NZ206700A

NZ206700A - Improvement in genetic production of proteins using promoter/operator/ribosome binding site sequence

Info

Publication number: NZ206700A
Application number: NZ206700A
Authority: NZ
Inventors: M-B Dworkin; E Dworkin-Rastl; G Adolf; N Hauel; P Meindl; P Swetly; R Hauptmann
Original assignee: Boehringer Ingelheim Int
Priority date: 1982-12-24
Filing date: 1983-12-22
Publication date: 1987-11-27
Also published as: FI834700A0; DK576983A; DE3382233D1; NO834792L; UA8035A1; MX9202878A; AU2283283A; ES8506090A1; NO173742B; HU202277B; DE3247922A1; SU1417800A3; JPH088868B2; EP0115613B1; DD216043A5; SU1366064A3; ES533214A0; ES8503372A1; ES533213A0; KR840007105A

Abstract

The present invention relates to the combination of the promoter/operator region of the tryptophan operon of Serratia marcescens with a synthetic ribosome binding sequence, an expression plasmid which contains this sequence and in which the above sequence is followed by the only Hind III cleavage site in the plasmid, into which site the gene to be expressed can be inserted, and to production plasmids for the expression of eukaryotic gene products in prokaryotes, especially for the preparation of leucocyte interferon.

