CA2143417A1 - Novel antibodies for conferring passive immunity against infection by a pathogen in humans - Google Patents

Abstract

Proteins and peptides derived from a murine P. falciparum monoclonal antibody, including synthetic humanized variable light chain and variable heavy chain sequences, CDR peptides, and humanized antibodies useful in therapeutic methods and compositions for conferring passive immunity to infection by a malaria-causing parasite are provided.

Description

~ 9~/0~6~0 PCT/US93/0843~
.

2143~17 NOVEL ANTIBODIES FOR CONFERRING PASSIVE IMMUNITY
AGAINST INFECTION BY A PATHOGEN IN HUMANS

Field of the Invention This invention relates generally to the field of monoclonal and recombinant antibodies directed to epitopes on selected pathogens, e.g., a malaria parasite, methods for preparing and using, and compositions employing, these antibodies.

Backcround of the Invention 1~ Malaria is a severe and widespread disease, caused by various species of the protozoan parasite genus Plasmodlum, including four species that infect man, e.g., P. falciparum, P. ViV2X, P. ovale and P. malariae [See, e.g., V. Enea et al., Science, 225:628-630 (1984) ] .
Malaria remains one of the most widespread and fatal diseases in the world today because of the lac~ of an effective vaccine and programs to control vector populations, as well as new drug-resistant strains.
Generally, treatment of malaria relies heavily on 2 0 prophylactic drugs, such as the 4-aminoquinolines.
However, for most cases, drug resistance by P. falciparllm and the production of some undesirable side effects, have undermined the efficacy of these drug therapies.
The focus of much research effort in the field 25 of malaria prophylaxis is the sporozoite form of the Plasmodlum parasite, particularly the circumsporozoite (CS) protein [Clyde et al., Am. J. Tro~. Med. Hya., 24:397 (1975); Rieckman et al., Bull. WHO, 57(1) :261 (1979); and U. S. Patent 4,957,869]. The cloning and characterization of the CS protein genes or fragments thereof of a number of Plasmodium species and recombinant expression thereof in E. coli or yeast host cells have been reported. The central repeat domain of the CS
proteins is immunodominant, i.e., if one injects W09~/0~690 ~ ~ j PCT/~IS93/08~3' ,-- ~
2143~17 sporozoites into an animal, the animal produces anti-repeat antibodies. The first anti-sporozoite candidate vaccine tested in man was based upon the repetitive epitopes found on the CS protein of P. falciparum consisting of (AsnAlaAsnPro)37(AsnValAspPro)4 tSEQ ID NO:
1], which is invariant in a number of strains examined to date. Clinical trials utilizing a vaccine candidate, called R32tet32, consisting of NH2-Met-Asp-Pro-[(Asn-Ala-Asn-Pro)15(Asn-Val-Asp-Pro)l]2-Leu-Arg-Arg-Thr-His-Arg-Gly-Arg-His-His-Arg-Arg-His-Arg-Cys-Gly-Cys-Trp-Arg-Leu-Tyr-Arg-Arg-His-His-Arg-Trp-Gly-Arg-Ser-Gly-Ser-COOH [SEQ
ID NO: 2], produced a protective response in a human volunteer against the sporozoite challenge [see, Ballou et al., The Lancet, June 6, 1987, pp. 1277-1281; and European Patent Publication No. 0192626, published August 27, 1986, incorporated herein by reference].
Numerous monoclonal antibodies (mAbs) directed toward proteins from various stages of the Pl asmodi~m life cycle have been identified and shown to be effective in passive transfer experiments in mice and monkeys [Y.
Charoenvit et al., J. Immunol., 146(3):1020-1025 (1990)~.
However, the use of antibodies for the treatment or prophylaxis of malaria may have disadvantages. The administration of murine or other animal antibodies to humans may be limited by the adverse immune response of humans to the foreign antibody, e.g., rapid clearance and toxic side effects. Such immune responses in humans have been shown to be directed against both immunoglobulin constant and variable regions of murine antibodies.
Several techniques have been described which suggest alteration of murine (and other species) antibodies to reduce the occurrence of an immune response in a desired species, e.g., human, to the parent antibody tSee, e.g., PCT Patent Publication No. PCT/~086/01533, publisAed March 13, 1986; British Patent Application No.

PCT~US93/~8~3 O W09~/0~690 21~3~17 GB2188638A, published October 7, 1987; Amit et al., Science, 233:747-753 (1986); Queen et al., Proc. Natl.
Acad. Sci. USA, 86:10029-10033 (1989); PCT Patent Publication No. PCT/WO90/07861, published July 26, 1990;
and Riecnmann et al., Nature, 332:323-327 (1988)]. While the prior art suggests possible experimental techniques, none show how to provide the combination of properties required for effective prevention of in viyo growth of P.
fal ciparum .
There remains a need in the art for alternative methods of providing immunity against infection with selected pathogens, e.g., a malarial parasite, particularly for a prophylactic agent capable of providing effective short-term protection.

Summarv of the Invention In one aspect, the present invention provides complementarity determining region (CDR) peptides from a monoclonal antibody directed against a selected epitope on a pathogen, as well as fragments and analogs of these peptides. Preferably, the antibody is capable of binding an epitope of Plasmodium, particularly the CS repeat region epitope or a fragment thereof, e.g., murine anti-P. falciparum mAb NFS2. These CDRs retain the antigen binding specificity of the mAb from which they were derived.
Another aspect provides an isolated, naturally occurring or synthetic, humanized immunoglobulin light or heavy chain variable region amino acid sequence comprising one or more CDR sequences originating from the light or heavy chain of such a selected antibody.
In yet a further aspect, the invention provides a fusion protein comprising a first amino acid sequence derived from the variable light chain and/or heavy chain of an anti-Plasmodium antibody, an anti-Plasmodium CDR, a PCT/US93/0~3' . ~ WO91/0;690 21~3417 functional fragment or analog thereof. The first selected amino acid sequence is operatively linked or fused to a second selected amino acid se~uence. These fusion proteins are characterized by the antigen binding specificity of the mA~ from which the first selected amino acid sequenc~ is derived.
A fur.her aspect of the invention provides an engineered antibody with specificity for the selected Plasmodium epitope, e.g., P. falciparum repeat region.
In another aspect, the invention provides a P.
falcipa~um antibody or fragment thereof produced by screening hybridoma products derived from any species immunoglobulin repertoires, or human or murine antibody combinatorial libraries, with the epitope of mAb NFS2.
In a further aspect, the present invention provides Fab fragments of the above-described engineered antibodies or anti-Pl asmodium mAbs.
As yet additional aspects, the invention provides nucleic acid sequences which encode the proteins, peptides, antibodies and fragments described herein, as well as plasmids con~;n;ng one or more of the sequencPs, host cells transformed therewith, and methods for producing the products of expression of these nucleotide se~uences in host cells, e.g., mammalian cells.
Other aspects provided by the invention include a pharmaceutical composition and a prophylactic method for conferring passive immunity to a human anticipating exposure to a malarial parasite, comprising an effective amount of at least one protein, antibody, peptide or fragment described herein and a pharmaceutically acceptable carrier or diluent.
Other aspects and advantages of the present invention are described further in the following detailed description of preferred embodiments thereof.

' ~'09~/0~6gO PCT/~S93/08~3~
21~3~17 Brief Description of the Drawinqs Fig. 1 illustrates the amino acid SEQ ID NO: 4 and nucleotid~ SEQ ID NO: 3 sequences of the naturally occuLIing light ~hain variable region of mAb NFS2.
Fig. 2 illustrates the amino acid SEQ ID NO: 6 and nucleotide SEQ ID NO: 5 sequences of a synthetic humanized light chain variable region Pfhzlcl-1 containing an~i-Pl asmodium CDRs SEQ ID NOs., 21-26. The CDRs are underlined.
Fig. 3 illustrates the amino acid SEQ ID NO: 8 and nucleotide SEQ ID NO: 7 sequences of synthetic humanized light chain variable region Pfhzlc1-2.
Fig. 4 illustrates the amino acid SEQ ID NO: 10 and nucleotide SEQ ID NO: 9 sequences of the naturally occurring heavy chain variable region of mAb NFS2.
Fig. 5 illustrates the amino acid SEQ ID NO: 12 and nucleotide SEQ ID NO: 11 sequences of a synthetic humanlzed heavy chain variable region Pfhzhc2-4.
Fig. 6 illustrates the amino acid SEQ ID NO: 14 and nucleotide SEQ ID NO: 13 sequences of synthetic humanized heavy chain variable region Pfhzhc2-3.
Fig. 7 is a schematic drawing of plasmid - Pfhzhc2-3-Pcd employed to express a synthetic anti-Pl asmodium heavy chain in m~m~lian cells. The plasmid contains a beta lactamase (Beta-lac), gene, an SV40 origin of r~plication (SV40), a cytomegalovirus promoter sequence (CMV), the synthetic heavy chain Pfhzhc2-3 SEQ
ID NO: 13, a poly A signal from bovine growth hormone (BGH), a betaglobin promoter (beta glopro), a dihydrofolate reductase gene (DHFR), and another BGH
sequence poly A signal in a pUC19 bac~ground.
Fig. 8 is a schematic drawing of plasmid Pfhzlcl-1-Pcn employed to express a synthetic light chain in m~mm~l ian cells. The plasmid differs from that of Fign 7, in that it contains the synthetic humanized light PC~t~,lS93/08135 ' , ~ ~ O94/05690 chain Pfhzlcl-1 SEQ ID NO: 5 rather than the heavy chain, and a neomycin gene (Neo) in place of DHFR.
Fig. 9 illustrates the nucleotide SEQ ID NO: 42 and amino acid SEQ ID NO: 43 sequences of a synthetic humanized heavy chain variable region Pfhzhc2-6.

De~alled Descri~tion of the Invention The present invention provides prophylactic agents capable of conferring a short duration, protective immune state against infection of humans by selected pathogens in the immunized human, e.g., for epidemic control and for use by those anticipating exposure to the pathogen. Recombinant or engineered antibodies, preferably chimeric, humanized or human mcnoclonal antibodies, are capable of use as such passive protective proteins. These proteins in a prophylactic composition may be administered before anticipated exposure to the pathogen and would not require daily regimens of follow-up doses to mediate the short term protection.
While the following description refers specifically to antibodies capable of conferring passive protection to the sporozoite form of the pathogen, P.
falciparum, a causative agent of malaria in humans, the invention described herein is not limited to any particular stage of that pathogen nor to that pathogen alone. The teachings of the present invention permit one skilled in the art to construct other recombinant antibodies directed to other selected pathogens, e.g., other species of Plasmodium, including the blood stages, liver stages, or gametocyte stages. Antibodies of the invention directed against the circumsporozoite CS gene of the other human infective parasites, e.g., P.
malariae, P. vivax and P. ovale, may also be constructed according to this invention to provide passive transfer proteins use~ul against these parasitic infections.

~094/05690 21~3~17 Similarly, passive therapy agents prepared according to the invention may involve other infective agents, viruses, bacteria and the like. Additionally, such antibodies may also be usPful as therapeutic agents for the treatm~nt of acute stages of infections.
I . Defini tions "First fusion partner" refers to a nucleic acid sequence encoding an amino acid sequence, which can be all or part of an immunoglobulin heavy chain, a light chain, functional fragment thereof including the variable region from one or both chains and CDRs therefor, or an analog thereof, having the antigen binding specificity of a selected high titer antibody, preferably the murine antibody, NFS2.
"Second fusion partner" refers to anuther nucleo~ide seauence encoding a protein or peptide to which the first fusion partner is fused in frame or by means or an optional conventional linker sequence~ Such second fusion partner is preferably heterologous to the first fusion partner. A second fusion partner may include a nucleic acid sequence encoding a second antibody region of interest, e.g., all or part of an - appropriate human constant region or framewor~ region.
I'Fusion molecule" refers to the product of a first fusion partner operatively linked to a second fusion partner. "Operative linkage" of the fusion partners is defined as an association which permits expression of the antigen specificity of the anti-P.
falciparum sequence (the first fusion partner) from the donor antibody as well as the desired characteristics of the second fusion partner. For example, a nucleic acid sequence encoding an amino acid linker may be optionally used, or linkage may be via fusion in frame to the second fusion partner.

