DD216043A5 - METHOD FOR PRODUCING A PLASMID - Google Patents

Abstract

The present invention relates to the combination of the promoter/operator region of the tryptophan operon of Serratia marcescens with a synthetic ribosome binding sequence, an expression plasmid which contains this sequence and in which the above sequence is followed by the only Hind III cleavage site in the plasmid, into which site the gene to be expressed can be inserted, and to production plasmids for the expression of eukaryotic gene products in prokaryotes, especially for the preparation of leucocyte interferon.

Description

Berlin, May 31, 1984 AP C 12 N / 258 476/2 63 230/11

Process for the preparation of a plasmid

Field of application of the invention

The invention relates to a method for producing a plasmid containing certain DNA sequences.

Characteristic of the known technical solutions

A prerequisite for the expression of genes in bacteria is the presence of a sogn promoter, fine recognition sequence for the binding of the bacterial RNA polymerase, a promoter thus allows the transcription of the downstream sequences "genes whose products are synthesized at any time, have promoters, which are always capable of binding RNA polymerase molecules. "Other genes. or operons of the bacteria are regulated, d. H. their promoter can be made accessible or inaccessible by certain mechanisms.

Another prerequisite for the synthesis of the desired gene products is efficient translation of the RNA transcripts to the bacterial ribosomes. So was by Shine and Dalgarno (see Nature 254 , 34-38- (1975)). demonstrated that in bacteria the nucleotide sequence at the 5'-end of the RNA is responsible for their binding to the rihosome

Object of the invention

The object of the present application is therefore to improve the gene engineering production of non-bacterial proteins by means of a known promoter, which is linked to a structural gene via a novel ribosome binding / linker sequence. , :

Explanation of the essence of the invention

The present invention thus relates to the preparation of a plasmid _t which is a .DNA sequence of the formula

5 ¹ AATTCACGCTGATCGCTAAAACATTGTGCAAAAGAGGGTTGACTTTGCCTTc 3 'GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG

j ': / romofor · :

GGGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTA CGGtTGGTCMTTGATCATGTGTTCAAGTGCCGTTGCCATTCCTGCAAATTCGA --- Promotor / Gperator- i ----- ^ RSS-->

'; '' Hin dill

which optionally contains a linker sequence subsequent to the ribosome binding sequence. This sequence represents a novel combination of a promoter sequence known from the literature and a ribosome binding sequence known from the literature.

However, a preferred frequency here is the DNA sequence of the formula '' .. ''.

5'AATTCACGCTGATCGCTAAAACATTGTGCAAAAGAGGGTTGACTTTGCCTTc 3 'GTGCGACTäGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG

L --Proraotor; ^:

GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAAGCT CGCTTGGTCAATTGATCATGTGTJCAAGTGCCGTTGCCATTCCTCCAAATTCGA-

--Promotor / Oparator

TAAAGATG ¹ ATTTCTAC ^ linker ^

and the new linker sequence of the formula .5 'AGCTTAAAGATG • 3', ATTTCTAC.

Another object of the present invention are the expression plasmids containing these sequences, in which, following the above sequences, the only Hinlll-cleavage site of the plasmids follows, in which the respective desired gene can be used for the preparation of the production plasmids, and the use of so produced production plasmids for the production of eukaryotic gene products in prokaryotes, in particular for the production of leukocyte interferon. ''.

To achieve the object according to the invention, for example, the following procedure is adopted:. ,

Selection of a suitable bacterial promoter sequence:

For this purpose, preferably a promoter is used which, in combination with an operator sequence, is inducible or repressible. Such a promoter has the advantage that the synthesis of the desired non-bacterial protein can be switched on only in a late phase of the bacterial growth cycle, e.g. in the case of the tryptophanoperone (see Hallwell and Emta'ge in Gene 9_, 27-47 (1980)) by removal of · tryptophan from the culture medium and by addition of indole (3) -acrylic acid as an inducer of tryptophanoperone to the culture medium, and thus does not affect the multiplication of the bacteria. For the construction of the expression plasmid, it is expedient to use the very strong and regulatable literature-known promoter / operator system, the tryptophanoperone from Serratia marcescens (see Miozzari and Yanofsky in Nature 27 5, 684-689 (1978)) of the formula

, .... .-- 4 -

5'AATTCACGCTGATCGCTAAAACATTGTGCAAAAGAGGGTTGACTTtGCCTTC 3 • GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAAGGGAAG

- fc '- promoter-; ;

GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGG '· CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCC Promoter / Operator ^{; ;} ^ ~

"Used. This is obtained by literature methods. - ''.'-''

Construction of Ribosome Binding Sequence:

To this _end: the sequence of formula als'besonders effectively described.

5 'TAAGGAGGTTTA'.

(See, Jay et al., Proc. Nat. Acad., U.S.A., 73, 5543-5548 (1981)). '.

The construction of the ribosome binding sequence of the formula ¹ '. '12mer

5 ^{τ /} TAAGGAGGTTTA TTCCTCCAAAT

ι ι

ö'mer lOmer

3 'ATTCCTCCAAATTCGA.

ι ι ι)

Preferably, this is done by assembling the 3 synthetic oligonucleotides of the formulas.

6 mer

'lOmer- ·. 5 .'- AGCTTAAACC 'and

12-me-r · ^: 5'-TAAGGAGGTTTA

according to literature methods, whereby expediently before the 6mer oligonucleotide is radiolabeled.

The subsequent linking of the promoter / operator with the ribosome binding sequence is carried out by literature methods.

Construction of the expression plasmid:

From a plasmid, e.g. the plasmid pBP 101, which contains part of the tryptophan operon of Serratia marcescens, is excised with the 90 bp promoter / operator sequence using restriction enzymes Eco RI and Hae III. This fragment is then linked to the synthetically produced RBS by means of the enzyme DNA ligase, and the promoter / operator RBS fragment thus produced, the Eco RI end in front of the promoter / operator and a Hin dIII end after containing RBS is inserted into the plasmid pBR 322, instead of the plasmid's own 29 bp EcoRI-Hin allI fragment. The effectiveness of the thus constructed expression plasmid (pER 103) with respect to the expression of genes incorporated into the Hin dIII site is shown by the example of leukocyte interferon, subtype A (IFN-αΑ).

Expression of IFN-qA in pER 103:

Interferon 'is in human cells, how others to ex -? Certain proteins also synthesized as a preprotein, i. as a protein with a leader sequence. This leader sequence is only cleaved off upon excretion of the protein molecule from the cell by a specialized enzyme, thereby producing the mature form of the protein. One way to synthesize mature interferon from bacteria is to remove the leader sequence at the DNA level, i. the construction of a gene encoding only the sequences of the mature protein.

>. , Construction of the Interferon Production Plasmid for IFN-aA:

For example, leukocyte interferon has a pre-sequence of 23 amino acids, followed by a cysteine, which, after cleavage of the pre-interferon, is the first amino acid of the "mature" interferon polypeptide for the construction of plasmids that allow the synthesis of mature interferon in bacteria If, "it is necessary to isolate a fragment of the interferon gene, it begins exactly with the codon for." An ATG methionine codon must then be added to this cysteine codon to allow the initiation of protein synthesis. These. Construction is then conveniently effected, for example, into the expressing plasmid pER103, so that the distance between ATG initiation codon and RBS for translation is optimal. Interferon, produced by means of such a piasm in bacteria, has the amino acid sequence of the mature polypeptide plus an additional methionine at its NH terminal end.

