EP0621872A1 - A human kunitz-type protease inhibitor variant - Google Patents
A human kunitz-type protease inhibitor variantInfo
- Publication number
- EP0621872A1 EP0621872A1 EP93902106A EP93902106A EP0621872A1 EP 0621872 A1 EP0621872 A1 EP 0621872A1 EP 93902106 A EP93902106 A EP 93902106A EP 93902106 A EP93902106 A EP 93902106A EP 0621872 A1 EP0621872 A1 EP 0621872A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- phe
- amino acid
- arg
- variant according
- lys
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/81—Protease inhibitors
- C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
- C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
- C07K14/8114—Kunitz type inhibitors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Definitions
- the present invention relates to a variant of a human Kunitz- type protease inhibitor domain, DNA encoding the variant, a method of producing the variant and a pharmaceutical composition containing the variant.
- Polymorphonuclear leukocytes (neutrophils or PMNs) and mononuclear phagocytes (monocytes) play an important part in tissue injury, infection, acute and chronic inflammation and wound healing.
- the cells migrate from the blood to the site of inflammation and, following appropriate stimulation, they release oxidant compounds (O 2 ⁇ , O 2 -, H 2 O 2 and HOCl) as well as granules containing a variety of proteolytic enzymes.
- the secretory granules contain, i.a., alkaline phosphatase, metalloproteinases such as gelatinase and collagenase and serine proteases such as neutrophil elastase, cathepsin G and proteinase 3.
- Latent metalloproteinases are released together with tissue inhibitor of metalloproteinase (TIMP).
- TIMP tissue inhibitor of metalloproteinase
- the serine proteases neutrophil elastase, cathepsin G and proteinase-3 are packed as active enzymes complexed with glucosaminoglycans. These complexes are inactive but dissociate on secretion to release the active enzymes.
- To neutralise the protease activity large amounts of the inhibitors ⁇ 1 -proteinase inhibitor ( ⁇ 1 -PI) and ⁇ 1 -chymotrypsin inhibitor ( ⁇ 1 -Chl) are found in plasma. However, the PMNs are able to inactivate the inhibitors locally.
- ⁇ 1 -PI which is the most important inhibitor of neutrophil elastase is sensitive to oxidation at the reactive centre (Met- 358) by oxygen metabolites produced by triggered PMNs. This reduces the affinity of ⁇ 1 -PI for neutrophil elastase by approximately 2000 times.
- the elastase After local neutralisation of ⁇ 1 -PI, the elastase is able to degrade a number of inhibitors of other proteolytic enzymes. Elastase cleaves ⁇ 1 -ChI and thereby promotes cathepsin G activity. It also cleaves TIMP, resulting in tissue degradation by metalloproteinases. Furthermore, elastase cleaves antithrombin III and heparin cofactor II, and tissue factor pathway inhibitor (TFPI) which probably promotes clot formation. On the other hand, the ability of neutrophil elastase to degrade coagulation factors is assumed to have the opposite effect so that the total effect of elastase is unclear.
- the effect of neutrophil elastase on fibrinolysis is less ambiguous. Fibrinolytic activity increases when the elastase cleaves the plasminogen activator inhibitor and the ⁇ 2 plasmin inhibitor. Besides, both of these inhibitors are oxidated and inactivated by O 2 metabolites.
- PMNs contain large quantities of serine proteases, and about 200 mg of each of the leukocyte proteases are released daily to deal with invasive agents in the body. Acute inflammation leads to a many-fold increase in the amount of enzyme released. Under normal conditions, proteolysis is kept at an acceptably low level by large amounts of the inhibitors ⁇ 1 -PI, ⁇ 1 -ChI and ⁇ 2 macroglobulin. There is some indication, however, that a number of chronic diseases is caused by pathological proteolysis due to overstimulation of the PMNs, for instance caused by autoimmune response, chronic infection, tobacco smoke or other irritants, etc.
- Aprotinin (bovine pancreatic trypsin inhibitor) is known to inhibit various serine proteases, including trypsin, chymotrypsin, plasmin and kallikrein, and is used therapeutically in the treatment of acute pancreatitis, various states of shock syndrome, hyperfibrinolytic haemorrhage and myocardial infarction (cf., for instance, J.E. Trapnell et al, Brit. J. Surg. 61, 1974, p. 177; J. McMichan et al., Circulatory shock 9, 1982, p. 107; L.M. Auer et al., Acta Neurochir. 49, 1979, p. 207; G. Sher, Am.
