with selected human antibody light chain framework and constant regions; (b) the light chain framework from said antibody and a constant region from a selected human antibody; (c) the complete light chain from said anti-Plasmodium antibody; and (d) the complete light chain from a selected human antibody.

14. The antibody according to claim 11, wherein said heavy chain comprises a variable heavy chain sequence selected from the sequences of Fig. 5 (SEQ ID NO: 12), Fig. 6 (SEQ ID NO: 14), Pfhzhc2-3 (SEQ ID NO:14), and Pfhzhc2-6 (SEQ ID N0:42) . WO 94/05690 ¥ 82 "wo 94/05690 PCT/US93/08435 256232

15. The antibody according to claim 13 wherein said light chain comprises a variable light chain sequence selected from the sequences, of Fig. 2 (SEQ ID NO: 6) and Fig. 3 (SEQ ID NO: 8).

16. The antibody according to claim 13 wherein light chain complementarity determining region is selected from one or more of the sequences consisting of (a) LysSerSerGlnSerLeuLeuTyrSerSerAsn GlnLysAsnTyrLeuAla: SEQ ID NO: 22; (b) TrpAlaSerThrArgGluSer: SEQ ID NO: 24; and (c) GlnGlnTyrTyrSerTyrProArgThr: SEQ ID NO: 26.

17. The antibody according to claim 11 wherein said heavy chain complementarity determining region is selected from one or more of the sequences consisting of (a) SerTyrAlaMetSer: SEQ ID NO: 16; (b) Glull eSer AspGlyG ly Ser Tyr Thr TyrTyrPr o AspThrValThrGly: SEQ ID NO: 18; and (c) Leul leTyrTyrG lyTy r AspG lyTyrAlaMet AspTyr: SEQ ID NO: 20.

18. An anti-P. falciparum complementarity determining region peptide selected from the group consisting of (a) SerTyrAlaMetSer: SEQ ID NO: 16; (b) Glul 1 eS er AspG ly G1 y S er Ty rThrTy r Tyr ProAspThrValThrGly: SEQ ID NO: 18; (c) Leul leTyrTyrG lyTyrAspG lyTyrAlaM et AspTyr: SEQ ID NO: 20; (d) LysSerSerGlnSerLeuLeuTyrSerSerAsn GlnLysAsnTyrLeuAla: SEQ ID NO: 22; ^vo 94/05690 PCT/US93/08435 • 25 6 2 3 84 (e) TrpAlaSerThrArgGluSer: SEQ ID NO: 24; (f) GlnGlnTyrTyrSerTyrProArgThr: SEQ ID NO: 26; and an analog thereof, characterized by the antigen specificity of NFS2.

19. A synthetic immunoglobulin variable chain amino acid sequence comprising a complementarity determining region originating from a Plasmodium antibody in a heterologous variable chain framework, a fragment or analog thereof sharing the anti-Plasmodium antigen specificity of said sequence.

20. The sequence according to claim 19 selected from the group consisting of the amino acid sequences of Fig. .5 (SEQ ID NO: 12), Fig. 6 (SEQ ID NO: 14), Fig. 2 (SEQ ID NO: 6) and Fig. 3 (SEQ ID NO: 8).

21. A monoclonal antibody, other than NFS2, which is capable of binding to a P. falciparum epitope comprising the sequence Pro Asn Ala Asn Pro Asn SEQ ID NO: 27, a Fgi, fragment thereof, or a (Fab')2 fragment thereof.

22. A pharmaceutical prophylactic composition comprising a fusion protein or antibody according to any of claims 8 through 21 and a pharmaceutical ly acceptable carrier or diluent.

23. A pharmaceutical composition according to claim 22 wherein said protein is a humanized P. falciparum antibody. WO 94/05690 PCT/US93/08435 2 5 6 2 3 2

24. A recombinant plasmid comprising a nucleic acid sequence of any of claims 1 through 7 in operative association with a regulatory control sequence capable of directing the replication and expression of said nucleic acid sequence in a selected host cell.

25. A mammalian cell line transfected with at least one recombinant plasmid comprising a nucleic acid sequence of any of claims 1 through 7.

26. A method of producing a engineered antibody comprising culturing a mammalian cell line transfected with at least one recombinant plasmid comprising a nucleic acid sequence of any of claims 1 through 7 under suitable conditions permitting expression and assembly of complementary heavy and light chains, and recovering the assembled antibody from the cell culture.

27. The use of a protein or antibody of claims 8 through 21 in the preparation of a pharmaceutical composition suitable for passively protecting a human against infection by a Plasmodium species. 25 6232

28. A molecule according to any one of claims 1-6, substantially as hereinbefore described with reference to the Examples.

29. A synthetic immunoglobulin variable region nucleotide sequence according to claim 7, substantially as hereinbefore described with reference to the Examples.

30. A fusion protein according to any one of claims 8-10, substantially ar. hereinbefore described with reference to the Examples.

31. An antibody according to any one of claims 11-17, substantially as hereinbefore described with reference to the Examples.

32. A peptide according to claim 18, substantially as hereinbefore described with reference to the Examples.

33. A sequence according to claim 19 or claim 20, substantially as hereinbefore described with reference to the Examples.

34. A monoclonal antibody according to claim 21, substantially as hereinbefore described with reference to the Examples.

35. A pharmaceutical composition comprising a fusion protein, antibody, sequence or peptide according to any one of claims 30-34 and a pharmaceutically acceptable carrier or diluent.

36. A recombinant plasmid comprising a nucleic acid sequence of claim 28 or claim 29.

37. A mammalian ceil line transfeaed with at least one recombinant plasmid comprising a nucleic acid sequence of claim 28 or claim 29.

38. A method according to claim 26, substantially as hereinbef< reference to the Examples. 25 6 23

39. A use of a protein, antibody, sequence or peptide of claims 30-34 in the preparation of a pharmaceutical composition suitable for passively protecting a human against infection by a Plasmodium species. RUSSELL McVEAGH WEST-WALKER by: (kfy ATTORNEYS FOR THE APPLICANT </div>