CA2127246A1 - A human kunitz-type protease inhibitor variant - Google Patents

Abstract

A variant of human Kunitz-type protease inhibitor domain I of tissue factor pathway inhibitor (TFPI), the variant comprising the following amino acid sequence X1 Cys Ala Phe Lys Ala Asp X2 Gly X3 Cys X4 X5 X6 X7 X8 X9 Phe Phe Phe Asn Ile Phe Thr Arg Gln Cys Glu Glu Phe X10 Tyr Gly Gly Cys X11 X12 X13 Gln Asn Arg Phe X14 Ser Leu Glu Glu Cys X15 X16 Met Cys Thr Arg X17 (SEQ ID No. 1), wherein X1 represents H or 1-7 naturally occurring amino acid residues except Cys, X2-X16 each independently represents a naturally occurring amino acid residue, and X17 represents OH or 1-5 naturally occurring amino acid residues except Cys, with the proviso that at least one of the amino acid residues X1-X17 is different from the corresponding amino acid residue of the native sequence.

Description

W¢n3/14122 PCT/DK93/00005 ,i ~ ?ï ~ 3 . s ~
' A HUMAN KUNITZ-TYPE PROTEASE INHIBITOR VARIANT

FIELD OF INVENTION ~.
The present invention relates to a variant of a human Kunitz- ~ ;
type protease inhibitor domain, DNA encoding the variant, a method of producing the variant and a pharmaceutical composition containing the variant. ;

BACKGROUND OF THE INVENTION

Polymorphonuclear leukocytes (neutrophils or PMNs) and `~
mononuclear phagocytes (monocytes) play an important part in tissue injury, infection, acute and chronic inflammation and wound heaIing. The cells migrate from the blood to the site of inflammation and, following~ appropriate stimulation, they release oxidant compounds (2-' 2-~ H2O2 and HOCl) as well as granules containing a variety of proteolytic enzymes. The 20 secretory granules contain, i.a., alkaline phosphatase, -metalloproteinases such as gelatinase and collagenase and serine proteases such as neutrophil elastase, cathepsin G and ; proteinase 3.
~ .:
,. ..~ ~
Latent metalloproteinases are released together with tissue inhibitor of metalloproteinase tTIMP). The activation mechanism has not been fully elucidated, but it is likely that oxidation of~thiol groups and/or proteolysis play a part in the process.
Also, free metalloproteinase activity is dependent on inactivation of TIMP.

In the azurophil granules of the leukocytes, the serine proteases neutrophil elastase, cathepsin G and proteinase-3 are -~ packed as active enzymes complexed with glucosaminogl~cans.
Thése complexes are inactive but dissociate on secretion to release the active enzymes. To neutralise the protease activity, large amounts of the inhibitors ~1-proteinase inhibitor (~1-PI) ' '

2 PCT/DK93/0000 ~t ~ '? ~ 1 2 and ~1-chymotrypsin inhibitor (~1-ChI) are found in plasma.
However, the PMNs are able to inactivate the inhibitors locally.
Thus, ~1-PI which is the most important inhibitor of neutrophil elastase is sensitive to oxidation at the reacti~e ce~tre (Met-358) by oxygen metabolites produced by triggered PMNs. Thisreduces the affinity of 1-PI for neutrophil elastase by approximately 2000 times.

After local neutralisation of ~1-PI, the elastase is able to degrade a number of inhibitors of other proteolytic enzymes.
Elastase cleaves ~1-ChI and thereby promotes cathepsin G
activity. It also cleaves TIMP, resulting in tissue degradation by metalloproteinases. Furthermore, elastase cleaves antithrombin III and heparin cofactor II, and tissue factor pathway inhibitor (TFPI) which probably promotes clot formation.
On the other hand, the ability of neutrophil elastase to degrade coagulation factors is assumed to have the opposite effect so that the total effect of elastase is unclear. The effect of neutrophil elastase on fibrinolysis is less ambiguous.
.:
Fibrinolytic activity increases when the elastase cleaves the plasminogen activator inhibitor and the ~2 plasmin inhibitor. -Besides, both of these inhibitors are oxidated and inactivated by 2 metabolites.

~-~ 25 ~PMNs contain large quantities of serine proteases, and about 200 - .
~- ~ mg of each of the Ieukocyte proteases are released daily to deal with invasive agents in the body. Acute inflammation leads to a ~- many-fold increase in the amount of enzyme released. Under normal conditions, proteolysis is kept at an acceptably low level by large amounts of the inhibitors ~1-PI, ~1-ChI and ~2 macroglobulin. There is some indication, however, that a number of ch~onic diseases is caused by pathological proteolysis due to overstimulation of the PMNs, for instance caused by autoimmune response, chronic infection, tobacco smoke or other irritants, etc.

; Aprotinin (bovine pancreatic trypsin inhibitor) is known to ',:

W~3/14122 PCT/DK93/0000 inhibit various serine proteases, including trypsin, chymotrypsin, plasmin and kallikrein, and is used therapeutically in ~he treatment of acute pancreatitis, various states of shock syndrome, hyperfibrinolytic haemorrhage and myocardial infarction (cf., for instance, J.E. Trapnell et al, Brit. J. Surq. 61, 1974, p. 177; J. McMichan et al., Circulatorv shock 9, 1982, p. 107;-L.M. Auer et al., Acta Neurochir. 49, 1979, p. 207; G. Sher, Am. J. Obstet. Gynecol. 129, 1977, p.
164; and B. Schneider, Artzneim -Forsch. 26, 1976, p. 1606).
Administration of aprotinin in high doses significantly reduces blood loss in connection with cardiac surgery, including cardiopulmonary bypass operations (cf., for instance, B.P.
Bidstrup et al., J. Thorac. Cardiovasc. Sura. 97, 1989, pp. 364 372; W. van Oeveren et al., Ann. Thorac. Sura. 44, 1987, pp.
640-645). It has previously been demonstrated (cf. H.R. Wenzel and H. Tschesche, Anaew. Chem. Internat. Ed. 20, 1981, p. 295) -~ that certain aprotinin analogues, e.g. aprotinin(l-58, Vall5) exhibits a relatively high selectivity for granulocyte elastase and an inhibitory effect on collagenase, aprotinin (1-58, Alal5) has a weak effect~ on elastase, while aprotinin (3-58, Argl5, Alal7, Ser42j~exhibits an excellent plasma kallikrein inhibitory e~ffect (~cf~. WO 89/10374).
~.
However, when administered n vivo, aprotinin has been found to have a nephrotoxic effect in rats, rabbits and dogs after ~-~ repeated injections of relatively high doses of aprotinin (Bayer, Trasvlol Inhibitor of Proteinase; E. Glaser et al. in ~"Verhandlungen der Deutschen Gesellschaft f~r Innere Medizin, 78. Kongress", Bergmann, Munchen, 1972, pp. 1612-1614). The nephrotoxicity (i.a. appearing in the form of lesions) observed for aprotinin might be ascribed to the accumulàtion of aprotinin - in the proximal tubulus cells of the kidneys as a result of the - high positive net charge of aprotinin which causes it to be bound to the negatively charged surfaces of the tubuli.. This nephrotoxicity makes aprotinin less suitable for clinical purposes, in particular those requiring administration of large ; doses ~of the inhibitor (such as cardiopulmonary bypass WO93/14122 ~ PCT/DK93/0000~.~

operations). Besides, aprotinin is a bovine protein which may therefore contain one or more epitopes which may give rise to an undesirable immune response on administration of aprotinin to humans.
:
It is therefore an object of the present invention to identify .
human protease inhibitors of the same type as aprotinin (i.e.
Kunitz-type inhibitors) with a similar inhibitor profile or -~
. modified to exhibit a desired inhibitor profile.
,~, SU~RY OF THE INVENTION `
.