Description

<div class="application article clearfix" id="description"> 2 067 00) ■ , * Priority Oate;s;: .*§?? Complete Specification Filed:^^. class: COT HZ>. lew', .COO15|QQ.'. pya iryaQ .|,aq&4 CA^PR!.^. ,/■. .oml^o. Publication Date: ...27. .NOV. 1987 P.O. Jovrnaf, No: ., >50^ (g> CcrMZ\l<*f CtlA)(SU& Cl2,Pl<llStf «oavcv^(o° Cl2Jtfllx\ Patents Form No. 5 NEW ZEALAND PATENTS ACT 1953 COMPLETE SPECIFICATION "NUCLEIC ACIDS, PLASMIDS CONTAINING SUCH ACIDS, PROCESSES FOR THEIR PREPARATION AND THE USE OF SUCH PLASMIDS IN THE SYNTHESIS OF GENE PRODUCTS" —I->WE BOEHRINGER INGELHEIM INTERNATIONAL GMBH, a body corporate organised under the laws of the Federal Republic of Germany of 6507 Ingelheim am Rhein, German Federal Republic hereby declare the invention, for which-t/we pray that a patent may be granted to -»e/us, and the method by which it is to be performed, to be particularly described in and by the following statement -1- (followed by page \ &■) - lOL- The present invention relates to nucleic ' Q acids comprising a novel promoter/operator/ribosome binding site sequence, plasmids containing such nucleic acids, processes for their preparation and the use of sych plasmids for the synthesis 5 of gene products. A precondition for the expression of genes in bacteria is the presence of a so-called promoter, a recognition sequence for the binding of bacterial RNA polymerase. Consequently, a promoter allows 10 the transcription of the sequences located downstream. Genes, the products of which are synthesised at any time, have promoters which are always capable of binding RNA polymerase molecules. Other genes or operons of bacteria are regulated, that is to 15 say their promoter can be made accessible or inaccessible by means of specific mechanisms. A further precondition for the synthesis of desired gene products is efficient translation of the RNA transcripts by bacterial ribosomes. 20 Thus, it has been shown by Shine and Dalgarno (see Nature 254, 34-38 (1975)) that in bacteria the nucleotide sequence of the 5' end of a mRNA is responsible for its binding to ribosomes. The present invention is based on the discovery 25 that the genetic production of proteins foreign to procaryotes such as bacteria may be improved by the use of a novel promoter/operator/ribosome binding site sequence which optionally additionally carries a linker sequence following the ribosome 110 JUL1987 30 binding site sequence. vt. Thus, according to one feature of the present invention there is provided a polydeoxyribonucleotide having the sequence 5' AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG — Promoter- GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTA CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA Promoter/Operator •+«— RBS - 2 - (wherein RBS is the ribosome binding site sequence) ' L/ and mutants thereof having a functional promoter/operator /RBS sequence. Such mutant sequences may be obtained by conventional methods. The free end of the ribosome binding site sequence may be termed the Hind III end of the nucleic acid, representing a Hind III site at which the restriction endonuclease Hind III has cut and if desired the nucleic acid may be represented 10 5 '(AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3• |GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Eco RI ;— Promoter 15 GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAl CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGAl Promoter /Opera tor- — — RBS Hind III 20 The above-mentioned nucleic acid may, if desired additionally carry a linker sequence following the ribosome binding site sequence. A preferred linker sequence for use with the present invention is the nucleic acid 25 5' AGCTTAAAGATGTGT 31 ATTTCTACACACTAG which nucleic acid is novel and constitutes a further feature of the present invention. Thus, a preferred embodiment of the present 30 invention is the polydeoxyribonucleotide of sequence:- 5 ' AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3 ' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Promoter — GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAjAGCT CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGAj Promoter/Operator ^ RBS ^1 --Linker >j y- * o Hindlll < •i tO JUL 1987 TAAAGATGTGT ATTTCTACACACTAG V r -V - 3 - "'6 >„ / 1 and the invention also encompasses mutants thereof (J having a functional promoter/operator/RBS sequence. The novel DNA ribosome binding site/linker sequence 5 ' TAAGGAGGTTTAAGCTTAAAGATGTGT 5 3' ATTCCTCCAAATTCGAATTTCTACACACTAG also constitutes a further feature of the present invention. The promoter/operator/ribosome binding site/linker 10 sequences hereinbefore defined are preferably additionally linked to a further DNA sequence comprising an amino acid coding sequence so as to provide a structural gene for a polypeptide in such a form that the latter can be expressed by means of a bacterium, e.g. 15 an E.coll strain. The combination of DNA sequences takes place in such a way that the amino acid coding sequence of the additional DNA sequence is coupled to the DNA linker sequence by means of a 3',5'phosphodiester bond. The nucleic acid thus formed may thus be 20 employed to improve the genetic production of a polypeptide by the use of a novel ribosome binding site/linker sequence. The gene which codes for a polypeptide may, for example, code for an interferon, especially 25 the human a-interferon encoded by plasmid 1F7. (Plasmid 1F7 has been deposited at the Deutsche Sammlung von Mikroorganismen under DSM No. 2362; see also Journal of Interferon Research (1982) 2, 575-585). A preferred polydeoxyribonucleotide 30 thus comprises the sequence: 5 »AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG —Promoter — tXr ■" — GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAJAGC T CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCG Aj Promoter/Operator ^ RBS 5| r . . ^ - Hindlll --Linker N u H i IFN-a2C gene ^ A A TAAAGATGTGljGATCTGCCTCAAA. ATTTCTACACACTAGfACGGAGTTT |f,Y0 JUL 1987 SaU3A c i nI - 4 - (wherein RBS is the ribosome binding site sequence and IFN-a2C gene is the mature a-interferon structural gene of plasmid 1F7 or a degenerate variant thereof). According to a further feature of the present 5 invention, there is provided a plasmid containing a nucleic acid as hereinbefore defined. Thus, in a preferred embodiment of the present invention expression plasmids, e.g. the expression plasmid pER 103, are provided which contain a promoter/operator 10 /ribosome binding site/linker sequence according to the invention and in which a single Hind III restriction site in the plasmid follows after the above sequence into which the particular gene desired can be inserted to produce a production plasmid. 15 Such production plasmids may be used for the preparation of eucaryotic gene products in bacteria, for instance for preparing leucocyte interferon. According to a further feature of the present invention, there are provided plasmids which contain 20 one or more nucleic acids as hereinbefore defined (such nucleic acids incorporating a gene which codes for a polypeptide in such a form that the gene may be expressed by means of a a bacterium) and optionally a par-locus, e.g. the par-locus of 25 plasmid pPM 31 or a functional mutant thereof (see cell (1980) 2j), 529-542) . Such mutants may be prepared by methods known per se. A preferred plasmid according to the present invention is an a-interferon production plasmid 30 which contains one or two promoter/operator/ribosome binding site/linker/IFN-a2C-gene sequences as hereinbefore defined and optionally a par-locus isolated from plasmid pPM 31 or a functional mutant thereof. The a-interferon production plasmid pER 33 35 containing a promoter/operator/ribosome binding site/1inker/IFN-a2C-gene sequence as hereinbefore defined is especially preferred. The a-interferon f-' " production plasmid pER 21/1, which contains two _ q _ ~ ~ c-/) promoter/operator/ribosome binding site/linker/IFN- * c*<5"> i'/~ a2C-gene sequences as hereinbefore defined ^ (J is also especially preferred. Moreover, the a2C-interferon encoding plasmid parpER 33, which contains 5 the promoter/operator/ribosome binding site/linker/IFN-a2C-gene sequence as hereinbefore defined and a par-locus isolated from plasmid pPM 31 is also especially preferred. According to a further feature of the present 10 invention, there is provided a process for preparing a nucleic acid possessing the promoter/operator/ribosome binding site DNA sequence as hereinbefore defined wherein the 90-bp Eco RI/Hae III fragment comprising the promoter/operator sequence of the tryptophan 15 operon of Serratia marcescens is linked to the ribosome binding site sequence 5' TAAGGAGGTTTA 3' ATTCCTCCAAATTCGA 20 A promoter/operator/ribosome binding site/linker sequence may be obtained by connecting the appropriate linker sequence to the promoter/operator/ribosome binding site sequence. Similarly, a promoter/operator 25 /ribosome binding site/linker/ polypeptide structural gene sequence may be prepared by connecting an appropriate amino acid coding DNA sequence to the promoter/operator/ribosome binding site/linker sequence or by connecting the promoter/operator/RBS 30 sequence to the linker/structural gene sequence.- A plasmid as hereinbefore defined may be prepared by combination of the whole of or a portion of a plasmid, such as the plasmid pBR322, with the appropriate DNA sequence as hereinbefore defined. 35 An expression plasmid as hereinbefore defined may be prepared by the use of the plasmid pBR322 as a vector from which the plasmid's own 29-bp long Eco RI-Hind III fragment is removed by restriction, v < endonuclease splitting and is replaced by insert^njQ jy|_^937: Pr) of a promoter/operator/RBS sequence or promoter/operator- <_/ /RBS/linker sequence according to the invention in the presence of a ligase. A production plasmid may be prepared by the insertion of a gene coding for a polypeptide into 5 an expression plasmid according to the present invention containing a promoter/operator/RBS sequence by means of a linker sequence, optionally with subsequent insertion of a par-locus isolated from plasmid pPM 31. The expression plasmid employed 10 is preferably the plasmid pER 10 3. More than one polypeptide encoding DNA sequence may if desired be incorporated into the production plasmid. The production plasmid pER 33 may thus be prepared by inserting the above-mentioned IFN-a2C gene 15 by means of the appropriate linker sequence into the expression plasmid pER 103. The production plasmid parpER 33 may be prepared by introducing a par-locus isolated from plasmid pPM 31 into the production plasmid pER 33 prepared as described 20 above. At least one promoter/operator/ribosome binding site/linker/IFN-a2C-gene DNA sequence may be introduced into the production plasmid pER 33. For example, the production plasmid pER 21/1 may 25 be prepared by introducing a second promoter/operator /ribosome binding site/linker/IFN-a2C-gene DNA sequence into the production plasmid pER 33. A human interferon may thus be prepared by transforming an appropriate host by means of 30 an appropriate production plasmid as hereinbefore defined to enable the regulated production of said interferon. An appropriate host is a bacterium such as an E. coli strain, especially Escherichia coli HB 101. 