The gene coding for IFN-aA Interferonproduktionsplasmid pER 33 is constructed according to the invention, for example, according to these principles '(its preparation is represented schematically in Fig. 4): ^' _-:, -

a) Construction of the mature interferon-encoding gene, with the exception of the codon for the NH ₂ -terminal, cysteine:

The starting material for the interferon information is, for example, "the cDNA coding for IFN-aA Cl8n 1 F7, which at 17 '. -May 198'2' under 'the DNS number r 2362 at the depository" Deutsche Saminlung von Mikro- · Organisms, Grieseba.chstraße. 8, D 3400 Göttingen (Federal Republic of Germany) "(see also 'German Patent Application P' 32 20 '' 116.8 dated 28.05. 1982).

It contains the interferon gene inserted into the Pst I cleavage site of pBR 322. IFN-aA (as well as other leukocyte interferron subtypes) has a cleavage site for Sau 3A equal to that coding for the NH ^ -terminal cysteine TGT on. The existence of this cleavage site forms the basis for the method used to construct a "mature" interferon gene from appropriate Re. , Striktionsfragmenten, for example, from the interferon-spec. Fish 646 bp Ava II fragment and the 34bp-Sau 3A-Ava II fragment of the plasmid 1 F7. , · T, -

b) preparation of the oligonucleotide complex; - /

The missing cysteine codon and, before that, an ATG methionine codon must now be added to the gene so constructed; Furthermore, a connecting piece is necessary which allows the ligation of this construction into the Hin dIII cleavage site of the expression plasmid pER 103. For this purpose 4 oligonucleotides are synthesized: a 14mer 5 'TGTGATCTGCCTCA, a 12mer' .5 'AGCTTAAAGATG, a 9mer 5 ¹ CAGATCACA and an 8mer 5' CATCTTTÄ. These oligonucleotides, post-ligated and a Sau 3A resection, are the desired fragment that can link the interferorigen part (Sau. \ 3A end) to pER 10 "3 (Hin dIII end)":

12mer. l'4mer

ι τ T

5 '. AGCTTAAAGATGTGT; GÄTCTGCCTCA 3 'ATTTCTACACACTAGAC.

I II

Hin .dl 11 8mer; 9 mer

Sow 3A

.1 11 I

Met C ν s.

According to the invention, the oligonucleotides are designed so that the initiation codon ATG and the cysteiri codon TGT are on separate fragments. This allows for a general use of 12mer (and 8mer) in the insertion of genes into pER 10.3. The oligonucleotide with the cysteine codon must therefore be at least 9 nucleotides, long. For example, the following nucleotides can be used:

5'TGTGATCTG, 5'TGTGATCTGC, '5'TGTGATCTGCC, 5'TGTGATCTGCCT or 5 TGTGATCTGCCTC.

For example, the ligated oligonucleotide obtained with the 14mer is digested with Sau 3A to give the sow that fits into the interferon gene. 3A end to produce.

The subsequent linkage of interferon gene and oligonucleotide complex, ligation into a plasmid and its transformation into a bacterial host, e.g. as Escherichia coli HB '101, carried out by literature methods.

In order to achieve a further increase in yield in the production of eukaryotic gene products, it may also be advantageous / if the relevant production plasmid contains the "DNA sequences required for the expression multiply, eg twice, for example two complete genes for mature interferon, including the Here, too, the gene for mature interferon provided with a bacterial promoter, 'a prokaryotic' 'ribosomal binding site and an ATG initiation codon' 'is prepared from a production plasmid prepared according to the invention, eg from -pER 33, isolated and after altering one of the two ends of this piece of DNA in a mit.einem, · a restriction enzyme, eg. EcoRI, linear sier prepared according to the invention, · 'complete, same plasmid inserted.

Further, it is advantageous / when a tryptophanoperone-carrying plasmid so produced according to the invention, e.g. the plasmid p.ER 33 contains a par ^ locus, that is, a DNA sequence which, in the absence of a selection pressure, e.g. by an antibiotic such as ampicillin, during bacterial growth is responsible for the uniform delivery of plasmids into daughter cells (see P.M. Meacock, S.N. Cohen in Cell 20_, 529-542 (1980)). For this purpose, the pax locus was first isolated from the plasmid pPM 31, which is described in the abovementioned reference, and incorporated into an interferon production plasmid prepared according to the invention.

Thus, the present invention has succeeded in constructing an expression plasmid containing the promoter / operator region of the tryptophan operon of Serratia marcescens, as well as a synthetic RBS. The effectiveness of this construction for the genetic engineering of non-bacterial proteins was shown using the example of leukocyte interferon.

The following examples are intended to explain the invention in more detail:

  , - ίο -

A. Description of the general methods;

1. Restriction enzyme digestions . , ·

Restr ungsendo.nukleasen, for example, the company Be thesda. Research 'Laboratories,' were used under the following conditions:

Eco RI, Hin dill, Pst I and Ava II digestions were carried out in TA buffer (33 mM tris acetate, pH 7.9, 66 mM K-acetate, 10 mM Mg-adetate, 100 μg / ml BSA);

/ Hae HI digestions were performed in TM buffer (70 mM Tris-HCl, pH 7.5, 7 mM MgCl ₂ ); Sau 3A digests were performed in 10mM Tris-HCl, pH 7.4, 10mM, MgCl ₂ , 75mM NaCl.

2. Plasmid preparation, gel electrophoresis

Plasmids were prepared from 1.5 ml or 100-300 ml overnight cultures in L-broth + 25 μg / ml tetracycline or ¹ + 100 μg / ml ampicillin according to the protocol of Birnboim and DoIy (see Nucleic Acids Res *). . Ί_ · 1513-1523 (1979)) prepared .. More 'cleaning of the plasmids was made (by-Isopropanolfällungen see below) and, (in large batches) isolated by chromatography.' _v Iphie to Sepharose * 4B of the firm .Pharmacia. Larger. Quantities of plasmids (from 1-6 liters of culture) were worked up according to the 'cleared lysate, "method of Clewell and Helsinki (see Biochemistry 9_ / 4428-4440 (1970)), followed by ethidium bromide CsCl gradient centrifugation has been.

Electrophoresis of plasmids or their restriction digestion products was carried out, in 0.8% to 1.4% A'garose ', or in 6% polyacrylamide gels, in 40 mM Tris-acetate, pH 7.8; 20 mM Na acetate ,. 2mM SDTA. preparative

Restriction fragments were removed by excising the gel fragment containing the desired fragment and electrophoretically eluting the DNA from the gel into a dialysis tubing.

3. kinase and phosphatase reactions, ligase reactions

5'-phosphorylation reactions (end-labeling) were performed in TM buffer (70 mM Tris-HCl, pH 7.5, 7 mM MgCl3) + 5 mM DTT + 0.2-0.5 mM ATP (10-20 μϊϊ

p-ATP) with 5 units of T4 polynucleotide kinase,

-. available from Bethesda Research Laboratories, performed at 37 ° C for 60 minutes. This was on. 10.Minuten incubated at 7O ⁰ C to inactivate the enzyme. , .

Ligase reactions were performed in TM buffer + 5 mM DTT + 0.25 mM ATP with 0.1 unit T4 DNA ligase, available from Bethesda Research Laboratories (for blunt-end ligations), or 0.005 unit ligase (Alloys of cohesive ends), carried out overnight at 14 ⁰ C. Subsequently, the enzyme was denatured at 7O ⁰ C for 10 minutes. ',.

Successive kinase and ligase reactions were performed in the same reaction mixture. After heat denaturation of the first enzyme, 5 mM DTT and 0.25-0.5 mM ATP were added again and the second reaction was connected.

