NZ246570A

NZ246570A - Variant polypeptides of human kunitz type protease inhibitor domain 1 of tissue factor pathway inhibitor and compositions thereof

Info

Publication number: NZ246570A
Application number: NZ246570A
Authority: NZ
Inventors: Fanny Norris; Kjeld Norris; Soren Erik Bjorn; Lars Christian Petersen; Ole Hvilsted Olsen
Original assignee: Novo Nordisk As
Priority date: 1992-01-07
Filing date: 1993-01-07
Publication date: 1996-09-25
Also published as: FI943234A0; NO942549L; JPH07504891A; FI943234A; EP0621872A1; CA2127246A1; CZ164494A3; RU94036773A; AU675926B2; IL104324A0; WO1993014122A1; NO942549D0; HUT70293A; HU9401990D0; AU3346093A; ZA9396B

Description

<div class="application article clearfix" id="description"> New Zealand No. 246570 International No. PCT/DK93/000 D5 TO BE ENTERED AFTER ACCEPTANCE AND PUBLICATION Priority dates: "71 * 1 ^'X International fifing date: "7) 11 ^3 Classification:iPcJo'. ClQ.Nis/l5', co"j, C.V0.tsJ5/\O; CiaP3l/oo; Afc>\ K38|SS Publication date: 2 5 SEP 1996 Journal No.: NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION Tatle of invention: A human kunitz-type protease inhibitor variant Name, address and nationality of applicant(s) as iii international application form: NOVO NORDISK A/S, of Novo Alle, DK—2880 Bagsvaerd, Dfenxnark. WO 93/14122 PCT/DK93/00005 1 A HUMAN KUNITZ-TYPE PROTEASE INHIBITOR VARIAN' O LR 57 0 ~ V FIELD OF INVENTION 5 The present invention relates to a variant of a human Kunitz-type protease inhibitor domain, DNA encoding the variant, a method of producing the variant and a pharmaceutical composition containing the variant. 10 BACKGROUND OF THE INVENTION Polymorphonuclear leukocytes (neutrophils or PMNs) and mononuclear phagocytes (monocytes) play an important part in 15 tissue injury, infection, acute and chronic inflammation and wound healing. The cells migrate from the blood to the site of inflammation and, following appropriate stimulation, they release oxidant compounds (02*, 02-, H202 and HOC1) as well as granules containing a variety of proteolytic enzymes. The 20 secretory granules contain, i.a., alkaline phosphatase, metalloproteinases such as gelatinase and collagenase and serine proteases such as neutrophil elastase, cathepsin G and proteinase 3. 25 Latent metalloproteinases are released together with tissue inhibitor of metalloproteinase (TIMP). The activation mechanism has not been fully elucidated, but it is likely that oxidation of thiol groups and/or proteolysis play a part in the process. Also, free metalloproteinase activity is dependent on 3 0 inactivation of TIMP. In the azurophil granules of the leukocytes, the serine proteases neutrophil elastase, cathepsin G and proteinase-3 are packed as active enzymes complexed with glucosaminoglycans. 35 These complexes are inactive but dissociate on secretion to release the active enzymes. To neutralise the protease activity, large amounts of the inhibitors o^-proteinase inhibitor (a.,-Pl) WO 93/14122 PCT/DK93/00005 246570 and a^chymotrypsin inhibitor (a.,-chl) are found xn plasma. However, the PMNs are able to inactivate the inhibitors locally. Thus, ci^-PI which is the most important inhibitor of neutrophil elastase is sensitive to oxidation at the reactive centre (Met-5 358) by oxygen metabolites produced by triggered PMNs. This reduces the affinity of a^-PI for neutrophil elastase by approximately 2000 times. After local neutralisation of o^-PI, the elastase is able to 10 degrade a number of inhibitors of other proteolytic enzymes. Elastase cleaves a.,-ChI and thereby promotes cathepsin G activity. It also cleaves TIMP, resulting in tissue degradation by metalloproteinases. Furthermore, elastase cleaves antithrombin III and heparin cofactor II, and tissue factor 15 pathway inhibitor (TFPI) which probably promotes clot formation. On the other hand, the ability of neutrophil elastase to degrade coagulation factors is assumed to have the opposite effect so that the total effect of elastase is unclear. The effect of neutrophil elastase on fibrinolysis is less ambiguous. 20 Fibrinolytic activity increases when the elastase cleaves the plasminogen activator inhibitor and the a2 plasmin inhibitor. Besides, both of these inhibitors are oxidated and inactivated by 02 metabolites. 25 PMNs contain large quantities of serine proteases, and about 200 mg of each of the leukocyte proteases are released daily to deal with invasive agents in the body. Acute inflammation leads to a many-fold increase in the amount of enzyme released. Under normal conditions, proteolysis is kept at an acceptably low 3 0 level by large amounts of the inhibitors c^-Pl, o^-Chl and a2 microglobulin. There is some indication, however, that a number of chronic diseases is caused by pathological proteolysis due to overstimulation of the PMNs, for instance caused by autoimmune response, chronic infection, tobacco smoke or other irritants, 3 5 etc. Aprotinin (bovine pancreatic trypsin inhibitor) is known to WO 93/14122 PCT/DK93/00005 1 » 24 6 5 7 0 inhibit various serine proteases, including trypsin, chymotrypsin, plasmin and kallikrein, and is used therapeutically in the treatment of acute pancreatitis, various states of shock syndrome, hyperfibrinolytic haemorrhage and 5 myocardial infarction (cf. , for instance, J.E. Trapne.ll et al, Brit. J. Sura 61. 1974, p. 177; J. McMichan et al. , Circulatory shock 9, 1982, p. 107; L.M. Auer et al., Acta Neurochir. 49, 1979, p. 207; G. Sher, Am. J. Obstet. Gvnecol. 129. 1977, p. 164; and B. Schneider, Artzneim. -Forsch. 26. 1976, p. 1606). 10 Administration of aprotinin in high doses significantly reduces blood loss in connection with cardiac surgery, including cardiopulmonary bypass operations (cf., for instance, B.P. Bidstrup et al., J. Thorac. Cardiovasc. Sura. 97. 1989, pp. 364-372; W. van Oeveren et al., Ann. Thorac. Surg. 44. 1987, pp. 15 640-645). It has previously been demonstrated (cf. H.R. Wenzel and H. Tschesche, Anaew. Chem. Internat. Ed. 20. 