NO833198L - PREPARATION OF HEPATIT-B VIRUS VACCINE - Google Patents

Abstract

A DNA fragment capable of coding for HBsAg and DNA derivatives of Dane particles is fused to the region for controlling the arg3 gene of yeast and cloned in a yeast vector. The recombinant vector is employed for transforming the competent yeast cells in which the HBsAg gene is expressed.

Description

The present invention relates to the cloning of a gene that codes for hepatitis B surface antigen in yeast using recombinant DNA techniques and the production of a hepatitis B virus vaccine from antigen produced by the yeast.

Hepatitis B virus (HBV) infection is a serious widespread health problem. The infection can manifest itself in acute or chronic phases. The number of cases of acute hepatitis in the USA is estimated to be at least 100,000 per year. year with a mortality ratio of 1 to 2%. In the USA, the prevalence of chronic carriers of HBV among healthy adults varies between 0.1 and 1%, depending on age and social class. In South America, the incidence of chronic carriers is approx. 1 to 3%; in the USSR and southern Europe approx.

3 to 6%; and in Asia and Africa more than 10%.

-'In developed countries there is a need for a vaccine for people at high risk of exposure such as patients and personnel at medical centers where blood is processed, military personnel, spouses of chronic carriers, travelers to areas with a lot of HBV, newborns of chronic carriers, homosexuals, prostitutes and drug addicts. In the third world there is a need for a cheap vaccine for mass immunization. Mass immunization programs may ultimately not only affect the frequency of hepatitis in adults and the collection of chronic carriers, but also reduce the impact and mortality of chronic active hepatitis and hepatocellular carcinoma. " Dane particles believed to be hepatitis B virions and which can be isolated from infected patients, has a diameter of approx. 42 nm. Each consists of a capsule comprising hepatitis B surface antigen (HBsAg), a capsid (HBcAg), an endogenous polymerase and a DNA genome. The genome is ring-shaped and double-stranded with a single-band region consisting of approx. 200 bases. The one-band region can be filled in in vitro by the action of endogenous polymerase. The longest chain contains approx. 3,200 bases.

It has been difficult to produce HBV vaccines because it has proved difficult to grow the virus in tissue culture and because the only known host is humans. Small amounts of authentic HBV antigens have been isolated from infected humans. F-D-C Reports, pp. 3-4, 19 July 1982 contains a report of clinical trials of a recently developed hepatitis B vaccine.

Valenzuela et al., Nature, vol. 298, 347-350 (1982), describe the synthesis of HBsAg in yeast using an expression vector in which the HBsAg coding sequence is an 835 bp TaqI-HpaI fragment and the promoter is yeast alcohol dehydrogenase In promoter. Several previous short reports describe research prior to this literature citation. These are Valenzuela et al., Arch. Biol. With. Exp. (Chile), Volume 14(1), 21-22

(1981) who report expression in yeast of a DNA fragment containing a frequency encoding a similar protein to HBsAg ligated to a yeast alcohol dehydrogenase promoter region; a report in Scrip No. 616, p. 14 (August 12, 1981), which states that a group of American researchers including P. Valenzuela and W.J. Rutter has described the production in yeast of "the protein-coating surrounding hepatitis B virus"; and Zuckerman, . Nature, vol. 295, 98-99 (1982) which reports that W.J. Rutter has reported the expression of glycosylated HBsAg in yeast cells.

Antigenic components of HBV such as HBsAg have been produced

in bacteria after the insertion of a recombinant DNA molecule containing a gene that codes for the antigen. Burrell et al., Nature, Vol. 279, No. 5708, 43-47 (1979), report expression in E. coli strain HB101 of HBV DNA sequences cloned in plasmid pBR322.

Murray et al., European. patent application 13,828, describes the production of a recombinant vector which can code for HBV antigens containing HBsAg in E.coli strain HB101. The vector is made from Dane particle DNA and plasmid pBR322. The authors state that useful hosts may be bacterial hosts, yeast or other fungi, animal or plant cells, and other hosts, although the only host shown is E. coli. Charnay et al., Nature, vol. 286, 893-895 (1980) report the construction of a bacteriophage carrying a fusion of the 0-galactosidase gene and the HBsAg structural gene. The bacteriophage causes synthesis of a fusion protein comprising antigenic determinants for both HBsAg and 3-galactosidase.