- phosphatase reactions were restriction digestion buffer (usually TA buffer) carried out / by the addition of 1 unit of alkaline phosphatase (manufactured by Sigma calf intestine) to a Sestriktionsverdauung and incubation for 15 minutes at 37 ⁰ C. By this were 1-2 phenol extractions, a

Ätherextraktion and an alcohol precipitation connected. Often, the DNA fragments were then electrophoretically separated and geliert before further manipulations were carried out. '':

.To large DNA fragments (500 bp and larger) of small. Isopropanol salifications were carried out. Fragments (linker fragments that had been ligated or small restriction digestion products) were separated. The reaction was quenched with 2N 'NHv-acetate' (final concentration) and precipitated with 0.6 volumes of isopropanol for 10-20 minutes at room temperature. After centrifugation .5 Minutes in an Eppendorf centrifuge was removed from the stand, the precipitate washed with cold 70% ethanol, centrifuged again; the resulting pellet was dried and ready for further manipulation. ·

B. Preparation of Oligonucleotides: Legend: - :. ·

DMTr. '=' p, p ¹ -dimethoxy-triphenylmethyl

ibu ν, = isobutyryl

bz ''. , . =, Benzoyl (at the base nitrogen)

·. , = - polymeric carrier material. ·

B,. '<= "thymine" or

'' 2 '' * ;. 'N -Isobutyrylguanine or

'- "N" ¹ -benzoyl cytosine or

'. N. benzoyladenine THF. = Tetrahydrofuran.

', - 13 -

Example I .. '.- Functionalization of the polymeric carrier material

The functionalization of the polymeric carrier material 'followed by literature methods. The support material used was HPLC silica gel (Macherey 5 Nagel, particle size 20 μΐη, pore size 200 A). It was derivatized as described by Mateucci and Caruthers, except that the succinylation step with succinic anhydride in anhydrous pyridine was performed (see MD Matteucci, MH Caruthers, Tetrahedron Letters 2JL, 719 (1981)), J. Am. former Soc. 10 3 , 3185 (Γ981) and also T. Tanaka, RL Letsinger, Nucleic Acids Research 10_, 3249 (1982)). The protected nucleosides were covalently linked to the silical gel according to the following formula:

DMTr-O

OC ₂ H ₁ ,

-Si-O-SI- (CH ₁ J, -N-CO- (CH) '- CO-O

-OC ₂ H,

The loading density was between 68 and 104 μΜοΙ of nucleoside pro g carrier material.

Example II '

5'-dimethoxy-4-ethyl-desoxythymidine-3'-chloromethoxyphosphite

The fully protected nucleoside 3'-chiormethoxy phosphites were synthesized by methods known from the literature (MD Matteucci., MH Caruthers, J. Am. Chem. 10 3 , 3185 (1981) and T. Tanaka, RL Letsinger, Nucleic Acids Research 10_, 3249 (1994). 1982)).

i 5'44.6. rag (1.0, mmol) of 5'-dimethoxytrityl-thymidine (DMTrdT) '·: were dissolved in 1.0 ml of absolute THF and this solution was added; .-78 ° C within 15 minutes under argon dropwise added to a stirred / / stirred solution of 0.9 mmol of methyl dichlorophosphite in L 0.5 ml of absolute pyridine and 2.0 ml of absolute THF., I After a further 10 minutes the reaction solution is heated to room I temperature and centrifuged. The supernatant was transferred with a pipette to a dry, argon-filled, grounded flask (25 ml). At room temperature, the solvent was removed under vacuum, then 0.5 ml each time; Toluene and THF added and re-evaporated,

the product was a colorless foamy solid. ! This product was not analyzed for purity for: Siert, 'but dissolved in absolute pyridine and 10.0 ml of this solution • under argon at -20 ⁰ C until further use, I maximum of one week, stored.

Example III . ^1:. , .

''. ' , , 2

; 5'-dimethoxytrityl-N-iso-butyryl-deoxyguanosine-3'-chloro ^: methoxy-phosphite

¹ Analogously to Example II, a solution of this nucleoside! phosphorochloridites in 10.0 ml of pyridine from 640.0 mg

'' '2'. (1.0 mmol) 5'-dimethoxytrityl-N -isobutyl-deoxy-uanozine

: manufactured. , ''.

Example 'IV ' ...-

5'-Dime thoxytrityl-N ° -benzoyl-desoxycytidine-3'-chloromethoxy-phosphite, '. , , ι

Analogously to Example II, a solution of this Nucleosidphosphoro-chloro iditol in 10, 0 ml of pyridine from 633.7 mg (1.0 mmol)

'4 ·

5'-dimethoxy-trityl-N-benzovinyldeoxycytidine.

- 15 -. Example V ''

5'-dimethoxytrin-N-benzoyl-deoxyadenosine-3'-chloro-methoxy-phosphite

Analogously to Example II, a solution of this nucleoside phosphoro-chioridite in 10.0 ml of pyridine was prepared from 657.7 mg (1.0 mmol) of ~ 5 "'-dimethoxytrityl-N-benzoyl-deoxyadenosine.

Example VI Synthesis of d-TCCTTA

bz

50 mg (= 5 μΜοΙ) of the DMTrdA-loaded polymeric support (see Example I) was placed in a glass frit. Various solvents and reagent solutions were then added according to the following listing, the carrier was briefly shaken therein, and the solution was removed again after the desired reaction by being pressed through the middle from above with the aid of an argon gas stream.

a.) Cleavage of the DMTr group with 3 ml of a solution of 70 g of zinc bromide, 500 ml of nitromethane and 5 ml of water. Reaction time: 10 minutes. , ,

b) - 4 χ Wash with 3 ml each of a mixture of n-butanol-lutidine-THF (4: 1: 5).

c) 4 χ Wash with 4 ml of absolute pyridine.

d) Ancondensation of the next nucleotide unit:

1 ml of the pyridine solution of 5'-dimethoxytrityl-deoxythymidine-3'-chloromethoxyphosphite (Example B) (ca.

j. .- - .. - - 16 -. ·

\ 100 μΜοΙ) under argon, in the frit to the poly-; added to the carrier and this is stored in the solution.

I'm talking. '· .'-' '· ·. · ''

^; 'Response time: 10 minutes.

! e) 3 'x washes with 3 .ml of absolute pyridine.

- f) Oxidation .of the phosphorous acid triester with 100 mg of iodine, '- dissolved in 3 ml of a mixture of THF, lutidine and: water (2: 2: ^1).! , ; ; 'Response time :, 7 minutes

I- g) 3 χ Wash with 4 ml of THF each. , , (

i \ h) acetylation of the unreacted 5'-OH groups with

of a solution of 150 mg 4-dimethylaminopyridine, 0.3 ml

, Collidine: 0.25 ml of acetic anhydride and 2.5 ml of THF.

;. Reaction time: 5 minutes.

i i) 4 χ washing with 3 ml nitromethane.This cycle of a)

: to i). was repeated four more times, with ¹ ×

: 'Step d) which is needed for the sequence

l -nucleotide building block was used. *

I yield determination:

After Ankondensieren the last Nücleotid-block was: ^that; Support material dried under oil pump vacuum, a sample

weighed to the nearest 1 mg and mixed with 10.0 ml of a 0.1 ^ M '; Solution of toluene sulphonic acid in acetonitrile. By ': the .dabei entering cleavage of Dimethoxytrityl cation ι. The result is an orange-red colored solution "whose absorbance was measured at 498" according to the formula.