PCT/US93/08~3' W09~/05690 2143~17 "Fusion protein" refers to the protein encoded by the fusion molecule, which may be obtained by expression of the fusion molecule in a selected host cPll. Such fusion proteins may be engineered antibodies, e.g., chimeric or humanized antibodies, or any of the antibody regions identified herein fused to i~munoglobulin or non-immunoglobulin proteins and the liXe.
"Donor antibody" refers to an antibody (polyclonal, monoclonal or recombinant) which contributes its naturally-occurring or modified variable light and/or heavy chains, variable regions thereof, CDRs thereof or other functional fragments thereof to a first fusion partner, so as to provide the fusion molecule and fusion protein, with the antigenic specificity characteristic of the donor antibody. One donor antibody suitable for use in this invention is murine mAb NFS2 and others are described below.
"Acceptor antibody" refers to an antibody (polyclonal, monoclonal or recombinant) heterologous to the donor antibody, but homologous to the patient (human or other m~mm~l ) to be treated, which contributes all or any portion of the sequences of its variable heavy and/or light chain framework regions and/or its heavy and/or light chain constant regions to a second fusion partner.
Preferably a human antibody is the acceptor antibody.
"CDRs" are defined as the complementarity determining region amino acid sequences of an antibody which are the hypervariable regions of the heavy and light chains. CDRs provide the majority of contact residues for the binding of the an~ibody to the antigen or epitope. CDRs of interest in this invention are derived from donor antibody variable heavy and light chain sequences, and include functional fragments and analogs of the naturally occurring CDRs, which share or PCT/US93/08~3' 0~94/05690 2143~17 retain the same antigen binding specificity as the donor antibody from which they were derived.
By "sharing the antigen binding specificity" it is meant, for example, that although mAb NFS2 may be characterized by a certain level of antigen af~inity, and a CDR encoded by a nucleic acid sequence of NFS2 in an appropriate structural environment may have a lower affinity, it is expected that CDRs of NFS2 in such environments will nevertheless recognize the same epitope(s) as NFS2.
A "functional fragment" is a partial CDR
sequence or partial heavy or light chain variable sequence which retains the same antigen binding specificity as the antibody from which the fragment was derived.
An "analog" is an amino acid or peptide sequence modified by replace~ent of at least one amino acid, modification or chemical substitution of an amino acid, which modification permits the amino acid sequence to retain the biological characteristics, e.g., antigen specificity, of the unmodified sequence.
An "allelic variation or modification" is an - alteration in the nucleic acid sequence encoding the amino acid or peptide sequences of the invention. Such variations or modifications may be due to degeneracies in the genetic code or may be deliberately engineered to provide desired characteristics. These variations or modifications may or may not result in alterations in any encoded amino acid sequence.
An "engineered antibody" is a type of fusion protein, i.e., a synthetic antibody (e.g., a chimeric or humanized antibody) in which a portion of the light and/or heavy chain variable domains of a selected acceptor antibody is replaced by analogous parts of CDRs from one or more donor antibodies which have specificity W094/0;69~ i PCT/~'S93/0~3' for the selected epitope. These engineered antibodies may also be characterized by alteration of the nucleic acid sequences encoding the acceptor antibody light and/o- hea~J ~v-ariable domain framework regions in order to retain donor ar.tibody binding specificity. These antibodies can comprise immunoglobulin constant regions and variable framework regions from the acceptor antibody, and one or more CDRs from the Pl asmodium donor antibodies described herein. Preferably the engineered antibodies of the invention will be produced by recombinant DNA technology.
"Chimeric antibody" refers to a type of engineered antibody which contains naturally-occurring variable region light chain and heavy chains ~both CDR
and framework regions) derived from a non-human donor mAb in association with light and heavy chain constant regions derived from a human (or other heterologous animal) acceptor mAb.
"Humanized antibody" refers to an engineered antibody having its CDRs and/or other portions of its light and/or heavy chain variable domain framework regions derived from a non-human donor immunoglobulin, the remaining immunoglobulin-derived parts of the molecule being derived from one or more human immunoglobulins. Such antibodies can also include engineered antibodies characterized by a humanized heavy chain associated with a donor or acceptor unmodified light chain or a ch; meriC light chain, or vice versa.
"Effector agents" refers to non-protein carrier molecules to which the fusion proteins, and/or natural or synthetic light or heavy chain of the donor antibody or other fragments of the donor antibody may be associated by conventional means. Such non-protein carriers can include conventional carriers used in the diagnostic field, e.g., polystyrene or other plastic beads, or other _ ~0~4/~5690 PC~/~S93/0~3~
2143~17 non-protein substances useful in the medical field and safe for administration to humans and animals. Other effector agen~s may include a macrocycle, for chelating 2 heavy metal atom, or a toxin, such as ricin. Such effector agents are useful to increase the h~lf-life of the anti-Plasmodium derived amino acid secuences or to add to its properties.
II. Anti-Plasmodium Antibodies For use in constructing the recombinant antibodies of this invention as it relates to malaria-causing pathogens, non-human species may be employed to generate a desirable donor antibody upon presentment with an antigen from a Plasmodium strain capable of infecting humans. Conventional hybridoma techniaues are employed to provide a hybridoma cell line secreting 2 non-humzn mAb to the selected antigen. As one example, the murine mAb, NFS2, has been identified as a desir2ble antibody which may be employed for use in developing a chimeric or humanized antibody of this invention.
Murine IgG ~Ab NFS2 is characterized by an antigen binding specificity to the repeat region of the P. falciparum CS protein. In in vitro assays, it - prevented invasion of sporozoites into human hepatocytes or hepatoma cells. Analogous antibodies in the mouse model have conferred passive protection against malaria.
The production of mAb NFS2 is described in detail in Example l below.
This invention is not limited to the use of the illustrative NFS2 mAb or its hypervariable sequences.
Wherever in the following description the donor mAb is identified as NFS2, this designation is made for simplicity of description only. Other anti-Dlasmodi~m antibodies may be substituted therefor. Suitable antibodies include, for example, the murine mAb 2Al0, which is directed against the CS repeat protein or other - W094/05690 PCT/US93/0~3' mAbs described in R. A. Wirtz et al, Bull WHO, 6s:39-45 (1987).
Antibodies produced in other animals protected by immunization with sporozoites or a protective epitope of a selected Plasmodium species may be similarly employed in this lnvention as 2 source of protective anti-Plasmodium sequences.
For example, the P. falciparum CS protein repeat region protein R32tet32 NH2-~et-Asp-Pro-[(Asn-Ala-Asn-Pro) 15 (Asn-Val-Asp-Pro)l]2-Leu-Arg-Arg-Thr-His-Arg-Gly-Arg-His-His-Arg-Arg-His-Arg-Cys-Gly-Cys-Trp-Arg-Leu-Tyr-Arg-Arg-His-His-Arg-Trp-Gly-Arg-Ser-Gly-Ser-COOH SEQ
ID NO: 2 may be employed to elicit both human and murine mAbs with binding specificity therefor. This repeat region protein is a suitable target for screening for neutralizing antibodies useful in prophylactic agents against malarial infection.
Similarly, the epitope to which NFS2 is responsive, and analogs thereof, may be useful in the screening and development of additional P. falciparum antibodies, for use in the development of prophylactic compositions for short-term protection of humans against malaria. Other epitopes of interest include non-repetitive flanking region epitopes, other repeat domains or various liver, and blood and sexual stage epitopes of Plasmodium species. Knowledge of these epitopes enables one of skill in the art to define synthetic, and to identify naturally-occurring, peptides which would be suitable to confer passive or active immunity against P.
falciparum or other Plasmodium species. This knowledge also permits the production of mAbs useful in the prophylaxis of malarial infection in humans.
For example, other P. falciparum antibodies may be developed by screening hybridomas or other combinatorial libraries, or antibody phage displays [W.

~ VQ9~/05690 PCT/~iS93/08~3' 21~3~17 D. Huse et al., Science, 246:1275-1281 (1988)] using the murine mAb epitope described herein. A collection of antibodies, including hybridoma products or antibodiec derived from any species immunoglobulin repertoire may be screened in a conventional competition assay, such as descri~ed in the examples below, with one or more epitopes described herein.
Anti~odies such as those described above, including those generated against a desired epitope and produced by conventional techniques, including without limitation, genes encoding murine mAbs, human mAbs, and combinatorial antibodies, may be useful as donor antibodies, as sources of antibody fragments, as well as in prophylactic compositions against P. falciparum in humans. Preferably, the antibodies developed in response to Plasmodium, particularly P. falciparum, epitopes may be useful as donors of desirable variable heavy and/or light chain amino acid sequences, or functional fragmen~s thereof (e.g., CDRs) useful in the development of fusion proteins, including engineered antibodies. Thus, the invention may utilize a donor antibody, other than NFS2, which is capable of binding to the P . fal ciparum peptide consisting essentially of the amino acid sequence of the repeat protein and analogs thereof.
Additionally, the mAbs identified herein, other mAbs which are developed and are responsive to the use of the sporozoites, R32tet32 tSEQ ID NO: 2] or the repeat epitopes identi~ied herein may be further altered or manipulated to impart additional desirable prophylactlc characteristics.
III. Antibody Fragments, Amino Acid and Nucleotide Sequences The present invention provides isolated naturally-occurring or synthetic variable light chain and variable heavy chain se~uences derived from mAb NFS2, as , ,~V094/0~690 PCT/~ISg3/08~35 -2~3~1~

well as CDRs and fragments therefrom, which may be employed in the design of fusion proteins (including engineered antibodies) which are characterized ~y the antigen binding specificity of this mA~.
~he naturally-occurring variable heavy chain of NFS2 is characterized by the amino acid and encoding nucleic acid sequences illustrated in Fig. 4 tSEQ ID NOS:
9 and 10]. This chain is characterized by CDRs having the following nucleotide and predicted amino acid sequences. CDR 1 is characterized by the sequence:
AGCTATGCCATGTCT SEQ ID NO: 32 SerTyrAlaMetSer SEQ ID NO: 33.
The naturally occurring CDR 2 nucleic acid and amino acid ~ sequences are SEQ ID NOS: 17 and 18, respectively:
GAAATTAGTGATGGTGGTAGTTACACCTACTATCCAGACACTGTGACGGGC
GluIleSerAspGlyGlySerTyrThrTyrTyrProAspThrValThrGly.
The naturally-occurring CDR 3 has the nucleic acid and amino acid sequences SEQ ID NOS: 19 and 20, respectively:
CTCATCTACTATGGTTACGACGGGTATGCTATG&ACTAC
LeuIleTyrTyrGlyTyrAspGlyTyrAlaMetAspTyr.
Synthetic humanized variable heavy chains of NFS2 are characterized by ~he amino acid and encoding nucleic acid sequences illustrated in Fig. 5-[SEQ ID NOS:
9 and lO~ and Fig. 6 [SEQ ID NOS: 13 and 14]. In both synthetic chains, the CDRs have the following nucleotide and predicted amino acid sequences. Nucleotide changes were made in CDR l from the naturally occurring CDRs, and are indicated by underlining. Synthetic CDR 1 is characterized by the sequence:
AGCTATGCCATGAGC SEQ ID NO: 15 SerTyrAlaMetSer SEQ ID NO: 16.
The synthetic CDR 2 nucleic acid and amino acid sequences are identical to the naturally-occurring sequences SEQ ID
NOS: 17 and 18, respectively. The synthetic CDR 3 has the same nucleic acid and amino acid sequences as does W094/0~690 ' ,' PCT/US93/08~35 .-- .
21~3~7 the naturally occurring CDR 3 SEQ ID NOS: 19 and 20, respectively.
The naturally occurring variable light chain of NFS2 ls characterized by the amino acid sequence and encoding nucleic acid sequence of Fig. 1 [SEQ ID NOS: 3 and 4]. This chain is further characterized by CDRs having the following nucleotide and amino acid sequences.
CDR 1 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 34 and 35, respectively:
AAGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAAAGAATTACTTGGCC
LysSerSerGlnSerLeuLeuTyrSerSerAsnGlnLysAsnTyrLeuAla.
CDR 2 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 36 and 37, respectively:
TGGGCATCCACTAGGGAATCT
TrpAlaSerThrArgGluSer.
CDR 3 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 38 and 39, respectively:
CAGCAATATTATAGCTATCCTCGGACG
GlnGlnTyrTyrSerTyrProArgThr.
A synthetic humanized variable light chain of NFS2 is characterized by the amino acid and encoding nucleic acid sequences illustrated in Fig. 2 [SEQ ID NOS:
5 and 6]. This chain is characterized by CDRs having the following predicted amino acid sequences and encoded by the illustrated nucleotide sequences. Nucleotide changes were made in the three CDRs from the naturally occurring corresponding CDRs, and are indicated by underlining.
Synthetic CDR 1 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 21 and 22, respectively:
AAGAGCTCTCAGAGCCTTTTATACTCGAGCAATCAAAAGAATTACTTG&CC
LysSerSerGlnSerLeuLeuTyrSerSerAsnGlnLysAsnTyrLeuAla.
Synthetic CDR 2 is characterized by the nucleic acid and amino acid sequences SEQ ID NOS: 23 and 24, respectively-TGG&CGTCAACTAGGGAATCT
TrpAlaSerThrArgGluSer.