The present invention relates to a variant of human Kunitz-type ;.~
protease inhibitor domain I of tissue factor pathway inhibitor ~.
15 (TFPI), the variant comprising the following amino acid sequence ~:
. ~
X1 Cys Ala-Phe Lys Ala Asp x2 Gly X3 Cys X4 X5 X6 X7 X8 X9 Phe Phe : Phe Asn Ile Phe Thr Arg Gln Cys Glu Glu Phe X10 Tyr Gly Gly Cys X~ X12 X13 G1n~Asn Arg Phe X14 Ser ~eu Glu Glu Cys X15 X16 Met Cys ~0 Thr Arg X17 (SEQ ID No. l) wherein X1 represents ~ or 1-7 naturally occurring amino acid : residues :except Cys, X2-X16 each independently represents a naturally occurring amino acid residue except Cys, and X17 ~répresents~OH or 1-5 naturally occurring amino acid residues : ~ except~ys~,~ with the proviso that at least one of the amino acid residues:X1-Xl7 is different from the corresponding amino acid res~idue of the native sequence.
' .
In~the present context, the term "naturally occurring amino acid residue" is intended to indicate any one of the 20 commonly :~ occurring amino acids, i.e~ Ala, Val, Leu, Ile Pro, Phe, Trp, Met! Gly, Ser, Thr, Cys, Tyr, Asn, Gln, Asp, Glu, Lys, Arg and ~: His.
~ .: : 35 TFPI, also known as extrinsic pathway inhibitor (EPI) or lipoprotein associated coagulation inhibitor (LACI), has been :

W~Q~/l4122 '~ PCT/DK93/00005 isolated by Broze et al. (Proc. Na~l. Acad. Sci._USA 84, 1987, pp. 1886-1890 and EP 300 988) and the gene coding for the protein has been cloned, cf. EP 318 451. Analysis of the secondary structure of the protein has shown that the protein has three Kunitz-t~pe inhibitor domains, from amino acid 22 to amino acid 79 (I), from amino acid 93 to amino acid 150 (II) and from amino acid 185 to amino acid 242 (III). Kunitz-type domain I of TFPI has been shown to bind TF/FVIIa, while Kunitz-type domain II has been shown to bind to FXa (Girard et al., Nature lo 338, 1989, pp. 518-5~0~.

By substituting one or more amino acids in one or more of the positions indicated above, it may be possible to change the inhibitor profile of TFPI Kunitz-type domain I so that it pref~rentially inhibits neutrophil elastase, cathepsin G and/or proteinase-3. Furthermore, it may be possible to construct variants which specifically inhibit enzymes involved in coagulation or fi~rinolysis (e.g. plasmin or plasma kallikrein) or the complement cascade.
. -One advantage of TFPI Kunitz-type domain I is that it has a negative net charge as opposed to aprotinin which, as indicated above, has a strongly positive net charge. It is therefore possible to construct variants of the invention with a lower positive net charge than aprotinin, thereby reducing the risk of kidney damage on administration of large doses of the variants.
Another advantage is that, contrary to aprotinin, it is a human protein (fragment) so that undesired immunological reactions on administration to humans are significantly reduced.
DETAILED DI`SCLOSURE OF THE INVENTION

Examples of preferred variants of Kunitz-type domain I of TFPI
-~ are variants wherein x1 is Ser-Phe or Met-His-Ser-Phe; or wherein ~- 35 X2 is an amino acid residue selected from the group consisting of Ala, Arg, Thr, Asp, Pro, Glu, Lys, Gln, Ser, Ile and Val, in particular wherein X2 iS Thr or Asp; or wherein X3 is an amino W093/14l22 PCT~DK93/000 acid residue selected from the group consisting of Pro, Thr, Leu, Arg, Val and Ile, in particular wherein X3 is Pro or Ile;
or wherein X4 iS an amino acid residue selected from the group consisting of Lys, Arg, Val, Thr, Ile, Leu, Phe, Gly, Ser, Met, Trp, Tyr, Gln, Asn and Ala, in particular wherein X4 iS Lys, Val, Leu, Ile, Thr, Met, Gln or Arg; or wherein X5 is an amino acid residue selected from the group consisting of Ala, Gly, Thr, Arg, Phe, Gln and Asp, in particular wherein X5 iS Ala, Thr, Asp or Gly; or wherein X6 is an amino acid residue selected from the group consisting of Arg, Ala, Lys, Leu, Gly, His, Ser, Asp, Gln, Glu, Val, Thr, Tyr, Phe, Asn, Ile and Met, in particular wherein X6 is Arg, Phe, Ala, Ile, Leu or Tyr; or wherein X7 is an amino acid residue selected from the group consisting of Ile, Met, 1n, Glu, Thr, Leu, Val and Phe, in particular wherein X7 is Ile;
lS or wherein X8 i5 an amino acid residue selected from the group consisting of Ile, Thr, Leu, Asn, Lys, Ser, Gln, Glu, Arg, Pro and Phe, in particular wherein x8 is Ile or Lys; or wherein X9 is an amino acid residue selected from the group consisting of Arg, ~- Ser, Ala, Gln, Lys and Leu, in particular wherein X~ is Arg; or wherein X10 is an amino acid residue selected from the group consisting of Gln, Pro, Phe, Ile Lys, Trp, Ala, Thr, Leu, Ser, Tyr,~His:, Asp, Met, Arg and Val, in particular wherein X10 is Val or Ile;~or wherein X11 is an amino acid residue selected from the group consisting of Gly, Met, Gln, Glu, Leu, Arg, Lys, Pro and Asn,: in particular wherein X11 is Arg or Glu; or wherein X12 is . Ala or Gly; or wherein X13 iS an amin~ acid residue selected from :~ the group consisting of Lys, Asn and Asp, in particular wherein ' -: X13 is Lys or Asn; or wherein X14 is an amino acid residue selected from the group consisting of Val, Tyr, Asp, Glu, Thr, ~: 30 Gly, Leu, Ser, Ile, Gln, His, Asn, Pro, Phe, Met, Ala, Arg, Trp and Lys, in~particu~ariwherein X14 is Lys or Glu; or wherein X15 is Lys, Met, Glu or Leu; or wherein X1~ is Lys, Ala, Asn or Glu;
or wherein X17 iS Asp. In a preferred embodiment, x1 is Met-His-~: Ser-Phe and X17 iS Asp, while X2-X16 are as defined above.
~- 3S
~-~ Variants of TFPI Kunitz-type domain I of the invention should : preferably not contain a Met residue in the protease binding .

. . . ' ' :
W~3~14122 PCT/DK~3/00005 region (i.e. the amino acid residues represented by X3-X14). By analogy to ~l-PI described above, a Met residue in any one of these positions would make the inhibitor sensitive to oxidative inactivation by oxygen metabolites produced by PMN5, and conversely, lack of a Met residue in these positions should render the inhibitor more stable in the presence of such oxygen metabolites.