Loading [μΜοΙ / g] = (para ⁴⁹⁸ ). * (Dilution factor). 3.14

Weight of Carrier- [mg]

The loading of the carrier material with dimethoxytrityl protecting groups can be calculated. This gave: 43 μΜοΙ / g. This corresponds to an average yield of 85% per condensation step. '"

Cleavage of the methyl radicals of the Phosphorsäuretriester groups: ι

The support was shaken for 45 minutes in 4 ml of a solution of thiophenols, triethylamine and dioxane (1: 1: 2), then washed with methanol, then with ether.

Cleavage of the base protecting groups and simultaneous cleavage of the hexanucleotide chain from the polymeric carrier: The carrier material was concentrated for 14 hours with 10 ml of conc. Ammonia heated to 50 ° C, the aqueous solution was then filtered off with suction and the filtrate was concentrated to about 2 ml. ,

Cleaning the product:

The crude product thus obtained, which still carried a dirnethoxytrityl protective group at the 5 'end, was subjected to reversed phase HPLC. Column: μ-Bondapak C-, g Fa. Waters; Eluent: 0.1 M triethylammonium acetate buffer pH 7 with 25% acetonitrile; Flow 2 ml / min .; Retention time: 14 minutes. The collected elution fractions were concentrated to about 1 ml, treated with 10 ml of 80% acetic acid and allowed to stand for 30 minutes at room temperature. Then was at 50 ⁰ C in vacuo to. The mixture was concentrated by evaporation, the residue was dissolved in 25 ml of water and the cleaved dimethoxytritanol was extracted with 3 × 15 ml of ether. The aqueous phase was evaporated again to dryness, the residue was dissolved in 2.5 ml of water over Biogel P> 2 (cf. Column: 60 χ 1.7 cm) .. desalted and lyophilized.

i. · ·. "- is -

• Analysis of the p'rodu & ts:. , ·

The analytical HPLC diagram was used as the purity control

: (Column: 300 χ 3.9 mm, · urBondapak.C ₁₈ , Waters, Eluans:

0.1 M triethylammonium acetate buffer pH 7 with 12% acetone - / _: tril; Flow: 1.5 μl / min .; Retention time: 3.7 minutes).

" Example νΐϊ :., '..'

Synthesis of d-TAAGGAGGTTTA

Prepared analogously to Example ¹ starting from 300 mg VI '· (30, μΜο.1) DMTrdÄ ^bi V ^ P). , ..., HPLC chart of the product:, "column: 300 χ 3.9 mm, μ-Bondapak C ₁₈ , from Waters; eluent: -0.1 M triethylammonium acetate buffer pH 7 with .12% '; acetonitrile ·; Flow: 1.5 'ml / min, retention time:...' X 4.4 minutes',.

; Example VIII ^: '\,' ^:

Synthesis of d-AGCTTAAACC :

'.''.'' ¹ ^ -

''. ι · ^;

  i · -. · ·

Prepared analogously to Example VI starting from 200 mg (16 μΜοΙ). ''. ν. ' ^: ''' · .. '

DMTrdC ^b ^ - (p ^.:. '. -.''.·.'. * "HPLC diagram of the product:" Column: 300 χ 3.9 ram, μ-Bondapak C ₁₀ , from Waters ;

Eluans: 0.1 M triethylammonium acetate buffer pH 7 with 12%:. 'Acetonitrile; Flow: 1.5 ml / min; Retention time:. , .3,4. 'Minutes. ,.

- I? - "'- Example IX ; Synthesis of d-CATCTTTA -

Prepared analogously to Example VI starting from 150 mg of (1.32 μΜοΙ) DMTrdA ^b2 / N / v {Δ) HPLC diagram of the product:

Column: 300 χ 7.8 mm, μ-Bondapak C, _g , Fa. Waters; "Eluane: 0.1 M triethylammonium acetate buffer pH 7 with 20% acetonitrile, flow: 1.5 ml / min, retention time: 7.7 minutes.

Example X -,

Synthesis of d-AGCTTAAAGATG "

Prepared analogously to Example VI starting from, 200 mg (16.2 μΜοΙ) DMTrdG ^lb % ^ £). , '' \,

HPLC diagram of the product: -

Column: 300 χ 7.8 mm, μ-Bondapak C, n, 'Fa. Waters; Eluent: 0.1 M triethylammonium acetate buffer pH 7 with 26% acetonitrile; Flow: 1.5 ml / min; Retention time: 5.2 minutes. '- -

Example XI ',': "·

Synthesis of d-TGTGATCTGCCTCA

Prepared analogously to Example.'VI starting from 250 mg (22 μχΜοΙ '

DMTrdA ^bz / v- {?).

HPLC chart of the product: * '

Column: 300 χ 7.3 mm; μ-Bondapak C ₀ ; Fa. Waters; Eluent: 0.1 M triethylammonium acetate buffer pH 7 with 25% acetonitrile; Flow: 1.5 ml / min; Retention time:

6.1 minutes.

I Example XII

: |. Synthesis of d-CAGATCACA _; ,

.: Prepared analogously to Example VI starting from 150 mg. Mg (13.2 μmol) of DMTrdA / Vv (PJ.) ^; HPLC diagram of the product:

Column: 300 χ 7.8 mm; u-Bondapak C, _fi ; Fa. Waters;

Eluent: 0.1 M triethylammonium acetate buffer pH 7 at 20%; . 'acetonitrile; Flow: β, 2 ml / min; Retention time:. \ · 5.2 minutes. , ','. ,

: s *: · - '' -

Analysis of Oligodeoxynucleotides

The sequence analysis of the synthetically produced oligodeoxy, nucleotides was carried out after they had been added to the interferon

  ronpröduktionspläsmid pER 33 were installed (see

L Example 2: Sequence analysis of the interferon plasmid pER 33). ; At the same time, this analysis confirms the correctness of the: sequence of bases in the oligooxynucleotides (see > Fig. 5),:.: '-. ''

; Example 1 '·' . .

Construction of the expression plasmid pER 103

• The construction of the expression plasmid pER -103 is; schematically shown in Fig. 1. .

: a) Isolation of the promoter / operator fragment

The plasmid pBR 101, which contains about 1000 bp of the tryptophan operon of Serratia marcescens, provided the. . Starting material for the ..Isolierung the promoter / Opera .tor region represents This regulatory region is intra-'halb a 90'bp long Eco RI - Hae · III ^fragment: in

~ the promoter in the direction of ^ .Eco RI - $ Hae III

- - or isnti-er t is. - -: ------ - ^:

About 25] ig of the plasmid pBP 101 was digested with the restriction enzyme Eco RI, two fragments were gel electrophoresis (1.4% agarose) separated from each other and the 200 bp fragment was electrophoretically eluted from the gel. This fragment was then digested with Hae III, the two digestion products were separated on a 6% polyacrylamide gel and the 90 bp fragment (promoter / operator) was again isolated from the gel. '

b) Construction of Ribosome Binding Sequence (RBS)

The RBS was composed of 3 synthetic oligonucleotides: the 6mer 5'-TCCTTA, the 10mer 5'-AGCTTAAACC, and the 12mer 5'-TAAGGAGGTTTA 500mols of the 6mer were phosphorylated with the aid of the enzyme polynucleotide kinase and radiolabeled (see part A). · the reaction mixture was heated for 10 minutes at 7O ⁰ C to inactivate the kinase, then equimolar. amounts of (unphosphorylated) Lomer and added 12mer were., the oligonucleotide mixture was heated to 95 ° C and then slowly (over about 3 hours) cooled to 30-35 ⁰ C, wherein the oligonucleotides hybridized with each other:

12-mer

5 '

dTAAGGAGGTTTA 3 '

HO 3 'dATTCCTCCAAATTCGA 5'

6''mer.