Tiollais et al., British Patent Application No. 2,034,323, describes the preparation of a coliphage containing HBV DNA. Annealed phage HBV DNA is transformed into E. coli strain C600.

British Patent Application No. 2,070,621, first published as PCT application WO81/00577, describes a plasmid comprising part of the HBsAg gene and the promoter and Z gene of the lactose operon and which can be cloned in E. coli.

Rutter et al., European Patent Application No. 20,251, describes recombinant vectors including a recombinant vector comprising pBR322 and BamHI fragments of HBV DNA, which can be used to transform E. coli. Another vector comprising a BamHI fragment of HBV DNA and part of the tryptophanoperon was used to achieve expression in E. coli strain HB101.

Edman et al., Nature, Vol. 291, No. 5815, 503-506 (1981), describe the construction of plasmids that direct synthesis of HBcAg and a 3-lactamase-HBsAg fusion protein under the control of the tryptophan operon regulatory region in E. coli.

Other literature describes insertion of HBV DNA into bacteria including Charnay et al., Prog. Eaten. Virol., Vol. 27, 88-92 (1981); MacKay et al., Proe. Nati. Acad. Pollock. U. S., Vol. 78, No. 7, 4510-4514 (1981); Fritsch et al., CR. Acad. Sei, Vol. 287, No. 16, 1453 (1978); UK Patent Specification 2,034,323 (Derwent No. 46874C); and Pasek et al. Nature, Vol. 282 No. 6. 575 (1979).

HBV DNA is also cloned in mammalian cells. These include human, mouse, and human hepatoma cell lines. F. ex'. report Dubois et al., Proe. Nati. Acad. Pollock. U. S., Vol. 77, No. 8, 4549-4553 (1980), transformation of mouse cells with a plasmid containing the HBV genome and expression of HBsAg; Hirschman et al., Proe. Nati. Acad. Pollock. U. S., Vol. 77, No. 9, 5507-5511 (1980) reports the production of HBV-like particles by HeLa cells transformed with HBV DNA.

Methods for the production of HBV vaccine using HBsAg from human blood are described by Funakoshi et al., Prog. With. Virol. vol. 27, 163-167 (1981), and Maupas et al. Prog. With. Virol. vol 27, 185-201 (1981). The vaccine prepared by Funakoshi et al. contains 40 µg purified, formalin-treated HBsAg, sodium phosphate chloride, 20 mg mannitol; and 0.1% aluminum hydroxide as excipient. In the latter publication, Maupas et al report. that a dose of vaccine "was 1 ml of purified, formalin-treated HBsAg containing

2-10 ug/ml protein (Lowry's method) and 0.1% aluminum hydroxide. The regimen used in the study "reported by Maupas et al. required three injections at one-month intervals with a booster dose after one year; and the authors suggest a regimen consisting of two injections of concentrated HBsAg at three-month intervals.

Additional references for the preparation of HBV vaccines are Maupas et al., Adamowicz et al., and Funakoshi et al. at pages 3, 37 and 57, of hepatitis B vaccine INSERM symposium no. 18, edit. by Maupas and Guesry, 1981, Elserier/North-Holland Biomedical Press.

Yeast have been used as host organisms for certain other DNA sequences. E.g. Fraser et al., British Patent Application No. 2,068,969 describes the preparation of chicken ovalbumin in yeast; Scrip No. 640, p.ll (November 4, 1981) contains a report that a type of interferon is produced in yeast. In European patent no. 11,562 (Derwent no. 38762C) hybrid yeast plasmids are reported containing the ura^ yeast gene in the 2u plasmid. The present invention relates to the production of a recombinant DNA molecule comprising a nucleotide sequence which can code for HBsAg and a regulatory region derived from the yeast arg 3 gene which can effect transcription of the HBsAg sequence in the yeast, Saccharomyces cerevisiae. The molecule contains vectors into which the HBsAg sequence and regulatory region have been inserted, which vectors can be used to produce a yeast vector or to maintain HBsAg

and the regulatory areas. Microorganisms containing the recombinant DNA molecule, such as microorganisms transformed with plasmids according to the invention, form part of the invention. The invention also contains a plasmid with an arg_3 regulatory region and a restriction point close to this for the insertion of a coding sequence such as an HBsAg sequence,

so that the protein synthesized by expression of the coding sequence lacks extraneous amino acid residues.