~ ~ WO9~/0~90 ~ PCT/US93/08~3~
21~3417 Synthetic CDR 3 is characterized by the amino acid sequences SEQ ID NO: 26 and encoding nucleotide sequences SEQ ID NO:25, respectively:
CAGCAATATTATAGCTATCCGCGGACG
GlnGlnTyrTyrSerTyrProArgThr.
Another synthetic humanized variable light ckain of NFS2 is characterized by the amino acid and encoding nucleic acid sequences illustrated in Fig. 3 [SEQ ID NOS: 7 and 8]. This chain is characterized by identical CDRs 1 and 3 as in the Fig. 2 synthetic sequences. However, a nucleotide change was made in the CDR 2 from both the naturally occurring corresponding CDR
2, and the Fig. 2 synthetic CDR 2. Double underlining is employed to indicate the change from the Fig. 2 synthetic sequences. Synthetic CDR 2 is characterized by the nucleic acid and amino acid se~uences S Q ID NOS: 40 and 41, respectively: TGGGCGTCGACTAGGGAATCT
TrpAlaSerThrArgGluSer.
The present invention also includes the use OL
Fab fragments or F(abl)2 fragments. A Fab fragment contains the entire light chain and amino terminal portion of the heavy chain; and a F(ab~)2 fragment is the fragment formed by two Fab fragments bound by disulfide bonds. MAb NFS2 and engineered antibodies derived therefrom and described below provide sources of Fab fragments and F(ab~)2 fragments which can be obtained by conventional means, e.g. cleavage of the mAb with the appropriate proteolytic enzymes, papain and/or pepsin, or by recombinant methods. The Fab fragments or F(ab. )2 fragments may be derived from any of the mAbs describea above, as agents protective in vivo against infection by malarial pathogens, particularly P. falciparum.
The variable chain peptide sequences of murine mAb NFS2, its variable chain peptide sequences and CDRs, functional fragments, Fab fragments, and analogs thereof, and the nucleic acid sequences encoding them, may be ~ 09~/05690 . PCT/~'S93/0~3 .--useful in obtaining various fusion molecules encoding desired fusion proteins, particularly engineered antibodies, and in methods for preparing and administerins pharmac~utic21 compositions containing them.
The nucleic acid sequences of the invention, or fragments thereof, encoding the variable light chains and heavy chain peptide sequences or CDR pepti es, or functional fragments thereof are used in unmodified form or are synthesized to introduce desirable modifications.
The isolated naturally-occurring or synthetic nucleic acid sequences, which are derived from mAB NFS2 or from other desired anti-Plasmodium antibodies, may optionally contain restriction sites to facilitate insertion or ligation into a suita~le nucleic acid sequence encoding a desired antibody framework region, ligation with mutagenized CDRs, or fusion with a nucleic acid se~uence encoding a selected second fusion partner.
Taking into account the degeneracy of the genetic code, various coding sequences may be constructed which encode the variable heavy and light chain amino acid sequences, and CDR sequences of the invention, e.g., Figs. 1 - 6 [SEQ ID NOS: 3-26], and functional fragments and analogs thereof which share the antigen specificity of the donor antibody. The isolated or synthetic nucleic acid`se~uences of this invention, or fragments thereof, encoding the variable chain peptide sequences or CDRs or functional fragments thereof can be used to produce fusion proteins, i.e. chimeric or humanized antibodies, or other engineered antibodies of this invention, when operatively combined with a second fusion partner.
These sequences are zlso useful for mutagenic insertion of specific changes within the nucleic acid sequences encoding the CDRs or framewor~ regions, and for 35 incorporation of the resulting modified or fu~ion nucleic WO9~/05690 ~ PCT/~'S93/0813 ,--2143~17 acid sequence into a vector for expression. For example, silent nucleotide substitutions may be made in the nucleotide sequences encoding the CDRs to create restriction enz~Ime sites to facilitate insertion of the mutagenic frameworks, or to modify the selected framewor.~s a~ nucleotide positions analogous to those of the donor antibody. Such mutations may include those inserted for the purpose of contributing to higher antigen binding affinity.
IV. Fusion Mol ecul es and Fusion Proteins Fusion molecules of this invention can encode engineered antibodies, chimeric antibodies and humanized antibodies. A desired fusion molecule may contain a first fusion partner encoding an amino acid sequence having the antigen specificity of a Plasmodium antibody directed against the amino acid sequence of the repeat protein and analogs thereof, operatively linked to a second fusion partner. Desirably the source of the firs~
fusion partner is a selected mAb, e.,g., mAb NFS2, the source of nucleic acid sequences of Figs. 1 [SEQ ID NO:

3] and 4 tSEQ ID NO: 9].
A fusion molecule may encode an amino acid - sequence for a naturally occurring variable heavy chain sequence of Fig. 4 [SEQ ID NOS: 9 and 10], a functional fragment or analog thereof, a naturally occurring variable light chain sequence of Fig. 1 [ SEQ ID NO: 3 and 4], a functional fragment or analog thereof, or one or more NFS2 CDRs ~ SEQ ID NO: 15-26]. Another exemplary fusion molecule may encode a synthetic variable heavy and/or light chain from the donor mAb, such as those of Figs. 2 [SEQ ID NOS: 5 and 6], 3 [SEQ ID NOS: 7 and 8], 5 [SEQ ID NOS: 11 and 12], and 6 ~SEQ ID NOS: 13 and 14], having the antigen specificity of P. falclparum antibody.
A desirable fusion molecule of this invention 3 5 may be characterized by encoding an amino acid sequence ~V~ g4/05690 ' PCr/~iS93/08~3' 21434~7 1~
containing at least one, and preferably all of the CDRs [SEQ ID NOS: 15-26] of the variable region of the heavy and/or light chains of the murine antibody NFS2, or a functional ~rag~ent or analog thereof.
The second fusion partners are defined above, and may include a sequence encoding a peptide, protein or ~ragment thereof heterologous to the CDR-containing sequence having the antigen specificity of NFS2. One example is a sequence encoding a second antibody region of interest and may optionally include a linker sequence.
The resulting fusion molecule may encode both anti-P. falciparum antigen specificity and the characteristic of the second fusion partner, e.g., a functional characteristic such as secretion from a recombinant host, or a therapeutic characteristic if the fusion partner itself encodes a therapeutic protein, or additional antigenic characteristics, if the fusion partner encodes a protein having its own antigen specificity.
If the second fusion partner is derived from another antibody, e.g., any isotype or class of immunoglobulin framework or constant region (preferably human), or the like, an engineered antibody is provided.
Thus, for example, a fusion molecule of this invention may comprise a complete antibody molecule, having full length heavy and light chains (Figs. 4 rSEQ ID NOS: 9 and lO] and 1 [SEQ ID NOS: 3 and 4]~. For example, the invention includes isolated naturally-occurring or synthetic nucleic acid sequences, which may encode variable region sequences, CDR peptides, fragments thereof derived from desired Pl asmodium mAbs, any fragment of an engineered antibody, such as the Fab or F(abl)2 fragment, a heavy chain dimer, or any minimal recombinant fragment thereof such as an Fv or a single-chain antibody (SCA) or any other sequence encoding a ~V094/05~90 PCT/~'S~3/~8~3~

protein with the same specificity as the selected mAb,e.g., the Pl asmodium mAb NFS2.
The first fusion partner may also be associated with effector agents as defined above, to which the first fusion partner may be operatively linked by conventional means, e.g., attached to the NFSZ encoding nucleic acids by a covalent bridging structure.
Fusion or linkage between the first fusion partners and the selected second fusion partner may be by way of any suitable means, e.g., by conventional covalent or ionic bonds, protein fusions, or heterobifunctional cross-linkers, e.g., carbodiimide, glutaraldehyde, and the like. Where the first fusion partner is associated with an effector agent, non-proteinaceous, conventional chemical linking agents may be used to fuse or join the anti-P. falciparum amino acid sequences to the effector agent. Such techniques are known in the art and readily described in conventional chemistry and biochemistry texts.
Additionally, conventional inert linker sequences which simply provide for a desired amount of space between the fusion partners or between the first fusion partner and the effector agent may also be constructed into the fusion molecule. The design of such linkers is well known to those of s~ill in the art.
Expression of such fusion molecules results in fusion proteins of this invention. One particularly desirable type of fusion protein includes the engineered antibody in which, at a m1nimllm, fragments of the variable heavy and/or light domains of an acceptor mAb have been replaced by analogous parts of the variable light and/or heavy chains from one or more donor monoclonal antibodies, which include the Pl asmodium mAbs described herein, such as NFS2.

,~ W094/05690 PCT/~iS93/08~3~
2143~17 One example of a particularly desirable engineered antibody is a humanized antibody, in which CDRs from a desired donor murine mAb are inserted into the framework regions of a human antibody. A preferred donor antibody is one directed against a Pl asmodium epitope, preferably one specific for the repeat region epitope of ~. falciparum. A particularly preferred donor antibody has all or a portion of the variable domain amino acid se~uences of NFS2. In these humanized antibodies one, two or preferably three CDRs from the Pl asmodium antibody heavy chain and/or light chain variable regions are inserted into the framework regions of a selected human antibody, replacing the native CDRs of that latter antibody.
Preferably, the variable domains in both human heavy and light chains have been altered by CDR
replacement. This engineered humanized antibody thus preferably has the structure of a natural human antibody or a fragment thereof. Such humanized antibodies may or may not also include minimal alteration of the acceptor mAb light and/or heavy variable domain framework region in order to retain donor mAb binding specificity. The - humanized antibody possesses the combination of properties required for effective prevention and treatment of infectious P. falciparum disease in animals or man.
The remainder of the engineered antibody may be derived from any suitable acceptor human immunoglobulin.
A suitable human antibody may be one selected from a conventional database, e.g., the Kabat database, Los Alamos database, and Swiss Protein database, by homology to the nucleotide and amino acid sequences of the donor antibody. A human antibody characterized by a homology to the framework regions of the donor antibody (on an amino acid basis) may be suitable to provide a heavy ~' W09~/0~690 ' PCT/US93/Og~3' 2143~17 chain constant region and/or a heavy chain variable framewor~ region for the insertion of the donor CDRs. A
suitable acceptor antibody capable of donating light chain constan~ or variable framewor~ regions may be selected in a similar manner. It should be noted that the acceptor antibody heavy and light chains are not required to originate from the same human antibody.
Desirably, the heterologous fram~ework and constant regions are selected from the human immunoglobulin classes and isotypes, such as IgG
(subtypes 1 through 4), IgM, IgA and IgE. However, the acceptor antibody need not comprise only human immunoglobulin protein sequences. For instance, a gene may be constructed in which a DNA sequence encoding part of a human immunoglobulin chain is fused to a DNA
sequence encoding the amino acid sequence of a polypeptide effector or reporter molecule.
As one example, an engineered antibody may be encoded by a synthetic nucleic acid sequence encoding CDRs Qf the variable light chain region of NFS2 or a functional fragment thereof in place of at least a part of the nucleic acid sequence encoding the light chain variable region of an acceptor mAb, and a nucleic acid sequence encoding CDRs of the variable heavy chain region of NFS2 or a functional fragment thereof in place of at least a part of the nucleic acid sequence encoding the heavy chain variable region of an acceptor mAb, such as a human antibody. The resulting humanized antibody is characterized by the antigen binding specificity of mAb NFS2.
Alternatively, the engineered antibody (or the other monoclonal antibodies) of the invention may have attached to it an effector or reporter molecule.
Alternatively, the procedure of recombinant DNA
technology may be used to produce an engineered antibody 1 - WO9~/0~690 PCT/~'S93/08~3~
2143~17 of the invention in which the Fc fragment or CH3 domain of a complete antibody molecule has been replaced by an enzyme or toxin molecule.
It will be understood by those skilled in thP
art that such an engineered antibody may be further modified by changes in variable domain amino acids without necessarily affecting the specificity of the donor antibody. It is anticipated that heavy and light chain amino acids may be substituted by other amino acids either in the variable domain frameworks or CDRs or both.
Such engineered antibodies can be effective in prevention of productive malaria (e.g., by P. falciparum) infection in humans.
Additionally, the invention provides fusion proteins which are chimeric antibodies, as defined above.
Such antibodies differ from the humanized antibodies described above by providing the entire donor antibody heavy chain and light chain variable regions, including framework regions, e.g., Figs. 1 [SEQ ID NOS: 3 and 4]
and 4 tSEQ ID NOS: 9 and lO], fused to acceptor constant regions for both chains.
V. Production of Proteins and Anti~odies A fusion molecule, recombinant antibody or fusion protein of this invention is desirably constructed by recombinant DNA technology using genetic engineering techniques. The same or similar techniques may also be employed to generate other embodiments of this invention, e.g., to construct the chimeric or humanized antibodies, the synthetic light and heavy chains, the CDRs, and the nucleic acid sequences encoding them, as above mentioned.
A specific embodiment of the compositions of this invention is set out in Example 3 below using the CDRs of murine NFS2 and one or more selected human antibody light and heavy chain framework regions.
Briefly described, a hybridoma producing the murine ~ WQ94/05690 P~T/~'S93/0~3~
2~3417 antibody NFS2 is conventionally cloned, and the cDNA of its heavy and light chain variable regions is obtained by techniques known to one of skill in the art, e.g., the techniques described in Sambrook et al., Molecular Clonina (A LaboratorY Manual), 2nd edition, Cold Spring Harbor Laboratory (1989). The variable re~ions of the NFS2 are obtained using PCR primers, and the CDRs are identified using a known computer database, e.g, Kabat, for comparison to other antibodies.
Homologous framework regions of a heavy chain variable region from a human antibody were identified using the same databases, e.g., Kabat, and a human antibody having homology to NFS2 was selected as the acceptor antibody. The sequences of synthetic heavy chain variable regions containing the NFS2 CDRs within the human antibody frameworks were designed with optional nucleotide replacements in the framework regions for restriction sites. This designed sequence was synthesized by overlapping oligonucleotides, amplified by polymerase chain reaction (PCR), and corrected for errors.
A suitable light chain variable framework region was designed in a similar manner, resulting in two synthetic light chain variable sequences containing the NFS2 CDRs. See, Figs. 2 [SEQ ID NOS: 5 and 6] and 3 [SEQ
ID NOS: 7 and 8]. As stated above, the source of the light chain is not a limiting factor of this invention.
These synthetic variable light and/or heavy chain sequences and the CDRs of mAb NFS2, and their encoding nucleic acid sequences, are employed in the construction of fusion proteins and engineered antibodies, preferably humanized antibodies, of this invention, by the following process. By conventional techniques, a DNA sequence is obtained which encodes the 3S donor anti~ody variable heavy or light chain re~ions, ~ W094/0~690 PCT/~IS93/08~3~

