WO1990005186A1

WO1990005186A1 - Somatotropin expression using a serratia promoter

Info

Publication number: WO1990005186A1
Application number: PCT/US1989/003854
Authority: WO
Inventors: John E. Mott
Original assignee: The Upjohn Company
Priority date: 1988-11-04
Filing date: 1989-09-12
Publication date: 1990-05-17
Also published as: AU4315089A

Abstract

Provided are expression vectors and methods for expressing somatotropins comprising a Serratia marcescens trp promoter and a gene encoding said somatotropin operatively linked thereto.

Description

SOMATOTROPIN EXPRESSION USING A SERRATIA PROMOTER FIELD OF INVENTION

This invention relates to methods for expressing mammalian somatotropins. More specifically, the invention relates to expres¬ sing bovine somatotropin in an E. coli host with a spontaneous runaway expression vector comprising a promoter from Serratia marcescens . BACKGROUND OF THE INVENTION Some heterologous polypeptides, including bovine somatotropin (bSt) , are difficult to express in most E. coli expression systems. Modifications within the first 4 codons of the cDNA encoding the bSt structural gene result in increased levels of bSt expression when these modified cDNAs are expressed in a pBR322-related vector. These modified cDNAs are expressed at even higher levels when placed in a spontaneous runaway expression vector (PCT patent application PCT/US 88/00328, incorporated herein by reference).

Bovine somatotropin is a mixture of heterogeneous proteins, the amino acid sequences of which are known (Paladini, A.C., et al., Molecular Biology of Growth Hormone, CRC Reviews in Biochem. , 15(l):25-56 (1983)). The naturally occurring mixtures have been purified from pituitary glands of cattle. The commercial potential for using bSt for promoting growth and lactation is well recognized and documented by biological studies on both dairy and feed cattle (Eppard, P.J. and Bauman, D.E., The Effect of Long-Ter Administra¬ tion of Growth Hormone on Performance of Lactating Dairy Cows; and Bauman, D.E., Effect of Growth Hormone on Growth Rates and Mammary Development of Ruminants, Proc. 1984 Cornell Nutrition Conference for Feed Manufacturers, pp. 5-17, published by Cornell University, Ithaca, New York) .

Recombinant bovine somatotropin (rBSt) can be produced in transformed microorganisms using a variety of recombinant genetic plasmids (see, e.g., Seeburg, P.H. , et al., "Efficient Bacterial Expression of Bovine and Porcine Growth Hormones," DNA, 2:37-45 (1983); European Patent Application 47 600; United Kingdom Patent Application, GB 2073245A; Schoner, B.E., et al., Role of mRNA Translational Efficiency in Bovine Growth Hormone Expression in Escherichia coli, PNAS USA, 81:5403-5407 (1984); European Patent Application 103 395; and European Patent Application 111 814). These documents relate to the insertion or deletion of bases at the 5' end of the bSt gene creating a protein different from the naturally- occurring polypeptide, or to changes in the bSt cDNA to maximize preferred codons and to reduce secondary structure in the mRNA, or to the use of a runaway plasmid to enhance expression. On the other hand, the instant invention teaches the use of the trp promoter from Serratia marcescens to produce somatotropins, and in particular bSt, at a high level. Methods of culturing and fermenting transformed microorganisms expressing bSt are also referred to in the above-cited documents.

Purification of biologically active rBSt from transformed cells has also been described previously (see, e.g., U.S. patent Nos. 4,511,502, 4,511,503, 4,512,922 and 4,518,526; European Patent Application 131 843; and, Schoner, R.G. , et al. , "Isolation and Purification of Protein Granules from E. coli Cells Overproducing BSt," Bio-Tech., 3:151-154 (1985)).

Nicoles and Yanofsky (Meth. Enzym. , 101, p. 155 (1983) have demonstrated that the Serratia marcescens trp promoter is functional in Escherichia coli . PCT/US 88/00328 describes the expression of an rbSt cDNA gene vising a spontaneous runaway vector and the tryptophan promoter of E. coli in an E. coli host. The present invention relates to the use of the Serratia marcescens trp promoter in this expression system. INFORMATION DISCLOSURE STATEMENT

G.F. Miozzari and C. Yanofsky, Nature, 276, pp. 684-89 (1978) refer to cloning and sequencing the regulatory region, including the promoter and operator, of the trp operon of Serratia marcescens . B.P. Nichols and C. Yanofsky, Meth. Enzym., 101, pp. 155-64 (1983) refer to expression plasmids containing the Serratia marcescens trp promoter and their use for overproduction of trp operon polypeptides in E. coli .