By adding 0.25 mM AT? and 5nuM DTT, 6mer and IQ.mer were covalently linked together using the enzyme DNA ligase (see Part A). The absence of P. phosphate residues at the 5 'ends of the 12-mer and 10-mer prevented the development of

   · - '..- 22. -.

are of multimeric ligation products. After the reaction was heated 10 minutes at 70 ⁰ C, the ligase to inactivated V / ming, then "were, after addition of 0.5 mM ATP and 5 mM DTT, in a further kinase reaction .. (see part A) and kinased the 5 'ends of the 12mer and the 10mm, completing the RBS.

c) Linkage of Promoter and RBS - '

Twelve pmoles of the 90 bp Eco RI-Hae III promoter / operator fragment were ligated under standard conditions (see Part A) with 60 pMoles of RBS. Since only the blunt end of the 90 bp fragment produced by the Hae .HI cut can ligate to the blunt end of the RBS, only molecules which are RBS in the correct orientation downstream of the promoter are formed. , contained. After the reaction for 10 minutes at 7O ⁰ G. ~~~ was dle ligase inactivated, it was adjusted to TA buffer, concentration, (see part A) ', and 200 units. Hin dill and 10 units .Eco RI rewritten. This was beneficial to. the multimers formed in the ligase reaction (since in addition to the desired reaction, both Eco RI ends and Hin dIII ends could ligate to each other) can be converted back into monomers. Thereafter, the sample was separated on a 6% polyacrylamide gel and the approximately 10.0 bp promoter / operator RBS fragment (having an Eco RI and Hin. DIII end) excised from the gel and eluted electrophoretically. to separate it from the excess of non-ligated RBS. This was the one for the

 · Expression responsible Teil.des' expression plasmid completed (see Fig. 3).

The .Nükleotidsequenz shown in Fig. 3 can be determined by methods known from the literature, the "polynucleotide" . understand the synthesis.

d) insertion of the promoter / inducer RBS fragment into the

Plasmid pBR 322 . ,

About 2 μά of the plasmid pBR 322 were with the Restrik-. cut Eco enzymes RI and Hin dill, resulting in two fragments: a large 4332 bp and a; small with 29 bp. The large fragment was made by Elek-;

. trophoresis ment isolated on a 8% agarose gel _f 0 from the small Frag-- ", excised from the gel and eluted About 0.4 pmoles of this fragment" were then incubated ^with: about 10 pmoles of the promoter / operator-RBS fragment ligated (see ., part a) the pBR 322 fragment could: not ligate because of its two non-matching \ overhanging ends with itself, as the promoter / operator-RBS fragment could be ligated in only one orientation into the plasmid was promotion in Towards the Hin dIII site, to the tetracycline resistance gene of pBR 322... _: /

^e ). Transformation of Escherichia coli with the expression plasmid pER 10 3,

Escherichia coli HB 101 was transformed with the reaction mixture of this last ligation in a manner known from the literature (see Dworkin and Dawid, Dev. Biol. 76, 435-448 (1980)) and the transformants were selected on ampicillin-containing agar plates. For this E. coli HB 101 cells were added to a density of

8 ^;

cultured about 2 × 10 cells / ml. The cells were pelleted and suspended in 100 μM CaCl 2 solution (20 minutes at ⁰ ° C). Thereafter, the cells were mifde.ni reaction mixture, the ligase reaction for 5 minutes at 0 ° 4 ⁰ C and 5 minutes at 37 ⁰ C incubated. After adding. 0/5 - 1 ml of 1-broth was further incubated for 15-30 minutes at 37.7 ° C.19 transformants were selected and analyzed for Hae III restriction digests

possible content of Pfomotof / Cperator-RBS fragment The 192 bp pB £ 322 / Hae III fragment

was missing and had been replaced by a 264 bp fragment (16'bp from the Hae III cleavage site in pBR 322 "link's";'from' the Eco> RI cleavage site + 103 bp promoter / operator RBS fragment + 145 bp from the Hin dIII cleavage site 'bis' to the next Hae III cleavage site 'right' thereof, in pBR [ 322 ] . Of the 19 transformants selected, the expected pattern of ennoblement (see Figure 2).

f) Sequence analysis, the promoter / operator RBS region of the expression plasmid pER 103 '. '. '

to the correctness of the constructed Expressionspläsmide determine without doubt-, one of these plasmids (by 103) in the promoter / operator-RBS region was sequenced ^x sheet, 'and determined their position in pBR 322nd The ' sequence analysis ' was carried out according to the method known from the literature: by Maxam and Gilbert (see Proc. Nat. Acad., 74 , 560-564 (1977)) and was carried out by the Eco RI-SpaItsteHe in the Hin dIII cleavage site (and beyond), as well as from the Hin dIII site towards the Eco RI site (and 'beyond'). It was found that the nucleotide sequence shown in Fig. 3; is placed. '. ''

pER 1.03 is thus an expression plasmid containing the. promo

gate / operator region of the tryptophan operon of Serratia. , , marcesesns in combination with a synthetic RBS

contains. This new expression plasmid earned its doctorate; Transcription of genes that are incorporated into its .sup.ndyl cleavage site and allows efficient

Translation of these transcription products. That this is the precipitate is shown in Example 2. ''. '

Example 2 Construction of the Interferon Production Plasmid pER 33

.a. Construction of the mature interferon-encoding gene; with the exception of the codon for the NH ^ -terminal cysteine

About 1] iq, the Pst I-Insertes von.'l F7 was digested with the restriction enzyme Sau 3A, and the 177 bp ~~~ fragment from the Sau 3A -terminal cleavage site after the NH ^ cysteine codon to the next Sau 3A / cleavage site, containing one Ava II cleavage site, was isolated from a 6% polyacrylamide gel. It was treated with 1 unit of alkaline phosphatase. (see Part A) and precipitated after removal of the phosphatase by phenol and Ätherextraktion with ethanol. The fragment was then cut with Ava II, giving the desired. 34 bp Sau 3A-Ava IT fragment and a 143 bp fragment were obtained. ,

In parallel, the interferon-specific 646 * bp Ava II fragment extending from the Ava II cleavage site within the 177 bp Sau 3A-F fragment to beyond the termination codon was prepared from plasmid 1F7 '. Approximately 0.5 pg of this 646 bp Ava II fragment was now incubated with the enzyme DNA ligase together with the mixture of 34 bp and 143 bp of Sau 3A-Ava II fragments (ligation of cohesive ends, see Part A). This resulted in Ava II fragments flanked covalently by Ava II Sau 3A fragments. Once an Ava II Sau 3A fragment has ligated to an Ava II fragment, no further alloys can be made at that site because the Sau 3A ends have been dephosphorylated. After the ligase reaction 10 minutes · .kinasiert heated to 7O ⁰ C to inactivate the enzyme, then -were · 5 mM DTT and 0.25 mM ATP added und'die 'dephosphorylated Sau 3A-ends were again

(see part A). The reaction mixture was separated on a 6% polyacrylamide gel and molecules in the range of 700-800 bp (a 646 bp Ava II fragment flanked by two, Ava II Sau 3A fragments) and in the range of 1300 1500 bp (two ligated together 646 bp Ava II fragments flanked by Ava II Sau 3A fragments) were eluted. , ·. '

b. .Preparation of the oligonucleotide complex of the formula

12mer - 14mer

'r ^: ' ri j - -j

5 '. AGCTTAAAGATGTGTCATCTGCCTCA 3 ATTTCTACACACTAG ^ C

ι · 'ι 1

Hin dill

, 8mer 9mer

-Sau 3A

- Λ_1 I__J *.