214341~

wherein at least the CDRs and those minimal portions of the acceptor mAb light and/or heavy variable domain framework region required in order to retain donor mAb binding speclficity as well as the remaining immunoglobulin-derived parts of the antibody chain derived from a human immunoglobulin.
A conventional expression vector or recombinant plasmid is produced by placing these sequences encoding the fusion protein in operative association with conventional regulatory control sequences capable of controlling the replication and expression in, and/or secretion from, a host cell. Such regulatory sequences may be readily selected by one of skill in the art and are not intended as a limitation of the present invention. Regulatory sequence include promoter sequences, e.g., CMV promoter, and signal sequences which can be derived by one of skill in the art from antibodies.
A first vector can contain a sequence encoding a light chain-derived polypeptide. Similarly, a second expression vector is produced having a similar DNA
sequence which encodes a complementary antibody light or - heavy chainO Preferably at least the CDRs (and those min;m~l por~ions of the acceptor mAb light and/or heavy variable domain framework region required in order to retain donor mAb binding specificity) of the variable domain are derived from a donor antibody and the remaining immunoglobulin-derived parts of the antibody chain are derived from a human immunoglobulin in these 3~ vectors. Preferably this second expression vector is identical to the first, with the exception of the coZing sequences and selectable markers, to ensure that each polypeptide chain is functionally expressed.
In another alternative, a single vector of the invention may be used, the vector including the sequence . , Wog~/05690 ' , PCT/~IS93/08~3~

21q3917 encoding both light chain and heavy chain-derived polypeptides. The DNA in the coding sequences for the light and heavy chains may comprise cDNA or genomic DNA
or both.
A selected host cell is co-transfecied by conventional techniques with both the first and second vectors (or the single vector) to create the transfected host cell of the invention comprising bot~ the -recombinant or synthetic light and heavy chains. The ~0 transfected cell is then cultured by conventional techniques to produce the engineered antibody of the invention. The humanized antibody which includes the association of both the recombinant heavy chain and/or light chain is screened from culture by appropriate assay, such as an ELISA assay followed by the Inhibition of Sporozoite Invasion (ISI) assay described in the examples below. Similar conventional techniques may be employed to construct other fusion proteins of this - invention.
Thus, the invention also includes a recombinant plasmid containing the coding sequence of the fusion molecule or engineered antibody of the invention. Such a vector is prepared by conventional tPchn;ques and suitably comprises the above-described DNA sequences and a suitable promoter operatively linked to the DNA
sequences which encode the engineered antibody. Such a vector is transfected into a mammalian cell via conventional techniques.
Suitable vectors for the cloning and subcloning steps employed in the methods and construction of the compositions of this invention may be selected by one of s~ill in the art. For example, the conventional pUC
series of cloning vectors, may be used. One vector used is pUC19, which is commercially available from supply houses, such as Amersham (Buckinghamshire, United ~ ~09~/~5690 s ~ PCT/~'S93/08~3~

2143~17 Kingdom) or Pharmacia (Uppsala, Sweden). Additionally, any vector which is capable of replicating readily, has an abundance of cloning sites and marker genes, and is easily manipulated may be used for cloning. Thus, the selection of the cloning vector is not a limiting factor in this invention.
Similarly, the vectors employed for expression of the engineered antibodies according to~this invention may be selected by one of skill in the art from any conventional vector. The vectors also contain selected regulatory sequences which are in operative association with the DNA coding sequences of the immunoglobulin regions and capable of directing the replication and expression of heterologous DNA seauences in selected host cells, such as CMV promoters. These vectors contain the above described DNA sequences which code for the engineered antibody or other fusion protein.
Alternatively, the vectors may incorporate the selected immunoglobulin sequences modified by the insertion of desirable restriction sites for ready manipulation.
The expression vectors may also be characterized by marker genes suitable for amplifying - expression of the heterologous DNA sequences, e.g., the mammalian dihydrofolate reductase gene (DHFR) or neomycin resistance gene (neoR). Other preferable vector sequences include a poly A signal sequence, such as from bovine growth hormone (BGH), and the betaglobin promoter sequence (betaglupro). The expression vectors useful herein may be synthesized by techniques well known to those skilled in this art.
The components of such vectors, e.g. replicons, selection genes, enhancers, promoters, and the like, may be obtained from natural sources or synthesized by known procedures for use in directing the expression of the 3~ recombinant DNA in a selected host. Other appropriate ~ - ~ WO9~/0~690 PCT/US93/08~3~
' 2~ 43~.7 expression vectors of which numerous types are known in the art for mammalian, bacterial, insect, yeast, and fungal expression may also be selected for this purpose.
~o exemplary expression vectors employed in the following examples for expression of the synthetic heavy and light chain sequences are the mammalian vectors Pfhzhc2-3-Pcd and Pfhzlcl-1-Pcn (see Figs. 7 and 8).
However, this invention is not limited to the use of these illustrative pUC19-based vectors.
The present invention also encompasses a cell line transfected with a recombinant plasmid containing the coding sequences of the engineered antibodies or other fusion protein described by this invention. Host cells useful for the cloning and other manipulations of these cloning vectors are also conventional. However, most desirably, cells from various strains of E. coli are used for replication of the cloning vectors and other steps in the construction of the mAbs of this invention.
Suitable host cells or cell lines for the expression of the engineered antibody or other protein of the invention of this invention are preferably a eukaryotic cell, and most preferably a mammalian cell, such as a CXO cell or a myeloid cell. Other primate cells may be used as host cells and, most desirably, human cells are used, thus enabling the protein to be modified with human glycosylation patterns.
Alternatively, other eukaryotic cell lines may be employed. The selection of suitable mammalian host cells and methods for transformation, culture, ampli~ication, screening and product production and purification are known in the art. See, e.g., Sambrook et al., cited above.
Bacterial cells may prove useful as host cells suitable for the expression of the recombinant mAbs of 3S the present invention. However, due to the tendency of ~ W09~/05690 i PCT/~iS93/~8~3~
21~3417 proteins expressed in bacterial cells to be in an unfolded or improperly folded form or in a non-glycosylated form, any recombinant mAb produced in a bacterlal ceil would have to be screened for retention of antigen binding ability. If the protein expressed by the hacter1ai cell was produced in a properly folded form, that bacterial cell would be a desirable host. For example, various strains of E. coli used for expression are well-known as host cells in the field of biotechnology. Various strains of B. subtilis, Streptomyces, other bacilli and the like may also be employed in this method.
Where desired, strains of yeast cells known to those skilled in the art are also available as host cells, as well as insect cells and viral expression systems. See, e.g. Miller et al., Genetic Enqineerina, 8:277-298, Plenum Press (1986) and references cited therein.
The general methods by which the vectors of the invention may be constructed, transfection methods re~uired to produce the host cells of the invention, and culture methods necessary to produce the fusion protein, - and preferably an engineered antibody of the invention from such host cell are all conventional techniques.
Likewise, once produced, the fusion proteins, preferably the engineered antibodies of the invention, may be purified from the cell culture contents according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like. Such techniques are within the s~ill of the art and do not limit this invention.
The engineered antibody is then e~m-ned for in vitro activity by use of an assay appropriate for the selected pathogen. Presently conventional ELISA assay . WO91/~5690 -~ > PCT/US93/08~3~
2143~17 formats are employed to assess qualitative and ~uantitative binding of the engineered antibody to the R32tet32 epitope [SEQ ID NO: 2]. The ISI assay described in Example 6 may also be employed. A similar assay, the inhibition of hepatocyte invasion assay (ILSDA), may be performed [S. Mellouk et al., Bull. WHO, Suppl. 68:52-58 (1990)]. Additionally, assays currently being developed in the SCID mouse model may also be used ~o verify efficacy prior to subsequent human clinical studies performed to evaluate the persistence of the engineered antibody in the body despite the usual clearance mechanisms.
The examples below demonstrate the method for constructing the humanized antibodies derived from the murine mAb NFS2. Following the procedures described for humanized antibodies prepared from this antibody, one of skill in the art may also construct humanized antibodies from other malarial antibodies, variable region sequences and CDR peptides described herein. Engineered antibodies can be produced with variable region frameworks potentially recognized as "self" by recipients of the altered antibody. Minor modifications to the variable - region framewor~s can be implemented to effect large increases in antigen binding without appreciable increased immunogenicity for the re¢ipient. Such engineered antibodies can effectively passively protect a human against P. falciparum infection.
VI . Therapeutic/Prophylactic Uses The fusion proteins, particularly the engineered antibodies described above, functional fragments, analogs and the other protein or peptides described herein may be employed as prophylactic agents, capable of conferring short-term passive immunity to infection by the pathogen from which the original antigenic substance derives, e.g., P. fal ciparum , to a ~ ~VO91/0~690 PCT/~'Sg3/08~3~