A currently preferred variant of the invention is one in which one or more of the amino acid residues located at the protease-binding site of the Kunitz domain (i.e. one or more of X3-X14 -corresponding to positions 13, 15, 16, 17, 1~, 19, 20, 34, 39, 40, 41 and 46 of aprotinin) are substituted to the amino acids present in the same positions of native aprotinin. This variant comprises the following amino acid sequence Met His Ser Phe Cys Ala Phe Lys Ala Asp Asp Gly Pro Cys Lys Ala Arg Ile Ile Arg Phe Phe Phe ~sn Ile Phe Thr Arg Gln Cys Glu Glu Phe Val Tyr Gly Gly Cys Arg Ala Lys ~ln Asn Arg Phe Lys Ser Leu 20 ; Glu Glu Cys Lys Lys Met Cys Thr Arg Asp (SEQ ID No. 2).

In another aspect, the invention relates to a DNA construct encoding~a human Kunitz-type inhibitor domain variant according to the invention. The DNA~ construct of the invention may be prepare`d synthetically by established standard methods, e.g. the ~pbosphoamidite method described by S.L. Beaucage and M.H.
Caruthers, Tetrahedron Letters 22, 1981, pp. 1859-1869, or the -~ ~method described by Matthes et al., EMBO JQurnal 3, 1984, pp.
801-805. According to the phosphoamidite method, oligonucleotides are synthesized, e.g. in an automatic DNA
synthesizer, purified,lannealed, ligated and cloned in suitable vectors.

-Alternatively, it is possible to use genomic or cDNA coding for TFPI Kunitz-type domain I (e.g. obtained by screening a genomic or cDNA library for DNA coding for TFPI using synthetic oligonucleotide probes and isolating the DNA sequence coding for . ~ , domain I therefrom). The DNA sequence is modified at one or more sites corresponding to the site(s) at which it is desired to introduce amino acid substitutions, e.g. by site-directed mutagenesis using synthetic oligonucleotides encoding the desired amino acid sequen~e for homologous recombination in accordance with well-known procedures.

In a still further aspect, the invention relates to a recombinant expression vector which comprises a DNA construct of lo the invention. The recombinant expression vector may be any vector which may conveniently be subjected to recombinant DNA
procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
Alternatively, the vector may be one which, when introduced into a host~ cèll, is integrated into the host cell genome and replica~ed together with the chromosome(s) into which it has been integrated.
. ~, ; In~ the vector, the DNA sequence encoding the TFPI Kunitz-type `
domain I variant of the invention should be operably connected to~a~ suitab~le promoter sequence. The promoter may be any DNA
sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous~ or heterologous to the host cell. Examples of suitable~promoters for directing the transcription of the DNA
encoding the TFPI Kunitz-type domain I variant of the invention in mammalian cells are the SV 40 promoter (Subramani et al., Mol. Ceil Bi'ol. }, 1981, pp. 85i-864), the MT-l (metalloth4Onein gene) promoter (PaImiter et al., Science 222, 1983, pp. 809-814) ~ or the adenovirus 2 major late promoter. Suitable promoters for - - use in yeast host cells include promoters from yaast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255, 1980, pp. 12073-12080; Alber and Xawasaki, J. Mol. Appl. Gen. 1, 1982, pp~ 419-434~ or alcohol dehydrogenase genes (Young et al., in Genetic , ~ ..

,, ,~ - .
. ~:

W~43/14122 PCT~DK93/0000~

Enqineerinq of Microorqanisms for Chemicals (Hollaender et al, eds~), Plenum Press, New York, 1982), or the TPI1 (US 4, 599, 311) or ADH2-4c (Russell et al., Nature 304, 1983, pp. 652-654) promoters. Suitable promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (Mc~night et al~, The EMB0 ~. 4, 1985, pp. 2093-2099) or the tPiA promoter.

The DNA sequence encoding the TFPI Kunitz-type domain I variant of the invention may also be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., oP. cit.) or (for fungal hosts) the TPIl (Alber and Kawasaki, op. cit.) or ADH3 (McKnight et al., ~E~
cit.) promoters. The vector may further comprise elements such as polyadenylation signals (e.g. from SV 40 or the adenovirus 5 Elb region), transcriptional enhancer sequences ~e.g. the SV 40 enhancer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs).
,'':
The~ recombinant expression vector of the invention may further-: 20 comprise~a~`DN~ sequence enabling the vector to replicate in the host cel1~in~question. An examples of such a sequence (when the host cell is a mammalian cell) is the SV 40 origin of replication, or (when the host cell is a yeast cell) the yeast plasmid~2~ replication genes REP 1-3 and origin of replication.
" 25~ The vector may also comprise a selectable marker, e.g. a gene the~product~of which complements a defect in the host cell, such ;~ as~ the gene coding for dihydrofolate reductase (DHFR) or one which confers resistance to a drug, e.g. neomycin, hygromycin or methotrexate, or the SchizosaccharomYces ~ombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130.

The procedures used to ligate the DN~ sequences coding for the ~ ~ TFPI Kunitz-type domain I variant of the invention, the promoter -~ ~ and the terminator, respectively, and to insert them into suitable vectors containing the information necessary for replication, are well known to persons skilled in the art (cf., for instance, Sambrook et al., Molecular Cloninq: A LaboratorY

WO93/14122 PCT/DK93/0000$-Manua , Cold spring Harbor, New York, 1989).

The host cell into which the expression vector of the invention is introduced may be any cell which is capable of producing the TFPI Kunitz-type domain I ~ariant of the invention and is preferably a eukaryotic cell, such as a mammalian, yeast or fungal cell.

The yeast organism used as the host cell according to the invention may be any yeast organism which, on cultivation, produces large quantities of the TFPI Kunitz-type domain I
variant of the invention. Examples of suitable yeast organisms are strains of the yeast species Saccharomvces cerevisiae, Saccharomyces kluvveri, Schizosaccharomyces ombe or Saccharomvces uvarum. The transformation of yeast cells may for instance be effected by protoplast formation followed by transformation in a manner known ~E se.
.
:.
-~ Examples of suitable mammalian cell lines are the COS (ATCC CRL
1650~ BHK ~(ATCC~CRL 1632, ATCC CCL 10) or CHO ~ATCC CCL 61) cell lines. Methods of transfecting mammalian cells and expressing~DNA sequehces introduced in the cells are described in e.g. Kaufman and Sharp, J. Mol. Biol. 159, 1982, pp. 601-621;
Southern and Berg, J. Mol. AP~1. Genet. 1, 1982, pp. 327-341;
Loyter et al., Proc. Natl. Acad._Sci. USA 79, 1982, pp. 422-426;
Wigler et al., ~L~ }4, 1978, p. 725; Corsaro and Pearson, Somatic~Géll Genetics 7, 1981, p. 603, Graham and van der Eb, Viroloqv 52, 1973, p. 456;^ and Neumann et al., EMBO J. 1, 1982, pp. 841-845.
Alternatively, fungal cells may be used as host cells of the invention. Examples of suitable fungal cells are cells of filamentous fungi, e.g. Asperaillus spp. or Neurospora spp., in particular strains of As~eraiIlus orvzae or AsPerqillus ni~er.
The use of As~eraillus spp. for the expression of proteins is described in, e.g., EP 238 023.

-W~3/14122 ~ - PCT/DK93/OOOOS

The present invention further relates to a method of producing a TFPI Kunitz-type domain I variant according to the invention, the method comprising culturing a cell as described above under conditions conducive to the expression of the variant and recovering the resulting variant from the culture.
~ .
The medium used to cultivate the cells may be any conventional medium suitable for growing mammalian cells or fungal (including yeast) cells, depending on the choice of host cell. The variant will be secrete~ by the host cells to the growth medium and may be recovered therefrom by conventional procedures including separating the cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the - supernatant or filtrate by means of a salt, e.g. ammonium lS sulfate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography or af;finity chromatography, or the like.