The invention also includes the preparation of a vaccine to stimulate protection against HBV infection in humans comprising a vaccine amount of HBsAg prepared according to the present invention and a suitable carrier.

Furthermore, the invention includes a method for the production of recombinant DNA molecules and microorganisms that contain the molecules as well as a method for the production of HBsAg and HBsAg-containing vaccine.

Figure 1 shows a restriction endonuclease cleavage map for

PRIT10601.

Figure 2 is a restriction endonuclease cleavage map for

pRIT10616.

Figure 3 is a restriction endonuclease cleavage map for

pMC2 00.

Figure 4 is the nucleotide sequence of a portion of the 3,300 bp HindIII yeast DNA insert in pMC200, which portion contains HincII, BglII and EcoRI sites. Figure 5 is a flowchart illustrating the preparation

of pRIT10.6 71 and pRIT10673.

Figure 6 is a flowchart illustrating the preparation

of pRIT10749.

Figure 7 is a flowchart illustrating the preparation

of pRIT10761 and pRIT10764.

The recombinant DNA molecule is produced by fusing

a nucleotide sequence containing a structural gene for HBsAg with a yeast arg3 regulatory region, which regulatory region can direct transcription of the HBsAg sequence in yeast, thereby causing its expression. By "recombinant DNA molecule" is meant a DNA fragment containing the HBsAg coding sequence and the regulatory region as well as other DNA molecules "containing the fragment such as plasmid or phage vectors.

By "regulatory region" is meant a sequence containing a promoter region and other sequences necessary for transcription. The yeast arg3 regulatory region is particularly advantageous because it can be a strong promoter for expression of an HBsAg coding sequence.

By "HBsAg" is meant a protein that is structurally identical to authentic HGsAg or has essentially the same antigenic determinants as authentic HBsAg, i.e. is capable of stimulating the production of antibodies that specifically recognize and react with authentic HBsAg or are specifically recognized by anti-HBsAg antibodies.

The HBsAg coding sequence can be isolated from DNA extracted from Dane particles in infected human serum by filling the single-band region with a DNA polymerase, preferably the endogenous polymerase, followed by digestion with a restriction endonuclease. The choice of endonuclease will depend in part on the Dane particles available. E.g. can, as illustrated in the examples below, the HBsAg coding sequence of HBV DNA i| Certain Dane particles of the adw serotype are isolated on a single! BamHI fragment, and the HBsAg coding sequence of HBV DNA in certain Dane particles of the ayw serotype can be isolated on an Hhal fragment. HBV DNA in Dane particles of the same serotype can therefore show different patterns for restriction points.

Restriction of DNA to produce DNA fragments used in the invention, ligation of such fragments to produce recombinant DNA molecules used in the invention and introduction into microorganisms are carried out by known techniques such as the techniques described in the previously and subsequently indicated literature places. The conditions are chosen so as to avoid denaturation of the DNA and the enzymes. E.g. the pH is buffered to approx. 7.0 to 11.0 and the temperature is kept below approx. 60°C. Restriction is preferably carried out at a temperature of approx. 30 to 40°C and ligation is carried out at approx. 0-10°C. Restriction enzymes and ligases used in the practice of the invention can be purchased and should be used according to accompanying instructions. T4 DNA ligase is the preferred ligase.

Fusion of the HBsAg sequence to the regulatory region can be performed using intermediate vectors as illustrated in the examples below. Alternatively, the HBsAg sequence can be inserted directly into the vector containing the regulatory region. A vector is DNA that can carry and retain the DNA fragment in the invention, including e.g. phages and plasmids. Techniques for cloning DNA fragments in phages are described e.g. by Charnay et al. Nature, vol. 286, 893-895 (1980) and Tiollais, British patent application 2,0 34.32 3. Preferably, the HBsAg sequence is placed in such a way in relation to the regulatory region that the HBsAg which is synthesized by expression of the HBsAg sequence lacks foreign amino acid residues.

A regulatory region that has been found to be particularly useful originates from the yeast arg_3 gene which codes for ornithine carbamoyl transferase (OCT). Use of arg3 regulatory area i is advantageous foi^di its activity is subject to ba0ide _ specific and general control mechanisms. It has been cloned in E. coli on a plasmid. pYe ura3 arg3 as indicated by Crabeel et al., Proe. Nati. Acad. Pollock. U. S. A., Volume 78,

5026 (1981). Preferred hosts are S. cerevisiae strains in which the arginine biosynthesis pathway is derepressed, such as strain lcl697d. Use of such strains leads to increased expression from the arg3 promoter compared to the other strain used in the examples, strain DC5.