subject. The protective effect conferred by the use of the engineered antibodies of this invention is produced by binding of the immunoglobulin to the pathogen and the subsequen, removal of this bound complex by the normal function of macrophages. Thus, the engineered antibodies of the present invention, when in preparations and ~ormulations appropriate for prophylactic use, are highly desirable for persons anticipating short-term exposure to the pathogen, e.g., travelers, tourists, or military personnel anticipating travel in endemic areas.
Therefore, this invention also relates to a method of prophylactic treatment of human P. falciparum infection in a human in need thereof which comprises administering an effective, protective dose of antibodies including one or more of the engineered antibodies or other fusion proteins described herein, or fragments thereof, to a human anticipating exposure to a species of Plasmodium.
The fusion proteins, including the engineered antibodies or fragments thereof of this invention, may also be used in conjunction with other antibodies, particularly human mAbs reactive with other epitopes - responsible for the disease against which the engineered antibody of the invention is directed. Similarly mAbs reactive with other epitopes responsible for the disease in a selected animal against which the antibody of the invention is directed may also be employed in veterinary compositions. Any antibody that is capable of operating without interfering with the Plasmodium antibody of this invention, e.g., antibodies to other malaria stages or to different epitopes, are useful in these compositions.
The prophylactic agents of this invention are believed to be desirable to confer protection to exposure to the pathogen for from about 4 days to about 8 weeks, without requiring booster dosages of the agent. This ~ 1~VO9~/05690 PCT/US93/08~3~
214~7 definition of 'short-term' relates to the relative duration of the recombinant antibodies of the present invention in the human circulation.
The mode of administration of the prophylactic agent o~ the invention may be any suitable route which deliv~rs the agent to the host. The fusion proteins, including the engineered antibodies, and fragments thereof, and pharmaceutical compositions o~ the invention are particularly useful for parenteral administration, i.e., subcutaneously, intramuscularly or intravenouslyr However, the agent is preferably administered by intramuscular injection.
Prophylactic agents of the invention may be prepared as pharmaceutical compositions containing an effective amount of the engineered antibody of the invention as an active ingredient in a nontoxic and sterile pharmaceutically acceptable carrier. In the prophylactic agent of the invention, an aqueous suspension or solution containing the engineered antibody, preferably buffered at physiological pH, in a form ready for injection is preferred. The compositions for parenteral a~m; n ictration will commonly comprise a - solution of the engineered antibody of the invention or a cocktail thereof dissolved in an acceptable carrier, preferably an aqueous carrier. A va~iety of aqueous carriers may be employed, e.g., saline, glycine, and the like. These solutions are sterile and generally free of particulate matter. These solutions may be sterilized by conventional, well known sterilization techniques. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH ad~usting and buffering agents, etc. The concentration of the antibody of the invention in such pharmaceutical formulation can ~ ~V~9~/05690 PCT/~S93/08~3~
2~43~17 vary widely, i.e., from less than about 0.5%, usually at or at least about 1% to as much as 15 or 20~ by weight and will be selected primarily based on fluid volumes, viscosities, etc., according to the particular mode of administration selected.
Thus, a pharmaceutical composition of the invention for parenteral, e.g., intramuscular injection, could be prepared to contain 1 mL sterile ~uffered water, and between about 50 to about 100 mg of an engineered antibody of the invention. Simil~rly, a pharmaceutical composition of the invention for intravenous infusion could be made up to contain 250 ml of sterile Ringer's solution, and 150 mg of an engineered antibody of the invention. Actual methods for preparing parenterally administrable compositions are well known or will be apparent to those skilled in the art and are described in more detail in, for example, Reminqton's Pharmaceutical Science, 15th ed., ~ac~ Publishing Company, Easton, Pennsylvania.
It is preferred that the prophylactic agent of the invention, when in a pharmaceutical preparation, be present in unit dose forms. The appropriate therapeutically effective dose can be determined readily by those of skill in the art. To effectively prevent P.
falciparum infection in a human or other animal, one dose of approximately 1 mg/kg to approximately 20 mg/kg of a protein or an antibody of this invention should be a~m; n; ~tered parenterally, preferably intramuscularly (i.m.) and possibly intravenously (i.v.). Such dose may be repeated at appropriate intervals during exposure.
The antibodies, engineered antibodies or fragments thereof described herein can be lyophilized îor storage and reconstituted in a suitable carrier prior to use. This tech~;que has been shown to be effective with _ _ _ ~ ~yo94/05690 PCT/US93/0813~
21434~

conventional immunoglobulins and art-known lyophilization and reconstitution techniques can be employed.
Single or multiple administrations of the pharmaceutical compositions can be carried out with dosage levels and pattern being selected by the treating physician. In any event, the pharmaceutical composition of the invention should provide a quantity of the engineered antibodies of the invention sufficient to effectively prevent infection.
The following examples illustrate the construction of exemplary engineered antibodies and expression thereof in suitable vectors and host cells, and are not to be construed as limiting the scope of this invention. All amino acids are identified by conventional codes or by full name, unless otherwise indicated. All restriction enzymes, plasmids, and other reagents and materials were obtained from commercial sources unless otherwise indicated. All general cloning, ligation and other recombinant DNA methodology were as performed in Sambrook et al., cited previously, or the first edition thereof.

- Example 1 - DescriPtion of Production of NFS2 Murine IgG mAb NFS2 was made by repeated injection of P. falciparum sporozoites into mice followed by B cell fusion with a myeloma cell line. The murine mAb NFS2 is characterized by an antigen binding specificity to the repeat region of the P. falciparum CS
protein. Specifically, the NFS2 mAb binds to the epitope, Pro Asn Ala Asn Pro Asn SEQ ID NO: 27. It is possible that the antibody also binds to a larger, or overlapping epitope on the repeat region.

~ V09-~/05690 PCT/US93/0813~

This murine mAb, in in vitro assays, prevented invasion of sporozoites into human hepatocytes and hepatoma cells. Analogous antibodies in the mouse model have conferred passive protection against malaria and have been observed ~o be highly potent [see, e.g., R. A.
Wirtz et al., Bull WH0, 6S:39-45 (1987), incorporated herein by reference]. This antibody is available from the U. S. Naval Medical Research Institute.

Example 2 - Clonina and Sequencinq of NFS2 Cytoplasmic RNA was prepared by the method of Favaloro et al., Meth. Enzymol., 65:718-749 (1980) from NFS2, and hybridoma cell lines. The following primers were used in the synthesis of Ig heavy (VH) and light (VL) chain variable region cDNAs, respectively. The V~
primers, #2580 and ~2789, extended from HindII through XbaI and were made to conserved regions of murine RNA.
HindIII
#2580: 5'CCAGATGTAAGCTTCAGCTGACCCAGTCTCCA3' SEQ ID N0: 28 PvuII
X~a I NaeI
#2789:

5'CATCTAGATG&CGCCGCCACAGTACGTTTGATCTCCAGCTTGGTCCC3' SEQ
ID N0: 29 The V~ primers, #2621 and #2853, extended from K~nI through PstI and were made to çonserved regions of murine RNA.
K~nI XhoI
#2621: 5rGGG&TACCAG&TCCA(A/G)CT(G/T)CTCGAGTC(A/T)GG3' SEQ ID N0: 30 PstI
#2853: 5'GCCTGCAGCTAGCTGAGGAGACGGTGACCGTG&TCCCTTGG-NheI
CCCCAG3' SEQ ID N0: 31 PCR, as described by Saiki et al., Science, 3~ 239:487-491 (1988), was performed on the RNA template.
For the PCR, the primers used were identified above. For _ W094/05690 PCT/US93/08~3~
21434~7 PCR amplification of VH/ DNA/primer mixtures consisted of 5 ~l RNA and 0.5 ~M of the primers. For PCR
amplifications of VL, DNA/primer mixtures consisted of 5 ~l RNA and 0.5 ~M of the primers. To these mixtures W2S
added 250 ~M each of dATP, dCTP, dGTP and dTTP, 10 Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.01% (w/v) gelztin, 0.01% (v/v) Tween 20, 0.01~ (v/v) Nonidet P40 and 5 units AmpliTaq [Cetus]. Samples were subjected to 25 thermal cycles of PCR at 94C, 30 seconds; 55C, 30 seconds; 72C, 45 seconds; ending with 5 minutes at 72C.
For cloning and sequencing, amplified V~ DNA was purified on a low melting point agarose gel and by Elutip-d column chromatography ~Schleicher and Schuell-Dussel, Germanyj and cloned into pUC18 [New England Biolabs]. The general cloning and ligation methodology was as described in Maniatis et al., cited above.
V~ DNA W2s cloned as K~nI-PstI fragments into similarly-digested pUC18. VL DNA was cloned as HindIII-XbaI fragments into pUC18 digested with the same enzymes.
Representative clones were sequenced by the dideoxy method [Sanger et al., Proc. Natl. Acad. Sci. USA, 74:5463-5467 (1977)] using T7 DNA polymerase [US
Biologicals]. From the se~uences of NFS2 VH and VL
domains, the CDR sequences were elucidated in accordance with the methodology of Xabat et al., in "Sequences of Proteins of Immunological Interest", US Dept of Health and Human Services, US Government Printing Office (1987) utilizing computer assisted ali~nment with other VH and VL sequences. The CDRs of the heavy and light chalns of NFS2 are listed above and identified herein as SEQ ID
NOS: 15-20 and 21-26.

WO~4/056gO ' , PCT/US93/0~3~
~' 21~3~17 Example 3 - Humanized Antibodies The following example describes the preparation of an exemplary engineered antibody. Similar procedures may ~e follow~d ~or t~e development of engineered antibodies, using other Pl asmodium antibodies or other an~i-pathogen antibodies developed by conventional means.
The source of the donor CDRs utilized to prepare these engineered antibodies was the murine mAb, NFS2, described in Examples 1 and 2 above. The se~uenced NFS2 variable framework regions were employed to again search through the Kabat database to identify homologous framework regions of a human antibody. The framework region of an antibody obtained from a human SLE patient B-cell hybridoma cell line 18/17 [H. Dersimonian et al., J. Immunol., 139:2496-2501 ~1987)] was de~ermined to be approximately 80~ homologous to the NFS2 variable heavy chain framework region.
Given the murine NFS2 CDRs (Example 2) and ~he sequence of the human antibody 18/17, a synthetic heavy chain variable region was made, and PCR performed to fill in and amplify DNA. The NFS2 CDR sequences and the 18/17 VH framework regions were synthesized by the following - overlapping oligonucleotides:
SEQ ID NO:44:TAGTGAAGAATTCGAGGACGCCAGCAACATGGTGTTGCAGAC
CCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGCCTACGGG&AGGTGCAG
(Base 1-97);
SEQ ID NO:450GCTAGCGGATTCACCTTTAGCAGCCATGTCGGACCCCCCAGG
GACTCTGAGAGGACACGTCGATCGCCTAAGTGGAAATCCTATGCCATGAGCTGGG
TCCGCCAG&CTCCAG&GAAAGGTCTAGAGTGGGTCTCAGAAATCTTTATAGTGAT
G&TG&TAGTTAC (Base 158-259);
SEQ ID NO:46: GAACACGCTGTATCTGCAAATGAACA&CCT&AGAGCCGAG
GACACGTCTCTGTTAAG&TTCTTGTGCGACATAGACGTTTACT&CAGTATATTAC
TGTGCGAAACTCATCTACTATG&TTACGACG&&TATGCTATGGACTAGCTGCCCA
TACGATACCTGATC (Base 316-421);
SEQ ID N0:47: TTCTTGAAAGCTTGG&CCCTTGGTACTAGCTGAGCTCAC~G

WO9~/05690 ' , ~ PCT/~'S93/08~3~
~"
21~3417 TGACCAGGGTACCCTGGCCCCAGTAGTCCATAGCATACCCGTCG (Base 484-400);
SEQ ID NO:48: CATTTGCAGATACAGCGTGTTCTTGGAATTGTCTCTGGATA
TCGTGAACCGGCCCGTCACAGTGTCTGGATAGTAGGTGTAACTACCACCATCACT
AATTTC (Base 337-236);
SEQ ID NO:49: CTAAAGGTGAATCCGCTAGCTGCACAGGAGAGTCTCAGGGA
CCCCCCAGGCTGTACCAAGCCTCCCCCAGACTCGAGCAGCTGCACCTCCCCGTAG
GCACC (Base 177-77).
These primers are annealed together and DNA is filled in using Taq polymerase, followed by PCR
amplification using the following 5' primer:
- SEQ ID NO:50. CCGCGAATTCGAGGACGCCAGCAAC
and 3' primer: SEQ ID NO:51:
CCGCAAGCTTGGGCCCTTGGTACTAGCT.
Any errors in the mapped sequence which were inserted by PCR were corrected. In addition, conservative nucleotide replacements were placed in the framework regions to introduce selected restriction sites suitable for enzymatic cleavage. These alterations in the framewor~ regions are indicated by boxes in the sequences of Figs. 2 [SEQ ID NOS: 5 and 6], 3 [SEQ ID
NOS: 7 and 8], 5 [SEQ ID NOS: 11 and 12] and 6 [SEQ ID
- NOS: 13 and 14]. Additionally, most murine and human antibodies have a basic residue before CDR3. Because the variable heavy chain of NFS2 has a non-basic residue Ser before CDR3 [SEQ ID NOS: 19-20 and 25 and 26], the acceptor basic residue (Lys) before CDR3 was deleted and replaced with Ser to create heavy chain Pfhzhc2-3.
Two synthetic heavy chain variable regions ~ere obtained, namely, Pfhzhc2-3 SEQ ID NOS: 13 and 14, and Pfhzhc2-4 SEQ ID NOS: 11 and 12. These sequences are described in detail in Figs. 5 and 6. Each of these synthetic heavy chain variable regions is characterized by one or two nucleotide, or amino acid, differences.
Fo~ example, Pfhzhc2-3 [SEQ ID NOS: 13 and 14] has a Ser ~ 094/05690 ` PCT/US93/~8~3~