- aprotininin analogues e.g. aprotinin(1-58, Vall5) exhibits a relatively high selectivity for granulocyte elastase and an inhibitory effect on collagenase
- aprotinin (1-58, Ala15) has a weak effect on elastase
- aprotinin (3-58, Arg15, Ala17, Ser42) exhibits an excellent plasma kallikrein inhibitory effect (cf. WO 89/10374).
- aprotinin when administered in vivo, aprotinin has been found to have a nephrotoxic effect in rats, rabbits and dogs after repeated injections of relatively high doses of aprotinin
- aprotinin is a bovine protein which may therefore contain one or more epitopes which may give rise to an undesirable immune response on administration of aprotinin to humans.
- the present invention relates to a variant of human Kunitz-type protease inhibitor domain I of tissue factor pathway inhibitor (TFPI), the variant comprising the following amino acid sequence
- X 11 X 12 X 13 Gln Asn Arg Phe X 14 Ser Leu Glu Glu Cys X 15 X 16 Met Cys Thr Arg X 17 (SEQ ID No. 1) wherein X 1 represents H or 1-7 naturally occurring amino acid residues except Cys, X 2 -X 16 each independently represents a naturally occurring amino acid residue except Cys, and X 17 represents OH or 1-5 naturally occurring amino acid residues except Cys, with the proviso that at least one of the amino acid residues X 1 -X 17 is different from the corresponding amino acid residue of the native sequence.
- the term "naturally occurring amino acid residue” is intended to indicate any one of the 20 commonly occurring amino acids, i.e. Ala, Val, Leu, lle Pro, Phe, Trp, Met, Gly, Ser, Thr, Cys, Tyr, Asn, Gln, Asp, Glu, Lys, Arg and His.
- TFPI also known as extrinsic pathway inhibitor (EPI) or lipoprotein associated coagulation inhibitor (LACI)
- EPI extrinsic pathway inhibitor
- LACI lipoprotein associated coagulation inhibitor
- Kunitz-type domain I of TFPI has been shown to bind TF/FVIIa, while Kunitz-type domain II has been shown to bind to FXa (Girard et al., Nature 338, 1989, pp. 518-520).
- TFPI Kunitz-type domain I By substituting one or more amino acids in one or more of the positions indicated above, it may be possible to change the inhibitor profile of TFPI Kunitz-type domain I so that it preferentially inhibits neutrophil elastase, cathepsin G and/or proteinase-3. Furthermore, it may be possible to construct variants which specifically inhibit enzymes involved in coagulation or fibrinolysis (e.g. plasmin or plasma kallikrein) or the complement cascade.
- enzymes involved in coagulation or fibrinolysis e.g. plasmin or plasma kallikrein
- TFPI Kunitz-type domain I has a negative net charge as opposed to aprotinin which, as indicated above, has a strongly positive net charge. It is therefore possible to construct variants of the invention with a lower positive net charge than aprotinin, thereby reducing the risk of kidney damage on administration of large doses of the variants. Another advantage is that, contrary to aprotinin, it is a human protein (fragment) so that undesired immunological reactions on administration to humans are significantly reduced.
- X 1 is Ser-Phe or Met-His-Ser-Phe
- X 2 is an amino acid residue selected from the group consisting of Ala, Arg, Thr, Asp, Pro, Glu, Lys, Gln, Ser, lle and Val, in particular wherein X 2 is Thr or Asp
- X 3 is an amino acid residue selected from the group consisting of Pro, Thr, Leu, Arg, Val and lle, in particular wherein X 3 is Pro or lle
- X 4 is an amino acid residue selected from the group consisting of Lys, Arg, Val, Thr, lle, Leu, Phe, Gly, Ser, Met, Trp, Tyr, Gln, Asn and Ala, in particular wherein X 4 is Lys, Val, Leu, lle, Thr, Met, Gln or Arg; or wherein X 5 is an amino acid residue selected from the group consisting of Lys, Arg, Val, Thr, Met, Gln
- Variants of TFPI Kunitz-type domain I of the invention should preferably not contain a Met residue in the protease binding region (i.e. the amino acid residues represented by X 3 -X 14 ).
- a Met residue in any one of these positions would make the inhibitor sensitive to oxidative inactivation by oxygen metabolites produced by PMNs, and conversely, lack of a Met residue in these positions should render the inhibitor more stable in the presence of such oxygen metabolites.
- a currently preferred variant of the invention is one in which one or more of the amino acid residues located at the protease- binding site of the Kunitz domain (i.e. one or more of X 3 -X 14 corresponding to positions 13, 15, 16, 17, 18, 19, 20, 34, 39, 40, 41 and 46 of aprotinin) are substituted to the amino acids present in the same positions of native aprotinin.