The present invention also relates to a pharmaceutical ~20 ~Gomposition~comprising a TFPI Kunitz-type domain ~ variant of the~ i~nvention together with a pharmaceutically acceptable carrier~or~excipient. In the composition of the invention, the - variant may be formulated by any of the established methods of formulating pharmaceutical compositions, e.g. as described in 25~ ~Reminqton's Pharmaceutical Sciences, 1985. The composition may ~ typical1y~be in a form suited for systemic injection or infusion - and may~j as such, be formulated with sterile water or an isotonic saline or glucose solution.

It has surprisingly been found that the TFPI Kunitz-type domain I is in itself capa~le of inhibiting Cathepsin G. The invention -~ therefore also relates to a pharmaceutical composition for the ~ ~ inhibition of Cathepsin G, the composition comprising human r'~ ~ Kunitz-type protease inhibitor domain I of TFPI or a variant thereof ~as described above and a pharmaceutically acceptable ~ carrier or excipient.

: ~ ' WO93/1412~ PCT/DK93/0000 _ i.' 12 The TFPI Kunitz-type domain I variant of the invention is therefore contemplated to be advantageous to use for the therapeutic applications suggested for native aprotinin or aprotinin analogues with other inhibitor profiles, in particular S those which necessitate the use of large aprotinin doses.
Therapeutic applications for which the use of the variant of the invention is indicated as a result of its ability to inhibit human serine proteases, e.g. trypsin, plasmin, kallikrein, elastase, cathepsin G and proteinase-3, include (but are not limited to) acute pancreatitis, inflammation, thrombocytopenia, preservation of platelet function, organ preservation, wound healing, shock (including sho~k lung) and conditions involving hyperfibrinolytic haemorrhage, emphysema, rheumatoid arthritis, adult respiratory distress syndrome, chronic inflammatory bowel disease and psoriasis, in other words diseases presumed to be caused by pathological proteolysis by elastase, cathepsin G and proteinase3 released from triggered PMNs.

- ~urthermore, the present invention relates to the use of TFPI Kunitæ-type inhibitor domain I or a variant thereof as described above for the preparation of a medicament for the prevention or therapy of diseases or conditions associated with pathological pr~oteolysis by proteases released from overstimulated PMNs. As --- indiaated above, it may be an advantage of administer heparin , .-concurrently with the TFPI Kunitz-type inhibitor domain I or variant. -','.`

Apart from the pharmaceutical use indicated abo~e, TFPI Kunitz-type domain II or a variant thereof as specified above may be used~ to lsolate~useful natural substances, e.g. proteases or receptors from human material, which bind directly or indirectly to TFPI Kunitz-type domain II, for instance by screening assays or by affinity chromatography.

The present invention is further illustrated in the following examples which are not in any way intended to limit the scope of the invention as claimed.

,~: ....

W~93/14122 ~ ; PCT/DK93/00005 EXAMPLE~

General_Methods Standard DNA techniques were carried out as described (Sambrook, J., Fritch, E.F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, Cold Spring Harbour Laboratory Press, Cold Spring Harbour, N.Y.). Synthetic oligonucleotides were prepared on an automatic DNA synthesizer ~380B, Applied Biosystems) using phosphoramidite chemistry on a controlled pore glass support (Beaucage, S.L., and Caruthers, M.H., Tetrahedron Letters 22, (l98l~ 1859-1869). DNA sequence determinations were performed by the dideoxy chain-termination technique (Sanger, F., Micklen, S., and Coulson, A.R., Proc.Natl. Acad.Sci. USA 74 (1977) 5463-5467). Polymèrase chain reactions (PCR) were performed on a DNA
Thermal Cycler (Perkin Elmer Cetus).

Amino~ acid analysis was carried out after hydrolysis in 6M HCl ~20 ~at~ lQ~~C~in -vacuum-sealed tubes for 24 hours. Analysis was ~-~ performed on a Beckman 12lM8 automatic amino acid analyzer -~ modified for microbore operation.

N-terminal amino acid sequence analysis was obtained by 25~ automated;~Edman degradation using an Applied Biosystems 470A
gas-phas~e~sequencer. AnaIysis by on-line reverse phase HPLC was performed for~the detec~ion and quantitation of the liberated pTH amino acids from each sequencer cycle.

Molecular weight determination was obtained on a BIO-ION 20 plasma desorption mass spèctrometer (PDMS) ~equipped with a - flight tube of approximately 15 cm and operated in positive mode. Aliquots of S ~l were analyzed at an accelerating voltage ~ set to 15 kV and ions were collected for S million fission -~ 3~5 events. The accuracy on assigned molecular ions is approximately ~ O.1% for well defined peaks, otherwlse somewhat less.

, . , WO93tl4122 PcT/DK93/oooQ~
r J . ;..~

ExamPle 1 Production of the first Kunitz domain of tissue factor pathway inhibitor TFPI-1 from ~east strain KFN-1651 cDNA encoding full length TFPI was isolated from the human liver derived cell line HepG2 ~ATCC HB 8065) and inserted as a 0.9 kb BamHI-XbaI fragment into a mammalian expression vector, pKFN-1168, as described (Pedersen, A.H., Nordfang, O., Norris, F., Wiberg, F.C., Christensen, P.M., Moeller, K.B., Meidahl-Pedersen, J., Beck, T.C., Norris, K., Hedner, U., and Kisiel, W.1990, J.Biol.Chem. 26S, 16786-16793). The DNA sequence of the insert is given in SEQ ID No. 3. TFPI-1 is encoded by nucleotides 152-325 as indicated.

TFPI-l: 0.1 ~g of the 0.9 kb BamHI-XbaI fragment from pKFN-1168 - was used as a template~in a PCR reaction containing 100 pmole ea~h of the primers NOR-2524 (GCTGAGAGATTGGAGAAGAGAATGCATTCATTTTGTGC) and NOR-2525 (TAATCCTTCTAGATTAATCTCTTGTACACAT). The 17 3'-terminal bases of 20'~ NOR-2~524 are~identical to bases 152 to 168 in the TFPI-l gene in SEQ~ID-No. 3, ~and the 21 5'-terminal bases are identical to ;' bases 215 to~235 ln the synthetic leader gene (see SEQ ID No. 5) from pKFN-1000 described below. Primer NOR-2525 is complementary to~bases 311 to 32~5 in SEQ ID No. 3 and has a 5' extension containing a translation stop codon followed by an XbaI site.

The P~R reaction was performed in a 100 ~1 volume using a , ~ , ~ commercial kit (GeneAmp, Perkin~Elmer Cetus) and the following ¦~ cycle: 94 for 20 sec, 50 for 20 sec, and 72 for 30 sec. After 19 cycles a final cycle was performed in which the 72 step was maintained for 10 min.'The'PCR product, a 211'bp fragment, was isolated by electrophoresis on a 2% agarose gel.

Signal-leader: 0.1 ~g of a 0.7 kb PvuII fragment from pKFN-1000 ~described below was used as a template in a PCR reaction '- ~ containing 100 pmole each of the primers NOR-1478 GTAAACGACGGCCAG~) and NOR-2523 (TCTCTTCTCCAATCTCTCAGC). NOR-~ , .

W~93/l4l22 ~ 3 ~ PCT/DK93/00005 ~`
1478 is matching a sequence just upstream of the EcoRI site in SEQ ID No. 5. Primer NOR-2523 is complementary to the 17 3'-terminal bases of the synthetic leader gene of pKFN-1000, see SEQ ID No. 5. The PCR reaction was performed as described above, resulting in a 257 bp fragment.