at position 98; and Pfhzhc2-4 [SEQ ID NOS: 11 and 12] has a Lys at position 98. Otherwise, these heavy chain variable regions are identical.
For a suitable light chain variable framewor~
region, the NFS2 light chain CDRs and the light chain variable framework sequence of the human antibody identified in H. G. Klobeck et al., Nucl. Acids Res., 13:6515-652g (1985) were used to make a s~itable synthetic light chain sequence by the same methods. The oligonucleotides used were as follows.
SEQ ID NO:52: TAAGCGGAATTCGTAGTCGGATATCGTGATGACCCAGTC
TCCAGACTCGCTAGCTGTGTCTCTGGGCGAGAGGGC (Base 1-75);
SEQ ID NO:53: TTACTTGGCCTGGTATCAGCAGAAACCCGGGCAGTCTCC
TAAGTTGCTCATAGTTTTCTTAATGAACCGGACTTACTGGGCGTCAACTAG (Base 130-198);
SEQ ID NO:54: GACAGATTTCACTCTCACCATCAGCAGCCTGCAGGCTGAA
GATGTGGCAGTATACTACTGCTGTCTAAAGTGTCAGCAATATTATAGCTATCC
(Base 241-321);
SEQ ID NO:55: CAGTTGGAAAGCTTGGCGCCGCCACAGTACGTTTGATCTCCA
CCTTGGTCCCTCCGCCGAACGTCCGCGGATAGCTATAATATTGC (Base 389-304);
SEQ ID NO:56: GTGAAATCTGTCCCAGACCCGCTGCCACTGAATCGG
TCAGGTACCCCAGATTCCCTAGTTGACGCC (Base 252-187);
SEQ ID NO:57: CAGGCCAAGTAATTCTTTTGATTGCTCGAGTATAAA
AG&CTCTGAGAGCTCTTGCAGTTGATGGTGGCCCTCTCGCCC (Base 141-64).
As described above, the primers were annealed together and DNA filled in using Taq polymerase, followed by PCR amplifcation with the following 5' SEQ ID NO:58:
GCGGAATTCGTAGTCGGATATCGTGATGAC and 3' SEQ ID NO:59:
TGGAAAGCTTGGCGCCGCCACAGTACGTTTGATC primers.
Two synthetic light chain variable sequences containing the NFS2 CDRs were designed and synthesized as described above for the synthetic heavy ch~' n~ and referred to as Pfhzlcl-1 SEQ ID NOS: 5 and 6, and ~ j~V,O9~ 690 ' PCT/~'S93/~8~3~

21~3~17 Pfhzlc1-2 SEQ ID NOS: 7 and 8. These two sequences differed in amino acid sequence at only one amino acid position, 49. Pfhzlcl-1 [SEQ ID NOS: 5 and 6] has a Ser at position 49; Pfhzlc1-2 [SEQ ID NOS: 7 and 8] has a Pro at the same position.
These synthetic variable light and/or heavy chain sequences are employed in the construction of an exemplary humanized antibody. It is expe~ted that any of the synthetic heavy chains will successfully associate with any of the synthetic light chains to produce a useful humanized antibody.
To produce a humanized antibody, for the heavy chain variable sequence Pfhzhc2-3 [SEQ ID NO: 13 and 14]
(Fig. 6), the following signal sequence was synthesized onto this variable region: S~Q ID NOS: 60: ATGGTGTTGCAG
ACCCAGGTCTTCATTTCTCTGTTGCTCTGGATCTCTGGTGCCTAC, which encodes SEQ ID NO:61: MetValLeuGlnThrGlnValPheIleSerLeu LeuLeuTrpIleSerGlyAlaTyr. For the synthetic light chain variable sequence Pfhzlcl-1 [SEQ ID NO: 5 and 6] (Fig.
2), the construct is digested with EcoRI and EcoRV, and the same signal sequence was ligated onto the variable sequence. Other signal sequences are well known to those of skill in the art and may be substituted for this exemplary sequence.
Selected constant regions of the human IgG1 antibodies selected for the heavy and light chain were synthesized and confirmed by PCR. These constant region seauences were then inserted into pUC19-based expression vectors. The above-described synthetic variable constructs, containing the signal and variable regions of the light and heavy chains, were thereafter inserted into these pUC19-based expression vectors containing CMV
promoters and the constant regions and fused in frame to the previously inserted human heavy and light chain - ~09~/05690 PCT/US93/0~35 2143~17 constant regions by conventional methods [Maniatis et al., cited above]. Thus, after insertion of the synthetic variable regions into these expression vectors, the pl2smids shown in Figs. 7 and 8, resulted. These plasmias were then co-transfected into a selected host cell and, following incubation, the media was assayed for antibody activity via ELISA as described in Example 4 below.
Using similar techniques, another exemplary humanized antibody is constructed using the synthesized heavy chain sequence Pfhzhc2-3 [SEQ ID NO:13 and 14]
(Fig. 6) and the synthetic light chain sequence Pfhzlc1-2 [SEQ ID NO:7 and 8].

ExamDle 4 - A Hiqh Affinity Humanized Antibodv The amino acid differences in the variable regions of the frameworks of the original murine antibody NSF2 described in Examples 1 and 2 and the Pfhzhc2.3 were determined, and several changes were made to increase the level of conservation of the original antibody conformation.
At amino acid position 49, the Ser of the humanized heavy chain Pfhzhc2.3 was changed to Ala, which is the amino acid found at this position in the native murine NSF2. The replacement employed conventional genetic engineering technology, e.g., by making a synthetic DNA fragment containing the appropriate nucleotide changes to alter the amino acid. A fragment of Pfhzhc2.3 was digested with XbaI and EcoRV and the synthetic fragment bearing the nucleotide change encoding Ala in place of a Ser codon, is inserted to make the amino acid replacement. The resulting synthetic heavy chain was termed Pfhzhc2.6.
This synthetic heavy chain was expressed as previously described for the Pfhzhc2.3 synthetic heavy ~ '094/05690 2 1 4 3 4 1 7 PCT/US93/0~35 chain. The expression plasmid for this humanized heavy chain sequence is essentially identical to the expression plasmid illustrated in Fig. 7, with the exception ~f the single amino acid difference described previously.
Similarly, humanized antibodies consisting of the Pfhzhc2.6 heavy chain and Pfhzlcl.1 light chain and the Pfhzhc2.6 heavy chain and the Pfhzlc1.2 light chain were assembled via co-transfection of mammalian cells and assayed for antibody activity by ELISA, as described in Example 5 below.
Other high affinity antibodies specific for P.
falciparum can be developed using a similar method designed to achieve minimal variable region framewor~
modifications. The method involves the following order of steps of alteration and testing:
(1) In addition to the alteration at amino acid position 49, other individual framework amino acid residues known to be critical for interaction with CDRs are compared in the primary antibody and the engineered CDR-replacement antibody. For example, heavy chain amino acid residue (Kabat numberïng; see Kabat et al., cited above) is compared in the primary (donor) and engineered antibodies. A residue at this position is thought to interact with the invariant heavy chain CDR residue at position 94 (Lys-basic) via a salt bridge.
If an amino acid is in the framework of the donor antibody but not in the framework of the engineered antibody, then an alternative heavy chain gene comprising the engineered antibody is produced. In the reverse situation whereby the engineered antibody framework comprises a residue at one position but the donor antibody does not, then an alternative heavy chain gene comprising the original amino acid at that position is reproduced. Prior to any further analysis, alternative - ~094/05690 2 1 4 3 4 1 7 PCT/US93/0~3~

plasmids produced on this basis are tested for production of high affinity engineered antibodies.
(2) Framework amino acids within four residues of the CDRs as defined according to Kabat (see Kabat e~
al., cited above) ar2 compared in the primary antibody and engineered CDR-replacement antibody. Where differences are present, then for each region the specific amino acids of that region are su~stituted for those in the corresponding region of the engineered antibody to provide a small number of engineered genes.
Alternative plasmids produced on this basis are then tested for production of high affinity antibodies.
(3) Framework residues in the primary and engineered CDR-repl2cement antibodies are compared and residues with major differences in charge, size or hydrophobicity are highlighted. Alternative plasmids are produced on this basis with the individual highlighted amino acids represented by the corresponding amino acids of the primary antibody and such alternative plasmids are tested for production of high affinity antibodies.

Exam~le 5: ELISA Assays Expression of the synthetic heavy chain and light chain sequences were tested by transiently transfecting the plasmid DNAs into monkey COS cells. The following results are reported for Pfhzhc2-3 and Pfhzlcl-1. Ten micrograms of the plasmids are mixed together and ethanol precipitated. The DNAs are dissolved in Tris buffered saline (TBS) and mixed with DEAE-dextran (400 ~g/ml final concentration)/chloroquine (0.1 mm), added to 3-4 x 105 COS cells grown in T25 flask, incubated for 4 hours at 37C. Cells were shoc~ed with 10% DMSO in phosphate buf~ered saline (PBS) for 1-2 minutes and after washing with PBS, cells were incubated in the presence of serum free growth medium. Media were collected 72 hours ~ ~O9~/0~690 PCT/VS93/08~3~
--' ` 2143~17 post transfection (day 3 sample) and fresh media were added which were collected 120 hours post transfection (referred to as day 5 sample).
To compare the binding affinity of various an.lbodies, i.e., chimeric and humanized, large scale COS
transfections were performed as described above. For each antibody, 200 ~Lg heavy chain plasmid and 200 ~g light chain plasmid DNAs were used to transfect a total of 2.5 x 107 COS cells. The media collected (day 3 and day 5) were pooled, assayed for antibody expression using Fc capture ELISA. The media were concentrated using Amicon to 6 ml. Amount of antibody in the pooled media varied from 9 mg/ml to 25 mg/ml. These concentrated samples were used to compare binding affinities via the ISI and ILSDA assays.
The presence of humanized antibody in the medium of wells containing transfected clones is measured by conventional ELISA techniques. Micro-titer plates are coated overnight at 4C with goat anti-human IgG (Fc specific) antibodies tSigma, St. Louis, MO] at 0.1 ~g per well. After washing with PBS (pH 7.5), 50 ~l of culture medium from the wells containing transfectants is added to each microtitre well for 2 hours at room temperature.
The wells are then emptied, washed with PBS and peroxidase-conjugated goat anti-human IgG antibodies [BioRad, Richmond, CA] are added at 50 ~L of a 1/1000 dilution per well. Plates are then incubated at room temperature for 1 hour. The wells are then emptied and washed with PBS. 100 /Ll 2.2'-azino-di[3-ethyl-benzthiazoline sulfonate(6)] are added per well.Reactions were allowed to continue for 1 hour at room temperature. The absorbance at 405 nm is then measured spectrophotometrically. The ability of the humanized antibody in the medium of wells containing transfected clones to bind P. falciparum circumsporozoite protein was ~ ~O9~/05690 PCT/~'S93/08~
21~3417 measured by ELISA. Microtiter plates were coated overnight at 4C with E. Co 7 i-produced R32tet32 at O.1 ~g per well. After washing with PBS, 50 ~1 of culture medium from the wells which contain transfectants is added to each microtiter well for 2 hours at room temperature. The wells are then emptied, washed with PBS
and peroxidase-conjugated goat anti-human IgG antibodies [BioRad, Richmond, CA] are added at 50 ~L of a l/lOOO
dilution per well. Plates are then incubated at room temperature for 1 hour. The wells are then emptied and washed with PBS. 100 ~l 2.2'-azino-di[3-ethyl-benzthiazoline sulfonate(6)] are added per well.
Reactions were allowed to continue for l hour at room temperature. The absorbance at 05 nm is then measured spectrophotometrically.
In preliminary studies, an increase in affinity was observed for the humanized an.ibodies of Example 4, which contained the Pfhzhc2-6 heavy chain construct, as compared to the Pfhzhc2-3 heavy chain construct.

Example 6 - Construction of Chimeric Antibody A chimeric antibody of the invention was constructed essentially as described above. A chimeric antibody contains the native murine NSF2 variable framework and CDR regions on the human constant regions selected for the heavy chain [H. Dersimonian et al., J.
Immunol., 139:2496-2501 (1987) and light chain tKlobeck et al., Nucl. Acids. Res., 13:6515-6529 (1985)], with the exception that the variable regions were obtained by PCR
of the RNA of the murine antibody obtained from the NFS2 hybridoma and the entire constant regions of the human IgG1 antibodies were synthesized by overlapping oligonucleotides and amplified by PCR. Any errors which were inserted by PCR were corrected. The resulting ,- W094/0569~ PCT/~'S93/0~35 ~143~17 ~.h; meric heavy chain and chimeric light chain were expressed as described above for the humanized antibody.
This chimeric antibody is advantageous in that it is characterized by activity substantially identical to that of the native murine antibody, but contains enough human sequences that it is anticipated to be useful in human therapy.