1981, p. 295) that certain aprotinin analogues, e.g. aprotinin(1-58, Vall5) exhibits a relatively high selectivity for granulocyte elastase and an inhibitory effect on collagenase, aprotinin (1-58, Alal5) 20 has a weak effect on elastase, while aprotinin (3-58, Argl5, Alal7, Ser42) exhibits an excellent plasma kallikrein inhibitory effect (cf. WO 89/10374). However, when administered jn vivo, aprotinin has been found to 25 have a nephrotoxic effect in rats, rabbits and dogs after repeated injections of relatively high doses of aprotinin (Bayer, Trasvlol. Inhibitor of proteinase; E. Glaser et al. in "Verhandlungen der Deutschen Gesellschaft fur Innere Medizin, 78. Kongress", Bergmann, Munchen, 1972, pp. 1612-1614). The 3 0 nephrotoxicity (i.a. appearing in the form of lesions) observed for aprotinin might be ascribed to the accumulation of aprotinin in the proximal tubulus cells of the kidneys as a result of the high positive net charge of aprotinin which causes it to be bound to the negatively charged surfaces of the tubuli.. This 35 nephrotoxicity makes aprotinin less suitable for clinical purposes, in particular those requiring administration of large doses of the inhibitor (such as cardiopulmonary bypass WO 93/14122 PCT/DK93/00005 4 operations). Besides, aprotinin is a bovine protein which may therefore contain one or more epitopes which may give rise to an undesirable immune response on administration of aprotinin to humans. It is therefore an object of the present invention to identify human protease inhibitors of the same type as aprotinin (i.e. Kunitz-type inhibitors) with a similar inhibitor profile or modified to exhibit a desired inhibitor profile. SUMMARY OF THE INVENTION The present invention relates to a variant of human Kunitz-type protease inhibitor domain I of tissue factor pathway inhibitor 15 (TFPI) , the variant comprising the following amino acid sequence XI Cys Ala Phe Lys Ala Asp X2 Gly X3 Cys X4 X5 X6 X7 X8 X9 Phe Phe Phe Asn lie Phe Thr Arg Gin Cys Glu Glu Phe X10 Tyr Gly Gly Cys XII X12 X13 Gin Asn Arg Phe Xu Ser Leu Glu Glu cys X15 X16 Met Cys 20 Thr Arg X17 (SEQ ID No. 1) wherein X1 represents H or 1-7 naturally occurring amino acid residues except Cys, X2-X16 each independently represents a naturally occurring amino acid residue except Cys, and X17 25 represents OH or 1-5 naturally occurring amino acid residues except Cys, with the proviso that at least one of the amino acid residues X1-X17 is different from the corresponding amino acid residue of the native sequence. 3 0 In the present context, the term "naturally occurring amino acid residue" is intended to indicate any one of the 20 commonly occurring amino acids, i.e. Ala, Val, Leu, lie Pro, Phe, Trp, Met, Gly, Ser, Thr, Cys, Tyr, Asn, Gin, Asp, Glu, Lys, Arg and His. TFPI, also known as extrinsic pathway inhibitor (EPI) or lipoprotein associated coagulation inhibitor (LACI), has been 5 10 35 WO 93/14122 PCT/DK93/00005 30 246 5 7 0 isolated by Broze et al. (Proc. Natl. Acad. Sci. USA §4., 1987, pp. 1886-1890 and EP 300 988) and the gene coding for the protein has been cloned, cf. EP 318 451. Analysis of the secondary structure of the protein has shown that the protein 5 has three Kunitz-type inhibitor domains, from amino acid 22 to amino acid 79 (I), from amino acid 93 to amino acid 150 (II) and from amino acid 185 to amino acid 242 (III) . Kunitz-type domain I of TFPI has been shown to bind TF/FVIIa, while Kunitz-type domain II has been shown to bind to FXa (Girard et al., Nature 10 338. 1989, pp. 518-520). By substituting one or more amino acids in one or more of the positions indicated above, it may be possible to change the inhibitor profile of TFPI Kunitz-type domain I so that it 15 preferentially inhibits neutrophil elastase, cathepsin G and/or proteinase-3. Furthermore, it may be possible to construct variants which specifically inhibit enzymes involved in coagulation or fibrinolysis (e.g. plasmin or plasma kallikrein) or the complement cascade. 20 One advantage of TFPI Kunitz-type domain I is that, it has a negative net charge as opposed to aprotinin which, as indicated above, has a strongly positive net charge. It is therefore possible to construct variants of the invention with a lower 25 positive net charge than aprotinin, thereby reducing the risk of kidney damage on administration of large doses of the variants. Another advantage is that, contrary to aprotinin, it is a human protein (fragment) so that undesir< d immunological reactions on administration to humans are significantly reduced. DETAILED DISCLOSURE OF THE INVENTION Examples of preferred variants of Kunitz-type domain I of TFPI are variants wherein X1 is Ser-Phe or Met-His-Ser-Phe; or wherein 35 X2 is an amino acid residue selected from the group consisting of Ala, Arg, Thr, Asp, Pro, Glu, Lys, Gin, Ser, lie and Val, in particular wherein X2 is Thr or Asp; or wherein X3 is an amino WO 93/14122 PCT/DK93/00005 35 246 5 7 0 acid residue selected from the group consisting of Pro, Thr, Leu, Arg, Val and lie, in particular wherein X3 is Pro or lie; or wherein X4 is an amino acid residue selected from the group consisting of Lys, Arg, Val, Thr, lie, Leu, Phe, Gly, Ser, Met, 5 Trp, Tyr, Gin, Asn and Ala, in particular wherein X4 is Lys, Val, Leu, lie, Thr, Met, Gin or Arg? or wherein X5 is an amino acid residue selected from the group consisting of Ala, Gly, Thr, Arg, Phe, Gin and Asp, in particular wherein X5 is Ala, Thr, Asp or Gly; or wherein X6 is an amino acid residue selected from the 10 group consisting of Arg, Ala, Lys, Leu, Gly, His, Ser, Asp, Gin, Glu, Val, Thr, Tyr, Phe, Asn, lie and Met, in particular wherein X6 is Arg, Phe, Ala, lie, Leu or Tyr; or wherein X7 is an amino acid residue selected from the group consisting of lie, Met, Gin, Glu, Thr, Leu, Val and Phe, in particular wherein X7 is lie; 15 or wherein X8 is an amino acid residue selected from the group consisting of lie, Thr, Leu, Asn, Lys, Ser, Gin, Glu, Arg, Pro and Phe, in particular wherein X8 is lie or Lys; or wherein X9 is an amino acid residue selected from the group consisting of Arg, Ser, Ala, Gin, Lys and Leu, in particular wherein X9 is Arg; or 20 wherein X10 is an amino