Plasmid pKFN 1000 is a derivative of plasmid pTZ19R (Mead, D.A., Szczesna-Skorupa, E. and Kemper, B., Prot. Engin. 1 (1986) 67-74) containing DNA encoding a synthetic yeast signal-leader ;;
peptide.

Plasmid pXFN-1000 is described in Wo 90/10075. The DNA sequence of 235 bp downstream from the EcoRI site of pKFN-1000 and the encoded amino acid sequence of the synthetic yéast signal-leader 15 is given in SEQ ID No. 5. ;

, ;,., Signal-leader-TFPI-1: Approx. 0.1 ~g of each of the two PCR- ;~
fragments described above were mixed. A PCR reaction was ~-~
p=erf~ormed~using 100 pmole each of~primers NOR-1478 and NOR-2525 ~;
Z0~ àn-d~the-~following~cycle:~ 94 for 1 min, 50 for 2 min, and 72 for ~3~min~ After~16 cycles a final cycle was performed in which ;~;
the 72~ step~was maintained for 10 min~ ;.
, ~
; -The resulting 443 bp fragment was~purified by electrophoresis on 25~ a ~1% ~agàrose~gel~ and then digested with EcoRI and XbaI~ The r ~ult~ing~412 ~bp fragment was~ligated to the 9.5 kb NcoI-XbaI
~ fragment~from~ pNT636 and~the 1~4 kb NcoI-EcoRI fragment from s~ pMT636~Plasmid~pMT6~36 is described in WO 89/01968~

pMT636 is an E. ~1~ - S. cerevisiae shuttle vector containing the Schi~osaccharo~*c~s Domhel TPI genè (POT) (Russell,~ P.R., 9gn~ 40 tl98S) 125-130), the S. cerevisiae triosephosphate isomerase promoter and terminator, TPIp and TPIt (Alber, T., and Kawasaki, G., Mol.~Ap~l.Gen. 1 (1982), 419-434).
-The~ligation mixture was used to transform a competent E. col ~ -. ~ . . .
~ ~ strain (r , m~) selecting for ampicillin resistance. DNA `-~
, ~ .
, : :

WO93/14122 ~J i ~ PCT/DK93/0 sequencing showed that plasmids from the resul~ing colonies contained the correct DNA sequence for TFPI-l correctly fused to the synthetic yeast signal-leader gene.

One plasmid, pKFN-1603, was selected for further use. The construction of plasmid pKFN-1603 is illustrated in fig. 1. /

The expression cassette of plasmid pKFN-1603 contains the following sequence:
TPIp - KFN1000 signal-leader - TFPI1 - TPIT

The DNA sequence~of the 412 bp EcoRI-XbaI fragment from pKFN-- 1603 is shown in SEQ ID No. 7.

Yeast transformation: S. cerevisiae strain MT663 (E2-7B XE11-36 a/ , ~tpi/~tpi, pep 4-3/pep 4-3) was grown on YPGaL (1%~Bacto yeast extract, 2% Bacto peptone, 2% galactose, 1~ lactate) to an O.D.~at;600~nm of~0.6.

20 ; 1~00 ml~of culture was harvested by centrifugation, washed with 10 ml of~;wa~er,~;recentrifugated and resuspended in 10 ml of a solution containir~ 1.2 M sorbitol, 25 mM Na2EDTA pH = 8.0 and .7 mg/ml dithiotr~ l. The suspension was incubated at 30C
for 15 minutes, cen;-ifuged and the cells resuspended in 10 ml 2~5~ of~ a~so~lution containing 1.2 M sorbitol, 10 mM Na2EDTA, 0.1 M
sodium~citrate, pH Q 5.~, and 2 mg Novozym234. The suspension was~lncubated ~at 30C for 30 minutes, the cells collected by centrifugation,~washed in 10 ml of 1.2 M sorbitol and 10 ml of Q S (1.2 M- sorbitol, 10 mM CaC12, 10 mM Tris HCl (Tris =
Tris(hydroxymethyl)aminomethane) pH = 7.5) and resuspended in 2 ml of~ CAS. For transformatlon, 0.1 ~g of plasmid pKFN-1603 and - left at room temperature for 15 minutes. 1 ml of (20%
polyethylene gIycol 4000, 20 mM CaCl2, 10 mM CaCl2, 10 mM Tris ", " . ~
HCl, pH = 7.5) was added and the mixture left for a further 30 minutes at room tenperature. The mixture was centrifuged and the pellet resuspended in 0.1 ml of SoS (1.2 M sorbitol, 33~ v/v ~;~ YPD, 6.7 ~M CaC12, 14 ~g/ml leucine) and incubated at 30C for ,~

,:

. ~
WQ~3/14122 ~ PCT/DK93/00005 , 2 hours. ~he suspension was then centrifuged and the pellet resuspended in 0~5 ml of 1.2 M sorbitol. Then, 6 ml of top agar (the SC medium of Sherman et al~, Methods in Yeast Genetics, Cold Spring Harbor Laboratory (1982)) containing 1.2 M sorbitol plus 2.5%agar) at 52OC was added and the suspension poured on top of plates containing the same agar-solidified, sorbitol containing medium. -.
Transformant colonies were picked after 3 days at 30OC, reisolated and used to start liquid cultures. One such transformant XFN-1651 was selected for further characterization.

Fermentation: Yeast strain KFN-1651 was grown on YPD medium (1%
yeast extract, 2% peptone (from Difco Laboratories), and 3%
glucose). A 1 liter culture of the strain was shaken at 30C to an optical density at 650 nm of 24. After centrifugation the supernatant was isolated.
:,:
.~ :
The yeast supernotant was adjusted to pH 3.0 with 5% acetic acid and phosphoric~acid and applied a column of S-Sepharose Fast Flow (Pharmacia) and equilibrated with 50 mM formic acid, pH

3~.~7.~ After~wash with equilibration buffer, the HKI-domain was elutèd with 1 M sodium chloride. Desalting was obtained on a Sephadex~G-25 column (Pharmacia) equilibrated and eluted with 0.1% ammonium hydrogen carbonate, pH 7.9. After concentraton by vacuum centifugation and adjustment of pH 3.0 further purificat1on was performed on a Mono S column (Pharmacia) equilibrated with 50 mM ~formlc acid, pH 3.7. After wash with ~equilibration buffer, gradient elution was carried out from 0 -1 M sodium chloride in equilibration buffer. Final purificationwas performled by re~erse ~hase HPLC on a Vydac C4 column (The Separation Group, CA) with gradient elution from 5-55%
acetonitrile, 0.1% TFA. The purified product was lyophilised by vacuum centrifugation and redissolved in water.
.:
~` Aliquots were analysed by mass PD-mass spectrometry (found: MW
~ 6853,5, calculated: MW 6853-8) and N-terminal amino acid :~:

.