35 The present invention also extends to include r'1* bacterial host cells containing a production plasmM • * * °«\ as hereinbefore defined in a form in which the v incorporated gene coding for. a polypeptide may % 10JUL1987 be expressed. - 7 - The following procedure is adopted by way of example: 5 The selection of a suitable bacterial promoter sequence: A promoter which, in combination with an operator sequence, can be induced or repressed is preferably used for this purpose. A promoter of this type has the advantage that the synthesis of the desired protein need be started only in 10 a late phase of the bacterial growth cycle, for example in the case of the tryptophan operon (see Hallewell and Emtage in'Gene 9, 27-47 (1980)) by extracting tryptophan from the culture medium and by adding indol-(3)-acrylic acid as an inducer 15 of the tryptophan operon to the culture medium, thus not influencing the multiplication of the bacteria. Appropriately, the promoter/operator sequence used for constructing the expression plasmid is the very strong and regulatable known promoter/operator 20 sequence of the tryptophan operon of Serratia marcescens (see Miozzari and Yanofsky in Nature 276, 684-689 (1978)) , which can be isolated by processes known in the literature in an Eco RI/Hae III fragment having the Sequence: 25 51AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Promoter GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGG 3 0 CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCC Promoter/Operator » ' 35 Construction of the ribosome binding site sequence: The sequence of formula 51TAAGGAGGTTTA < t.iv T o n _ -8- _ -6-^ (see Jay et al. in Proc. Nat. Acad. Sci. USA 78, ' ur> kJ 5543-5548 (1981)), which is described as especially effective, is used for this purpose. The construction of the ribosome binding site sequence of the formula 5 12mer i i 5' TAAGGAGGTTTA 3' ATTCCTCCAAATTCGA i i i i 6mer lOmer 10 is preferably carried out by assembling three synthetic oligonucleotides of formulae 6mer 5' TCCTTA, lOmer 15 5' AGCTTAAACC and 12mer 5' TAAGGAGGTTTA according to methods known in the literature, the 6mer oligonucleotide appropriately being previously 20 radioactively labelled. The subsequent linking of the promoter/operator with the ribosome binding site sequence is carried out according to processes known in the literature. 25 Construction of the expression plasmid The promoter/operator sequence is cut out by means of the restriction enzymes Eco RI and Hae III from a plasmid containing a portion of Serratia 30 marcescens DNA comprising the region from the EcoRI site preceding the promoter site of the trp operon to the Hae III site within the trp operon leader sequence. This fragment is then linked with the synthetically produced RBS by means of the 35 enzyme DNA ligase, and the promoter/operator/RBS fragment produced in this way, containing an Eco RI y "v t ^ r "qNs. end in front of the promoter/operator and a / Hind III end after the RBS, is inserted into the plasmid pBR322 instead of the plasmid's own 29 bp L 10JUL198/ "J( C / - 9 - . long Eco RI-Hind III fragment. The effectiveness &() of the expression plasmid (pER 103) constructed in this way as regards the expression of genes 5 inserted at the Hind III restriction site is shown by the example of leucocyte interferon, sub-type a2C. Expression of the IFN-a2C gene in pER 103: Like other exocellular proteins, interferon is also synthesised in human cells as a pre-protein, 10 that is to say as a protein with a leader sequence. Only when the protein molecule escapes from the cell is this leader sequence split off by a specific enzyme with the result that the mature form of the protein is produced. One possibility of synthesising 15 mature interferon within bacteria is to remove the leader sequence at the DNA level, that is to say construct a gene which codes only for the sequences of the mature protein. 20 Construction of an interferon production plasmid for IFN-a2C: For example, leucocyte interferon has a pre-sequence of 23 amino acids, followed by cysteine which, after splitting of the pre-interferon, represents 25 the first amino acid of the "mature" interferon polypeptide. To construct plasmids which should allow the synthesis of mature interferon in bacteria, it is necessary to isolate a fragment of the interferon gene which starts exactly with the codon for this 30 cysteine. An ATG methionine codon must then be placed in front of this cysteine codor^ to allow the initiation of protein synthesis. This construction is then inserted in a suitable way, for example, into the expression plasmid pER 103, so that the 35 distance between the ATG initiation codon and RBS is the best possible for translation. Interferon prepared by means of such a plasmid in bacteria possesses the amino acid sequence of the mature polypeptide plus an additional methionine at its 40 NH2-terminal end. - 10 - The interferon production plasmid pER 33 coding for IFN-a2C has been constructed, <2? for example, according to these principles (its preparation is shown diagrammatically in Fig. 4). 5 a) Construction of the gene coding for mature interferon, with the exception of the codon for the N-terminal cysteine The starting material used for the interferon 10 information is, for example, the plasmid 1F7 coding for IFN-a2C, which was deposited on 17th May 1982 under accession number 2362 at the "Deutsche Sammlung von Mikroorganismen, Grisebachstrasse 8, D 3400 GOttingen, Federal 15 Republic of Germany (see also New Zealand Patent Application No. 204384 filed 27th May 1983). This plasmid was constructed by inserting the IFN-a2C gene into the Pst I site of pBR322. The IFN-a2C gene (like the genes of other 20 leucocyte interferon sub-types) has a restriction site for Sau 3A immediately after the TGT coding for the N-terminal cysteine. Existence of this site forms the basis for the method used for constructing a "mature" interferon gene 25 from suitable restriction fragments, for example from the interferon-specific 646 bp Ava II fragment and the 34bp-Sau 3A-Ava II fragment of plasmid 1F7. 30 b) Preparation of the oligonucleotide complex; An ATG methionine codon now has to be added to the gene constructed in this way at the 5' end of the missing cysteine codon and in front of it; it is also necessary to have a connecting 35 piece which allows this construction to be inserted into the Hind III site in the expression plasmid pER 103. For this purpose, 4 oligonucleotides o are synthesised: a 14mer 5* TGTGATCTGCCTCA, ( I* a 12mer 5' AGCTTAAAGATG, a 9mer 5' CAGATCACA 10 - 11 - and an 8mer 5' CATCTTTA. After ligating and ^3 a Sau 3A re-cut, these oligonucleotides will ^"cT\. represent the desired fragment which can connect the interferon gene part (Sau 3A end) to pER 103 (Hind III end): 12mer 14mer agcttaaagatgtgtgatctgcctca 3 • atttctacacactagIac I i i LJ i I Hind III 8m<er 9mer 1 Met Cys * Sau 3A 15 According to the invention, the oligonucleotides are constructed in such a way that the initiation codon ATG and the cysteine codon TGT are located on separate fragments. This allows the general use of the 12mer (and the 8mer) in the insertion 20 of genes in pER 103. The oligonucleotide with the cysteine codon therefore has to be at least 9 nucleotides long. For example, the following nucleotides can be used: 25 51TGTGATCTG, 5'TGTGATCTGC, 51TGTGATCTGCC, 5'TGTGATCTGGCT or 5 TGTGATCTGCCTC. 30 Thus, for example, the ligated double-stranded oligonucleotide obtained by using the above 14mer is digested with Sau 3A to produce the Sau 3A end for linkage to the interferon coding sequence. 35 The subsequent linking of the interferon A t 7* O gene and the oligonucleotide complex, insertion ^^ into a plasmid and the transformation of the lattjis|: into a bacterial host, for example such as Escher|qii9cJ^J C /> c l N - 12 - coli HB 101, are carried out according to processes^;? known in the literature. To further increase the yield in the preparation ~,Q of eucaryotic gene products, it can also be advantageous 5 if the relevant production plasmid contains multiple, for example double, the DNA sequences necessary for expression, for example two complete genes for mature interferon-a2C including the bacterial regulatory sequences. For this purpose, the gene 10 for the mature interferon, provided with a bacterial promoter, a procaryotic ribosomal binding site sequence and an ATG initiation codon, is isolated from a production plasmid prepared according to the invention, for example from pER 33, and, after 15 one of the two ends of this DNA portion has been changed, is inserted into a linearised completely identical plasmid prepared according to the invention by means of a restriction enzyme, for example EcoRI. It is also advantageous if a plasmid prepared 20 in this way according to the invention and carrying a promoter/operator sequence of the tryptophan operon of Serratia marcescens, such as, for example, the plasmid pER 33, is modified to contains a par-locus, that is to say a DNA sequence which, in the absence 25 of a selection pressure, for example by means of an antibiotic such as ampicillin, is responsible during bacterial growth for the uniform transfer of plasmids into subsidiary cells (see P.M. Meacock, S.N. Cohen in Cell 20, 529-542 (1980)). For this 30 purpose, the par locus was first isolated from the plasmid pPM 31, described in the literature reference mentioned above, and introduced into an interferon production plasmid prepared according to the invention. 35 It thus became possible by means of the present invention to construct an expression plasmid which /> contains the promoter/operator region of the tryptophan * operon of Serratia marcescens and a synthetic RBS. ''N The effect of this construction for the genetic z 10 JUL 1987 - 13 - p production of proteins has been shown by the example "C of a sub-type of leucocyte interferon. The following Examples will explain the invention in more detail. 