J.N. Hope, et al, J. Biol. Chem., 261, pp. 7663-68 (1986) refer to cloning and expressing the gene encoding E. coli ribokinase downstream from the Serratia marcescens trp promoter on a multicopy plasmid in an E. coli host.

J. Stader, et al, J. Bact. , 166, pp. 244-52 (1986) refer to cloning and expressing an E. coli membrane protein (MotB) downstream from the Serratia marcescens trp promoter in an E. coli host. M.L. Wilson and R.M. MacNab, J. Bact., 170, pp. 588-97 (1988) refer to expression of the MotA E. coli membrane protein in and E. coli host under control of the Serratia marcescens trp promoter. E. Dworkin-Rastl, et al, Gene, 21, pp. 237-48 (1983) and German patent application 3247922-A refer to an expression plasmid consist¬ ing of the promoter/operator region of the Serratia marcescens trp operon and a synthetic ribosome binding site ligated into pBR322 and its use for producing leukocyte-type interferons. SUMMARY OF THE INVENTION

The instant invention relates to vectors comprising the Serratia marcescens trp promoter useful for expressing somatotropins.

More particularly, the preferred expression vectors also comprise a synthetically produced, AT-rich ribosome binding site and a spontaneous runaway vector comprising dual origins of replication, particularly well suited for expressing bSt and porcine somatotropin (pSt) , more particularly, bSt.

The invention also relates to methods for producing somatotro¬ pins, particularly bSt and pSt, using these vectors. The preferred DNA sequence encoding bSt contains a single change wherein the fourth codon for alanine is changed from GCC to GCT (PCT patent application PCT US 88/00328).

DETAILED DESCRIPTION OF THE INVENTION Generally, the definitions of nomenclature and descriptions of general laboratory procedures used in this invention can be found in Maniatis, T. et al., Molecular Cloning, A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. The manual is hereinafter referred to as "Maniatis" and is incorporated herein by reference. All restriction endonuclease and other DNA modifying enzymes are commercially available and are used according to the manufacturer's instructions.

For high level expression of a desired cloned gene in a pro- karyotic system, it is essential to construct expression vectors that contain, at a minimum, a strong promoter to direct mRNA transcrip¬ tion, a ribosome binding site for translational initiation, and, usually, a transcription terminator (collectively, "the expression control sequences") all of which are operatively linked to the desired gene. The term "operatively linked" includes having an appropriate start signal in front of the gene encoding the desired product and maintaining the correct reading frame to permit expres¬ sion of the inserted gene under the control of the expression control sequences and synthesis of the desired product encoded for by that gene.

Since the accumulation of large amounts of a gene product often inhibits cell growth and sometimes causes cell death, the promoter chosen to direct the synthesis of the product should be regulated in such a way that cell growth can reach high densities before the promoter is induced. Examples of regulatory regions suitable for this purpose are the promoter and operator region of the E. coli tryptophan biosynthetic pathway (.trp promoter) and the leftward promoter of phage lambda (PL . The trp promoter is repressed in the presence of tryptophan and can be induced by tryptophan starvation or by the addition of the inducer indole acrylic acid (Yanofsky, C, et al., J. Bacteriol., 158:1018-1024 (1984)). Most preferred are expression vectors having restriction enzyme sites for insertion of genes to be expressed at an appropriate distance from the Shine- Dalgarno sequence.