- This variant comprises the following amino acid sequence
- the invention in another aspect, relates to a DNA construct encoding a human Kunitz-type inhibitor domain variant according to the invention.
- the DNA construct of the invention may be prepared synthetically by established standard methods, e.g. the phosphoamidite method described by S.L. Beaucage and M.H. Caruthers, Tetrahedron Letters 22, 1981, pp. 1859-1869, or the method described by Matthes et al., EMBO Journal 3, 1984, pp. 801-805.
- oligonucleotides are synthesized, e.g. in an automatic DNA synthesizer, purified, annealed, ligated and cloned in suitable vectors.
- genomic or cDNA coding for TFPI Kunitz-type domain I e.g. obtained by screening a genomic or cDNA library for DNA coding for TFPI using synthetic oligonucleotide probes and isolating the DNA sequence coding for domain I therefrom).
- the DNA sequence is modified at one or more sites corresponding to the site(s) at which it is desired to introduce amino acid substitutions, e.g. by site-directed mutagenesis using synthetic oligonucleotides encoding the desired amino acid sequence for homologous recombination in accordance with well-known procedures.
- the invention relates to a recombinant expression vector which comprises a DNA construct of the invention.
- the recombinant expression vector may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced.
- the vector may be an autonomously replicating vector, i.e. a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid.
- the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated.
- the DNA sequence encoding the TFPI Kunitz-type domain I variant of the invention should be operably connected to a suitable promoter sequence.
- the promoter may be any DNA sequence which shows transcriptional activity in the host cell of choice and may be derived from genes encoding proteins either homologous or heterologous to the host cell.
- suitable promoters for directing the transcription of the DNA encoding the TFPI Kunitz-type domain I variant of the invention in mammalian cells are the SV 40 promoter (Subramani et al., Mol. Cell Biol. 1, 1981, pp. 854-864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222, 1983, pp.
- Suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255, 1980, pp. 12073- 12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1, 1982, pp. 419- 434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds.), Plenum Press, New York, 1982), or the TPI1 (US 4, 599, 311) or ADH2-4C (Russell et al., Nature 304. 1983, pp.
- promoters for use in filamentous fungus host cells are, for instance, the ADH3 promoter (McKnight et al., The EMBO J. 4, 1985, pp. 2093-2099) or the tpiA promoter.
- the DNA sequence encoding the TFPI Kunitz-type domain I variant of the invention may also be operably connected to a suitable terminator, such as the human growth hormone terminator (Palmiter et al., op. cit.) or (for fungal hosts) the TPI1 (Alber and Kawasaki, op. cit.) or ADH3 (McKnight et al., op. cit.) promoters.
- the vector may further comprise elements such as polyadenylation signals (e.g. from SV 40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV 40 enhancer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs).
- the recombinant expression vector of the invention may further comprise a DNA sequence enabling the vector to replicate in the host cell in question.
- a sequence when the host cell is a mammalian cell
- the SV 40 origin of replication or (when the host cell is a yeast cell) the yeast plasmid 2 ⁇ replication genes REP 1-3 and origin of replication.
- the vector may also comprise a selectable marker, e.g. a gene the product of which complements a defect in the host cell, such as the gene coding for dihydrofolate reductase (DHFR) or one which confers resistance to a drug, e.g. neomycin, hygromycin or methotrexate, or the Schizosaccharomyces pombe TPI gene (described by P.R. Russell, Gene 40, 1985, pp. 125-130.
- DHFR dihydrofolate reductase
- the host cell into which the expression vector of the invention is introduced may be any cell which is capable of producing the TFPI Kunitz-type domain I variant of the invention and is preferably a eukaryotic cell, such as a mammalian, yeast or fungal cell.
- the yeast organism used as the host cell according to the invention may be any yeast organism which, on cultivation, produces large quantities of the TFPI Kunitz-type domain I variant of the invention.
- suitable yeast organisms are strains of the yeast species Saccharomyces cerevisiae, Saccharomyces kluyveri, Schizosaccharomvces pombe or Saccharomyces uvarum.
- the transformation of yeast cells may for instance be effected by protoplast formation followed by transformation in a manner known per se.
- suitable mammalian cell lines are the COS (ATCC CRL 1650), BHK (ATCC CRL 1632, ATCC CCL 10) or CHO (ATCC CCL 61) cell lines.