14 A. Description of the general methods; 1. Restriction enzyme digestion Restriction endonucleases, for example of 5 Messrs. Bethesda Research Laboratories, were used under the following conditions: Eco RI, Hin dill, Pst I and Ava II digestion was carried out in TA buffer (33 mM Tris acetate, pH 7.9, 66 mM potassium acetate, 10 mM Mg acetate, 10 100 jjg/ml BSA) ; Hae III digestion was carried out in a TM buffer (70 mM Tris-HCl, pH 7.5, 7 mM MgClj); Sau 3A digestion was carried out in 10 mM Tris-HC1, pH 7.4, 10 mM MgClj, 75 mM NaCl. 2. Plasmid preparation, gel electrophoresis Plasmids were prepared from 1.5 ml (or 100-300 ml) of overnight cultures in L broth + 25 pg/ml of tetracycline or +100 pg/ml Ampicillin according 20 to the method of Birnboim and Doly (see Nucleic Acids Res. 7, 1513-1523 (1979)). Further purification of the plasmids was carried out by means of isopropanol precipitation (see below) and (in the case of large quantities) by chromatography on sepharose 4B of 25 Messrs. Pharmacia. Greater quantities of plasmids (from 1-6 litres of culture) were prepared according to the "cleared lysate" method of Clewell and Helsinki (see Biochemistry 4428-4440 (1970)), ethidium bromide CsCl gradient centrifugation subsequently 30 being carried out. Electrophoresis of plasmids or their restriction . digestion products was carried out in 0.8-1.4% agarose gels or in 6% polyacryamide gels in 40 mM Tris acetate, pH 7.8, 20 mM Na acetate, 2 mM EDTA. 35 Preparation of restriction fragments was carried out by cutting out the gel portion containing the desired fragment and by electrophoretic elution 15 of the DNA from the gel into a dialysis tube 40JUU987 - 15 - 3. Kinase and phosphatase reactions, ligase reactions^O 5'-Phosphorylation reactions (end markings were carried out in a TM buffer (70 mM Tris-HCl, O. pH 7.5, 7 mM MgCl,) + 5 mM DTT + 0.2-0.5 mM ATP ? 7 (10-20 pCi p-ATP) with 5 units of T4 polynucleotide O 5 kinase obtainable from Messrs. Bethesda Research Laboratories, for 60 minutes at 37°C. Incubation was then carried out for 10 minutes at 70°C to inactivate the enzyme. Ligase reactions were carried out overnight 10 at 14°C in a TM buffer + 5 mM DTT + 0.25 mM ATP with 0.1 units of T4 DNA ligase, obtainable from Messrs. Bethesda Research Laboratories (for "blunt-end" ligating), or 0.005 units of ligase (ligating of cohesive ends). The enzyme was subsequently 15 denatured for 10 minutes at 70°C. Successive kinase and ligase reactions were carried out in the same reaction mixture. After heat denaturation of the first enzyme, 5 mM DTT and 0.25-0.5 mM ATP were added again, and the second 20 reaction was conducted. Phosphatase reactions were carried out in a restriction digestion buffer (conventionally TA buffer), by the addition of 1 unit of alkaline phosphatase (prepared by Messrs. Sigma from calf 25 gut) to a restriction digestion preparation, and incubation for 15 minutes at 37°C. This was followed by 1-2 phenol extractions, ether extractions and alcohol precipitation. The DNA fragments were frequently separated electrophoretically and gel-30 eluted before further manipulation was carried out. To separate large DNA fragments (500 bp or larger) from small fragments (linker fragments which had not been ligated or small restriction digestion 35 products), isopropanol precipitation was carried out: the reaction was started with 2N NH„ acetate N 4 y/V \ x\ M\ ml to JUU987 « 2 06700 - 16 - (final concentration) and precipitation was carried out with 0.6 volumes of isopropanol for 10 to 20 minutes at room temperature. After centrifuging for 5 minutes in an Eppendorf centrifuge, the supernatant 5 was removed, the precipitation was washed with cold 70% ethanol and centrifuging was carried out again; the resulting pellet was dried and was ready for further manipulation. 10 B. Preparation of oligonucleotides? p,p'-dimethoxy-triphenylmethyl Isobutyryl Benzoyl (on the base nitrogen) polymeric carrier material Thymine or 2 N -Isobutyryl-guanine or 4 N -Benzoylcytosme or N^-Benzoyladenine Tetrahydrofuran DMTr = ibu = bz = 15 (p>- = B 20 THF 2 06700 17 Example I Functionalising the polymeric carrier material The polymeric carrier material was functionalised according to processes known in the literature. 5 HPLC silica gel (Macherey 5 Nagel, grain size 20 um, pore size 200-A) was used as carrier material. It was derivatised as described in Mateucci and Caruthers, with the exception that the succinylation step was carried out with succinic acid anhydride 10 in anhydrous pyridine (M.D. Matteucci, M.H. Caruthers, Tetrahedron Letters 21, 719 (1981)), J. Am. chem. Soc. 103, 3185 (1981) and also T. Tanaka, R.L. Letsinger, Nucleic Acids Research 10, 3249 (1982)). The protected nucleosides were thus linked covalently 15 to the silica gel according to the following formula: The load density was between 68 and 10 4 umol of nucleoside per g of carrier material. Example II 30 5'-Dimethoxytrityl-deoxythymidin-3'-chloromethoxyphosphite The fully protected nucleoside-3'-chloromethoxy-phosphites were synthesised according to processes known in the literature (M.D. Matteucci, M.H. Caruthers, J. Am. Chem. 103, 3185 (1981) and T. Tanaka, R.L. 35 Letsinger, Nucleic Acids Research K), 3249 (1982)). 544.6 mg (1.0 mMol) of 5'-dimethoxytrityl-thymidine (DMTrdT) were dissolved in 1.0 ml of absolute THF and this solution was added dropwise at -78°C within 15 minutes under Argon to a stirred B 20 25 2 067 00 - 18 - solution of 0.9 mMol of methyl-dichlorophosphite in 0.5 ml of absolute pyridine and 2.0 ml of absolute tetrahydrofuran. After a further 10 minutes, the reaction solution was heated to room temperature 5 and centrifuged. The supernatant was transferred by means of a pipette into a dry taper-ground stopper flask (25 ml) and filled with Argon. At room temperature, the solution was drawn off _in vacuo, 0.5 ml of toluene and tetrahydrofuran each was then added 10 and evaporation was carried out again, a colourless foamy solid remaining as the product. This product was not analysed for its purity, but was dissolved in 10.0 ml of absolute pyridine, and this solution was stored under Argon at -20°C for further use, 15 but for no longer than one week. Example III 2. 5 -Dimethoxytrityl-N-lsobutyryl-deoxyquanosin-31-chloromethoxy-phosphite 20 Analogously to Example II, a solution of this nucleoside phosphoro-chloridite was prepared in 10.0 ml of pyridine from 640.0 mg (1.0 mmol) 2 of 51-dimethoxytrityl-N -isobutyl-deoxyguanosine. 25 Example IV 4 5'-Dimethoxytr ityl-N—benzoyl-deoxycytidin-3'-chloro-methoxy-phosphi te Analogously to Example II, a solution of this nucleoside phosphoro-chloridite was prepared 30 in 10.0 ml of pyridine from 633.7 mg (1.0 mmol) of 51-dimethoxy-tr ityl-N4-benzoyl-deoxycytidine. Example V 5'-Dimethoxytr ityl-N—benzoyl-deoxyadenosin-3'-35 chloromethoxy-phosph i te Analogously to Example II, a solution of this nucleoside phosphoro-chloridite was prepared in 10.0 ml of pyridine from 657.7 mg (1.0 mmol) 2 06700 - 19 - r of 5'-dimethoxytrityl-N -benzoyl-deoxyadenosine. Example VI Synthesis of d-TCCTTA 5 50 mg (= 5 /imol) of the polymeric carrier • hz laden with DMTrdA (see Example I) were poured into a glass frit. According to the following list, various solvents and reagent solutions were then added, the carrier was shaken briefly, and 10 a solution removed again, after the desired reaction, by pressing it through the frit from above by means of an Argon gas stream. a) Splitting of the DMTr group by means of 3 ml 15 of a solution of 70 g of zinc bromide, 500 ml of nitromethane and 5 ml of water. Reaction time: 10 minutes. b) Washing 4 times each with 3 ml of a mixture 20 of n-butanol-lutidin-THF (4:1:5). c) Washing 4 times each with 4 ml of absolute pyr idine. 25 d) Condensation on of the next nucleotide module: 1 ml of the pyridine solution of 51-dimethoxytr ityl-deoxythymidin-3 '-chloromethoxyphosphite (Example B) (approximately 100 pmol) was added to the polymeric carrier under Argon 30 in the frit and this was shaken in the solution. Reaction time: 10 minutes. e) Washing 3 times each with 3 ml of absolute pyr idine. 35 f) Oxidation of the triphosphite with 100 mg of iodine dissolved in 3 ml of a mixture of tetrahydrofuran, lutidine and water (2:2:1). 206700 - 20 - Reaction time: 7 minutes. g) Washing 3 times each with 4 ml of tetrahydrofuran. h) Acetylation of the unreacted 5'-OH groups with a solution of 150 mg of dimethylaminopyridine, 5 0.3 ml of collidine, 0.25 ml acetic anhydride and 2.5 ml of tetrahydrofuran. Reaction time: 5 minutes. i) Washing 4 times each with 3 ml of nitromethane. This cycle from a) to i) was repeated only 10 four more times, and the nucleotide module required for the sequence was inserted in step d). Determining the yield: After the last nucleotide module was condensed 15 on, the carrier material was dried in an oil-pump vacuum, a sample of approximately 1 mg was weighed accurately and mixed with 10.0 ml of a 0.1 M solution of toluene sulphonic acid in acetonitrile. As the result of the splitting of the dimethoxytrityl 20 cation which occurs, an orange-red solution, the absorption of which was measured at 498 nm, is obtained. According to the formula Load [jjmol/g] = (Abs.49®) . (Dilution factor). 14.3 25 Weight of the carrier [mg] the loading of the carrier material with dimethoxytrityl protective groups can be calculated. 43 jimol/g is obtained. This corresponds to an average yield of 85% per condensation step. 30 Splitting of the methyl radicals from the triphosphate groups: 2 067 - 21 - The carrier material was shaken for 45 minutes in 4 ml of a solution of thiophenol, triethylamine and dioxan (1:1:2), and subsequently washed with ethanol and then with ether. 5 Splitting of the base protective groups and simultaneous splitting of the hexanucleotide chain from the polymeric carrier: the carrier material was heated for 14 hours to 50°C with 10 ml of concentrated ammonia, the aqueous solution was suction 10 filtered off and the filtrate was evaporated to approximately 2 ml. Purification of the product: The crude product thus obtained, which still 15 carried at the 5' end a dimethoxytrityl protective group, was subjected to reverse-phase HPLC. Column: /j-Bondapak C1Q of Messrs. Waters; eluant: 0.1M of triethylammoniumacetate buffer pH 7 with 25% acetonitrile; flow 2 ml/min.; retention time: 20 14 minutes. The collected elution fractions were evaporated to approximately 1 ml, mixed with 10 ml of 80% acetic acid and allowed to stand for 30 minutes at room temperature. The mixture was then evaporated to dryness _in vacuo at 50°C, the residue 25 was dissolved in 25 ml of water and the split-off dimethoxytritanol was extracted with 3 x 15 ml of ether. The aqueous phase was evaporated again to dryness, the residue was dissolved in 2.5 ml of water, demineralised by means of Biogel P 2 30 (column: 60 x 1.7 cm) and lyophilised. Analysis of the product: The analytic HPLC diagram was used as a purity check (column: 300 x 3.9 mm, p-Bondapak C-^g, Messrs. 