ExamPle 7 - ISI Assav The Inhibition of Sporozoite Invasion assay is performed as described in M. R. Hollingdale et al., J.
Immunol., 132:509-913 (1984) to be used to assess neutralizing effect against live P. falciparum sporozoites. In the ISI assay, the human hepatoma cloned cell line HepG2-~162 was grown to near confluency on 1%
CO2 glass cover slips in MEM and 10% bovine fetal serum.
Antisera or purified antibodies were diluted in culture medium (see table below) and added to the cell cultures.
30,000 P. falciparum sporozoites isolated from dissected mosquito salivary glands are counted, diluted and added to each cell culture. The cultures are incubated at 37C
for 2.5 hours, rinsed with PES, and fixed with methanol.
Fixed cultures are reacted in an immunoperoxidase antibody assay using a labelled mAb which recognizes the P. fal ciparum CS protein to visuali~e invaded sporozoites. Then, the number of invading sporozoites are counted by phase microscopy at 400x. The ISI is the percent reduction in invasion in the presence of the test antibody, the humanized antibody, as compared to a control (i.e. non-related) antibody. The assay ranks antibodies in order according to their relative potency.
The following table provides the results performed on the chimeric and synthetic antibodies described previously. Values given are percent inhibition and are the average of 2-3 independent assays.

, ~ 094/0~690 PCT/~IS93/0~3~
214~

__________ _________________________________ Summarv of ISI Studies In ~g/ml: 20 lO 5.0 2.0 1.00.1 Chimeric 9998.5 98 88 83 50 PfHzhc2-3/lcl-1 9275.5 60 Pf~zhc2-3/lc1-2 8580.0 O
PfHzhc2-6/lcl-1 9O.o 75 ~3 o PfHzhc2-6/lc1-2 87.0 65 50 O

Numerous modifications and variations of the present invention are included in the above-identified specification and are expected to be obvious to one of skill in the art. For example, recombinant antibodies capable of neutralizing pathogens other than P.
falciparu~ may be provided according to the teachings of this lnvention for the development of prophylactic agents capable of conferring passive immunity to other human diseases. Preferably, engineered antibodies capable of recognizing repeat regions on other malaria pathogens or engineered antibodies to any region on the surface of any stages of the life-cycle of the plasmodium species or capable of neutralizing any stage in the life cycle of the parasite, are desirable starting materials to develop passive ; mmlln; ty agents according to this invention.
Such modifications and alterations to the compositions and processes o~ the present invention are believed to be encompassed in the scope of the claims appended hereto.

t ~ U'~9~/05690 PCT/US93/08~35 21~3417 SEQUENCE LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: SmithKline Beecham, Corporation U. S. Government, Secretary of the Navy U. S. Government, Secretary of the Army (ii) TITLE OF INVENTION: Novel Antibodies for Conferring Passive Immunity Against Infection ~y a Pathogen in Man (iii) NUMBER OF SEQUENCES: 61 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Howson and Howson (B) STREET: Box 457, 321 Norristown Road (C) CITY: Spring House (D) STATE: PA
(E) COUNTRY: USA
(F) ZIP: 19477 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
(A) APPLICATION NUMBER: US 07/941,654 (B) FILING DATE: 09-SEP-1992 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Bak, Mary E.
(B) REGISTRATION NUMBER: 31,215 (C) REFERENCE/DOCKET NUMBER: SBC P50107 (ix) TELECOMMUNICATION INFORMATION:
(A~ TELEPHONE: (215) 540-9200 (B) TELEFAX: (215) 540-5818 ' ~ ' ~,~094/05690 PCT/US93/0~3~

(2~ INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 164 amino acids (B) TYPF: amino acid (D) TOPOLOGY: unknown (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:
Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn ~ro Asn Ala 3a Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro ~0 55 60 Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro=Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro llO 115 120 Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Val Asp Pro Asn Val Asp Pro Asn Val Asp Pro Asn Val Asp Pro (2) INFORMATION FOR SEQ ID NO:2:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTE: 163 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown -~ ' ~VO9~/0~690 PCT/US93/08435 21~3~17 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Met Asp Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn,Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Val Asp Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Ala Asn Pro Asn Val Asp Pro Leu Arg Arg Thr His Arg Gly Arg His His Arg Arg His Arg Cys Gly Cys Trp Arg Leu Tyr Arg Arg His His Arg Trp Gly Arg Ser Gly Ser (2) INFORMATION FOR SEQ ID NO:3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 339 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATUR~:
(A) NAME/KEY: CDS
(B) LOCATION: 1..339 ' ~ 'W~94/~5690 ' PCT/US93/08~35 2~3~ ~ 7 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ala Val Ser Val Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser ~5 20 25 CTT TTA TAT AGT AGC AAT CAA AAG AAT TAC TTG GCC~TGG TAC 126 Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Arg Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val L~s Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile AAA
Lys (2) INFORMATION FOR SEQ ID NO:4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 113 amino acids (B) TYPE: amino acid (D) TOPOLO&Y: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:
Asp Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ala Val Ser Val -' ~ ~W094/0~690 ' P~T/US93/08~35 21~3~7 Gly Glu Lys Val Thr Met Ser Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Glr. Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg 5~ 55 60 Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Arg Gly Ser Gly Thr , 75 Asp Phe Thr Leu Thr Ile Ser Ser Val Lys Ala Glu Asp Leu Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys (2) INFORMATION FOR SEQ ID NO:5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 339 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..339 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser l 5 10 Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr ~ WO9~/~5~90 ~ PCT/US93/08~35 Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile AAA 33g Lys (2) INFORMATION FOR SEQ ID NO:6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 113 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:
Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr , W~94/05690 ~ ,' PCT/US93/0~3~
~ 21~3417 Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala go Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly 9~ 100 105 Gly Gly Thr Lys Val Glu Ile Lys t2) INFORMATION FOR SEQ ID NO:7:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 339 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATUR~:
(A) NAM~/KEY: C~S
(B) LOCATION: 1..339 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp GCG TCG ACT AGG GAA TCT GG& GTA CCT GAC CGA TTC AGT GGC 210 Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu . ~ WO9~/05~90 1 ,' PCT/US93/~43~
21~3417 Gln Ala-Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr g0 95 Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile AAA
Lys (2) INFORMATION FOR SEQ ID NO:8:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 113 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
Asp Ile Val Met Thr C-ln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys . 45 Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys . , W094/0~690 ' , - PCT/~rS93/08~3~
2143~17 (2) INFORMATION FOR SEQ ID NO:9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 354 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: dou~le (D) TOPOLOGY: un~nown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..354 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Leu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Lys Ile Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr GCC ATG TCT TG& GTT CGC CAG TCT CCA GAG AAG AGG CTG GAG 126 Ala Met Ser Trp Val Arg Gln Ser Pro Glu Lys Arg Leu Glu Trp Val Ala Glu Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu Glu Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Ser Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser ,W09~/~5690 ' ,' PCT/US93/~8~3 '-- ' (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 118 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: pro~ein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:
Leu Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly Ser Leu Lys Ile Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ser Pro Glu Lys Arg Leu Glu Trp Val Ala Glu Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu Glu Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys Ala Ser Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met 95 100 . 105 Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser (2) INFORMATION FOR SEQ ID NO:11:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 389 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..366 -, WO91/~56gO ,~ . PCT/~IS93/08~3 '-- ' 2143~7 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:ll:

Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr TTT AGC AGC TAT GCC ATG AGC TGG GTC CGC CAG GCT~CCA GGG 126 Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly AAA G&T CTA GAG TGG GTC TCA GAA ATT AGT GAT GGT GGT AGT 16O
Lys Gly Leu Glu Trp Val Ser Glu Ile Ser Asp Gly Gly Ser ~5 50 55 Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys CTC ATC TAC TAT GGT TAC GAC GG& TAT GCT ATG GAC TAC TGG 33 Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser (2) INFOR~ATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein , ,WO9~/05690 ~ PCT/US93/~8~3~
.

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly 1 S 10 lS
G1Y Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr ~la Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Glu Ile Ser Asp Gly Gly Ser Tyr'Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Leu Ile Tyr Tyr Gly Tyr Asp g5 100 105 Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 389 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..366 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:
GAG GTG CAG CTG CTC GAG TCT GGG GGA GGC TTG GTA CAG CCT ~ 2 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr , WO9~/0~690 ~ ~ , PCT/US93/08~3~

Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Glu Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile ' 70 Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser 1l5 120 (2) INFORMATION FOR SEQ ID NO:14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:
Giu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu -, ~, WO9~/0~690 ,' ~ PCT/US93/08~35 2I43~17 Glu Trp Val Ser Glu Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser Leu Ile Tyr Tyr Gly Tyr Asp 100 ' 105 Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser t2) INFORMATION FOR SEQ ID NO:15:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

(2) INFORMATION FOR SEQ ID NO:16:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:
Ser Tyr Ala Met Ser -~09~/0~690 1 ,~ PCT/US93/08~3 .-- .

(2) INFORMATION FOR SEQ ID NO:17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) ~OLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

(2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:
Glu Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly (2) INFORMATION FOR SEQ ID NO:l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 39 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

-'09~/05690 ~ ,' PCT/US93/0~35 '--21434~7 (2) INFORMATION FOR SEQ ID NO:20:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 13 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:
Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr (2) INFORMATION FOR SEQ ID NO:21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs (B~ TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

(2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn 1 5 lO
Tyr Leu Ala WO 9~/0~90 ~ , ' , PCrtl~lS93~0~3~

(2) INFORMATION FOR SEQ ID NO:23:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

(2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:
Trp Ala Ser Thr Arg Glu Ser (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

(2) INFORMATION FOR SEQ ID NO:26:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown ,WO 94/0:)69~ PCI /l rS93/08~3~

~3~17 (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:
Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr (2) INFO~MATION FOR SEQ ID NO:27:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 6 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:
Pro Asn Ala Asn Pro Asn (2) INFO~ATION FOR SEQ ID NO:28:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 32 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

(2) INFORMATION FOR SEQ ID NO:29:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) ~, W094/0~690 . ~ PCT/~rS93/08~3~
2143~17 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:

(2) INFORMATION FOR SEQ ID NO:30:
(i) S~QUENCE C~RACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:

(2) INFORMATION FOR SEQ ID NO:31:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 47 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:

(2) INFORMATION FOR SEQ ID NO:3Z:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:

WOg~/05690 ' ' PCT/~;S93/08~3~
'--21~3~

(2) INFORMATION FOR SEQ ID NO:33:
(i) SEQUENCE CH~R~CTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) ~OLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:
Ser Tyr Ala Met Ser (23 INFORMATION FOR SEQ ID NO:34:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 51 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:

(2) INFORMATION FOR SEQ ID NO:35:
~ (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 17 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:
Lys Ser Ser Gln Ser Leu Leu Tyr Ser Ser Asn Gln Lys Asn Tyr Leu Ala ~ WO94/056gO ` PCI/I,iS93/08~3' 2143~17 (2) INFORMATION FOR SEQ ID NO:36:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:

(2) INFORMATION FOR SEQ ID NO:37:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:
Trp Ala Ser Thr Arg Glu Ser (2) INFORMATION FOR SEQ ID NO:38:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:

' ~ ~V094/0~690 ' PCT/~S93/08~3~
2143~17 (2) INFORMATION FOR SEQ ID NO:39:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 9 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:
Gln Gln Tyr Tyr Ser Tyr Pro Arg Thr (2) INFORMATION FOR SEQ ID NO:40:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 21 base pairs (B) TYPE: nucleic acid (C) ST~ANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID ~0:40:
TG&GCGTCGA CTAGGGAATC T 21 (2) INFORMATION FOR SEQ ID NO:41:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 7 amino acids (B) TYPE: amino acid (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:
Trp Ala Ser Thr Arg Glu Ser . ~'.'O 9~/05690 ' PCr/l 'S93/f~)8J.3 `-- ' 2~43~1~

(2) INFORMATION FOR SEQ ID NO:42:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 366 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..366 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:

Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Glu'Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ser Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser ~ 0gl/0~690 . PCT/~IS93/~8~3~
21~417 (2) INFORMATION FOR SEQ ID NO:43:
(i) SEQUENCE CHARACTERISTICS:
(A) ~ENGTH: 122 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:
Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ala Glu Ile Ser Asp Gly Gly Ser Tyr Thr Tyr Tyr Pro Asp Thr Val Thr Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp go Thr Ala Val Tyr Tyr Cys Ala Ser Leu Ile Tyr Tyr Gly Tyr Asp Gly Tyr Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser (2) INFORMATION FOR SEQ ID NO:44:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 97 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) ~'O9~/05690 1 ,' PCT/US93/08~3 -- ' 21~3~

(xi) SE~UENCE DESCRIPTION: SEQ ID NO:44:

(2) INFOR~TION FOR SEQ ID NO:45:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 164 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DF.SCRIPTION: SEQ ID NO:45:

ATGGTG&TAG TTAC 164 (2) INFORMATION FOR SEQ ID NO:46:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 164 base pairs - (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:

GAAACTCATC TACTAT&GTT ACGACGGGTA TGCTATGGAC TAGCTGCCCA 150 W~94/05690 ' .~ ~ PCT/~S93/0813 '-- ' 2143~17 (2) INFORMATION FOR SEQ ID NO:47:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 85 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:

(2) INFORMATION FOR SEQ ID NO:48:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 102 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:

G&CCCGTCAC AGTGTCTGGA TAGTAG&TGT AACTACCACC ATCACTAATT TC 102 (2) INFORMATION FOR SEQ ID NO:49:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 101 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:
CTAAAGGTGA ATCCGCTAGC TGCACAGGAG AGTCTCAG&& ACCCCCCAGG 50 ~'0 g4/0~690 ' . ' PCr/US93/08~3~

~1~3417 (2) INFORMATION FOR SEQ ID NO:50:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 25 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:50:

(2) INFORMATION FOR SEQ ID NO:51:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 28 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:51:

(2) INFORMATION FOR SEQ ID NO:52:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 75 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:52:

, WO9~/0~690 ~ ,~ , PCT/~!S93/0B~3~
2143~7 (2) INFORMATION FOR SEQ ID NO:53:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 90 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:53:

(2) INFORMATION FOR SEQ ID NO:54:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 93 base pairs (B) TYPE: nucleic acid (C~ STRANDEDNESS: single (D) TOPOLOGY: un~nown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:54:
GACAGATTTC ACTCTCACCA TCAGCAGCCT GCAGGCTGAA GATGTG&CAG 50 (2) INFORMATION FOR SEQ ID NO:55:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 86 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) W094/05690 , ~ , PCT/US93/0813~
,--2~3417 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:55:

(2) INFORM~TION FOR SEQ ID NO:56:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 66 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:56:

(2) INFO~MATION FOR SEQ ID NO:57:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 78 base pairs (B) TYPE: nucleic acid (C) STRANDEDN~SS: single (D) TOPOLOGY: unknown - (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:57:

(2) INFORMATION FOR SEO ID NO:58:
(i~ SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown ~ wo s~/0,6sn ' ~ ' ~ PC'r/liS93/08~3' 2143~17 (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:58:

(2) INEO~TION FOR SEQ ID NO:59:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:59:

(2) INFORMATION FOR SEQ ID NO:60:
(i) SEQUENCE CH~RACTERISTICS:
(A) LENGTH: 57 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: double (D) TOPOLOGY: unknown (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/XEY: CDS
(B) LOCATION: 1..57 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:60:

Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser Gly Ala Tyr _ W094/05690 ~ PCT/US93/08~35 21 43~17 (2) INFORMATION FOR SEQ ID NO:61:
(i) SEQU~NCE CHARACTERISTICS:
(A) LENGTH: 19 amino acids (B) TYPE: amino acid (D) TOPOLOC-Y: linear (ii~ MOLECULE TYP~: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:61:
Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser Gly Ala Tyr

Claims (27)

WHAT IS CLAIMED IS:

1. A fusion molecule comprising a first fusion partner nucleotide sequence encoding an amino acid sequence having the antigen specificity of a anti-Plasmodium antibody, operatively linked in frame to a second fusion partner nucleotide sequence.

2. The molecule according to claim 1 wherein said first fusion partner is a synthetic immunoglobulin variable region nucleotide sequence encoding an amino acid sequence comprising a complementarity determining region originating from a Plasmodium antibody, a fragment or allelic variation or modification thereof.

3. The molecule according to claim 2 wherein said second fusion partner is a heterologous immunoglobulin variable framework region.

4. The molecule according to claim 2 wherein said variable region nucleotide sequence is selected from the group consisting of a heavy chain variable region and a light chain variable region.

5. The molecule according to claim 4 selected from the group consisting of (a) a heavy chain nucleotide sequence of Fig. 5 (SEQ ID NO: 11);
(b) a heavy chain nucleotide sequence of Fig. 6 (SEQ ID NO: 13);
(c) a light chain nucleotide sequence of Fig. 2 (SEQ ID NO: 5) and Fig. 3 (SEQ ID NO: 7).
(d) a light chain nucleotide sequence of Fig. 3 (SEQ ID NO: 7); and (e) functional fragments thereof.

6. The molecule according to claim 4 wherein said first fusion partner nucleotide sequence comprises a sequence selected from the group consisting of (a) AGCTATGCCATGAGC: SEQ ID NO: 15;
(b) GAAATTAGTGATGGTGGTAGTTACACCTACTATCCA
GACACTGTGACGGGC: SEQ ID NO: 17;
(c) CTCATCTACTATGGTTACGACGGGTATGCTATGGAC
TAC: SEQ ID NO: 19;
(d) AAGAGCTCTCAGAGCCTTTTATACTCGAGCAATCAA
AAGAATTACTTGGCC: SEQ ID NO: 21;
(e) TGGGCGTCAACTAGGGAATCT: SEQ ID NO: 23;
(f) CAGCAATATTATAGCTATCCGCGGACG: SEQ ID
NO: 25;
(g) AGCTATGCCATGTCT: SEQ ID NO: 32;
(h) AAGTCCAGTCAGAGCCTTTTATATAGTAGCAATCAAA
AGAATTACTTGGCC: SEQ ID NO: 3 4;
(i) TGGGCATCCACTAGGGAATCT: SEQ ID NO: 36;
(j) CAGCAATATTATAGCTATCCTCGGACG: SEQ ID
NO: 38;
(k) TGGGCGTCGACTAGGGAATCT: SEQ ID NO: 41;
and an allelic variation or modification thereof, characterized by the antigen specificity of murine NFS2, said nucleic acid sequence optionally containing restriction sites to facilitate insertion into a desired antibody framework region or a plasmid vector.

7. A synthetic immunoglobulin variable region nucleotide sequence encoding an amino acid sequence comprising a complementarity determining region originating from a Plasmodium antibody, a fragment or allelic variation or modification thereof.

8. A fusion protein comprising a first amino acid sequence derived from a Plasmodium antibody capable of binding an epitope on a selected Plasmodium species, said sequence having the antigen specificity of said antibody fused to a heterologous second amino acid sequence.

9. The fusion protein according to claim 8 wherein said first amino acid sequence comprises an amino acid sequence selected from the group consisting of:
(a) a variable heavy chain sequence of said antibody;
(b) a variable light chain sequence of said antibody;
(c) a complementarity determining region of said antibody; and (d) a functional fragment of (a) through (c).

10. The fusion protein according to claim 8 wherein said fusion protein is selected from the group consisting of (a) a complete engineered antibody, having full length heavy and light chains comprising at least fragments of the variable regions derived from said Plasmodium antibody;
(b) the Fab or (Fab')2 fragment of the engineered antibody of (a);
(c) a dimer formed of heavy chains derived from the engineered antibody of (a);
(d) an Fv fragment of the engineered antibody of (a); and (e) a single-chain antibody derived from the engineered antibody of (a);
said protein having the same specificity as said Plasmodium antibody.

11. An engineered P. falciparum antibody comprising a heavy chain comprising a complementarity determining region derived from the variable heavy chain region of a non-human P. falciparum monoclonal antibody.

12. The antibody according to claim 11 wherein said non-human CDRs are in operative association with one of the group consisting of (a) a selected human antibody heavy chain framework and constant regions; and (b) the heavy chain framework from said antibody and a constant region from a selected human antibody.

13. The antibody according to claim 11 further comprising a light chain selected from the group consisting of (a) a light chain comprising a CDR derived from the variable light chain region of said monoclonal antibody in operative association with selected human antibody light chain framework and constant regions;
(b) the light chain framework from said antibody and a constant region from a selected human antibody;
(c) the complete light chain from said anti-Plasmodium antibody; and (d) the complete light chain from a selected human antibody.

14. The antibody according to claim 11, wherein said heavy chain comprises a variable heavy chain sequence selected from the sequences of Fig. 5 (SEQ ID
NO: 12), Fig. 6 (SEQ ID NO: 14), Pfhzhc2-3 (SEQ ID
NO:14), and Pfhzhc2-6 (SEQ ID NO:42).

15. The antibody according to claim 13 wherein said light chain comprises a variable light chain sequence selected from the sequences of Fig. 2 (SEQ ID
NO: 6) and Fig. 3 (SEQ ID NO: 8).

16. The antibody according to claim 13 wherein light chain complementarity determining region is selected from one or more of the sequences consisting of (a) LysSerSerGlnSerLeuLeuTyrSerSerAsn GlnLysAsnTyrLeuAla: SEQ ID NO: 22;
(b) TrpAlaSerThrArgGluSer: SEQ ID NO: 24;
and (c) GlnGlnTyrTyrSerTyrProArgThr: SEQ ID
NO: 26.

17. The antibody according to claim 11 wherein said heavy chain complementarity determining region is selected from one or more of the sequences consisting of (a) SerTyrAlaMetSer: SEQ ID NO: 16;
(b) GluIleSerAspGlyGlySerTyrThrTyrTyrPro AspThrValThrGly: SEQ ID NO: 18; and (c) LeuIleTyrTyrGlyTyrAspGlyTyrAlaMet AspTyr: SEQ ID NO: 20.

18. An anti-P. falciparum complementarity determining region peptide selected from the group consisting of (a) SerTyrAlaMetSer: SEQ ID NO: 16;
(b) GluIleSerAspGlyGlySerTyrThrTyrTyr ProAspThrValThrGly: SEQ ID NO: 18;
(c) LeuIleTyrTyrGlyTyrAspGlyTyrAlaMet AspTyr: SEQ ID NO: 20;
(d) LysSerSerGlnSerLeuLeuTyrSerSerAsn GlnLysAsnTyrLeuAla: SEQ ID NO: 22;

(e) TrpAlaSerThrArgGluSer: SEQ ID NO: 24;
(f) GlnGlnTyrTyrSerTyrProArgThr: SEQ ID
NO: 26;
and an analog thereof, characterized by the antigen specificity of NFS2.

19. A synthetic immunoglobulin variable chain amino acid sequence comprising a complementarity determining region originating from a Plasmodium antibody in a heterologous variable chain framework, a fragment or analog thereof sharing the anti-Plasmodium antigen specificity of said sequence.

20. The sequence according to claim 19 selected from the group consisting of the amino acid sequences of Fig. 5 (SEQ ID NO: 12), Fig. 6 (SEQ ID NO:
14), Fig. 2 (SEQ ID NO: 6) and Fig. 3 (SEQ ID NO: 8).

21. A monoclonal antibody, other than NFS2, which is capable of binding to a P. falciparum epitope comprising the sequence Pro Asn Ala Asn Pro Asn SEQ ID
NO: 27, a Fab fragment thereof, or a (Fab')2 fragment thereof.

22. A pharmaceutical prophylactic composition comprising a fusion protein or antibody according to any of claims 8 through 21 and a pharmaceutically acceptable carrier or diluent.

23. A pharmaceutical composition according to claim 22 wherein said protein is a humanized P.
falciparum antibody.

24. A recombinant plasmid comprising a nucleic acid sequence of any of claims 1 through 7 in operative association with a regulatory control sequence capable of directing the replication and expression of said nucleic acid sequence in a selected host cell.

25. A mammalian cell line transfected with at least one recombinant plasmid comprising a nucleic acid sequence of any of claims 1 through 7.

26. A method of producing a engineered antibody comprising culturing a mammalian cell line transfected with at least one recombinant plasmid comprising a nucleic acid sequence of any of claims 1 through 7 under suitable conditions permitting expression and assembly of complementary heavy and light chains, and recovering the assembled antibody from the cell culture.

27. The use of a protein or antibody of claims 8 through 21 in the preparation of a pharmaceutical composition suitable for passively protecting a human against infection by a Plasmodium species.