- Methods of transfecting mammalian cells and expressing DNA sequences introduced in the cells are described in e.g. Kaufman and Sharp, J. Mol. Biol. 159, 1982, pp. 601-621; Southern and Berg, J. Mol. APPI. Genet. 1, 1982, pp. 327-341; Loyter et al., Proc. Natl. Acad. Sci. USA 79, 1982, pp. 422-426; Wigler et al., Cell 14, 1978, p.
- fungal cells may be used as host cells of the invention.
- suitable fungal cells are cells of filamentous fungi, e.g. Aspergillus spp. or Neurospora spp., in particular strains of Aspergillus oryzae or Aspergillus niger.
- Aspergillus spp. for the expression of proteins is described in, e.g., EP 238 023.
- the present invention further relates to a method of producing a TFPI Kunitz-type domain I variant according to the invention, the method comprising culturing a cell as described above under conditions conducive to the expression of the variant and recovering the resulting variant from the culture.
- the medium used to cultivate the cells may be any conventional medium suitable for growing mammalian cells or fungal (including yeast) cells, depending on the choice of host cell.
- the variant will be secreted by the host cells to the growth medium and may be recovered therefrom by conventional procedures including separating the cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulfate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography or affinity chromatography, or the like.
- the present invention also relates to a pharmaceutical composition
- a pharmaceutical composition comprising a TFPI Kunitz-type domain I variant of the invention together with a pharmaceutically acceptable carrier or excipient.
- the variant may be formulated by any of the established methods of formulating pharmaceutical compositions, e.g. as described in Remington's Pharmaceutical Sciences, 1985.
- the composition may typically be in a form suited for systemic injection or infusion and may, as such, be formulated with sterile water or an isotonic saline or glucose solution. It has surprisingly been found that the TFPI Kunitz-type domain I is in itself capable of inhibiting Cathepsin G.
- the invention therefore also relates to a pharmaceutical composition for the inhibition of Cathepsin G, the composition comprising human Kunitz-type protease inhibitor domain I of TFPI or a variant thereof as described above and a pharmaceutically acceptable carrier or excipient.
- the TFPI Kunitz-type domain I variant of the invention is therefore contemplated to be advantageous to use for the therapeutic applications suggested for native aprotinin or aprotinin analogues with other inhibitor profiles, in particular those which necessitate the use of large aprotinin doses.
- Therapeutic applications for which the use of the variant of the invention is indicated as a result of its ability to inhibit human serine proteases, e.g.
- trypsin, plasmin, kallikrein, elastase, cathepsin G and proteinase-3 include (but are not limited to) acute pancreatitis, inflammation, thrombocytopenia, preservation of platelet function, organ preservation, wound healing, shock (including shock lung) and conditions involving hyperfibrinolytic haemorrhage, emphysema, rheumatoid arthritis, adult respiratory distress syndrome, chronic inflammatory bowel disease and psoriasis, in other words diseases presumed to be caused by pathological proteolysis by elastase, cathepsin G and proteinase-3 released from triggered PMNs.
- the present invention relates to the use of TFPI Kunitz-type inhibitor domain I or a variant thereof as described above for the preparation of a medicament for the prevention or therapy of diseases or conditions associated with pathological proteolysis by proteases released from overstimulated PMNs. As indicated above, it may be an advantage of administer heparin concurrently with the TFPI Kunitz-type inhibitor domain I or variant.
- TFPI Kunitz- type domain II or a variant thereof as specified above may be used to isolate useful natural substances, e.g. proteases or receptors from human material, which bind directly or indirectly to TFPI Kunitz-type domain II, for instance by screening assays or by affinity chromatography.
- useful natural substances e.g. proteases or receptors from human material
- affinity chromatography e.g. affinity chromatography
- Amino acid analysis was carried out after hydrolysis in 6M HCl at 110°C in vacuum-sealed tubes for 24 hours. Analysis was performed on a Beckman 121MB automatic amino acid analyzer modified for microbore operation.
- N-terminal amino acid sequence analysis was obtained by automated Edman degradation using an Applied Biosystems 470A gas-phase sequencer. Analysis by on-line reverse phase HPLC was performed for the detection and quantitation of the liberated pTH amino acids from each sequencer cycle.
- Molecular weight determination was obtained on a BIO-ION 20 plasma desorption mass spectrometer (PDMS) equipped with a flight tube of approximately 15 cm and operated in positive mode. Aliquots of 5 ⁇ l were analyzed at an accelerating voltage set to 15 kV and ions were collected for 5 million fission events. The accuracy on assigned molecular ions is approximately 0.1% for well defined peaks, otherwise somewhat less.