To synthesize intracellularly a protein encoded by a eukaryotic gene from its cDNA sequence in E. coli and other prokaryotes, it is expedient to remove the 5' untranslated region and the sequence coding for the signal peptide and to supply an initiation codon for translation initiation of the sequence coding for the mature protein. It may also be necessary to replace some of the coding sequence for the mature protein with chemically synthesized oligonucleotides to maximize translation efficiency. The preferred DNA coding sequence of the present invention is the bSt cDNA sequence modified at the 4th codon by changing GCC to GCT. The preferred vector of this invention comprises a pBR322 replicon which expresses the modified bovine somatotropin at particularly high levels. Vectors other than pBR322- derived plasmids can be used. pBR322 has a ColEl replicon. Other plasmids with ColEl replicons include pKC7, pAT153, and pBR325. They differ from pBR322 only in their drug resistance makers. Other useful vectors include pACYC184 (pl5A replicon) , pN01523 (pMBl replicon), pLG338 (pSClOl replicon), and pBEU50 (Rl replicon) (Maniatis; Pouvels, P.H. , et al, Cloning Vectors , Elsevier, New York 1985). Also useful are pUC19 (Yanisch-Perron, C, et al, Gene, 33:103-119 1985) and pHC314 (Boros, I., et al, Gene 30:257-260 1984). Most preferred are pURA type vectors (Rl and ColEl replicon; PCT/US 88/00328). As noted above, the isolation and purification of mammalian somatotropins from recombinant microorganisms is known (see, e.g., U.S. Pat. Nos. 4,511,502, 4,512,922 and 4,518,526; European Patent Application 131,843; and Schoner, R.G., et al., Isolation and purification of protein granules from E. coli cells overproducing BGH, Bio-Technology, 3:151-154). In summary, the process involves lysing the recombinant microorganisms, selective centrifugation, reshuffling of any non-native disulfide bonds to the native con¬ figuration and column chromatography.

A comparison between the sequence of the S . marcescens and the E. coli trp promoters as taken from Nicoles and Yanofsky, supra, is shown below. The sequence is from the -60 nucleotide to the -1 nucleotide of the promoter.

5. marcescens CTAAAACATTG TGCAAAAAGAG GGTTGACTTTG CCTTCGCGAAC CAGTTAACTAG TACAC

E. coli

GGCAAATATTC TTGAAATGAGC TGTTGACAATT AATCATCGAAC TAGTTAACTAG TACGC

Although there are substantial differences in the nucleotide sequences, the operator site is conserved between these two promoters and it has been shown that the S . marcescens promoter can be regu¬ lated by the trpR repressor protein (Manson and Yanofsky, J. Bact. , 126, p. 697 (1976)). EXAMPLE 1. Construction of a Plasmid for bSt Expression Com¬ prising the Serratia marcescens trp Promoter 1. Assembly and Introduction of the Serratia marcescens trp promoter into the pURA-4 vector.

The following four oligonucleotides are synthesized according to the method set forth in PCT application PCT/US 88/00328.

1 5'- AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTT

2 5'- GCCTTCGCGAACCAGTTAACTAGTACACAATCTAGATAAAAAGGGTAT

^• 3 5'- CGATACCCTTTTTATCTAGATTGTGTACTAGTTAACTGGTTCGCGAAGGC 4 5' - AAAGTCAACCCTCT TTTGCACAATGTTTTAGCGATCAGCGTG

These oligonucleotides are assembled into a double stranded DNA block as shown below.

1 2 5' 5'

4 3

The oligonucleotides are purified by cutting the appropriate band from a 20% acr lamide/urea gel. The bands are visualized by il- luminating the gel with short wave UV light on a thin layer silica gel GF (920 x 20 cm). The oligonucleotides are removed form the gel by soaking overnight in 0.5 M ammonium acetate and 1 mM EDTA at 37°C. The oligonucleotides are desalted using Waters Sep-Pak c-18 columns. Oligonucleotides 2 and 4 are labeled with -^'P- TP as described in PCT/US 88/00328. Oligonucleotides are hybridized to their comple¬ ments (i.e., 1/4, and 2/3). The hybridized oligonucleotides are then ligated together, and purified from a 10% acrylamide gel after autoradiography as previously described in PCT/US 88/00328.