acid residue selected from the group consisting of Gin, Pro, Phe, lie Lys, Trp, Ala, Thr, Leu, Ser, Tyr, His, Asp, Met, Arg and Val, in particular wherein X10 is Val or lie; or wherein X11 is an amino acid residue selected from the group consisting of Gly, Met, Gin, Glu, Leu, Arg, Lys, Pro and 25 Asn, in particular wherein X11 is Arg or Glu; or wherein X12 is Ala or Gly; or wherein X13 is an amino acid residue selected from the group consisting of Lys, Asn and Asp, in particular wherein X13 is Lys or Asn; or wherein X14 is an amino acid residue selected from the group consisting of Val, Tyr, Asp, Glu, Thr, 30 Gly, Leu, Ser, lie, Gin, His, Asn, Pro, Phe, Met, Ala, Arg, Trp and Lys, in particular wherein X14 is Lys or Glu; or wherein X15 is Lys, Met, Glu or Leu; or wherein X16 is Lys, Ala, Asn or Glu; or wherein X17 is Asp. In a preferred embodiment, X1 is Met-His-Ser-Phe and X17 is Asp, while X2-X16 are as defined above. Variants of TFPI Kunitz-type domain I of the invention should preferably not contain a Met residue in the protease binding WO 93/14122 PCI7DK93/00005 * ' 246570 region (i.e. the amino acid residues represented by X3-X14) . By analogy to al-PI described above, a Met residue in any one of these positions would make the inhibitor sensitive to oxidative inactivation by oxygen metabolites produced by PMNs, and 5 conversely, lack of a Met residue in these positions should render the inhibitor more stable in the presence of such oxygen metabolites. A currently preferred variant of the invention is one in which 10 one or more of the amino acid residues located at the protease-binding site of the Kunitz domain (i.e. one or more of X3-X14 corresponding to positions 13, 15, 16, 17, 18, 19, 20, 34, 39, 40, 41 and 46 of aprotinin) are substituted to the amino acids present in the same positions of native aprotinin. This variant 15 comprises the following amino acid sequence Met His Ser Phe Cys Ala Phe Lys Ala Asp Asp Gly Pro Cys Lys Ala Arg lie lie Arg Phe Phe Phe Asn lie Phe Thr Arg Gin Cys Glu Glu Phe Val Tyr Gly Gly Cys Arg Ala Lys Gin Asn Arg Phe Lys Ser Leu 20 Glu Glu Cys Lys Lys Met Cys Thr Arg Asp (SEQ ID No. 2). In another aspect, the invention relates to a DNA construct encoding a human Kunitz-type inhibitor domain variant according to the invention. The DNA construct of the invention may be 25 prepared synthetically by established standard methods, e.g. the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22. 1981, pp. 1859-1869, or the method described by Matthes et al., EMBO Journal 3. 1984, pp. 801-805. According to the phosphoamidite method, 3 0 oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors. Alternatively, it is possible to use genomic or cDNA coding for 35 TFPI Kunitz-type domain I (e.g. obtained by screening a genomic or cDNA library for DNA coding for TFPI using synthetic oligonucleotide probes and isolating the DNA sequence coding for WO 93/14122 PCT/ DK93/00005 / 0 8 0 domain I therefrom) . The DNA sequence is modified at one or more sites corresponding to the site(s) at which it is desired to mutagenesis using synthetic oligonucleotides encoding the 5 desired amino acid sequence for homologous recombination in accordance with well-known procedures. In a still further aspect, the invention relates to a recombinant expression vector which comprises a DNA construct of 10 the invention. The recombinant expression vector may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which 15 exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has 20 been integrated. In the vector, the DNA sequence encoding the TFPI Kunitz-type domain I variant of the invention should be operably connected to a suitable promoter sequence. The promoter may be any DNA 25 sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of the DNA encoding the TFPI Kunitz-type domain I variant of the invention 30 in mammalian cells are the SV 40 promoter (Subramani et al., Mol. Cell Biol, l. 1981, pp. 854-864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222. 1983, pp. 809-814) or the adenovirus 2 major late promoter. Suitable promoters for use in yeast host cells include proraoters from yeast glycolytic 35 genes (Hitzeman et al. , J. Biol. Chem. 255. 1980, pp. 12073-12080; Alber and Kawasaki, J. Mol. AppI. Gen. JL, 1982, pp. 419-434) or alcohol dehydrogenase genes (Young et al., in Genetic introduce amino acid substitutions, e.g. by site-directed WO 93/14122 PCT/DK93/00005 246^70 Engineering of Microorganisms for Chemicals (Hollaender et al, eds.)( Plenum Press, New York, 1982), or the TPli (US 4, 599, 311) or ADH2-4c (Russell et al., Nature 304, 1983, pp. 652-654) promoters. Suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (McKnight et al., The EMBO J. ±, 1985, pp. 2093-2099) or the tpiA promoter. The DNA sequence encoding the TFPI Kunitz-type domain I variant of the invention may also be operably connected to a suitable 10 terminator, such as the human growth hormone terminator (Palmiter et al., op. cit.) or (for fungal hosts) the TPI1 (Alber and Kawasaki, op. cit.) or ADH3 (McKnight et al., op. cit.) promoters. The vector may further comprise elements such as polyadenylation signals (e.g. from SV 40 or the adenovirus 5 15 Elb region), transcriptional enhancer sequences (e.g. the SV 40 enhancer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs). The recombinant expression vector of the invention may further 20 comprise a DNA sequence enabling the vector to replicate in the host cell in question. An examples of such a sequence (when the host cell is a mammalian cell) is the SV 40 origin of replication, or (when the host cell is a yeast cell) t le yeast plasmid 2n replication genes REP 1-3 and origin of replication. 25 The vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or one which confers resistance to a drug, e.g. neomycin, hygromycin or methotrexate, or the Schizosaccharomvces pombe TPI gene 30 (described by P.R. Russell, Gene 40. 