WO93/14122 PcT/DK93/oooQ~ ~

~ .. .. . .

seguencing for 45 Edman degradation cycles confirmed the primary structure of the TFPI-1 domain (Table 1) .
Table 1 N-Terminal Sequence Analysis of TFPI~
Approx. 350 pmol of KFN1651 (HPLC-fraction 18#920327~ was ;
analysed.
1 0 , The repetitive yield was xx.x %. Seguencer run~l575.
. .~ I .
Cycle Amino Yield Cycle Amino Yield I ~
No. ~ acid (pmol) No. acid_ (pmol) --1 Met 250 31 Glu 19 2 His 47 32 Glu 25 I -~
3 Ser 69 33 Phe 27

4 Phe 301 34 Ile 18 Cys - 35 Tyr 16 I
_ I ~,' 6 Ala 226 36 Gly 26 ¦
~7~ Phe 201 ~ 37 Gly 36 8~ Lys 201 38 Cys -9~ A1a~ ~216 39~ Glu 11 ¦~10~ ;Asp~ 05 ~~40 Gly 25 ¦
2S11~ Asp ~ 117 ~ 41 Asn 14 I
12~ Gly 148 42 Gln 15 ¦
~13 ~ Pro 62 43 Asn 19 I ~
~14 ~ ~ ~ys _ 44 Arg 15 f - ~ 5 ~Lys` 78 45 Phe 12 30~ - ~16~ Ala 98 46 Glù
-17~ Ile~ 75 47 Ser 18 ~ ~ Met 57 48 Leu 1`9 ~ ~ Lys 69 49 Glu ~20 ; ~~ Arg 48 50 Glu ~3~5;- ~2~ Phe 63 ~ 51 Cys ~22~ Phe~ ~ 90 52 Lys ~23- Phe 99 53 Lys - 24 Asn 46 54 Met ;~ 25 i"Ile !~'~ 1 5QI il `55~1 Cys ; ~ , , ~ , . , _ I ! , ~; 40 26 Phe 56 56 Thr 27 Thr 25 57 Arg 28 Arg 35 58 Asp ~29 Gln 33 45~ 30 ~ Cys - -The~PTH-derivative of Cys is not identified, e.g. cycles 5, 14, 30 and 38.~

i.:

W~3/14122 ~ . PCT/DK93/00005 The sequenater was stopped after 60 cycles and the sequence could be deduced for the first 45 amino acids.

Example Inhibition of serine Proteinases by TFPI fdomain I) KFN 1651 KFN 1651 was purified from yeast culture medium. The concentration of KFN 1651 was determined from the absorbance at 10 214 nm using BPTI as a standard. Porcine trypsin and human `-~
recombinant factor VIIa was obtained from Novo Nordisk A/S
(Bagsvaerd, Denmark), bovine chymotrypsin (TLCK treated) was obtained from Sigma Chemical Co. (St. Louis, MO, USA). Human truncated recombinant tissue factor was obtained from Corvas (San Diego, CA, USA).

Human neutrophil cathepsin G was purified from extracts of PMNs according to the method described by Baugh and Travis ~-`
(Biochemistry 15 (1976) 836-843). Peptidyl nitroanilide substrates, S2251, S2586/ S2288 were from Kabi (Stockholm, Sweden)~.~S73~88 was from Sigma Chemical Co. (St. Louis, MO, USA) and FXa-l was from NycoMed (Oslo, Norway). ;
..
Serine proteinases were incubated with various concentrations of ~; 25 KFN 1651 for 30 min. Substrate was then added and residual - proteinase activity was measured at 405 nm. The results are sh~wn in Table 2.
:
Unmodified TFPI Kunitz domain I (KFN 1651) was found to be an inhibitor of trypsin, chymotrypsin, meutrophil Cathepsin G and factor VIIa/tissue factor.

WO93/14122 PCT/DK93/0~0,~

~ .? 20 Table 2 _ __ :~
Protease Apparent Ki _ . . _ - .r . ~ .
Trypsin 18 x 109 M
S Ch~motrypsin 1.2 x 10-6 M ~-Cathepsin G 87 x 10-9 M ~.
Factor VIIa/TF 150 x 10-9 M
I . . _ ., _ __ ,~

50 mM Tris C1, 100 mM NaCl, pH 7.4. ~.

.

;, ~ :::: . :
.

1:

. ~ .
:: :

W ~ /14122 ~ "~,, PCT/DK93/00005 l;

2l SEQUENCE LIS~rrNG :~

(1) GENER~L INFO~M~IION:
(i) APPIIC~NT~
(A) N~ME: Novo Nordisk A/S ~:
(B) S~1~K~ Novo Alle ;~
(C) CITY: Eagsvaerd (E) CW NTRY: Denmark (F) POSr~L CODE (ZIP): DK-2880 :~
(G) TEIErff0NE: +45 4444 8888 (H) TEIEFAX: +45 4449 3256 (I) TELEX: 37304 (ii) TITIE OF INVENTION: A Human Kunitz'Type Protease Inhibitor Variant (iii) NUMBER OF SEQUENCES: 8 -(iv) CrrPUTER REAnaELE FORM:
(A) MEDIUM TYPE.: Floppy disk ~:
(B) CoMPUrER: IBM PC compatible (C) OPERaTING SYSTEM: FC-DOS/MS-D06 .
(D) SO ~ : PatentIn Release #l.o~ Version #1.25 (EPO) (2) INFCF~PIION FOR SEQ ID NO: l:
(i) SEÇUENCE CHPRALT~JSIICS:
(A) LENGTH: 55 amino acids (B) TYPE: amuno acid ;
(D) TOPOL0GY: linear (ii) M~IECULE TYPE: protein (vi) ORIGIN~L SoURCE: : .
(A) ~RGANISM: synthetic (xi) SEQUENCE DESCRIETION: SEQ ID NO: l:
Xaa Cys Ala Phe Lys Ala Asp Xaa Gly Xaa Cys Xaa Xaa Xaa Xaa Xaa l S l0 15 , , , . I , . i ~
Xaa Phe Phe Phe Asn Ilè Phe Thr Arg Gln Cys Glu Gl~ Phe Xaa Tyr :: Gly Gly Cys Xaa Xaa Xaa Gln Asn Arg Phe Xaa Ser Leu Glu Glu Cys ``

Xaa Xaa Met Cys Thr Arg Xaa (2) INFORM~IION FOR SEQ ID ~0: 2:
,:

W O 93/14122 PCT/DK93/0000~

" ~ `' fi !: ~ .:
r.~ i 2 2 (i) SEQUEN OE CH~RACTERISl~lCS:
(A) LENGTH: 58 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear tii) MOLECULE TYPE: protein (vi) ORIvl~L Sa~E: ' ~ ' (A) ORGANI5M: synthetic ~
,.
(xi) SEX~JENCE DESCRIPqION: SEQ ID NO: 2:
Met His Ser Phe Cys Ala Phe Lys Ala Asp Asp Gly Pro Cys Lys Ala -~
l 5 lO 15 ~.-Arg Ile Ile Arg ~he ~he Phe Asn Ile Phe Thr Arg Gln Cys Glu Glu ~he Val Tyr Gly Gly Cys Arg Ala Lys Gln Asn Arg Phe Glu Ser Leu -Glu Glu Cys Lys Lys Met Cys m r Arg Asp 2)~ INa~YYrIoN FOR SEQ ID N0: 3:

(A) LENGTH: 945 base pairs (B) TYPE:~nucleic acid (C) STRANGIrNESS: single (D) T~POLDGY: l m ear : : (ii3 YlLECUIE~IYPE: cCN~
3 C$D~CIaL SCURCS:
(A3 OQGaNISM: Homo sapiens (ix) EE~E:
(A) NPXE/KEY: cr~
(B)~ LDCAIION: 152. 325 :~