35 Waters; eluant: 0.1M triethylammoniumacetate buffer pH 7 with 12% acetonitrile; flow: 1.5 ml/min.; retention time: 3.7 minutes). 2 06700 i - 22 - Example VII Synthesis of d-TAAGGAGGTTTA Prepared analogously to Example VI starting from 300 mg (30 jumol) of DMTrdAbz ^(p). 5 HPLC diagram of the product: Column: 300 x 3.9 mm, ju-Bondapak C^g, Messrs. Waters; Eluant: 0.1 M triethylammonium acetate buffer pH 7 with 12% acetonitrile; flow: 1.5 ml/min.; 10 retention time: 4.4 minutes. Example VIII Synthesis of d-AGCTTAAACC Prepared analogously to Example VI starting 15 from 200 mg (16 pmol). DMTrdCbz ~~(1) HPLC diagram of the product: Column: 300 x 3.9 mm, ^u-Bondapak C^g, Messrs. Waters; 20 Eluant: 0.1M triethylammoniumacetate buffer pH 7 with 12% acetonitrile; flow: 1.5 ml/min; retention time: 3.4 minutes. Example IX 25 Synthesis of d-CATCTTTA Prepared analogously to Example VI starting from 150 mg (1.32 jjmol) DMTrdAbz A/vXg) . HPLC diagram of the product: Column: 300 x 7.8 mm, ju-Bondapak C^g, Messrs. 30 Water; Eluant: 0.1 M triethylammoniumacetate buffer pH 7 with 20% acetonitrile; flow: 1.5 ml/min.; retention time: 7.7 minutes. 35 Example X Synthesis of d-AGCTTAAAGATG Prepared analogously to Example VI starting from 200 mg (16.2 /jmol) DMTrdG'*"'30 • - 23 - HPLC diagram of the product: Column: 300 x 7.8 mm, p-Bondapak C18' Messrs. .0 o'. Waters; Eluant: 0.1 M triethylammoniumacetate buffer pH 5 7 with 26% acetonitrile; flow: 1.5 ml/min.; retention time: 5.2 minutes. Example XI Synthesis of d-TGTGATCTGCCTCA 10 Prepared analogously to Example VI starting from 250 mg (22 pmol) of DMTrdAbz **>*(?). HPLC diagram of the product: Column: 300 x 7.8 mm; p-Bondapak C^g; Messrs. Waters; 15 Eluant: 0.1 M triethylammoniumacetate buffer pH 7 with 25% acetonitrile; flow: 1.5 ml/min.; retention time: 6.1 minutes. Example XII 20 Synthesis of d-CAGATCACA Prepared analogously to Example VI starting from 150 mg (13.2 pmol) of DMTrdAbz *~{p). HPLC diagram of the product: Column: 300 x 7.8 mm; p-Bondapak C^g; Messrs. 25 Waters; Eluant: 0.1 M triethylammoniumacetate buffer pH 7 with 20% acetonitrile; flow: 0.2 ml/min.; retention time: 5.2 minutes. 30 Analysis of the oligodeoxynucleotides The sequence analysis of synthetically produced oligodeoxynucleotides was carried out after they had been incorporated in the interferon production plasmid pER 33 (see Example 2: sequence analysis 35 of the interferon plasmid pER 33). This analysis at the same time proved the correctness of the base sequence in the oligodeoxynucleotides (see Fig "V -.*• 5) . - 24 - J) Example 1 Q Construction of the expression plasmid pER 103 'O The construction of the expression plasmid pER 103 is shown diagrammatically in Fig. 1. 5 a) Isolation of the promoter/operator fragment As hereinbefore indicated, the required Eco RI-Hae III fragment comprising the trp promoter/operator of Serratia marcescens may, for example, be isolated 10 by conventional restriction enzyme digestion techniques from any plasmid known to contain this fragment (see Miozzari and Yanofsky, Nature 276, 684-689 (1978)). The source chosen for isolation of the 15 promoter/operator sequence was a novel plasmid designated pBP 101 containing approximately 1000 bp of the tryptophan operon of S. marcescens. From this plasmid, the Eco RI-Hae III fragment as hereinbefore defined, containing the trp promoter of S. marcescens 20 oriented in the direction Eco RI -f Hae III, can be obtained by digestion with Eco RI within a 200 bp Eco RI fragment. Approximately 25 pg of the plasmid pBP 101 were digested by means of the restriction enzyme 25 Eco RI, the two fragments obtained were separated from one another by means of gel electrophoresis (1.4% agarose), and the 200 bp long fragment was eluted from the gel electrophoretically. This fragment was then digested by means of Hae III, 30 the two digestion products were separated on a 6% polyacrylamide gel, and the 90-bp long fragment (promoter/operator) was isolated again from the gel. 35 b) Construction of the ribosome binding site sequence (RBS) The RBS was composed from 3 synthetic oligonuc.1^6-^ ^ 6^ tides: the 6mer 5'-TCCTTA, the lOmer 51-AGCTTAAACQ#1 ^ 25 t. - and the 12mer 5'-TAAGGAGGTTTA. 500 pmole of the 6mer were phosphorylated by means of the enzyme polynucleotide kinase and labelled radioactively (see Part A). The reaction mixture was heated for 10 minutes 5 to 70°C to inactivate the kinase, equimolar quantities of (non-phosphorylated) lOmer and 12mer were then added, the oligonucleotide mixture was heated to 95°C and then cooled slowly (over approximately 3 hours) to 30-35°C, the oligonucleotides being 10 hybridised with one another: By the addition of 0.25 mM ATP and 5mM DTT, the 20 6mer and lOmer were connected covalently to one another by means of the enzyme DNA-ligase (see Part A). The lack of phosphate radicals at the 5' ends of the 12mer and lOmer prevented the synthesis of multimeric ligation products. After the reaction, 25 heating was carried out for 10 minutes to 70°C to inactivate the ligase, then, after the addition of 0.5 mM ATP and 5 mM DTT, the 5* ends Of the 12mer and lOmer were also phosphorylated in a further kinase reaction (see Part A), with the result that 30 the RBS was produced. / 1 c) Linking of the promoter and RBS 15 pmole of the 90 bp long Eco RI-Hae III promoter/operator fragment were ligated under standard 35 conditions (see Part A) with 60 pmole of RBS. Since only the blunt end, produced by the Hae III cut, of the 90-bp fragment can ligate with the 12mer 15 5' I dTAAGGAGGTTTA HO 3' dATTCCTCCAAATTCGA i 1 i 6mer lOmer blunt end of the RBS, only molecules containing the RBS in the correct orientation downstream of 26 the promoter were obtained. After the reaction, the ligase was inactivated at 70°C for 10 minutes, it was adjusted to the TA buffer concentration 5 (see Part A) and further digestion was carried out with 200 units of Hind III and 10 units of Eco RI. This was advantageous in order to convert the multimers obtained in the ligase reaction (since, in addition to the desired reaction, both Eco RI 10 ends and Hind III ends could be ligated with one another) into monomers again. The sample was then separated on a 6% polyacrylamide gel, and the approximately 100-bp long promoter/operator RBS fragment (possessing an Eco RI end and a Hind III end) was 15 cut out from the gel and eluted electrophoretically to separate it from the excess of unligated RBS. The part of the expression plasmid responsible for expression was produced as a result (see Figure The nucleotide sequence illustrated in Fig. 3 can be completed by means of methods of polynucleotide synthesis known in the literature. 25 d) Insertion of the promoter/operator RBS fragment into the plasmid pBR322 Approximately 2 |ig of the plasmid pBR322 were cut by means of the restriction enzymes Eco RI and Hind III, two fragments being obtained: 30 a large fragment of 4332 bp and a small fragment of 29 bp. The large fragment was separated from the small fragment by means of electrophoresis on a 0.8% agarose gel, cut out from the gel and eluted. Approximately 0.4 pmole of this fragment 35 were then ligated with 10 pmole of the promoter/operator RBS fragment (see Part A). It was not possible to ligate the pBR322 fragment with itself because of its two overhanging ends which did not fit tog 3) 20 - 27 - since the promoter/operator RBS fragment could -O 0 ,3 only be ligated in the plasmid in one orientation, <-< promotion was carried out in the direction of the Hind III restriction site to the tetracycline resistance 5 gene of pBR322. e) Transformation of Escherichia coli with the expression plasmid pER 103 Escherichia coli HB 101 was transformed by 10 means of the reaction mixture of this last ligation in a way known in the literature (see Dworkin and Dawid, Dev. Biol. 7J5, 435-448 (1980) ) , and the transformants were selected on agar plates containing ampicillin. For this purpose, E.coli HB 101 cells 8 15 were cultivated to a density of approximately 2 x 10 cells/ml. The cells were pelletised and suspended in 100 mM CaCl^ solution (for 20 minutes at 0°C). Then, the cells were incubated with the reaction mixture of the ligase reaction for 5 minutes at 20 0°-4°C and for 5 minutes at 37°C. After the addition of 0.5 - 1 ml of 1-broth, further incubation was carried out for 15-30 minutes at 37°C. 19 transformants were selected and were tested for their possible content of the promoter/operator/RBS fragment 25 by means of Hae III restriction endonuclease. The 192-bp pBR322/Hae III fragment was missing and had been replaced by a 264 bp fragment (16 bp from the Hae III site in pBR322 "on the left" of the Eco RI site + 103 bp promoter/operator/RBS fragment + 30 145 bp from the Hind III site up to the next Hae III site "on the right" of it, in pBR322). Of the 19 selected transformants, 18 showed the expected \ digestion pattern (see Fig. 2). 