1985, pp. 125-130. The procedures used to ligate the DNA sequences coding for the TFPI Kunitz-type domain I variant of the invention, the promoter and the terminator, respectively, and to insert them into 35 suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., Molecular Cloning; A Laboratory WO 93/14122 PCT/DK93/00005 246 5 7 0 10 Manual. Cold Spring Harbor, New York, 1989). The host cell into which the expression vector of the invention is introduced may be any cell which is capable of producing the 5 TFPI Kunitz-type domain I variant of the invention and is preferably a eukaryotic cell, such as a mammalian, yeast or fungal cell. The yeast organism used as the host cell according to the 10 invention may be any yeast organism which, on cultivation, produces large quantities of the TFPI Kunitz-type domain I variant of the invention. Examples of suitable yeast organisms are strains of the yeast species Saccharomvces cerevisiae. Saccharomvces kluweri. Sch i z osa cchar omvces pombe or 15 Saccharomvces uvarum. The transformation of yeast cells may for instance be effected by protoplast formation followed by transformation in a manner known per se. Examples of suitable mammalian cell lines are the COS (ATCC CRL 20 1650), BHK (ATCC CRL 1632, ATCC CCL 10) or CHO (ATCC CCL 61) cell lines. Methods of transfecting mammalian cells and expressing DNA sequences introduced in the cells are described in e.g. Kaufman and Sharp, J. Mol. Biol. 159. 1982, pp. 601-621; Southern and Berg, J. Mol. AppI. Genet. 1, 1982, pp. 327-341; 25 Loyter et al., Proc. Natl. Acad. Sci. USA 79. 1982, pp. 422-426; Wigler et al., Cell 14. 1978, p. 725; Corsaro and Pearson, Somatic Cell Genetics 2/ 1981, p. 603, Graham and van der Eb, Virology 52, 1973, p. 456; and Neumann et al., EMBO J. 1, 1982, pp. 841-845. Alternatively, fungal cells may be used as host cells of the invention. Examples of suitable fungal cells are cells of filamentous fungi, e.g. Aspergillus spp. or Neurospora spp., in particular strains of Aspergillus orvzae or Aspergillus nicer. 35 The use of Aspergillus spp. for the expression of proteins is described in, e.g., EP 238 023. 30 WO 93/14122 PCT/DK93/00005 11 2 4 8 5 7 0 The present invention further relates to a method of producing a TFPI Kunitz-type domain I variant according to the invention, the method comprising culturing a cell as described above under conditions conducive to the expression of the variant and 5 recovering the resulting variant from the culture. The medium used to cultivate the cells may be any conventional medium suitable for growing mammalian cells or fungal (including yeast) cells, depending on the choice of host cell. The variant 10 will be secreted by the host cells to the growth medium and may be recovered therefrom by conventional procedures including separating the cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium 15 sulfate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography or affinity chromatography, or the like. The present invention also relates to a pharmaceutical 20 composition comprising a TFPI Kunitz-type domain I variant of the invention together with a pharmaceutically acceptable carrier or excipient. In the composition of the invention, the variant may be formulated by any c.t the established methods of formulating pharmaceutical compositions, e.g. as described in 25 Remington's Pharmaceutical Sciences. 1985. The composition may typically be in a form suited for systemic injection or infusion and may, as such, be formulated with sterile water or an isotonic saline or glucose solution. 30 It has surprisingly been found that the TFPI Kunitz-type domain I is in itself capable of inhibiting Cathepsin G. The invention therefore also relates to a pharmaceutical composition for the inhibition of Cathepsin G, the composition comprising human Kunitz-type protease inhibitor domain I of TFPI or a variant 35 thereof as described above and a pharmaceutically acceptable carrier or excipient. WO 93/14122 PCT/DK93/00005 / 0 12 The TFPI Kunitz-type domain I variant of the invention is therefore contemplated to be advantageous to use for the therapeutic applications suggested for native aprotinin or aprotinin analogues with other inhibitor profiles, in particular 5 those which necessitate the use of large aprotinin doses. Therapeutic applications for which the use of the variant of the invention is indicated as a result of its ability to inhibit human serine proteases, e.g. trypsin, plasmin, kallikrein, elastase, cathepsin G and proteinase-3, include (but are not 10 limited to) acute pancreatitis, inflammation, thrombocytopenia, preservation of platelet function, organ preservation, wound healing, shock (including shock lung) and conditions involving hyperfibrinolytic haemorrhage, emphysema, rheumatoid arthritis, adult respiratory distress syndrome, chronic inflammatory bowel 15 disease and psoriasis, in other words diseases presumed to be caused by pathological proteolysis by elastase, cathepsin G and proteinase-3 released from triggered PMNs. Furthermore, the present invention relates to the use of TFPI 20 Kunitz-type inhibitor domain I or a variant thereof as described above for the preparation of a medicament for the prevention or therapy of diseases or conditions associated with pathological proteolysis by proteases released from overstimulated PMNs. As indicated above, it may be an advantage of administer heparin 25 concurrently with the TFPI Kunitz-type inhibitor domain I or variant. Apart from the pharmaceutical use indicated above, TFPI Kunitz-type domain II or a variant thereof as specified above may be 3 0 used to isolate useful natural substances, e.g. proteases or receptors from human material, which bind directly or indirectly to TFPI Kunitz-type domain II, for instance by screening assays or by affinity chromatography. 