The preferred vector for cloning the fused DNA fragment in yeast is the plasmid YEpl3, which is capable of replication and existence in both E. coli and S. cerevisiae and is therefore known as a shuttle vector. Several other yeast vectors are known and available. HBsAg and the regulatory regions can be inserted into a yeast vector sequentially or, as illustrated in the examples below, simultaneously. Transformation with plasmid vectors will normally lead to the insertion of the DNA molecule according to the invention as a plasmid. However, other reactions such as recombinations can lead to the introduction of the DNA molecule into chromosomal DNA.

Vaccines to stimulate protection against HBV infection in humans comprising HBsAg produced by yeast according to the invention and a suitable carrier can be prepared by known techniques. The use of an auxiliary substance such as aluminum hydroxide is desirable. HBsAg produced in this way can also be combined with other immunogens for combination vaccines. HBV or combination vaccines can e.g. given by subcutaneous, intravenous or intramuscular route. The DNA fragment according to the invention and the HBsAg produced by it can also be used as a probe for the detection of HBV in biological samples by DNA hydridization techniques and various immunological measurements.

In the following examples of the invention, which are illustrative and not limiting, all percentages are parts by weight and all temperatures are in °C.

Example 1

Preparation of intermediate plasmid, pRIT10601, by combining HBV DNA with pBR322.

HBsAg positive serum of ayw serotype was defibrinated by adding CaCl2 to a final concentration of 0.28%

and centrifuged for 2 hours at 27,000 rpm in a SW 27 rotor on 10-20% sucrose gradients made in a buffer (pH 7.5) containing 10 mM tromethamine-HCl, IM NaCl and IM EDTA.

A transparent pellet containing Dane particles was resuspended in the same buffer and centrifuged over the buffered 20% sucrose layered on a 65% sucrose cushion. An opalescent band on the pad interlayer was taken out and centrifuged on a similar 20-65% gradient at 200,000 x Gi for 4 hours to pellet the Dane particles.

A. Single-stranded regions of the HBV genome in the Dane particles were repaired using endogenous DNA polymerase by resuspending the Dane particles in a reaction mixture (pH 8.0) containing 50 mM tromethamine-HCl, 10 mM MgCl 2 , 500 mM NaCl, 0.5 mM dithiothreitol, 5 0 mM each of dATP, dCTP and

32

dGTP and 8 µM P-dTTP (350 Ci/mmol) and incubate the resuspended particles for 5 hours at 37°C. The resuspension was diluted to pH 7.5 with a buffer containing 10 mM tromethamide-HCl, 10 mM EDTA, 100 mM NaCl and 0.02% sodium dodecyl sulfate (pH 7.5) and incubated with 0.5 mg/ml pronase for 1 hour at 37°C followed by phenol extraction and ethanol precipitation.-

Digestion of the DNA with BamHI restriction endonuclease gave

two radioactive fragments with sizes approx. 1,450 bp and 1,600 bp determined by agarose gel electrophoresis and autoradiography of the gel.

B. Approx. 30 mg of Dane particle DNA was repaired with endogenous DNA polymerase in the presence of unlabeled dTTP, and was extracted and sampled as described above. The DNA was mixed with 100 ng of plasmid pBR322 previously digested with BamHI restriction endonuclease and treated with alkaline phosphatase. Plasmid pBR322 is normally used in recombinant DNA methods and is deposited without restriction on availability in the American Type Culture Collection under No. 37017. The mixture was extracted with phenol, precipitated with ethanol, centrifuged, dried, resuspended in 12 µl of a mixture (pH

7.5) containing 50 mM tromethamine-HCl, 1 mM ATP, 10 mM MgCl2 t 10 mM dithiothreitol, 50 µg/ml gelatin and 2 units/ml T4 DNA ligase. The suspension was incubated for 4 hours at 10°C and then kept on ice for 18 hours.