35 f) Sequence analysis of the promoter/operator RBS region of the expression plasmid pER ,s t ^ T ^ 103 /fair- AOJUU987 C F * - 28 - To establish without any doubt the correctness Cjq of the expression plasmids constructed, one of these plasmids (pER 103) was analysed as regards its sequence in the promoter/operator/RBS region 5 and the position of this region in pBR322 was established. The sequence analysis was conducted according to the method of Maxam and Gilbert (see Proc. Nat. Acad. Sci. 74, 560-564 (1977)) known in the literature and took place from the Eco RI site in the direction 10 of the Hind III site (and beyond), and also from the Hind III site in the direction of the Eco RI site (and beyond). The nucleotide sequence illustrated in Fig. 3 was obtained. pER 103 is therefore an expression, plasmid 15 which contains the promoter/operator region of the tryptophan operon of Serratia marcescens in combination with a synthetic RBS. This new expression plasmid promotes the transcription of genes which are incorporated at its Hind III site and allows 20 efficient translation of these transcription products. Example 2 shows that this is the case. Example 2 Construction of the interferon production plasmid 25 pER 33 a. Construction of the gene coding for mature interferon, with the exception of the codon for the N-terminal cysteine Approximately 1 pg of the Pst I insert of 30 1F7 was digested by means of the restriction enzyme Sau 3A, and the 177 bp long fragment,'extending from the Sau 3A site after the N-terminal cysteine codon up to the next Sau 3A site and containing an Ava II site, was isolated from a 6% polyacrylamide 35 gel. It was treated with 1 unit of alkaline phosphatase (see Part A) and after the removal of the phosphatase by means of phenol and ether extraction was precipitated £ with ethanol. The fragment was subsequently cut iLj ^ 50 JULW87 m - 29 - by means of Ava II, with the result that the desired 34-bp Sau 3A-Ava II fragment and a 143-bp fragment were obtained. In parallel with this, the interferon-specific 5 646-bp Ava II fragment, extending from the Ava II site within the 177-bp Sau 3A fragment to behind the termination codon, was prepared from the plasmid 1F7. Approximately 0 .5 fig of this 646-bp Ava II fragment were then incubated together with the 10 mixture of 34-bp and 143-bp Sau 3A-Ava II fragments with the enzyme DNA-ligase (see Part A) for ligation of cohesive ends. As a result, Ava II fragments which, connected covalently, are flanked by Ava II-Sau 3A fragments, were obtained. As soon as 15 an Ava.II-Sau 3A fragment had ligated with an Ava II fragment, no further ligations could take place at this point any more, since the Sau 3A ends had been dephosphorylated. After the ligation step, heating was carried out for 10 minutes to 70°C 20 to inactivate the enzyme, then 5 mM DTT and 0.25 mM ATP were added, and the dephosphorylated Sau 3A ends were again phosphosylated (see Part A). The reaction mixture was separated on a 6% polyacrylamide gel and molecules in the range of 700-800 bp (a 25 646-bp Ava II fragment flanked by two Ava II-Sau 3A fragments) and in the range of 1300-1500 bp (two 646-bp Ava II fragments ligated with one another and flanked by Ava II-Sau 3A fragments) were eluted. ~'6 % 30 b. Preparation of the oligonucleotide complex of formula 12mer 14mer 35 5' agcttaaagatgtgtJgatctgcctca 3' atttctacacactagIac ' ' * ' 8mer 9mer! Hind iii ( ( ■ t fsau 3a Met Cys ' ■Y^ ° JUU987 , - . r 4 synthetically produced oligonucleotides, 30 namely a 14mer 51 tgtgatctgcctca, a 12mer 5' agcttaaagatg, a 9raer 5' gagatcaca and an 8mer 5' catcttta, were reacted as follows: 250 pmole of 8mer, 9mer and 5 14mer were each phosphorylated (see Part a), and after the reaction the kinase was inactivated by heating to 95°c, 250 pmole of non-phosphorylated 12mer were added and the oligonucleotide mixture was cooled slowly (over approximately 3 hours) 10 to 35°C to allow hybridising of the oligonucleotides. Then, after the addition of 5 mM of DTT and 0.25 mM of ATP, the oligonucleotides were ligated with one another (blunt-end ligation, see Part A). The lack of a phosphate radical at 51 end of the 15 12mer prevented the formation of dimers; the overhanging end of the 14mer is not self-complementary and cannot lead to dimerisation. An aliquot (25 pmole) of the ligated oligonucleotide complex was digested by means of 80 20 units of Sau 3A to produce the Sau 3A end for linkage with the interferon gene. The sample was then heated to 75°C for 10 minutes, extracted with phenol and precipitated with ethanol. This produced the linker fragment which connects the interferon gene 25 to the Hind Ill-cut pER 103 according to the invention. c) Linking of the interferon gene and oligonucleotide complex, ligation in pER 103 The isolated interferon fragment (see Example 30 2a) representing approximately 1 pmol of molecules was connected to the Sau 3A-cut oligonucleotide complex (approximately 25 pmol) by ligation of the cohesive Sau 3A ends (see part A). Again the r J "O - 31 - lack of a phosphate radical at the Hind III end of the oligonucleotide complex (12mer) prevented the occurrence of multimers. Interferon gene molecules which were flanked on both sides by an oligonucleotide 5 complex with a free Hind III end were obtained. After heat denaturation of the ligase and the addition of 5 mM of DTT and 0.25 mM of ATP, these ends were phosphorylated (see Part A), and then isopropanol precipitation was carried out (see Part A), to 10 separate oligonucleotide complex dimers obtained in the ligase reaction. Thereupon, the construction was ligated with 0.05 jig of Hind Ill-cut phosphatase-treated pER 103 (see Part A for ligation of cohesive ends). The phosphatase treatment (see Part A) 15 of the Hind Ill-cut plasmid prevented it from recirculating in the ligase reaction. This produced a mixture of plasmids which contained 50% of interferon production plasmids (namely those plasmids which had obtained a 34-bp Sau 3A-Ava II fragment in 20 the ligation with the 646 bp Ava II fragment at the start of the gene - see Example 2a). d) Transformation of Escherichia coli HB 101 and analysis of the transformants as regards 25 interferon production The plasmid mixture prepared according to Example 2c was used, analogously to Example le for the transformation of Escherichia coli HB 101 (see Dworkin and Dawid, Dev. Biol. 16, 435-448 30 (1980)). Approximately 20% of the transformants obtained had inserts (the rest were recirculated pER 103 plasmids), several of which were analysed for interferon expression. For this purpose, 100 ml of bacteria culture were cultivated to an optical 35 density of 0.6-0.8 in M9 Minimal Medium, to which all the amino acids apart from tryptophan (20 pg/ml. j'/* v per amino acid), and thiamine (1 pg/ml)f glucose j ^ (0.2%) and the inducer of the tryptophan operon (H T,10 JUU987 I ' o - 32 - z? indol-(3)-acrylic acid (IAA, 20pg/ml; see Hallewell and Emtage in Gene 9_, 27-47 (1980)), had been added. The bacteria were pelletised by centrifuging for 10 minutes at 7,000 revolutions per minute, washed 5 once in 50 mM of Tris HC1, pH 8, 30mM NaCl and finally suspended in 1.5 ml of the same buffer. After incubation with 1 mg/ml of lysozyme for 30 minutes on ice, the bacteria were frozen 5 times and thawed and the cell fractions were then removed by centrifuging 10 for an hour at 40,000 revolutions per minute. The supernatant was filtered sterile and tested for interferon activity in the plaque reduction test with V3 cells and vescicular Stomatitis Virus. Approximately half of all the clones (with an insert) 8 15 showed considerable interferon expression: 2 x 10 units (international reference units) per litre of culture. e. Sequence analysis of the interferon production plasmid pER 33) 20 One of these interferon-producing clones (pER 33) was selected and analysed as regards its sequence from the promoter/operator region into the interferon gene to establish the correctness of the constructed plasmid. The sequence analysis 25 was carried out again according to Maxam and Gilbert (see Proc. Nat. Acad. Sci. USA 74^, 560-564 (1977)) and took place from the Eco Rl-site labelled radioactively at the 3' end in the direction of the interferon gene. The expected sequence was obtained, a cut-30 out from this being shown in Figure 5. All the oligonucleotides fragments used to construct pER 33 can be seen in this cut-out. The above-mentioned properties demonstrate that the expression plasmid pER 103 prepared according 35 to the invention contains the promoter/operator sequence of the tryptophan operon of Serratia marce in combination with a synthetic ribosome binding site sequence. It was ^possible to show by the u - - juLwaf o (...' °o - 33 - example of a leucocyte interferon gene that genes incorporated in a suitable way in the expression plasmid pER 103 show high expression values. 5 The expression plasmid pER 103 was deposited in Escherichia coli HB 101 on October 27, 1983 under the DSM No. 2773 at the "Deutsche Sammlung von Mikroorganismen,,, Grisebachstra8e 8, D-3400 GOttingen, Federal Republic of Germany according to the Budapest 10 Treaty. Example 3 Construction of the interferon production plasmid PER 21/1 15 The construction of the plasmid pER 21/1 is shown diagrammatically in Figure 6. a) preparation of the IFN-a2C gene from PER 33 2 pg of pER 33 were cut with the restriction 20 enzymes Eco RI and Bam HI, resulting in two fragments having the lengths of approximately 1300 bp and 4,000 bp. These fragments were separated electrophoretically on a 1.2% agarose gel. The shorter fragment was isolated from the gel by means of electro-elution. 25 The ends of this DNA were converted to blunt ends by the addition of 1.25 nMol of dATP, dGTP, dCTP and dTTP each and 2 units of the klenow fragment of DNA polymerase I. The DNA was purified by phenol extraction and precipitation from an ethanolic 30 solution and subsequently taken up in 15 yl H2O. Approximately 15 pMol of Eco Rl-linker (New England Biolabs (Inc.) were phosphorylated at the 5'ends by the additon of X- p-ATP and T4-polynucleotide kinase in a 5 |il reaction solution. After heat 35 inactivation of the kinase, the DNA, 5 nMol of ATP and 0.1 units of T4 ligase were added and incubate^^£ N *" at 14°C for 16 hours. The reaction product was purified of lower-molecular substances by isopropanoif^ precipitation. 1|;10JUL198 The DNA was finally cut by means of 20 units 34 of restriction enzyme Eco RI, again purified by isopropanol precipitation and dissolved in 10 pi of h2o. 5 b) Linearisation of the Plasmid pER33 Approxmately 2 pg of pER 33 were treated with the restriction enzyme Eco RI. Subsequently, alkaline phosphatase was added to remove the 5'phosphate radicals. The approximately 5300 bp long linear 10 DNA was purified by electrophoresis in a 1.2% agarose gel and by electro-elution of the remaining uncut pER 33. The DNA was extracted with phenol and ether, precipitated from an ethanolic solution and dissolved in 10 pi of H^0. 15 c) Linking of the linearised pER 33 with the additional gene for IFN-a2C 4 pi of the DNA portion provided with Eco RI-linkers and containing the IFN-a2C gene plus regulatory elements were ligated with one another 20 and elements of 0.5 pi of Eco Rl-linearised and dephosphorylated pER 33 in a 20 pi reaction solution by means of 0.1 units of T4 ligase. After integration for 16 hours at 14°C, the enzyme was destroyed by heating to 68°C. 25 d) Transformation of E.coli HB101 and analysis of the transformants as regards interferon production E.coli HB101 was transformed analogously to Example le by means of the DNA from Example 30 3c. Two of the clones produced in this way were tested analogously to Example 2d for interferon expression by means of the plaque reduction test. Whereas the clone pER 33 shows up to 200 x 10^ units of IFN per 1 litre of culture, surprisingly more 35 than 300 x 10^ units per litre of culture were obtained with one of the new clones, designated pER 21/1. e) Restriction enzyme analysis of pER 21/1 - 35 - o'^ The plasmid pER 21/1 was isolated in a relatively large quantity and analysed by means of restriction enzyme digestion with Hind III. Since the DNA introduced into the Eco RI site in pER 33 had two 5 identical Eco RI ends, two orientations of this DNA were possible in the pER 21/1. Restriction enzyme digestion with Hind III of pER 21/1 with interferon genes directed in parallel should show fragments of approximately the sizes 4100, 950 10 (2 fragments) and 450 bp. However, if the two genes were oriented in the opposite direction, fragments of approximately the sizes 4350, 950, (two fragments) and 200 bp are to be expected. Digestion of approximately 2 jag of pER 21/1 by 15 means of the restriction enzyme Hind III and subsequent electrophoresis in a 1.4% agarose gel resulted in fragments of approximately 4100, 950 and 450 bp. Consequently, the two IFN-a2C genes are oriented parallel to one another (see Figure 6). 