3 5 The present invention is further illustrated in the following examples which are not in any way intended to limit the scope of the invention as claimed. WO 93/14122 PCT/DK93/00005 * 13 2 4 6 5 7 0 EXAMPLES General Methods 5 Standard DNA techniques were carried out as described (Sambrook, J., Fritch, E.F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, N.Y.). Synthetic oligonucleotides were prepared 10 on an automatic DNA synthesizer (380B, Applied Biosystems) using phosphoramidite chemistry on a controlled pore glass support (Beaucage, S.L., and Caruthers, M.H., Tetrahedron Letters 22. (1981) 1859-1869) . DNA sequence determinations were performed by the dideoxy chain-termination technique (Sanger, F., Micklen, 15 S., and Coulson, A.R., Proc.Natl. Acad.Sci. USA 74 (1977) 5463-5467). Polymerase chain reactions (PCR) were performed on a DNA Thermal Cycler (Perkin Elmer Cetus). Amino acid analysis was carried out after hydrolysis in 6M HC1 2 0 at 110"C in vacTj/am-sealed tubes for 24 hours. Analysis was performed on a Beckman 121MB automatic amino acid analyzer modified for microbore operation. N-terminal amino acid sequence analysis was obtained by 25 automated Edman degradation using an Applied Biosystems 470A gas-phase sequencer. Analysis by on-line reverse phase HPLC was performed for the detection and quantitation of the liberated pTH amino acids from each sequencer cycle. 3 0 Molecular weight determination was obtained on a BIO-ION 20 plasma desorption mass spectrometer (PDMS) equipped with a flight tube of approximately 15 cm and operated in positive mode. Aliquots of 5 /il were analyzed at an accelerating voltage set to 15 kV and ions were collected for 5 million fission 3 5 events. The accuracy on assigned molecular ions is approximately 0.1% for well defined peaks, otherwise somewhat less. WO 93/14122 PCT/DK93/00005 * 14 246570 Example 1 Production of the first Kunitz domain of tissue factor pathway inhibitor. TFPI-1. from veast strain KFN-1651 5 cDNA encoding full length TFPI was isolated from the human liver derived cell line HepG2 (ATCC HB 8065) and inserted as a 0.9 kb BamHI-Xbal fragment into a mammalian expression vector, pKFN— 1168, as described (Pedersen, A.H., Nordfang, O., Norris, F., Wiberg, F.C., Christensen, P.M., Moeller, K.B., Meidahl-10 Pedersen, J., Beck, T.C., Norris, K., Hedner, U., and Kisiel, W. 1990, J.Biol.Chem. 265. 16786-16793). The DNA sequence of the insert is given in SEQ ID No. 3. TFPI-1 is encoded by nucleotides 152-325 as indicated. 15 TFPI-1: 0.1 fig of the 0.9 kb BamHI-Xbal fragment from pKFN-1168 was used as a template in a PCR reaction containing 100 pmole each of the primers NOR-2524 (GCTGAGAGATTGGAGAAGAGAATGCATTCATTTTGTGC) and NOR-2 52 5 (TAATCCTTCTAGATTAATCTCTTGTACACAT). The 17 3'-terminal bases of 2 0 NOR-2524 are identical to bases 152 to 168 in the TFPI-1 gene in SEQ ID No. 3, and the 21 5'-terminal bases are identical to bases 215 to 235 in the synthetic leader gene (see SEQ ID No. 5) from pKFN-1000 described below. Primer NOR-2525 is complementary to bases 311 to 325 in SEQ ID No. 3 and has a 5' extension 25 containing a translation stop codon followed by an Xbal site. The PCR reaction was performed in a 100 /xl volume using a commercial kit (GeneAmp, Perkin Elmer Cetus) and the following cycle: 94* for 20 sec, 50* for 20 sec, and 72" for 30 sec. After 30 19 cycles a final cycle was performed in which the 72° step was maintained for 10 min. The PCR product, a 211 bp fragment, was isolated by electrophoresis on a 2% agarose gel. Signal-leader: 0.1 jug of a 0.7 kb PvuII fragment fron pKFN-1000 35 described below was used as a template in a PCR reaction containing 100 pmole each of the primers NOR-1478 (GTAAACGACGGCCAGT) and NOR-2523 (TCTCTTCTCCAATCTCTCAGC). NOR- WO 93/14122 PCT/DK93/00005 I - \ a 5.7 0 1478 is matching a sequence just upstream of the EcoRI site xn SEQ ID No. 5. Primer NOR-2523 is complementary to the 17 31-terminal bases of the synthetic leader gene of pKFN-1000, see SEQ ID No. 5. The PCR reaction was performed as described above, 5 resulting in a 257 bp fragment. Plasmid pKFN-1000 is a derivative of plasmid pTZ19R (Mead, D.A., Szczesna-Skorupa, E. and Kemper, B., Prot. Engin. 2. (1986) 67-74) containing DNA encoding a synthetic yeast signal-leader 10 peptide. Plasmid pKFN-1000 is described in WO 90/10075. The DNA sequence of 235 bp downstream from the EcoRI site of pKFN-1000 and the encoded amino acid sequence of the synthetic yeast signal-leader 15 is given in SEQ ID No. 5. Signal-leader-TFPI-l: Approx. 0.1 fig of each of the two PCR-fragments described above were mixed. A PCR reaction was performed using 100 pinole each of primers NOR-1478 and NOR-2525 20 and the following cycle: 94* for 1 min, 50* for 2 min, and 72° for 3 min. After 16 cycles a final cycle was performed in which the 72° step was maintained for 10 min. The resulting 443 bp fragment was purified by electrophoresis on 25 a 1% agarose gel and then digested with EcoRI and Xbal. The resulting 412 bp fragment was ligated to the 9.5 kb Ncol-Xbal fragment from pMT636 and the 1.4 kb NcoI-EcoRI fragment from pMT636. Plasmid pMT636 is described in WO 89/01968. 30 pMT636 is an £. coli - S. cerevisiae shuttle vector containing the Schizosaccharomvces pombe TPI gene (POT) (Russell, P.R. , Gene 4£ (1985) 125-130), the S. cerevisiae triosephosphate isomerase promoter and terminator, TPIp and TPIt (Alber, T., and Kawasaki, G., J.Mol.Appl.Gen. 1 (1982), 419-434). 35 The ligation mixture was used to transform a competent JS. coli strain (r", m+) selecting for ampicillin resistance. DNA WO 93/14122 PCT/DK93/00005 + z /' • 0 16 sequencing showed that plasmids from the resulting colonies contained the correct DNA sequence for TFPI-1 correctly fused to the synthetic yeast signal-leader gene. 5 One plasmid, pKFN-1603, was selected for further use. The construction of plasmid pKFN-1603 is illustrated in fig. 1. The expression cassette of plasmid pKFN-1603 contains the following sequence: 10 TPIp - KFN1000 signal-leader - TFPI1 - TPIt The DNA sequence of the 412 bp EcoRI-Xbal fragment from pKFN-1603 is shown in SEQ ID No. 7. 15 Yeast transformation: S. cerevisiae strain MT663 (E2-7B XE11-36 a/a, Atpi/Atpi, pep 4-3/pep 4-3) was grown on YPGaL (1% Bacto yeast extract, 2% Bacto peptone, 2% galactose, 1% lactate) to an O.D. at 600 nm of 0.6. 