- PDMS BIO-ION 20 plasma desorption mass spectrometer
- TFPI-1 tissue factor pathway inhibitor
- yeast strain KFN-1651 cDNA encoding full length TFPI was isolated from the human liver derived cell line HepG2 (ATCC HB 8065) and inserted as a 0.9 kb BamHI-Xbal fragment into a mammalian expression vector, pKFN- 1168, as described (Pedersen, A.H., Nordfang, O., Norris, F., Wiberg, F.C., Christensen, P.M., Moeller, K. B., Meidahl- Pedersen, J., Beck, T.C., Norris, K., Hedner, U., and Kisiel, W.
- TFPI-1 is encoded by nucleotides 152-325 as indicated.
- TFPI-1 0.1 ⁇ g of the 0.9 kb BamHI-Xbal fragment from pKFN-1168 was used as a template in a PCR reaction containing 100 pmole each of the primers NOR-2524
- NOR-2524 (GCTGAGAGATTGGAGAAGAGAATGCATTCATTTTGTGC) and NOR-2525 (TAATCCTTCTAGATTAATCTCTTGTACACAT).
- the 17 3'-terminal bases of NOR-2524 are identical to bases 152 to 168 in the TFPI-1 gene in SEQ ID No. 3, and the 21 5'-terminal bases are identical to bases 215 to 235 in the synthetic leader gene (see SEQ ID No. 5) from pKFN-1000 described below.
- Primer NOR-2525 is complementary to bases 311 to 325 in SEQ ID No. 3 and has a 5' extension containing a translation stop codon followed by an Xbal site.
- the PCR reaction was performed in a 100 ⁇ l volume using a commercial kit (GeneAmp, Perkin Elmer Cetus) and the following cycle: 94° for 20 sec, 50° for 20 sec, and 72° for 30 sec. After 19 cycles a final cycle was performed in which the 72° step was maintained for 10 min.
- the PCR product, a 211 bp fragment, was isolated by electrophoresis on a 2% agarose gel.
- Signal-leader 0.1 ⁇ g of a 0.7 kb PvuII fragment from pKFN-1000 described below was used as a template in a PCR reaction containing 100 pmole each of the primers NOR-1478
- NOR- 1478 is matching a sequence just upstream of the EcoRI site in SEQ ID No. 5.
- Primer NOR-2523 is complementary to the 17 3'- terminal bases of the synthetic leader gene of pKFN-1000, see SEQ ID No. 5. The PCR reaction was performed as described above, resulting in a 257 bp fragment.
- Plasmid pKFN-1000 is a derivative of plasmid pTZ19R (Mead, D.A., Szczesna-Skorupa, E. and Kemper, B., Prot. Engin. 1 (1986) 67- 74) containing DNA encoding a synthetic yeast signal-leader peptide.
- Plasmid pKFN-1000 is described in WO 90/10075.
- the DNA sequence of 235 bp downstream from the EcoRI site of pKFN-1000 and the encoded amino acid sequence of the synthetic yeast signal-leader is given in SEQ ID No. 5.
- Signal-leader-TFPI-1 Approx. 0.1 ⁇ g of each of the two PCR- fragments described above were mixed. A PCR reaction was performed using 100 pmole each of primers NOR-1478 and NOR-2525 and the following cycle: 94° for 1 min, 50° for 2 min, and 72° for 3 min. After 16 cycles a final cycle was performed in which the 72° step was maintained for 10 min.
- Plasmid pMT636 is described in WO 89/01968.
- pMT636 is an E. coli - S. cerevisiae shuttle vector containing the Schizosaccharomyces pombe TPI gene (POT) (Russell, P.R., Gene 40 (1985) 125-130), the S. cerevisiae triosephosphate isomerase promoter and terminator, TPI p and TPI T (Alber, T., and Kawasaki, G., J.Mol.APPI.Gen. 1 (1982), 419-434).
- POT Schizosaccharomyces pombe TPI gene
- the ligation mixture was used to transform a competent E. coli strain (r-, m + ) selecting for ampicillin resistance. DNA sequencing showed that plasmids from the resulting colonies contained the correct DNA sequence for TFPI-1 correctly fused to the synthetic yeast signal-leader gene.
- pKFN-1603 was selected for further use. The construction of plasmid pKFN-1603 is illustrated in fig. 1.
- the expression cassette of plasmid pKFN-1603 contains the following sequence:
- S. cerevisiae strain MT663 (E2-7B XE11-36 a/ ⁇ , ⁇ tpi/ ⁇ tpi, pep 4-3/pep 4-3) was grown on YPGaL (1% Bacto yeast extract, 2% Bacto peptone, 2% galactose, 1% lactate) to an O.D. at 600 nm of 0.6.