(xi) SE~UEN OE DESCFIP1ION: SEQ ID N0: 3:
C~ TGCACTTTGG GCI~n~rAT GCX3~rGCT 60 IAY~rDGCC CCTGCC~CTC Iq~Y~XCnG~ 3~UiGAA Gal~ GAAC ACACAAIIAT 120 ~: CAC~ C~oG GaE3nXioCaC CaCTGAAACT T AIG CAr TCA m TGT GCA TTC 172 ~Met His Ser Phe Cys Ala Phe :~AAG GCG GAT G~T GIGC CC~ TGT AAA GCA ATC ATG AAA AGA m TTC TTC 220 Lys Ala Asp Asp Gly Pro Cys Lys Ala Ile Met Lys Arg Phe Fhe Phe `:

W ~. ~/14122 ~ c~ ; PCT/DK93/00005 ,~

23 :
A~r ATT TTC ACT OGA C~G TGC GAA GAA TIT A~A TAT GGG GGA TGT G~A 268 Asn Ile Phe Thr Arg Gln Cys Glu Glu Phe Ile Tyr Gly Gly Cys Glu GGA AAT CAG A~r OGA IIT GAA AGT CTG GAA GAG TGC AAA AAA ATG TGT 316 Gly Asn Gln Asn Arg Phe Glu Ser Leu Glu Glu Cys Lys Lys Met Cys ACA AGA GAT AAIGC~A~CA GGAr~ATA~A GAC~A ~ C~CAhGAAA 365 :
Thr Arg Asp .-.
AEccAGAIsT ClGCTTTrTG GaALahGarC cTGGAALaIG IOGaGGTr~ ATTACCAGGT 425 ATTTTT~5aA GAAr5Acac~ A~ACh~TGTG AAccrTTcAA GrAIGEIG~a TC~X~n3~GCA 485 `:
AlAIGaACAA TrTDGAGACA CTG~AA~AAT GChAGAAC~T TTGT~AAEaT GGrcoGA~TG 545 GTTTccaGGT GGArAArI~T GGhAOOCRGC TCAATGCTGT GAAI~ACTOC CTGAC~CCGC 605 CC~A GGTTCCC~GC CTTTrDGA~T TTC~OGGTCC CrcArGGIGT CTCACTCCAG 66S
CAGACh-,~GG AITGTGTCGT GCCPAIGaGa AcaGaTTcTA C~AC~AITCA GrCArIGCGA 725 :-A ~ A~TTaAErAc AE~GæarcIG GG-JGAAAIGA AAAcAalTIT ACrrccAAAC 785 ~AAGAarGTcT GxGGGcaTGT AAAAAAGGTT Tc~IocAaAG~ ~ GG~G30CThA 845 TraAAhccAA AAE~aApAALA AAL2~GC~GA G~GTGAAAAT AEca~AIGAA G~GArcTTTG ~05 ;TIAaAAATAT GTEa D GT TATAElaATG TAACTCTAGa 945 t2) INFcq~AIlo~:FoR SEQ ID NO: 4:
s~EllCE~c~T~l~Cs:~ q'`, (A) IENGrH: 58 am mo acids . ~-' (B) TYPE:~amlno acid (D) ~ TOPCLOGY: lmear (xij S~lOE DESCRIP~ ID NO: 4:
llet His Se~ E~ Cys Ala~ Phe Lysj A~a Asp A~p Gly ~ro Cys Lys Ala Ile l~et Lys A~g E~e E~e ~e Asn Ile Phe Thr Arg Gln Cys Glu Glu ~e. Ile T~7r Gly Gly ~ys Glu Gly Asn Gln Asn Arg ~e Glu Ser Leu Glu Glu C~ys Lys Lys Met C~ys Thr Ar~ Asp - ~ : 50 55 ::
,'~ ', ~,:

; ' . ' ' ' ~ ` ' ~ ~j WO 93/14122 ~ ~ t~ PCI/DK93/0000~ G~

24 ~:
(2) ~RMP.l'ION E~R SE~ ID N~: 5:

(A) ~: 235 base pairs (B) T~ cleic acid .. : .
(C) S~: single ~ :
(D) IOPOIDGY: linear tvi) ORIGIN~L Sa~OE: ; .
(A) OR~N~: synthetic (ix) ~:
(A~ E~: CD6 (B) ~:ON: 77... 235 ~.

(xi) SE~PENOE I~ESCRIPIION: SE~Q ID N0: 5:

Aq~aG?~CC A~ ~ A~G GCr Grr llC 11~ GIT 1~ ICC TI~ AIC lO9 M~t Lys Ala Val Phe Leu Val Leu Ser Leu Ile :
l 5 lO

Gly ~e C~;:Trp:Ala Gln ~ro Val n~r Gly Asp Glu Ser Ser Val Glu - ~ ~15 20 25 ~:
A~ COG GA~ ~ 1~ CIG A5C A~C GCl~ GAA AAC ACC AC~ TIG GCr AAC 205 Ile ~ Glu Glu ~ I~u Ile Ile Ala Glu Asn Ihr lhr Leu Ala Asn `
: : ~ 30: 35 40 rG;GC!r GA~ TIG ~G AAG A~ 235 Ala Met~Ala: Glu Ar~ Leu Glu Lys Arg ;~.
45 50 `;
; , :
(2) ~IE~ F~ SEQ ID NO: 6:

(A): ~: 53 amir~ acids (B) TY~: amino acid (xi) SE~IENOE Dl~;~L~ll~N: SEQ ID NO: 6:
t Lys Ala Val E~e Leu Val Leu Ser Ieu Ile Gly ~e Cys Trp Ala ;
l 5 l0 15 Gln ~ro Val l~r Gly Asp Glu Ser Ser Val Glu Ile Pro Glu Glu Ser 20 25 30 ~.
: ~ :
, W(?!~3/14122 ,~, 1, 7 ~ PCI/DK93/000o5 Leu Ile Ile Ala Glu Asn Ihr Ihr Leu Ala Asn Val Ala Met Ala Glu Arg Leu Glu Lys Arg (2) INF~ION F~R S~2 ID ~O: 7:

(A) ~: 418 base pairs (B) T~: nucleic acid (C) SrR~NDElNESS: single (I)) IOPOL~XY: linear (vi) ORIG~L Sa~E:
(A) O~SM: synthetic/human (ix) E~:
(A) NP~/~y: CD6 (B) LOU ~ ON: 77..409 (~) ~:
~ (A) N~ME/XEY: sig_peptide : (B) L~CAIION: 77..... 235 : .:
x3 F~Y~nngE:
(A) Nl~qi~REY: mat_E~ptide . (B) ICl~YFD0N: 236... .409 ~ .
(xi) SEX~IENOE DES~K~ ON: SEQ ID NO: 7:
- GaJ~FX~CAlr CaALai~GbGr I~ C~ A~r~CAA~ CIP3~U4rTr C~C~CACA~r 60 P{~UUOGACC A~ AIG AAG GCT GTT TTC TTG GTT TTG TCC TTG AIC l09 ~: Met Lys Ala Val Phe Leu Val Leu Ser Leu Ile ~: ~53 ~50 -45 OE~ TTC TGC IGG GCC CA~ CC~ GIC ACT GGC G~r GA~ TCA TCT GTT G~G 157 Gly ~he C~s Trp Ala Gln Pro Val Thr Gly Asp Glu Ser Ser Val Glu ATr Cuv GA~ GAG TCr CIG ATC A~C GCT G~A AAC AOC ACr TTG GCr AAC 205 - Ile Pro Glu Glu Ser L~u Ile Ile Ala Glu Asn Thr Thr TPU Ala Asn ~ -25 -20 -15 `::
GTC GCC ATG G~T GAG AG~ TTG G~G A~G AG~ A~G c~r TCA TTT TGr GCA 253 -~: Val Ala Met Ala Glu Arg Leu Glu Lys Arg Met His ~Pr Phe Cys Ala TTC A~G GCG GA~ GAT G C ocA TGT A~A GCA ATC AIG AAA A~A m TTC 301 : - Phe Lys Ala Asp Asp Gly Pro Cys Lys Ala Ile Met Lys Arg Phe Phe ~ 10 15 20 "