20 100 ml of culture was harvested by centrifugation, washed with 10 ml of water, recentrifugated and resuspended in 10 ml of a solution containing 1.2 M sorbitol, 25 mM Na2EDTA pH = 8.0 and 6.7 mg/ml dithiotreitol. The suspension was incubated at 30'C for 15 minutes, centrifuged and the cells resuspended in 10 ml 25 of a solution containing 1.2 M sorbitol, 10 mM Na2EDTA, 0.1 M sodium citrate, pH 0 5.8, and 2 mg Novozym®234. > suspension was incubated at 30°C for 30 minutes, the cells collected by centrifugation, washed in 10 ml of 1.2 M sorbitol and 10 ml of cas (1.2 M sorbitol, 10 mM caci2, 10 mM Tris HC1 (Tris = 30 Tris(hydroxymethyl)aminomethane) pH = 7.5) and resuspended in 2 ml of cas. For transformation, 0.1 fig of plasmid pKFN-1603 and left at room temperature for 15 minutes. 1 ml of (20% polyethylene glycol 4000, 20 mM CaCl2, 10 mM CaCl2, 10 mM Tris HC1, pH = 7.5) was added and the mixture left for a further 30 35 minutes at room temperature. The mixture was centrifuged and the pellet resuspended in 0.1 ml of sos (1.2 M sorbitol, 33% v/v YPD, 6.7 mM CaCl2, 14 /zg/ml leucine) and incubated at 30"C for WO 93/14122 PCI7DK93/00005 17 2 hours. The suspension was then centrifuged ana tnewpellet resuspended in 0.5 ml of 1.2 M sorbitol. Then, 6 ml of top agar (the SC medium of Sherman et al., Methods in Yeast Genetics. Cold Spring Harbor Laboratory (1982)) containing 1.2 M sorbitol 5 plus 2.5%agar) at 52 * C was added and the suspension poured on top of plates containing the same agar-solidified, sorbitol containing medium. Transformant colonies were picked after 3 days at 30 °C, 10 reisolated and used to start liquid cultures. One such transformant KFN-1651 was selected for further characterization. Fermentation: Yeast strain KFN-1651 was grown on YPD medium (1% yeast extract, 2% peptone (from Difco Laboratories), and 3% 15 glucose). A 1 liter culture of the strain was shaken at 30eC to an optical density at 650 nm of 24. After centrifugation the supernatant was isolated. The yeast supernatant was adjusted to pH 3.0 with 5% acetic acid 20 and phosphoric acid and applied a column of S-Sepharose Fast Flow (Pharmacia) and equilibrated with 50 mM formic acid, pH 3.7. After wash with equilibration buffer, the HKI-domain was eluted with 1 M sodium chloride. Desalting was obtained on a Sephadex G-25 column (Pharmacia) equilibrated and eluted with 25 0.1% ammonium hydrogen carbonate, pH 7.9. After concentraton by vacuum centifugation and adjustment of pH 3.0 further purification was performed on a Mono S column (Pharmacia) equilibrated with 50 mM formic acid, pH 3.7. After wash with equilibration buffer, gradient elution was carried out from 0 -30 l M sodium chloride in equilibration buffer. Final purification was performed by reverse phase HPLC on a Vydac C4 column (The Separation Group, CA) with gradient elution from 5-55% acetonitrile, 0.1% TFA. The purified product was lyophilisad by vacuum centrifugation and redissolved in water. Aliquots were analysed by mass PD-mass spectrometry (found: MW 6853,5, calculated: MW 6853-8) and N-terminal amino acid 35 WO 93/14122 18 PCTVDK93/00005 2465 70 sequencing for 45 Edman degradation cycles confirmed the primary structure of the TFPI-1 domain (Table 1) Table 1 5 N-Terminal Sequence Analysis of TFPI-1 Approx. 350 pmol of KFN1651 (HPLC-fraction 18#920327) was analysed. 10 The repetitive yield was xx.x %. Sequencer run#1575. 15 20 25 30 35 40 Cycle Amino Yield Cycle Amino Yield No. acid (pmol) No. acid (pmol) 1 Met 250 31 Glu 19 2 His 47 32 Glu 25 3 ser 69 33 Phe 27 4 Phe 301 34 lie 18 5 Cys - 35 Tyr 16 6 Ala 226 36 Gly 26 7 Phe 201 37 Gly 36 8 Lys 201 38 Cys - 9 Ala 216 39 Glu 11 10 Asp 105 40 Gly 25 11 Asp 117 41 Asn 14 12 Gly 148 42 Gin 15 13 Pro 62 43 Asn 19 14 Cys - 44 Arg 15 15 Lys 78 45 Phe 12 16 Ala 98 46 Glu 17 He 75 47 Ser 18 Met 57 48 Leu 19 Lys 69 49 Glu 20 Arg 48 50 Glu 21 Phe 63 51 Cys 22 Phe 90 52 Lys 23 Phe 99 53 Lys 24 Asn 46 54 Met 25 lie 50 55 Cys 26 Phe 56 56 Thr 27 Thr 25 57 Arg 28 Arg 35 58 Asp 29 Gin 33 30 Cys — The PTH-derivative of Cys is not identified, e.g. cycles 5, 14, 30 and 38. WO 93/14122 PCT/DK93/00005 246 5 70 19 The sequenater was stopped after 60 cycles and the sequence could be deduced for the first 45 amino acids. 5 Example Inhibition of serine proteinases bv TFPI (domain II KFN 1651 KFN 1651 was purified from yeast culture medium. The concentration of KFN 1651 was determined from the absorbance at 10 214 nm using BPTI as a standard. Porcine trypsin and human recombinant factor Vila was obtained from Novo Nordisk A/S (Bagsvaerd, Denmark), bovine chymotrypsin (TLCK treated) was obtained from Sigma Chemical Co. (St. Louis, MO, USA). Human truncated recombinant tissue factor was obtained from Corvas 15 (San Diego, CA, USA). Human neutrophil cathepsin G was purified from extracts of PMNs according to the method described by Baugh and Travis (Biochemistry 15 (1976) 836-843). Peptidyl nitroanilide 2 0 substrates, S2251, S2586, S2288 were from Kabi (Stockholm, Sweden). S7388 was from Sigma Chemical Co. (St. Louis, MO, USA) and FXa-1 was from NycoMed (Oslo, Norway). Serine proteinases were incubated with various concentrations of 25 KFN 1651 for 30 min. Substrate was then added and residual proteinase activity was measured at 405 nm. The results are shown in Table 2. 30 Unmodified TFPI Kunitz domain I (KFN 1651) was found to be an inhibitor of trypsin, chymotrypsin, meutrophil Cathepsin G and factor Vila/tissue factor. WO 93/14122 20 PCT/DK93/00005 O /:; fc-v 7 fl & tf *» > y Table 2 Protease Apparent Ki Trypsin 18 x 10"9 M Chymotryps in 1.2 x 10"6 M Cathepsin 6 87 * 10"9 M Factor VIIa/TF 150 x 10"9 M 50 mM Tris CI, 100 mM NaCl, pH 7.4. 