- Transformant colonies were picked after 3 days at 30°C, reisolated and used to start liquid cultures.
- One such transformant KFN-1651 was selected for further characterization.
- Yeast strain KFN-1651 was grown on YPD medium (1% yeast extract, 2% peptone (from Difco Laboratories), and 3% glucose). A 1 liter culture of the strain was shaken at 30°C to an optical density at 650 nm of 24. After centrifugation the supernatant was isolated.
- YPD medium 1% yeast extract, 2% peptone (from Difco Laboratories), and 3% glucose.
- the yeast supernatant was adjusted to pH 3.0 with 5% acetic acid and phosphoric acid and applied a column of S-Sepharose Fast Flow (Pharmacia) and equilibrated with 50 mM formic acid, pH 3.7. After wash with equilibration buffer, the HKI-domain was eluted with 1 M sodium chloride. Desalting was obtained on a Sephadex G-25 column (Pharmacia) equilibrated and eluted with 0.1% ammonium hydrogen carbonate, pH 7.9. After concentraton by vacuum centifugation and adjustment of pH 3.0 further purification was performed on a Mono S column (Pharmacia) equilibrated with 50 mM formic acid, pH 3.7.
- KFN 1651 was purified from yeast culture medium. The concentration of KFN 1651 was determined from the absorbance at 214 nm using BPTI as a standard. Porcine trypsin and human recombinant factor Vila was obtained from Novo Nordisk A/S (Bagsvaerd, Denmark), bovine chymotrypsin (TLCK treated) was obtained from Sigma Chemical Co. (St. Louis, MO, USA). Human truncated recombinant tissue factor was obtained from Corvas (San Diego, CA, USA).
- Human neutrophil cathepsin G was purified from extracts of PMNs according to the method described by Baugh and Travis (Biochemistry 15 (1976) 836-843).
- Peptidyl nitroanilide substrates, S2251, S2586, S2288 were from Kabi (Stockholm, Sweden).
- S7388 was from Sigma Chemical Co. (St. Louis, MO, USA) and FXa-1 was from NycoMed (Oslo, Norway).
- Serine proteinases were incubated with various concentrations of KFN 1651 for 30 min. Substrate was then added and residual proteinase activity was measured at 405 nm. The results are shown in Table 2.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pain & Pain Management (AREA)
- General Chemical & Material Sciences (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Rheumatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Variant du domaine I des inhibiteurs de voie de Thromboplastine Tissulaire, inhibiteur de la protéase humaine de type Kumitz; le variant comprend la séquence d'acides aminés: X1 Cys Ala Phe Lys Ala Asp X2 Gly X3 Cys X4 X5 X6 X7 X8 X9 Phe Phe Phe Asn Ile Phe Thr Arg Gln Cys Glu Glu Phe X10 Tyr Gly Gly Cys X11 X12 X13 Gln Asn Arg Phe X14 Ser Leu Glu Glu Cys X15 X16 Met Cys Thr Arg X17 (SEQ ID No. 1) dans laquelle X1 représente H ou 1 à 7 résidus d'acide aminé survenant naturellement à l'exception de Cys, X2 à X16 représentent chacun indépendamment un résidu d'acide aminé survenant naturellement, et X17 représente OH ou 1 à 5 résidus d'acide aminé survenant naturellement à l'exception de Cys, à condition qu'au moins un des résidus d'acide aminé X1 à X17 soit différent du résidu d'acide aminé correspondant de la séquence naturelle.Variant of domain I of Tissue Thromboplastin pathway inhibitors, inhibitor of human protease of the Kumitz type; the variant comprises the amino acid sequence: X1 Cys Ala Phe Lys Ala Asp X2 Gly X3 Cys X4 X5 X6 X7 X8 X9 Phe Phe Phe Asn Ile Phe Thr Arg Gln Cys Glu Glu Phe X10 Tyr Gly Gly Cys X11 X12 X13 Gln Asn Arg Phe X14 Ser Leu Glu Glu Cys X15 X16 Met Cys Thr Arg X17 (SEQ ID No. 1) in which X1 represents H or 1 to 7 amino acid residues occurring naturally with the exception of Cys, X2 to X16 each independently a naturally occurring amino acid residue, and X17 represents OH or 1 to 5 naturally occurring amino acid residues with the exception of Cys, provided that at least one of the amino acid residues X1 to X17 is different of the corresponding amino acid residue of the natural sequence.