20 Example 4 Construction of the interferon production plasmid parpER 33 The construction of the plasmid parpER 33 is shown diagrammatically in Figure 7. 25 a) Preparation of the par-locus Approxmately 200, pMol of EcoRI linker (New England Biolabs Inc.) were phosphorylated at the ends in 20 pi reaction solution with 9 units of T4 polynucleotide kinase and 10 nMol of ATP, and 30 the enzyme was subsequently heat-inactivated. 8 pg of the plasmid pPM 31 were cut by means of the restriction enzyme Aval. The ends of the linearised plasmid were converted to blunt ends by the addition of 5nMol of dATP, dGTP, dTTP each 35 and 4 units of the klenow fragment of DNA polymerase I. The DNA was purified by phenol extraction and „■</" O ^ precipitation from ethanolic solution and taken A up in 40 (ul of H2O. 10 JUL1987 E \^ A 36 The Eco RI linkers were treated, together with the linearised DNA having blunt ends, for 16 hours at 14°C in 70 fil of reaction solution with 6 nMol of ATP after heat inactivation of the 5 enzyme, the solution was adjusted to 50 mM NaCl and 50 mM Tris HC1, pH=7.6 and the DNA was treated with 300 units of Eco RI. After 2 hours of incubation, the restriction enzyme was heat-denatured and the DNA was separated electrophoretically in a 1.4% 10 agarose gel. The DNA portion of approximately 400 bp length, containing the par-locus, was electro-eluted from the gel, purified by phenol extraction and precipitation from ethanolic solution and dissolved in 50 pi of HjO. This DNA portion now has Eco RI-15 specific overhangs at its ends. b) Linearisation of the plasmid pER 33 Approximately 2 pg of pER 33 were treated with the restriction enzyme Eco RI. Subsequently, alkaline phosphatase was added to remove the 5*-20 phosphate radicals. The approximately 5300-bp long linear DNA of the remaining uncut pER 33 was purified by electrophoresis in a 1.2% agarose gel and electro-elution. The DNA solution was extracted with phenol and ether, precipitated from ethanolic 25 solution and dissolved in 50 pi H20. c) Linking of the linearised pER 33 with the par-locus DNA 1 pi of linearised pER 33 DNA was ligated with 1 pi of par-locus DNA in a 20 pi reaction 30 solution by means of 0.1 units of T4 ligase. After incubation for 16 hours at 14°C, the enzyme was heat-inactivated. d) Transformation of E.coli HB101 and analysis of the plasmids from the transformed bacteria 35 E.coli HB101 was transformed analogously to Example le by means of the DNA from Example 4c. Approximately 50 colonies were obtained. From 10 of these colonies, a small quantity of O - 37 - ' Q plasmid DNA was isolated (Birnboim and Doly, Nucleic "Q Acid Research 7, 1513-1523 (1979)) and cut by means of the restriction enzyme Pstl. Analysis by agarose electrophoresis showed that all these plasmids 5 contained an approximately 400-bp long par-locus. One of these plasmids was selected and designated parpER 33. e) Analysis of parpER 33 as regards interferon production and stability 10 Analogously to Example 2d, bacteria containing either pER 33 or parpER 33 were cultivated and subsequently tested for interferon content in the plaque reduction test. Both strains showed approximately the same level of interferon expression. 15 In a long-term test extending over a 120 bacteria generations, the stability of the plasmids pER 33 and parpER 33 in E.coli HB101 in the absence of selection pressure by the antibiotic ampicillin was investigated. Samples were taken from the 20 culture at regular intervals, and the bacteria were tested for interferon content. It emerged that the bacteria containing pER 33 ceased interferon production after approximately 60 generations. However, bacteria containing parpER 33 produced 25 interferon-a2C to an undiminished extent even after 120 generations. It was therefore shown that introducing the par-locus into pER 33 ("parpER 33") increases the stability of the plasmid in E.coli HB101. 10 JULW87' Terms and abbreviations - 38 -used _D c.: % ATP Base pair: blunt end: bp: BSA: cDNA: coding: Codon: dephosphorylation: DNA: DTT; Electrophoresis: Expression: adenosine triphosphate two complementary nucleotides, for example A-T, G-C completely base-paired end of a DNA double-strand molecule, as distinct from overhanging single-strand ends base pairs bovine serum albumin a DNA complementary to mRNA carrying the information for something; DNA carries in the nucleotide sequence the information for the amino acid sequence of a protein group of 3 nucleotides which code for a specific amino acid or for the termination of polypeptide synthesis removal of a phosphate group deoxyribonucleic acid dithiothreitol Separation of (DNA) molecules in an electrical field conversion of the information of a gene into mRNA by transcription and in a further step into a polypeptide by translation 0 /O - 39 - 25 35 Expression plasmid: Gene: 10 Gene product: 15 Hybridisation (of nucleic acids): 20 Hybrid plasmid: IFN-a2C: Initiation codon: 30 Insert: Interferon production plasmid: Kinase: .3 c? o. a plasmid which allows the expression of genes appropriately incorporated in it downstream from a promoter/operator/ribosome binding site sequence a segment on the DNA which carries information for a specific transcript (RNA-molecule) which can be translated to give a protein. RNA (transcript), protein (translation product) the formation of stable complexes between DNA strands complementary to one another a plasmid which contains a DNA segment of extraneous origin leucocyte interferon sub-type a2C as encoded by plasmid 1F7 the codon ATG which codes for methionine and which can signal the start of translation the portion of extraneous DNA which is located in a hybrid plasmid Plasmid in which an interferon coding sequence is operably linked to a promoter/operator /ribosome binding site sequence an enzyme which can phosphorylate the 5'-OH 10JUU987^ Y ■-?... r c\N. ^ V n - 40 - u To kinase: Clone: Cohesive ends: Complementary: Ligase: To ligate: mRNA: Nucleotide: Nucleotide sequence: Oligonucleotide: Operator: <5> C group on DNA and RNA molecules to provide with 5'-phosphate groups A bacterial colony originating from an individual bacterium overhanging single-strand ends of a DNA molecule which can be hybridised with one another matching one another (in the nucleotides of DNA: A is complementary to T, G is complementary to C) An enzyme which can connect various DNA molecules covalently to one another to connect covalently to one another (DNA molecules) messenger RNA, i.e. an RNA coding for a polypeptide module of a DNA or RNA (A=adenosine, C = cytidine, G = guanosine, T = thymidine, U = uracil) sequence of nucleotides in a DNA or RNA molecule a few nucleotides linked with one another by phosphodiester bonds (short single-strand DNA segment) part of the regulatory region of an operon, to which the repressor 'o n /' o - 41 - .3 c- * Operon: Par locus phosphatase: Plasmid: Promoter: RBS: Restriction endonuclease (restriction enzyme): Restriction fragments: Ribosome binding site sequence: RNA: / > % binds, with the result that transciption is prevented a group of (bacterial) genes which are regulated by a single operator region a DNA sequence in a plasmid which during growth of the host enables even distribution or partition of the plasmid between daughter cells, an enzyme which can remove 5'-phosphate groups from DNA molecules an extrachromosomal cyclic DNA molecule DNA sequence which is capable of binding the enzyme RNA polymerase see ribosome binding site sequence An enzyme which can cut double-stranded DNA in a specific symmetrical DNA sequence fragments of DNA which are obtained as a result of digestion with one or more restriction endonucleases part of the mRNA which initially binds ribosomes ,- „ /-for translation. vv ribonucleic acid i \i v. . i;z 10 JUL1987* - 42 - RNA-polymerase: Termination codon: Transformant: Transformation: Transcription: Translation: Tris: .3 •*cr an enzyme which can synthesise an RNA strand complementary to DNA a codon which signals the end of translation a cell, e.g. a bacterium, which has received extraneous DNA (a plasmid) as a result of transformation: The incorporation of extraneous (plasmid) DNA in a cell, e.g. a bacterium The synthesis of RNA complementary to a DNA sequence The utilisation of information from mRNA in the synthesis of a polypeptide trishydroxymethylaminoethane 3? e n r 9- A-X- N 10 JUL'987 .~3 - 43 - ''O Brief description of the illustrations O g Figure 1 shows a diagrammatic representation of the construction of the expression plasmid pER 10 3. The fragment sizes are not shown true to scale. 5 Figure 2 shows the Hae III digestion pattern of the plasmids pBR322 and pER 103. The 192-bp fragment of pBR332 is replaced in pER 103 by a fragment of approximately 10 270 bp (see Example Id) Figure 3 shows the nucleotide sequence of pER 103 between the Eco RI and the Hind III sites. The rest of 15 the plasmid corresponds to the large Hind III-Eco RI fragment of pBR322 (see Example lc and If) Figure 4 is a diagrammatic representation of the construction 20 of the interferon production plasmid pER 33. With the exception of the restriction map of the 1F7 insert, showing the Pst I, Sau 3a and Ava II sites, the fragments are not shown true to scale. 25 Figure 5 shows a cut out of a sequence gel on which the promoter/RBS-interferon gene connection can be seen. All the oligonucleotide fragments used in the construction of pER 33 are present. For a 30 clearer understanding, the same sequence is shown again underneath in a double strand; the individual oligonucleotide modules are indicated. Figure 6 35 is a diagrammatic representation of the construction of the interferon production plasmid pER 21/1. 10 JUL1987 - 44 - The fragments and plasmids are not shown true to scale. Figure 7 is a diagrammatic representation of the construction of the interferon production plasmid parpER 33. The fragments and plasmids are not shown true to scale. - 45 - *0 WHAT 4/WE CLAIM IS:- ^ (r. </div>