10 WO 93/14122 PCT/DK93/00005 246570 21 SEQUENCE LISTING (1) GENERAL INFCfRMATICN: (i) APPLICANT: (A) NAME: Novo Nordisk A/S (B) STREET: Novo Alle (C) CITY: Bagsvaerd (E) COUNIKY: Denmark (F) POSTAL COEE (ZIP): DK-2880 (G) TEXEFHQNE: +45 4444 8888 (H) TELEFAX: +45 4449 3256 (I) TELEX: 37304 (ii) titlE OF INVEWITCN: A Human Kunitz-Type Protease Inhibitor Variant (iii) NUMBER OF SEQUENCES: 8 (iv) COMPUTER READABLE FORM: (A) MEDIUM TXH2: Floppy disk (B) OCMEUIER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DDS (D) SOFTWARE: Patentln Release #1.0, Version #1.25 (EPO) (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) IENGIH: 55 amino acids (B) TYPE: amino acid (D) TOPOIOGY: linear (ii) M3LEOJLE TYEE: protein (vi) ORIGINAL SOURCE: (A) ORGANISM: synthetic (xi) SEQUENCE DESCRIPnQN: SEQ ID NO: 1: Xaa Cys Ala Rie lys Ala Asp Xaa Gly Xaa Cys Xaa Xaa Xaa Xaa Xaa 15 10 15 Xaa Fhe Rie Rie Asn lie Phe Ihr Arg Gin Cys Glu Glu Rie Xaa Tyr Gly Gly Cys Xaa Xaa Xaa Gin Asn Arg Rie Xaa Ser leu Glu Glu Cys 20 25 30 35 40 45 Xaa Xaa Met 50 Cys Thr Arg Xaa 55 (2) INFORMATION FOR SEQ ID NO: 2: PCT/DK93/00005 2465 70 (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 58 amino acids (B) TYPE: amino acid (D) TOFOIOGY: linear (ii) MOLECULE TYPE: protein (vi) ORIGINAL SOURCE: (A) ORGANISM: synthetic (xi) SEQUENCE EESCRIFTICN: SE3Q ID NO: 2: Met His Ser Fhe Cys Ala Phe lys Ala A«sp Asp Gly Pro Cys lys Ala 15 10 15 Arg lie lie Arg Rie Rie Rie Asn lie Rie Thr Arg Gin Cys Glu Glu 20 25 30 Rie Val Tyr Gly Gly Cys Arg Ala Lys Gin Asn Arg Rie Glu Ser Leu 35 40 45 Glu Glu cys lys lys Met Cys Thr Arg Asp 50 55 (2) INFORMATION K3R SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 945 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOFOIOGY: linear (ii) M3IECULE TYPE: CENA (vi) ORIGINAL SOURCE: (A) ORGANISM: Homo sapiens (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 152..325 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GGATCOGAAT TOCAOCATGA AGAAAGTACA TGCACTTCGG GCTTCTGIAT GCCTGCIGCT 60 TAATCTTGCC OCTGOOOCTC TEAATGCTGA TTCTGAGGAA GAIGAAGAAC ACACAATTAT 120 CACAGAXAOG GAGTDGOCAC CACTGAAACT T A!IG CAT TCA TTT TG7T GCA TTC 172 Met His Ser Rie Cys Ala Rie 1 5 AAG GOG GAT GAT GGC OCA TGT AAA GCA ATC AUG AAA AGA TTT TIC TTC 220 Lys Ala Asp Asp Gly Pro cys Lys Ala lie Met Lys Arg Rie Rie Phe 10 15 20 WO 93/14122 22 WO 93/14122 PCT/DK93/00005 23 24 6 & 7 AAT AIT TIC ACT OGA CAG TGC GAA GAA TTT ATA TAT GGG GGA TGT GAA 268 Asn lie Hie Thr Arg Gin Cys Glu Glu Fhe lie Tyr Gly Gly Cys Glu 25 30 35 GSA AAT CAG AAT OGA TTT GAA ACT CTG GAA GAG TGC AAA AAA ATG TOT 316 Gly Asn Gin Asn Arg Hie Glu Ser Leu Glu Glu Cys Lys Lys Met Cys 40 45 50 55 ACA AGA GAT AATGCAAACA GGAITATAAA GACAACATIG CAACAAGAAA 365 Ihr Arg Asp AGOCAGATTT CIGCOTTIG GAAGAAGAJTC CIGGAATATG TOGAGGITAT ATTACCAGGT 425 AITl'iTATAA CAATCAGACA AAACAGIGIG AAOGTTTCAA CTATGGTGGA TGCCTGGGCA 485 AISTGAACAA TTTIGAGACA CTQGAAGAAT GCAAGAACAT TTCTGAAGAT GGTCCGAATG 545 GnTOCAGGT GGATAATIAT GGAAOCCAGC TCAATGCICT GAATAACTCC CIGACTCOGC 605 AATCAACCAA GGITOOCAGC C1T1T1GAAT TTCACGCTCC CTCATGGICT CTCACPCCAG 665 CAGACAGAGG AITCTCTOCT GCCAATGAGA ACAGATTCEA CTACAAITCA GTCATTGGGA 725 AATGCOGOCC ATITAAGEAC AGIGGATSIG GGGGAAATGA AAACAAIHT ACTTCCAAAC 785 AAGAAIGTCT GAGGGCAICT AAAAAAGGET TCATOCAAAG AATATCAAAA GGAQGCCTAA 845 TEAAAACCAA AAGAAAAAGA AAGAAGCAGA GAGIGAAAAT AGCATAIGAA GAGATCTTIG 905 TEAAAAATAT GTCAAITIGT TATAGCAATC TAACTCEAGA 945 (2) DJPDRMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 58 amino acids (B) TYPE: amino acid (D) TOFOIOGY: linear (ii) MDLECLJLE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: Met His Ser Hie Cys Ala Hie lys Ala Asp Asp Gly Pro Cys Lys Ala 15 10 15 lie Met Lys Arg Hie Hie Hie Asn He Phe Thr Arg Gin cys Glu Glu 20 25 30 Hie lie Tyr Gly Gly Cys Glu Gly Asn Gin Asn Arg Phe Glu Ser Leu 35 40 45 Glu Glu Cys lys Lys Met Cys Ihr Arg Asp 50 55 WO 93/14122 PCT/DK93/00005 24 ,, 4 h % (2) INFORMATION PC® SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS: (A) IENGIH: 235 base pairs (B) TYPE: nucleic acid (C) STRANDEENESS: single (D) TOPOLOGY: linear (ii) MOIECUIE TYPE: cENA (vi) ORIGINAL SOURCE: (A) ORGANISM: synthetic (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 77..235 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: GAATTGCATT CAAGAATAGT TCAAACAAGA AGATEACAAA CTATCAATIT CAIACACAAT 60 AIAAAOGAOC AAAAGA MG AAG GCT CTT TTC TTG GIT TTG TCC TTG ATC 109 Met lys Ala Val Ehe Leu Val Leu Ser Leu lie 15 10 GGA TTC TGC TGG GCC CAA OCA CTC ACT GGC GAT GAA TCA TCT GIT GAG 157 Gly Ehe cys Trp Ala Gin Pro Val Thr Gly Asp Glu Ser Ser Val Glu 15 20 25 MT COG GAA GAG TCT CTG ATC ATC GCT GAA AAC ACC ACT TTG GCT AAC 205 lie Pro Glu Glu Ser Leu He He Ala Glu Asn Thr Thr Leu Ala Asn 30 35 40 GIC GOC ATG GCT GAG AGA TTG GAG AAG AGA 235 Veil Ala Met Ala Glu Arg leu Glu lys Arg 45 50 (2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS: (A) LENGIH: 53 amino acids (B) TYPE: amino acid (D) TOFOIOGY: linear (ii) MOLECULE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: Met lys Ala Val Ehe Leu Val Leu Ser Leu lie Gly Fhe Cys Trp Ma 1 5 10 15 Gin Pro Val Thr Gly Asp Glu Ser Ser Val Glu lie Pro Glu Glu Ser 20 25 30 WO 93/14122 PCI7DK93/00005 25 246570 Leu lie lie Ala Glu Asn Ihr ihr Leu Ala Asn Val Ala Met Ala Glu 35 40 45 Arg Leu Glu Lys Arg 50 (2) INFORMATION PCR SBQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 418 base pairs (B) TYPE: nucleic acid (C) STRANDEENESS: single (D) TOFOIOGY: linear (ii) MOLECULE TYPE: cENA (vi) ORIGINAL SOURCE: (A) ORGANISM: synthetic/human (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 77..409 (ix) FEATURE: (A) NAMEyKEY: sigjpeptide (B) LOCATION: 77..235 (ix) FEATURE: (A) NAME^KEY: mat_peptide (B) LOCATION: 236..409 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: GAATTOCATT CAAGAATAGT TCAAACAAGA AGATIACAAA CTATCAATTT CATACACAAT 60 ATAAAOGAOC AAAAGA ATG AAG GCT GTT TTC TTG GTT TIG TOC TTG ATC 109 Met lys Ala Val Ehe Leu Val Leu Ser Leu He -53 -50 -45 GGA TTC TGC TOG GCC CAA CCA GTC ACT GGC GAT GAA TCA TCT GTT GAG 157 Gly Ehe Cys Trp Ala Gin Pro Val Thr Gly Asp Glu Ser Ser Val Glu -40 -35 -30 ATT COG GAA GAG TCT CTG ATC ATC GCT GAA AAC AOC ACT TTG GCT AAC 205 lie Pro Glu Glu Ser Leu He He Ala Glu Asn Thr Thr Leu Ala Asn -25 -20 -15 GTC GOC ATG GCT GAG AGA TTG GAG AAG AGA ATG CAT TCA TIT TGT GCA 253 Val Ala Met Ala Glu Arg Leu Glu lys Arg Met His Ser Ehe Cys Ala -10 -5 15 TTC AAG GOG GAT GAT GGC CCA TGT AAA GCA ATC ATG AAA AGA TTT TTC 301 Ehe lys Ala Asp Asp Gly Pro Cys lys Ala lie Met Lys Arg Rie Rie 10 15 20 WO 93/14122 PCT/DK93/00005 24 6 5 7 0 TIC AAT ATT TTC ACT OGA CAG