Description
Claims
Applications Claiming Priority (5)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DK9200002 | 1992-01-07 | ||
WOPCT/DK92/00002 | 1992-01-07 | ||
WOPCT/DK92/00340 | 1992-11-16 | ||
DK9200340 | 1992-11-16 | ||
PCT/DK1993/000005 WO1993014122A1 (en) | 1992-01-07 | 1993-01-07 | A human kunitz-type protease inhibitor variant |
Publications (1)
Publication Number | Publication Date |
---|---|
EP0621872A1 true EP0621872A1 (en) | 1994-11-02 |
Family
ID=26068350
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP93902106A Withdrawn EP0621872A1 (en) | 1992-01-07 | 1993-01-07 | A human kunitz-type protease inhibitor variant |
Country Status (13)
Country | Link |
---|---|
EP (1) | EP0621872A1 (en) |
JP (1) | JPH07504891A (en) |
AU (1) | AU675926B2 (en) |
CA (1) | CA2127246A1 (en) |
CZ (1) | CZ164494A3 (en) |
FI (1) | FI943234A0 (en) |
HU (1) | HUT70293A (en) |
IL (1) | IL104324A0 (en) |
NO (1) | NO942549L (en) |
NZ (1) | NZ246570A (en) |
RU (1) | RU94036773A (en) |
WO (1) | WO1993014122A1 (en) |
ZA (1) | ZA9396B (en) |
Families Citing this family (27)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5455338A (en) * | 1993-11-05 | 1995-10-03 | Zymogenetics, Inc. | DNA encoding novel human kunitz-type inhibitors and methods relating thereto |
US6057287A (en) * | 1994-01-11 | 2000-05-02 | Dyax Corp. | Kallikrein-binding "Kunitz domain" proteins and analogues thereof |
EP1489097B1 (en) | 1994-01-11 | 2011-10-19 | Dyax Corporation | Inhibitors of human plasmin derived from kunitz domains and nucleic acids encoding the same |
DE69533472T2 (en) * | 1994-01-11 | 2006-01-12 | Dyax Corp., Cambridge | KALLIKER INHIBITING "KUNITZ DOMAIN" PROTEINS AND DERIVATIVES THEREOF |
US5795954A (en) * | 1994-03-04 | 1998-08-18 | Genentech, Inc. | Factor VIIa inhibitors from Kunitz domain proteins |
US5589359A (en) * | 1994-08-05 | 1996-12-31 | Chiron Corporation | Chimeric proteins |
ATE226249T1 (en) * | 1994-08-05 | 2002-11-15 | Chiron Corp | PRODUCTION OF THE INHIBITOR FOR THE COMPLEX FORMATION OF THE TISSUE FACTOR |
US5780265A (en) * | 1995-06-05 | 1998-07-14 | Genentech, Inc. | Kunitz type plasma kallikrein inhibitors |
US5786328A (en) * | 1995-06-05 | 1998-07-28 | Genentech, Inc. | Use of kunitz type plasma kallikrein inhibitors |
US6242414B1 (en) | 1995-06-07 | 2001-06-05 | Chiron Corporation | Regulation of cytokine synthesis and release |
JPH11507060A (en) * | 1995-06-07 | 1999-06-22 | カイロン コーポレイション | Regulation of cytokine synthesis and release |
WO2000011034A1 (en) * | 1998-08-25 | 2000-03-02 | Knut Kleesiek | A mutant of tissue factor pathway inhibitor, dna sequence and use for detecting thrombotic disorders |
CN1325889A (en) * | 2000-05-26 | 2001-12-12 | 上海博德基因开发有限公司 | Polypeptide-human kazal-type inhibitor 11 and polynucleotide for coding it |
US7153829B2 (en) | 2002-06-07 | 2006-12-26 | Dyax Corp. | Kallikrein-inhibitor therapies |
ES2528254T3 (en) | 2002-06-07 | 2015-02-05 | Dyax Corp. | Modified Kunitz domain polypeptides and their use to reduce ischemia or the onset of a systemic inflammatory response associated with a surgical procedure |
ES2395014T3 (en) | 2002-08-28 | 2013-02-07 | Dyax Corp. | Methods to preserve organs and tissues |
US6989369B2 (en) | 2003-02-07 | 2006-01-24 | Dyax Corp. | Kunitz domain peptides |
DK1663281T3 (en) | 2003-08-29 | 2014-03-17 | Dyax Corp | POLY-PEGYLED PROTEASE INHIBITORS |
US7235530B2 (en) | 2004-09-27 | 2007-06-26 | Dyax Corporation | Kallikrein inhibitors and anti-thrombolytic agents and uses thereof |