, WO 93/14122 PCl /DK93/0000 TrC A~r ATr TrC ACr CG~ ~ ~C GAA GAA Trr ArA q~r GGG GG~ 1~ 349 ~e As~ Ile ~e mr An~ Gln Cys Glu Glu lX~e Ile ~r Gly Gly Cys GA~ GGA AAI~ C~G AAT CGi~ m G~A A~:r crG GAA ~G ~;C A~A AAA A~ 397 Glu Gly As~ Gln Asn Arg E~e Glu Ser Leu Glu Glu Cys Lys Lys M~t-T~ ACA AG~ G~ ~I~a 418 Cys Ihr Ar~ Asp (2) ~lE~:)l~ON F~R SEQ ID NO: 8:

(A) ~: 111 amino acids (B) TYPE: amir~ acid (D) IOPOI~GY: linear (ii) M~L~aJlE TY~E: protein (xi) SE~t)ENCE DES~;KlP~ N0: 8:
~het Lys Ala Val l~e Leu Val Leu Ser Leu Ile Gly Ehe Cys ~p Ala Gln ~ro Val q~r Gly A~p Glu Ser Ser Val Glu Ile ~ro Glu Glu Ser L~u Ile Ile Ala Glu Asn Ihr It~r Leu Ala Asn Val Ala M~:t Ala Glu :~
Arg T~u Glu Lys Ar~g Met His Ser Phe ~rs Ala ~e Lys Ala Asp Asp - Gly ~ Cys: Lys Ala Ile Met Lys Arg E~e E~e l~e Asn Ile ~e l~r ~::: 15 20 25 Arg Gln ~ys Glu Glu ~e Ile l~r Gly Gly Cys Glu Gly Asn Gln Asn Arg ~e Glu Ser Leu Glu Glu ~ys Lys Lys Met Cys Ihr Ar~ Asp ` ! ` ! I , ! I : ~ !
1 ' i~' j :
~:

~ ' .
~`:

Claims (39)

1. A variant of human Kunitz-type protease inhibitor domain I
of tissue factor pathway inhibitor (TFPI), the? variant comprising the following amino acid sequence wherein X1 represents H or 1-5 naturally occurring amino acid residues except Cys, X2-X16 each independently represents a naturally occurring amino acid residue, and X17 represents OH or 1-5 naturally occurring amino acid residues except Cys, with the proviso that at least one of the amino acid residues X1-X17 is different from the corresponding amino acid residue of the native sequence, and with the further proviso that X4 is not Ile.

2. A variant according to claim 1, wherein X1 is Met-His.

3. A variant according to claim 1, wherein X2 is an amino acid residue selected from the group consisting of Ala, Arg, Thr, Asp, Pro, Glu, Lys, Gln, Ser, Ile and Val.

4. A variant according to claim 3, wherein X3 is Thr or Asp.

5. A variant according to claim 1, wnerein X3 is an amino acid residue selected from the group consisting of Pro, Thr, Leu, Arg, Val and Ile.

6. A variant according to claim 5, wherein X3 is Pro or Ile.

7. A variant according to claim 1, wherein X4 is an amino acid residue selected from the group consisting of Lys, Arg, Val, Thr, Leu, Phe, Gly, Ser, Met, Trp, Tyr, Gln, Asn and Ala.

8. A variant according to claim 7, wherein X4 is Lys, Val, Leu, Thr, Met, Gln or Arg.

9. A variant according to claim 1, wherein X5 is an amino acid residue selected from the group consisting of Ala, Gly, Thr, Arg, Phe, Gln and Asp.

10. A variant according to claim 9, wherein X5 is Ala, Thr, Asp or Gly.

11. A variant according to claim 1, wherein X6 is an amino acid residue selected from the group consisting of Arg, Ala, Lys, Leu, Gly, His, Ser, Asp, Gln, Glu, Val, Thr, Tyr, Phe, Asn, Ile and Met.

12. A variant according to claim 11, wherein X6 is Arg, Phe, Ala, Ile, Leu or Tyr.

13. A variant according to claim 1, wherein X7 is an amino acid residue selected from the group consisting of Ile, Met, Gln, Glu, Thr, Leu, Val and Phe.

14. A variant according to claim 13, wherein X7 is Ile.

15. A variant according to claim 1, wherein X8 is an amino acid residue selected from the group consisting of Ile, Thr, Leu, Asn, Lys, Ser, Gln, Glu, Arg, Pro and Phe.

16. A variant according to claim 15, wherein X8 is Ile or Lys.

17. A variant according to claim 1, wherein X9 is an amino acid residue selected from the group consisting of Arg, Ser, Ala, Gln, Lys and Leu.

18. A variant according to claim 17, wherein X9 is Arg.

19. A variant according to claim 1, wherein X10 is an amino acid residue selected from the group consisting of Gln, Pro, Phe, Ile Lys, Trp, Ala, Thr, Leu, Ser, Tyr, His, Asp, Met, Arg and Val.

20. A variant according to claim 19, wherein X10 is Val or Ile.

21. A variant according to claim 1, wherein X11 is an amino acid residue selected from the group consisting of Gly, Met, Gln, Glu, Leu, Arg, Lys, Pro and Asn.

22. A variant according to claim 21, wherein X11 is Arg or Glu.

23. A variant according to claim 1, wherein x12 is Ala or Gly.

24. A variant according to claim 1, wherein X13 is an amino acid residue selected from the group consisting of Lys, Asn and Asp.

25. A variant according to claim 24, wherein X11 is Lys or Asn.

26. A variant according to claim 1, wherein X14 is an amino acid residue selected from the group consisting of Val, Tyr, Asp, Glu, Thr, Gly, Leu, Ser, Ile, Gln, His, Asn, Pro, Phe, Met, Ala, Arg, Trp and Lys.

27. A variant according to claim 26, wherein X14 is Lys or Glu.

28. A variant according to claim 1, wherein X15 is Lys, Met, Glu or Leu.

29. A variant according to claim 1, wherein X16 is Lys, Ala, Asn or Glu.

30. A variant according to claim 1, wherein X17 is Asp.

31. A variant according to claim 1, wherein X1 is Met-His and X15 is Asp.

32. A variant according to claim 1 comprising the following amino acid sequence .

33. A DNA construct comprising a DNA sequence encoding a human Kunitz-type protease inhibitor variant according to any of claims 1-32.

34. A recombinant expression vector comprising a DNA construct according to claim 33.

35. A cell containing a DNA construct according to claim 33 or an expression vector according to claim 34.

36. A method of producing a human Kunitz-type protease inhibitor variant according to any of claims 1-32, the method comprising culturing a cell according to claim 35 under conditions conducive to the expression of the protein, and recovering the resulting protein from the culture.

37. A pharmaceutical composition comprising a human Kunitz-type protease inhibitor variant according to any of claims 1-32 and a pharmaceutically acceptable carrier or excipient.

38. A composition according to claim 37 which further comprises heparin.

39. Use of human Kunitz-type protease inhibitor domain I of TFPI or a variant thereof according to any of claims 1-32 for the preparation of a medicament for the prevention or treatment of diseases or conditions associated with pathological proteolysis.