TCC GAA GAA TTT ATA TAT GGG GGA TCT 349 Hie Asn lie Fhe Thr Arg Gin Cys Glu Glu Fhe lie Tyr Gly Gly Cys 25 30 35 GAA GGA AAT CAG AAT OGA TIT GAA AST CTG GAA GAG TGC AAA AAA ATG 397 Glu Gly Asn Gin Asn Arg Rie Glu Ser Leu Glu Glu Cys Lys Lys Met 40 45 50 TGI ACA AGA GAT TAATCEAGA 418 Cys Ihr Arg Asp 55 (2) INFORMATION FOR SBQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS: (A) IJENGIH: HI amino acids (B) TYPE: amino acid (D) TOFOIOGY: linear (ii) MDLECCJLE TYPE: protein (Xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: Met lys Ala Veil Hie Leu Val leu Ser Leu lie Gly Fhe Cys Trp Ala -53 -50 -45 -40 Gin Pro Val Thr Gly Asp Glu Ser Ser Val Glu lie Pro Glu Glu Ser -35 -30 -25 Leu He lie Ala Glu Asn Thr Ihr Leu Ala Asn Val Ala Met Ala Glu -20 -15 -10 Arg Leu Glu Lys Arg Met His Ser Hie Cys Ala Fhe lys Ala Asp Asp -5 15 10 Gly Pro Cys lys Ala lie Met Lys Arg Fhe Fhe Fhe Asn lie Fhe Thr 15 20 25 Arg Gin Cys Glu Glu Rie He Tyr Gly Gly Cys Glu Gly Asn Gin Asn 30 35 40 Arg Fhe Glu Ser Leu Glu Glu Cys lys lys Met cys Thr Arg Asp 45 50 55 Zj+(>S7e> PCT/ DX91 /00005 2 1 -02- 1994 1. A variant of human Kunitz-type protease inhibitor domain I of tissue factor pathway inhibitor (TFPI), the variant comprising the following amino acid sequence 5 X1 Ser Phe Cys Ala Phe Lys Ala Asp X2 Gly X3 Cys X4 X5 Xs X7 X8 X9 Phe Phe Phe Asn lie Phe Thr Arg Gin Cys Glu Glu Phe X10 Tyr Gly Gly Cys X11 X12 X13 Gin Asn Arg Phe X14 Ser Leu Glu Glu Cys X15 X16 Met Cys Thr Arg X17 wherein X1 represents H or 1-5 naturally occurring amino acid 10 residues except Cys, X2-X15 each independently represents a naturally occurring amino acid residue, and X17 represents OH or 1-5 naturally occurring amino acid residues except Cys, with the proviso that at least one of the amino acid residues X'-X17 is different from the corresponding amino acid residue of the 15 native sequence, and with the further proviso that X4 is not lie. 2. A variant according to claim 1, wherein X1 is Met-His. 3. A variant according to claim 1, wherein X2 is an amino acid residue selected from the group consisting of Ala, Arg, Thr, 20 Asp, Pro, Glu, Lys, Gin, Ser, lie and Val. 4. A variant according to claim 3, wherein X2 is Thr or Asp. 5. A variant according to claim 1, wherein X3 is an amino acid residue selected from the group consisting of Pro, Thr, Leu, Arg, Val and lie. 25 6. A variant according to claim 5, wherein X3 is Pro or lie. ^7 </div>

Claims

<div class="application article clearfix printTableText" id="claims"> CLAIMS 7. A variant according ';o claim 1, wherein X4 is an amino acid residue selected from the group consisting of Lys, Arg, Val, Thr, Leu, Phe, Gly, Ser, Met, Trp, Tyr, Gin, Asn and Ala. 2-t 246570 -39" residue selected from the group consisting of Gin, Pro, Phe, lie, Lys, Trp, Ala, Thr, Leu, Ser, Tyr, His, Asp, Met, Arg and Val. 20. A variant according to claim 19, wherein X10 is Val or lie. 5 21. A variant according to claim 1, wherein Xu is an amino acid residue selected from the group consisting of Gly, Met, Gin, Glu, Leu, Arg, Lys, Pro and Asn. 22. A variant according to claim 21, wherein X11 is Arg or Glu. 23. A variant according to claim 1, wherein X12 is Ala or Gly. 10 24. A variant according to claim 1, wherein X13 is an amino acid residue selected from the group consisting of Lys, Asn and Asp. 25. A variant according to claim 24, wherein X11 is Lys or Asn. 26. A variant according to claim 1, wherein X14 is an amino acid residue selected from the group consisting of Val, Tyr, Asp, 15 Glu, Thr, Gly, Leu, Ser, lie, Gin, His, Asn, Pro, Phe, Met, Ala, Arg, Trp and Lys. 27. A variant according to claim 26, wherein X14 is Lys or Glu. 28. A variant according to claim 1, wherein X15 is Lys, Met, Glu or Leu. 2 0 29. A variant according to claim 1, wherein X16 is Lys, Ala, Asn or Glu. 30. A variant according to claim 1, wherein X17 is Asp. 31. A variant according to claim 1, wherein X1 is Met-His and X15 is Asp. N.Z. PATENT OFFICE 1- AUG 1996 RECEIVED •2ff -30- 246570 32. A variant according tc claim 1 comprising the following amino acid sequence Met His Ser Phe Cys Ala Phe Lys Ala Asp Asp Gly Pro Cys Lys Ala Arg lie lie Arg Phe Phe Phe Asn lie Phe Thr Arg Gin Cys Glu Glu 5 Phe Val Tyr Gly Gly Cys Arg Ala Lys Gin Asn Arg Phe Glu Ser Leu Glu Glu Cys Lys Lys Met Cys Thr Arg Asp. 33. A DNA construct comprising a DNA sequence encoding a human Kunitz-type protease inhibitor variant according to any of claims 1-3 2. 10 34. A recombinant expression vector comprising a DNA construct according to claim 33. 35. A cell containing a DNA construct according to claim 33 or an expression vector according to claim 34. 36. A method of producing a human Kunitz-type protease 15 inhibitor variant according to any one of claims 1-32, the method comprising culturing a cell according to claim 35 under conditions conducive to the expression of the protein, and recovering the resulting protein from the culture. 37. A pharmaceutical composition comprising a human Kunitz-type 2 0 protease inhibitor variant according to any one of claims 1-32 and a pharmaceutically acceptable carrier or excipient. 38. A composition according to claim 37 which further comprises heparin. 39. Use of human Kunitz-type protease inhibitor domain I of 25 TFPI or a variant thereof according to any one of claims 1-32 for the preparation of a medicament for the prevention or treatment of diseases or conditions associated- with pathological proteolysis. N.Z. PATENTJOFFIUS i- m —"wfeSvea l 24 6 57 3 o -3± 40. A variant of human Kunitz-type protease inhibitor domain I substantially as herein described with reference to the accompanying examples. 41. A method of producing a human Kunitz-type protease inhibitor variant substantially as herein described with reference to the accompanying example 1. 42. A variant of human Kunitz-type protease inhibitor domain I as claimed in claim 1 and substantially as herein described with reference to the accompanying examples. 43. A method as claimed in claim 36 and substantially as herein described with reference to the accompanying examples. </div>