US7276480B1 (en) | 2005-12-30 | 2007-10-02 | Dyax Corp. | Prevention and reduction of blood loss |
CN104984319A (en) | 2008-12-19 | 2015-10-21 | 巴克斯特国际公司 | Tfpi inhibitors and methods of use |
EP2385843A4 (en) | 2009-01-06 | 2013-02-27 | Dyax Corp | Treatment of mucositis with kallikrein inhibitors |
PT3459564T (en) | 2010-01-06 | 2022-01-31 | Takeda Pharmaceuticals Co | Plasma kallikrein binding proteins |
ES2621809T3 (en) | 2010-03-19 | 2017-07-05 | Baxalta GmbH | TFPI inhibitors and use procedures |
KR102107695B1 (en) | 2011-01-06 | 2020-05-07 | 다이액스 코포레이션 | Plasma kallikrein binding proteins |
DK2827883T3 (en) | 2012-03-21 | 2019-07-29 | Baxalta GmbH | TFPI INHIBITORS AND METHODS OF USE |
US11286307B2 (en) | 2015-12-11 | 2022-03-29 | Takeda Pharmaceutical Company Limited | Plasma kallikrein inhibitors and uses thereof for treating hereditary angioedema attack |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5106833A (en) * | 1987-07-23 | 1992-04-21 | Washington University | Coagulation inhibitors |
DK408089D0 (en) * | 1989-08-18 | 1989-08-18 | Novo Nordisk As | PROTEINS |
-
1993
- 1993-01-06 IL IL104324A patent/IL104324A0/en unknown
- 1993-01-07 NZ NZ246570A patent/NZ246570A/en unknown
- 1993-01-07 CZ CZ941644A patent/CZ164494A3/en unknown
- 1993-01-07 EP EP93902106A patent/EP0621872A1/en not_active Withdrawn
- 1993-01-07 WO PCT/DK1993/000005 patent/WO1993014122A1/en not_active Application Discontinuation
- 1993-01-07 CA CA002127246A patent/CA2127246A1/en not_active Abandoned
- 1993-01-07 RU RU94036773/13A patent/RU94036773A/en unknown
- 1993-01-07 JP JP5511993A patent/JPH07504891A/en active Pending
- 1993-01-07 AU AU33460/93A patent/AU675926B2/en not_active Ceased
- 1993-01-07 HU HU9401990A patent/HUT70293A/en unknown
- 1993-01-07 ZA ZA9396A patent/ZA9396B/en unknown
-
1994
- 1994-07-06 NO NO942549A patent/NO942549L/en unknown
- 1994-07-06 FI FI943234A patent/FI943234A0/en unknown
Non-Patent Citations (1)
Title |
---|
See references of WO9314122A1 * |
Also Published As
Publication number | Publication date |
---|---|
NO942549D0 (en) | 1994-07-06 |
ZA9396B (en) | 1993-08-10 |
HUT70293A (en) | 1995-09-28 |
JPH07504891A (en) | 1995-06-01 |
WO1993014122A1 (en) | 1993-07-22 |
FI943234A (en) | 1994-07-06 |
HU9401990D0 (en) | 1994-09-28 |
AU3346093A (en) | 1993-08-03 |
IL104324A0 (en) | 1993-05-13 |
AU675926B2 (en) | 1997-02-27 |
RU94036773A (en) | 1996-09-27 |
CA2127246A1 (en) | 1993-07-22 |
NZ246570A (en) | 1996-09-25 |
NO942549L (en) | 1994-09-07 |
FI943234A0 (en) | 1994-07-06 |
CZ164494A3 (en) | 1994-12-15 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU676145B2 (en) | A human kunitz-type protease inhibitor variant | |
AU675926B2 (en) | A human kunitz-type protease inhibitor variant | |
AU675925B2 (en) | A human kunitz-type protease inhibitor variant | |
AU671611B2 (en) | Human kunitz-type protease inhibitor variants | |
EP0621873B1 (en) | A novel human kunitz-type protease inhibitor and variants thereof | |
US5591603A (en) | Process for preparing aprotinin and aprotinin analogs in yeast cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 19940628 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH DE DK ES FR GB GR IE IT LI LU NL PT SE |
|
GRAG | Despatch of communication of intention to grant |
Free format text: ORIGINAL CODE: EPIDOS AGRA |
|
17Q | First examination report despatched |
Effective date: 19970121 |
|
GRAH | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOS IGRA |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 19970913 |