, Met Cy

4 synthetic oligonucleotides prepared, namely a 1.4mer 5j TGTGATCTGCCTCA, a ^1- l-mercury 5 'AGCTTAAAGATG, a 9mer 5' CAGATCACA and an 8mer 5 'CATCTTTA were reacted as follows: 250 pmol each of 8mer, 9mer and 14mer ^ were phospho-substituted ( see part A), after the reaction, the heating was inactivated Kinase.durch '95 ° C, there was added 250 pmoles not -kinasiertes 12mer was added and the Oligonukleotiagemisch slowly (over about cooled .3 hours) at 35 ⁰ C to hubris ₍ . ation to allow the oligonucleotides ⁷ Thereupon, after addition of 5 mM DTT and 0.25 mM ATP, the oligonucleotides each other ( "blunt-end" -Ligierung, see part a) the lack of a ligated \ phosphate residue at the '5'. - end of 12mers prevented the formation of dimers, the overhanging end of the 14mers is not self-complementary, it may not for ^{dimerization;.} perform sierung- "

An aliquot (25 pmoles) of the ligated oligonucleotide complex was digested with 80 units of Sau 3A to generate the Sau 3A end fitting into the interferon gene. The sample was then heated to 75 ^° C. for 10 minutes, extracted with phenol and precipitated with ethanol. Herewith was the linker fragment linking the interferon gene to the Hin dIII-cut pER 103 according to the invention,. completed. "

c. Linking of Interferongene, and Qligonucleotide Complex, -Ligation in pER 103 '

The isolated interferon fragments (see example 2a), representing about 1 pmol of molecules, were ligated with the Sau 3A cut oligonucleotide complex (about 25 pmoles) by ligation of the cohesive sow. 3A ends (see part A). connected. Again, the absence of a phosphate residue prevented the Hin dIII end of the oligonucleotide complex. (12mer) the construction of multimers. It originated the interferon gene molecules on both. Sides of an oligonucleotide complex flanked by a free Hin dIII end. After heat denaturation of the ligase and addition of 5 mM DTT and 0.25 mM ATP, these ends were phosphorylated (see Part A), then an isopropanol precipitate (see Part A). to separate the oligonucleotide complex dimers also formed in the ligase reaction. Then the construction of '0.05] ig Hin dlll-geschni'ttenem, phosphatasebehandeltem pER 103 was ligated (Ligation of cohesive ends, see Part A). The phosphatase treatment (see Part A) of the Hin dIII-cut plasmid reduced its recircularization in the ligase reaction, thus completing a mixture of plaques containing 50% interferon production plasmids (namely those plasmids containing a 34 pb Sau '3A-Ava II fragment in the ligation with the 646 bp Ava II fragment at the start of the gene - see Example 2a).'

  , - '- 28 - *

d. Transformation of Escherichia coli HB 101 and analysis of transformation for interferon production

The plasmid mixture prepared according to Example 2c was analogously to Example Ie for. Transformation of Escherichia coli HB 101 (see Dworkin and Dawid, Dev. Biol. 7j6, 435-448 (1980)). Approximately 20% of the resulting Tfans formants had inserts (the remainder were recirculated laranized pER103 plasmids), several of which were assayed for interferon expression. To this were added ^: 100 ml bacterial culture in M9 minimum medium containing all amino acids except; Tryptophan (20 μ g / ml per amino acid), as well as thiamine (1 μg / ml) x, glucose (0.2%) and the inducer of the tryptophanoperone indole (3'-acrylic acid '(IAA, 20 pg / ml See Hallwell and Emment in Gene 9: 27-47 (1980)) were grown to an optical density of 0 _r 6 - 0.8. The bacteria were added by centrifugation for 10 minutes 7000 rpm, washed Ix in 50 mM TrisHCl, pH 8, 30 mM NaCl and finally suspended in 1.5 ml of the same buffer After incubation with 1 mg / ml lysozyme for 3 minutes on ice, the cells were incubated Bacteria 5 χ were frozen and thawed and then the cell debris removed by centrifugation for one hour at 40 00.0 rpm The supernatant was sterile, filtered and tested for interferon activity in the plaque production test with / VS cells and vesicular stomatitis virus About half of all clones

"... (with insert) showed considerable interferon expression:

8 '' "'2 χ 10 units (international reference units)

per liter KuItUr ₇ . ^ . '.' · E ,. Sequence analysis of the interferon product plasmid pER

One of these interferon-producing clones (pER33) was selected and sequenced from the promoter / operator region to the interferon gene to determine the accuracy of the plasmid being constructed.

Sequence analysis was again carried out according to Maxam and Gilbert (see Proc Nat Nat Acad., USA 74, 560-564 (1977)) and was carried out from the 3'-end radioactively labeled Eco RI cleavage site in the direction of \ interferon gene. The expected sequence resulted, a section of which is shown in FIG. This section shows all the oligonucleotide fragments used to construct pER 33. .

The above-mentioned properties prove that. the expression plasmid pER 103 prepared according to the invention contains the promoter / operator sequence of the tryptophan operon of Serratia marcescens in combination with a synthetic ribosome binding sequence. Using the example of leukocyte interferon it could be shown that: in the expression plasmid pER 103 appropriately inserted genes show high levels of expression. The expression plasmid pER 10 3 was deposited in Escherichia coli K "12, HB 101 in the German 'collection of microorganisms Grisebachstraße 8, D 3400 Göttingen, under DSM No. 2773 on October 27, 1983 under the Budapest Treaty.

Example 3 Construction of the interferon plasmid pER 21/1

The construction of the plasmid pER 21/1 is shown schematically in FIG. ,

a) Preparation of the IFNaA gene from pER 33

2 \ ig pER 33 'were cleaved with the restriction enzyme EcoRI and 3amHI, resulting in two fragments of lengths approximately 1300 bp and approximately 4G0G bp. These fragments were

 . ''; - 30 -, ·

the electrophoretically separated on a ..l, 2% agarose gel. The shorter fragment was isolated by electroelution from the gel. The ends of this DNA were blunt-ended by the addition of 1.25 nM each of dATP, dGTP, dCTP and dTTP and 2 units Klenow fragment of DNA polymerase I; The DNA was purified by phenol extraction and precipitation from ethanolic solution and then taken up in 15 μM H2O. '_;

Approximately 15 pmol of EcoRI linker (New England 'Biolabs Inc.)