Claims

<div class="application article clearfix printTableText" id="claims"> Claims;

1. A polydeoxyribonucleotide having the sequence: 5 ' AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC . 3 ' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Promoter r GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTA CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA Promoter/Operator RBS 5| (wherein RBS is the ribosome binding site sequence) and mutants thereof having a functional promoter/operator/RBS sequence.

2. A polydeoxyribonucleotide as claimed in claim 1 which additionally carries a linker sequence following the ribosome binding site sequence.

3. A polydeoxyribonucleotide as claimed in claim 2 having the sequence: 5 1 AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3 ' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Promoter — — GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAjAGCT CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA,1 a Promoter/operator ^—RBS HindllI --Linker yj TAAAGATGTGT ATTTCTACACACTAG V\ - « - °a~y °o (wherein RBS is the ribosome binding site sequence) and mutants thereof having a functional promoter/operator/RBS sequence.

4. A polydeoxyribonucleotide as claimed in claim 3 which additionally carries a further DNA restriction fragment encoding an amino acid sequence so as to provide a structural gene for a human a-interferon, said further amino acid coding sequence being coupled to the said linker sequence by means of a 3*, 5'-phosphodiester bond.

5. A polydeoxyribonucleotide as claimed in claim 4 which additionally carries a further restriction fragment to form a polydeoxyribonucleotide comprising the sequence: 5 ' AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTC 3' GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Promoter ufc- — — GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAfAGCT CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCG A| Promoter/Operator : ^—rbs ——^ j . . v. Hind 111 --Linker £ IPN-a2C gene** ^ taaagatgtgt^atctgcctcaaa ATTTCTACACACTAGACGGAGTTT I - Sau3A (wherein RBS is the ribosome binding site and IFN-a2C gene is the mature a-interferon structural gene of plasmid IF7 or a degenerate variant thereof) and mutants thereof having a functional promoter/operator/RBS sequence operably linked to an IFN-a2C gene. 10 JUL 1987 - 47 - ^

An expression plasmid which comprises a DNA sequence as claimed in any one of claims 1, 2 or 3 and wherein a restriction fragment comprising an amino acid coding sequence can be inserted immediately following said DNA sequence so as to provide a structural gene for a polypeptide under the control of the promoter/operator sequence within said DNA sequence.

The expression plasmid of claim 6 designated pER 103 (deposited in E^ coli HB101 under DSM No. 2773 at the Deutsche Sammlung von Mikroorganismen) and mutants thereof having a functional promoter/operator/ribosome binding site sequence.

An a-interferon production plasmid which comprises one or more DNA sequences as claimed in claim 4 or claim 5.

An a-interferon production plasmid as claimed in claim 8 which further comprises a par-locus .

The a-interferon production plasmid of claim 8 designated pER 33 and mutants thereof having an a-interferon gene capable of expression in a bacterium.

The a-interferon production plasmid of claim 8 designated pER 21/1 and mutants thereof having an a-interferon gene capable of expression in a bacterium.

The a-interferon production plasmid of claim 9 designated parpER 33 and mutants thereof having an a-interferon gene capable of expression '7 in a bacterium. jW .-0 cJ - 48 -

13. A process for preparing a polydeoxyr ibonucleot ide c.s as defined in claim 1, wherein the Eco RI/Hae III fragment comprising the promoter/operator sequence of the tryptophan operon of Serratia marcescens is linked to the ribosome binding site sequence 5 ' taaggaggttta 3' attcctccaaattcga

14. A process for preparing a polydeoxyribonucleotide as claimed in claim 2 or claim 3, wherein a polydeoxyribonucleotide as claimed in claim 1 is ligated to an appropriate linker sequence.

15. A process for preparing a polydeoxyribonucleotide as claimed in claim 4 or claim 5, wherein a polydeoxyribonucleotide as claimed in claim 1 or claim 3 is ligated to a second restriction fragment to complete the required nucleotide sequence.

16. A process as claimed in claim 13 substantially as herein described in Examples la to lc.

17. A polydeoxyribonucleotide as defined in any one of claims 1 to 5 when prepared by a process as claimed in any one of claims 13 to 16.

18. A process for preparing a plasmid as claimed in claim 6 or claim 7, wherein the whole of or a portion of a plasmid is combined with a polydeoxyribonucleotide as claimed in any one of claims 1 to 3.

19. A process as claimed in claim 18 wherein the starting plasmid employed is plasmid pBR32y2^x 10 JUL 1987 - 49 - -D c

20. A process as claimed in claim 19 wherein "*,<? O the 29bp Eco RI-Hind III fragment is removed from plasmid pBR322 by restriction endonuclease splitting and is replaced by insertion of a DNA sequence as claimed in claim 1 or claim 2 in the presence of a ligase.

21. A process for preparing an a-interferon production plasmid as claimed in any one of claims 8 to 12 which comprises combining the whole of or a portion of a plasmid with a polydeoxyribonucleotide as claimed in claim 4 or claim 5.

22. A process for preparing an a-interferon production plasmid as claimed in any one of claims 8 to 12 which comprises inserting a restriction fragment comprising the DNA sequence I—IFN-a gene-AGCTTAAAGATGTGTJ ATTTCTACACACTAG! » / Linker _ Sau3A A f into a plasmid containing a polydeoxyribonucleotide as claimed in claim 1 so that said linker is directly ligated to the ribosome binding site sequence of said polydeoxyribonucleotide.

23. A process as claimed in claim 22 wherein said restriction fragment is inserted at the Hind III site of plasmid pER 103 as claimed in claim 6.

24. A process as claimed in claim 23 for the preparation of plasmid pER 33 as claimed in claim 10. if 10 JUL 194? 50

25. A process as claimed in any one of claims 21 to 23 which further comprises inserting 'O in the starting plasmid or an intermediate plasmid a par locus.

26. A process for preparing the production plasmid parpER 33 as claimed in claim 12 wherein an Eco RI fragment comprising the par locus of plasmid pPM 31 is inserted at the Eco RI site of plasmid pER 33.

27. A process as claimed in claim 21 for preparing a production plasmid containing two IFN-a2C genes wherein a DNA sequence as claimed in claim 5 is introduced into the production plasmid pER 33.

28. A process as claimed in claim 27 for preparing the production plasmid pER 21/1 which comprises isolating the IFN-a2C gene from plasmid pER 33 within an Eco RI- Bam HI fragment and inserting said fragment at the Eco RI site of plasmid pER 33 by means of an Eco RI/Bam Hl-linker.

29. A process for the preparation of a plasmid as defined in any one of claims 6 to 12 substantially as herein described in any one of the Examples.

30. A plasmid as defined in any one of claims 6 to 12 when prepared by a process as claimed in any one of claims 18 to 29.

31. A process for preparing a human a-interferon or an N-terminal Met derivative thereof wherein a bacterial host transformed by a production // £*• O x plasmid as claimed in any one of claims 8 ^ to 12 is grown under conditions whereby the '/v - 51 - c0 a-interferon gene(s) of said plasmid is/are expressed. K'Q

32. A process as claimed in claim 30 wherein the transformed bacterial host is of the species E.coli.

33. A process as claimed in claim 31, wherein the transformed bacterial host belongs to the strain E.coli HB 101.

34. A process as claimed in any one of claims 31 to 33 substantially as herein described in any one of Examples 2, 3 and 4.

35. A human a-interferon or N-terminal Met derivative thereof when prepared by a process as claimed in any one of claims 31 to 33.

36. Interferon-a2C or the N-terminal Met derivative thereof when prepared by a process as claimed in any one of claims 31 to 33.

37. A bacterium transformed by a plasmid as claimed in any one of claims 6 to 12.

38. A bacterium as claimed in claim 37 of the species E. coli.

39. A bacterium as claimed in claim 38 of the strain E. coli HB 101. BALDWIN, SON & CAREY W si 'idf&lMtt. ATTORNEYS FOR THE V C 10 JUL 1987; </div>