The sequence of the double-stranded oligonucleotide block is shown below: EcoRI 5' AATTCACGCTGATCGCTAAAACATTGTGCAAAAAGAGGGTTGACTTTGCCTTCGCGAACCAG GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAGCGCTTGGAC +1 TTAACTAGTACACAATCTAGATAAAAAGGGTAT AATTGATCATGTGΓΓAGATCTATTTTTCCCATAGC

Xbal Clal

The oligonucleotide is designed to insert into the unique EcoRI and Clal restriction sites of the pURA-4 vector (PCT/US 88/00328) . The fragment also contains a Xbal site which is unique for the vector and allows the insertion of ribosome binding sites as an Xbal/Clal fragment.

To clone this fragment into the pURA-4 vector, the vector is digested with EcoRI and Clal. The digestion is run on an acrylamide gel and the large vector fragment (5.5 Kb) is cut out and isolated using Geneclean (available from BIO 101 Inc., P.O. Box 2284, La Jolla, CA). This digestion removes the E. coli trp promoter and the trpL ribosome binding site. The vector fragment is ligated with the S . marcescens trp promoter fragment from above, and used to transform competent cells of E. coli MC 1000 (available in the Experiments with Gene Fusions Strain Kit, Cold Spring Harbor Laboratory, Cold Spring Harbor New York) . Vector DNA is isolated from transformed cells and DNA is prepared (Maniatis). The vectors are confirmed by DNA sequencing using Sequenase (United States Biochemical Corp. Cleve¬ land, Ohio). One confirmed candidate is designated pURA-Sm/m4. 2. Introduction of a ribosome binding site into the pURA-Sm/M4 Vector. A ribosome binding site is designed based on the AT and trp2 ribosome binding sites described in copending U.S. patent application S.N. 166,882, filed 11 March 1988, and incorporated herein by re¬ ference. The ribosome binding site (rbs) referred to as TAT contains the upstream sequence found in the AT-rich rbs and the Clal site as found in the Trp2 rbs. The two oligonucleotides are synthesized, and isolated as previously described. The two oligonucleotides are then hybridized to form the following fragment:

Xbal Clal

5' CTAGATTATTAAAAATTAAAGAGGTATAT TAATAATTTTTAATTTCTCCATATAGC

This fragment is designed to be inserted into the restriction site of the pURA-SM/M4 vector produced by digestion with Xbal and Clal.

The pURA-Sm/M4 vector is digested with Xbal and Clal and the large vector fragment is purified as described above. The purified vector fragment is ligated to the TAT rbs and the ligation product is used to transform competent cells of E. coli MC1000. The resultant vector is sequenced for confirmation and is designated pURA-Sm/TAT/- M4. EXAMPLE 2. BSt Expression Using an Expression Vector Comprising a Serratia marcescens trp Promoter

The pURA-Sm/TAT/M4 vector from Example 1 is used to transformed competent cells of BST-1C (PCT/US 88/00328) . The induction protocol was previously described (PCT/US 88/00328). The results of scanning of Coomassie stained protein gel showed the vector to express rbSt at a level of about 20% of the total protein.

EXAMPLE 3. Porcine and Ovine Somatotropin Expression Using an Expression Vector Comprising a Serratia marcescens trp Promoter Following the teachings of Examples 1 and 2 with minor changes known to those skilled in the art, the porcine or ovine somatotropin gene can also be expressed under the control of the Serratia marces¬ cens trp promoter.

Claims

CLAIMS I Claim:

1. A recombinant DNA molecule comprising a sequence of deoxyribo- nucleotides encoding a somatotropin and a Serratia marcescens trp promoter operatively linked thereto.

2. A recombinant DNA molecule according to claim 1, wherein the somatotropin is selected from porcine, ovine and bovine somatotropin.

3. A recombinant DNA molecule according to claim 2, wherein the somatotropin is bovine somatotropin.

4. A recombinant DNA molecule according to claim 3, pURA-Sm/TAT/M4.

5. A method for producing an animal somatotropin comprising cultur- ing a host transformed with a recombinant DNA molecule according to claim 1, and isolating said somatotropin from said culture.

6. A method for producing an somatotropin comprising culturing a host transformed with a recombinant DNA molecule according to claim

2, and isolating said somatotropin from said culture.

7. A method for producing bovine somatotropin comprising culturing a host transformed with a recombinant DNA molecule according to claim

3, and isolating said somatotropin from said culture.