  '32-'

were prepared by adding γ-ρ ATP and T4 polynucleotide

- Kinase phosphorylated in 5 μΐ Reaktionsl.ösung at the '5' ends. After heat inactivation of the kinase, the DNA,

. ' 5 nM of ATP and 0.1 unit of T4 ligase were added and incubated for 16 hours at 14 ° C. The reaction product was by Isopropan.olfallung of low molecular weight substances

, cleaned, .· -

The DNA was finally cut with 20 units of restriction enzyme, EcoRI, purified again by Isoprppanol elution and dissolved in 10 μM Η-Ο '.

b) Linearization of the plasmid pER 33 . , '

Approximately 2 \ ig pER 33 were treated with the restriction enzyme EcoRI. Subsequently, alkaline phosphatase was added to remove the 5'-phosphate residues. The approximately 5,300 bp linear DNA was culled by electrophoresis in a 1.2% agarose gel and electroeluted from residual unclipped pER33. The DNA was extracted with phenol and ether, precipitated from ethanolic solution and dissolved in .10 μΐ H2 O.

c) Linkage of the linearized pER 33 with the additional gene for IFNaA

4 μΐ of the EcoRI-linked DNA fragment containing the IFNaA gene plus regulatory elements was mixed with 0.5 μΐ EcoRI-linearized and dephosphorylated, pER3 3. in 20 μΐ reaction solution using .0.1 units T4- Ligase ligated together. After 16 hours incubation at 14 ° C, the enzyme was destroyed by heating to 68 ⁰ C. -,

<3) Transformation of E. coli HBlOl and analysis of

Transformation with regard to interferon production

E. coli HBlOl was transformed analogously to Example Ie with the DNA from Example 3c. Two of the clones prepared in this way were tested analogously to Example 2d for interferon expression by means of plaque reduction tests. While the clone pER 33 had up to 200 χ 10 ^β units of IFN-pro. 1 l culture, one of the new clones, pER. 2.1 / 1, surprisingly more than 300 χ 10 units per liter of culture.

e) Restriction enzyme analysis of pER 21/1 '·. '

The plasmid .PER 21/1 was isolated in a larger amount and by means of restriction enzyme digestion with Hin. dill analyzed. Since the DNA introduced into the EcoRI site in pER33 had two identical EcoRI ends, two orientations of this DNA were possible in pER 21/1. Restriction enzyme digestion with Hin dill of pER 21/1 with ''. Parallel interferon genes should show fragments of approximate size 4100, 950 (2 fragments) and 4.50 bp. However, if the two genes were oppositely oriented, fragments of approximately 4350, 950 (2 fragments) and 200 bp fragments are expected. Digestion of approximately 2 μg of pER 21/1 with the restriction enzyme Hin dill followed by electrophoresis in a 1.4% agarose

gel yielded fragments of approximate size 4100, 950 and 450'bp. Therefore, the two IFNaA genes are oriented parallel to each other (see Figure 6). '

Example 4 . ..

Construction of the interferon production plasmid parpER 33, -

The construction of the plasmid parpER 33 is messy in Flg. 7 is shown. ¹ . , -. · '·. \ ... '''·

a) Preparation of the par-locus '.

About 200 pmol of EcoRI linker (New England Biol-abs Inc.) were phorphorylated in 20 μl reaction solution with 9 units of T4 polynucleotide kinase and 10 nmol of ATP at the ends, and the enzyme was subsequently heat-inactivated.

'ι' '

  8 μg of the plasmid pPM 31 were cut with the restriction enzyme aval. The ends of the linearized plasmid were blunt-ended by addition of 5 nM dATP, dGTP ,, dTTP and 4 units of the enzyme Klenowfragment of the polymerase I. The DNA was purified by phenol extraction

, Traction and precipitation from ethanolic solution gere.inigt and in 40 μΐ H ^ O recorded.

The EcoRI linkers were co-administered with. the linearized. 'and - blunt-ended DNA in 70 .mu.l reaction solution with β, ηΜοΙ ATP' and 1 unit T4 ligase for 16 hours at, 14 ⁰ C treated. After heat inactivation of the enzyme, the solution was adjusted to 50 mM NaCl and 50 mM Tris-Cl pH = 7.6 and the DNA to 300 units. EcoRI treated. After 2 hours of incubation, the restriction enzyme was disrupted and the DNA was electrophoretically separated in a 1.4% agarose gel. The piece of DNA, about 400 bp long, containing the par locus was electroeluted from the gel by phenol extraction and precipitation

purified from ethanolic solution and dissolved in 50 μΐ H ₂ O. This piece of DNA now has EcoRI specific overhangs at its ends.

b) Linearization of the plasmid pER 33

About 2 μg of pER 33 was treated with the restriction enzyme EcoRI. Subsequently, alkaline phosphatase was added to remove the 5'-phosphate residues. 5300 bp long, linear DNA was through. Electrophoresis in 1.2% agarose gel and electroeluted from residual, uncut pER 33. The DNA solution was extracted with phenol and ether, precipitated from ethanolic solution and dissolved in 50 μM H-O. '

c) Linking the linearized pER 33 with the par locus

DNA ','. '~

1 μΐ linearized pER 33 DNA was ligated together with 1 μΐ par locus DNA in 20 μΐ ^l reaction solution with the aid of 0.1 units, T4 ligase. After 16 hours at 14 ⁰ C Inkbuation the enzyme was heat inactivated.

<3) Transformation of E. coli HB101 and analysis of plasmids from the transformed bacteria

E. coli HB101 was transformed analogously to Example Ie with the DNA 'from Example 4c. About .50 colonies were obtained. From ten of these colonies, a small amount of plasmid DNA was isolated (Birnboim and Doy, Nucleic Acid Research 7, 1513-1523 (1979)) and cut with the restriction enzyme PstI. The analysis by agarose.g- 'electrophoresis revealed that all these plasmids contained the approximately 400 Op length par-locus. One of these plasmids # was selected and designated .parpER 33.

  ·. ν - - 34 -;. -.

e) Analysis of des.-parpER 33 with regard to interferon production and stability .

Analogously to Example 2d were. Bacteria containing either pER., 33 or parpER 33 were grown and then tested for interferon content in the plaque reduction assay. , Both strains showed about the same level of interferon expression ...

In a long-term trial covering over 120 bacteria. The stability of the plasmids pER 33 and parpER 33 in E. coli HB101 was extended. in the absence of Selektiorisdruckes by the anti-antibiotic ampicillin examined. The culture samples were taken at regular intervals and the bacteria were tested for interferon content and it was found that the bacteria containing pER 33 ceased interferon production after approximately 60 generations, but bacteria containing parpER 33 still produced after 120 generations unabated Interferon aA. ·

Thus, the introduction of the par locus into pER 33 ("parpER 33") was shown to be the stability of the plasmid. 'E.'coli Ή-Β101 increased. ^·]

Λ '

Used terms and abbreviations

ATP base pair:

blunt end:

bp: BSA: C DNA: encode

codon:

dephosphorylate DNA: DTT: electrophoresis:

expression:

Expression plasmid:

Gene: adenine cinphosphate 2 complementary nucleotides, eg ' ¹ AT, GC

fully base-paired DNA double-stranded end, as distinct from overhanging single-stranded ends base pairs bovine serum albumin mRNA-complementary DNA,. the information, for something to wear; DNA carries the nucleotide 'sequence information for the amino acid sequence of a protein group of 3 nucleotides that encodes a particular amino acid or for the termination of polypeptide synthesis

  a phosphate group remove deoxyribonucleic acid dithiothreitol

Separation of (DNA) molecules in the electrical, field 'implementation of the information of a gene in mRNA by transcription and in. Further in polypeptide by translation plasmid, which allows the expression' of genes inserted therein

Section on the DNA that provides the information for a given

gene:

Hybridization (of nucleic acids):

hybrid:

IFN-aA: initiation codon;

Insert: Kinase:. '

kinase: clone: '

cohesive ends

complementary:

ligase:

'!

Transcript (RNA molecule), which can be further translated into a protein RNA. (Transcript), protein (translation product)

Formation of stable complexes between mutually complementary DNA strands Plasmid containing a DNA section of foreign origin. '' Leukocyteninterferon subtype A, the codon ATG, which codes for methionine and can signal the start of translation

the piece of foreign DNA that is in a hybrid plasmid enzyme that can phosphorylate 5 'OH groups on DNA and RNA molecules can be provided with 5' phosphate groups bacterial colony / single bacterial-derived single stranded DNA molecule, which hybridize to each other (nucleotides in the DNA: A is complementary to T, G is complementary to C). · D ^ A molecules can be covalently linked to one another · connect covalently

(DNA molecules) ·

- .37 -

mRNA:

nucleotide:

nucleotide

oligonucleotide:

Operator:

operon:

Phosphatase: plasmid:

promoter:

RBS:

Restriction endonuclease

(Restriction enzyme):

Restriction fragments

Ribosome binding sequence messenger RNA, is a polypeptide-encoding RNA building block of a DNA or RNA (A = adenosine, C = cytidine, G = guanosyl, T = thymidine, U =

- üracil) '.

Sequence of nucleotides in a DNA or RNA molecule '. , few together by phosphodiester linked nucleotides (short single-stranded DNA portion) of the regulatory region of an operon, to which the repressors bind, thus transcription is ^prevented: group of (bacterial) genes that are regulated by an operator region from

Enzyme that can remove 5'-phosphate groups from DNA molecules is an extrachromos.omales, circular DNA-i molecule DNA sequence that binds to the enzyme RNA polymerase; .suitable, see ribosome binding sequence

Enzyme capable of cleaving the DNA double strand in a particular symmetric DNA sequence. Fragments of DNA resulting from digestion with a restriction endonuclease. Part of the inRNA ^; ans. Ribosome. can bind ^; .

RNA:; /

RNA polymerase

Sequence:

;. termination;

; transformant:

Transformation:

Transcription:. 'Translation:

Tr is:

Ribonucleic acid Enzyme that can synthesize a DNA strand complementary to DNA see nucleotide sequence Codon, which signals the end of translation of bacterium 'which has received the foreign DNA (a plasmid)' by transformation

Injecting foreign (plasmid) DNA into bacteria Synthesizing RNA complementary to a DNA template Translating the information from mRNA into a polypeptide trishydroxymethylaminoethane

Short description of the illustrations

FIG. 1

shows a schematic representation of the construction of the expression plasmid pER 103. Fragment sizes are not drawn to scale.

FIG. 2

shows the Hae III digestion patterns of plasmids pBR 322 and pER, 103. The. 192 bp fragment * of pBR 322 is replaced in pER 103 by a fragment of about 270 bp.

FIG. 3

shows the nucleotide sequence of pER 103 between the Eco RI and the Hin dIII cleavage site. The remainder of the plasmid corresponds to the large Hin dIII Eco RI fragment of pBR 322.

FIG . 4 . , ·

is a schematic representation of the construction of the interferon production plasmid pER 33.-Φ: Pst I cleavage site, ^: Sau 3A cleavage site, ^ : Ava II cleavage site. Except for the restriction map of the 1 F7 insert, the fragments are not drawn to scale. , '

FIG. 5

shows a section of a sequence gel, on which the connection promoter RBS Interfsrongen can be seen. All oligonucleotide fragments used in the construction of pER 33 are present. For a better understanding, the same sequence is again indicated double-stranded below; the individual oligonucleotide components are shown.

FIG. 6 '.

is a schematic representation of the construction of the interferon production plasmid pER 21/1. The fragments or plasmids are not shown to scale.

FIG . 7 . ·

Figure 3 is a schematic representation of the construction of the interferon production plasmid parpER 33. The fragments and plasmids are not to scale.

Claims (11)

Claim of invention. · ', A method of producing a plasmid comprising a DNA sequence of the formula 2. Method according to item 1 », characterized in that the plasmid pBR 322 is used as the vector. Λ Γ. -1   , - 42 -; '' ..- ' 3. The method according to item 1, characterized in that a DNA linker sequence of the formula , 5 ¹ AGCTTAAAGATG 3 ¹ ATTTCTAC is used. * 4. The method according to item 1, characterized in that the structural gene used encodes an interferon. 5'AATTCACGCTGATCGCTAAAACATTGTGCAAAAGAGGGTTGACTTTGCCTTC 3 'GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG j £ promoter- ' : GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAAGCT CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA , ; .-- P rom pt ο r / operator- -:; % RSS ^: - ^ ^: '. '. , , Hin dill TAAAGATG. , . '·. ' ', ATTTCTAC /. . -'-.-. , '; '^ -Linker. - is used by ligase reaction. , .- 43 - 5. Method according to item 1 », characterized in that the structural gene used codes for human interferon oCA. 5'AATTCACGCTGATCGCTAAAACATTGTGCAAAAGAGGGTTGACTTTGCCTTc 3 '. GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG Promoter: GCGAACCAGTTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTA CGCTTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA - promoter / operator _: % £ - ^ RBS -9f  -. Hin dill. ', to which subsequent to the Ribosomenbindungs-. sequence, a linker sequence and then, optionally, in addition to the linker sequence, the sequence of a structural gene for any polypeptide is e-inserted in such a form that the structural gene is linked to the DNA sequence of the DNA linker sequence via the 3 ', 5'-phosphodiester bond is connected dnd is brought by bacteria for expression, and its mutants available in a conventional manner, characterized in that combines a vector, z *, a plasmid, with a corresponding DNA sequence ;. 6. A process for the preparation of the expression plasmid pER 1Ö3 according to items 1 to 3 and its in a conventional manner 'available mutants, characterized in that the. Vector is the plasmid pBR 322 from which by restriction endonuclease cleavage the plastidigeneigene 29 bp Eco RI Hin dill fragment is removed and in its place a DNA sequence of the formula 7. A process for the preparation of a Produktionsplamids according to item 1 to 6, which one or more DNA sequences of the formula 5 ¹ AATTCACGCTGATCGCTAAAACATTGTGCAAAAGAGGGTTGACTTTGCCTTc 3 'GTGCGACTAGCGATTTTGTAACACGTTTTTCTCCCAACTGAAACGGAAG ^ Promoto · ^; - ^ ----- GCGAACCAGtTAACTAGTACACAAGTTCACGGCAACGGTAAGGAGGTTTAAGCT CGCtTGGTCAATTGATCATGTGTTCAAGTGCCGTTGCCATTCCTCCAAATTCGA - »Promoter / Operator RBS - * - TAAAGATGTGTGATCTGCCTCAAA ATTTCTACACACTAGACGGAGTTT ...... Hin dill fc linker J (IFN-iiA gene; ^ and optionally a par locus, and its mutants available in a known manner! characterized in that the structural gene coding for IFN-flSA is inserted into a vector, preferably into an expression plasmid prepared according to points 1 to 5, subsequently to the linker sequence and, if desired, into a plasmid thus obtained which is linearized, a par-locus and / or another sequence of the above formula is introduced by ligase reaction. 8, method according to item 7, characterized in that a par-Loküs isolated from pPM 31 is used. 9. Process for the preparation of the production plasmid pER according to point T, characterized in that on the Hin dll1 cleavage site of the expression plasmid pSR 103 prepared according to point 6, the DNA sequence coding for IFN-CiA is subsequently inserted into the linker sequence. . 10. Process for the preparation of the production plasmid par pER 33 according to point 7 _t characterized in that in / the plasmid pER 33 prepared according to point 9, which. is linearized by the restriction enzyme Eco RI, a par-locus isolated from pPM 31 is inserted. 11. A process for the preparation, of, production plasmid pER 21/1 according to item 7, characterized in that ¹ , that in the prepared according to item 9 plastid pER 33, which is linearized with Eco RI-, a DNA fragment with the length of about 1300 bp, which by treatment of the prepared according to item 9 plasmid pER 33 with the ; Restriction enzymes Eco RI and Bam HI is inserted is inserted. For this ^ strings drawings