The ligated DNA mixture was used to transform competent cells of E. coli K12 strain C600 prepared according to the method of Cohen et al., Proe. Nati. Acad. Pollock. U. S., Vol. 69, 2110 (1972). Transformants were selected

on a solid medium containing ampicillin (200 pg/ml). Isolated colonies were examined for loss of tetracycline resistance, indicating insertion of a foreign DNA fragment into the BamHI site of pBR322. One such transformant clone was found to contain a plasmid, pRIT10601, which after digestion with BamHI endonuclease gave a pBR322 fragment of 4.360 bp and HBV DNA fragments of 1600 bp and 1450 bp. A culture of E. coli K12 strain C600(pRIT10601) was deposited according to the provisions of European

Patent Convention (EPC) and Budapest Treaty in American

Type Culture Collection, Rockville, Maryland U.S.A. it

2 June 1982 under accession number ATCC 39132. A restriction endonuclease cleavage map for plasmid pRIT10601 is shown in Figure 1.

C. The sizes of the fragments formed by digestion of Dane particle DNA and pRIT10601 with different restriction enzymes were compared as follows. Dane particle

32

DNA, i.e. HBV DNA, was labeled with P by endogenous polymerase reaction described above or by treating purified DNA with DNA polymerase I from E. coli. The labeled HBV DNA was mixed with pRIT10601 and the mixture was treated with a restriction endonuclease and electrophoresed on agarose gel. The gel was stained with ethidium bromide and photographed under UV light to locate the DNA fragments and then became!

in dried and autoradiographed to locate the radioactive ' HBV DNA fragments. The following labeled HBV fragments were found to exactly match the size of pRIT10601 fragments: 1,450 and 1,600 bp BamHI fragments; a 1,330 bp HpaI fragment; and a 1,130 bp BamHI-XhoI fragment. Labeled Dane particle DNA also hybridized specifically to both

m

The 1,450 and 1,600 bp fragments released by BamHI digestion of pRIT10601 after transfer of these fragments from an agarose gel onto a nitrocellulose filter by the technique of Southern, J. Mol.Biol., vol. 98, 503 (1975).

These results showed that the cloned DNA insert on pRIT10601 represents the HBV genome and that a relative orientation of the two BamHI fragments on pRIT10601 is the same as in the virion. pRIT10601 was used to prepare pRIT10671 in Example 10 below.

Eczema Part 2

, .fa

Preparation of intermediate plasmid, pRIT10616 by combining HBV DNA with pACYC184.

Dane particles were isolated from HBsAg positive serum of adw serotype as described above. Restriction endonuclease analysis of<32>P-labeled HBV DNA indicated that the DNA contained an EcoRI site.

HBV DNA filled in by endogenous polymerase reaction using unlabeled nucleotides was digested with EcoRI. The cleaved DNA was mixed with plasmid pACYC184 which had previously been digested with EcoRI and treated with alkaline phosphatase. Plasmid pACYCl84 has been deposited without restriction for availability in the American Type Culture Collection under accession number 37033. The mixture was ligated with T4 DNA ligase.

The ligated DNA mixture was used to transform competent cells of E. coli K12 strain C600. Transformants were selected on tetracycline (15 µg/ml) agar medium and examined for loss of chloramphenicol resistance which is indicative of insertion into the EcoRI site of pACYC184. One transformed colony was found to contain a plasmid, PRIT10616, which contained pACYC184. with a 3,200 bp insert comprising HBV DNA at the EcoRI site. A restriction map for pRIT10616 is shown in Figure 2. E. coli K12 strain C600 (pRIT10616) was deposited under the EPC provisions and the Budapest Treaty in the American Type Culture Collection on June 2, 1982 under accession number ATCC39131.

Example 3

Preparation of intermediate plasmid, pRIT10640 containing a nucleotide sequence coding for HBsAg by combining PRIT10616 with pBR313.

pRIT10616 was purified by CsCl-ethidium bromide density gradient centrifugation, essentially as described by Kahn et al, Methods in Enzymology, vol. 68, 268 (1979).

The DNA was digested with BamHI endonuclease, mixed with BamHI-digested, alkaline phosphatase-treated DNA from plasmid pBR313, ligated and used to transform competent cells of E. coli Kl2 strain C600 essentially as described in Example 1. Plasmid pBR313 has been deposited without restrictions on availability in the American Type Culture Collection under access number 37018.

Transformants were selected on ampicillin-containing agar and examined for loss of tetracycline resistance, indicating insertion at the BamHI site of pBR313. A transformed colony was found to contain a plasmid pRIT10640,

which consists of pBR313 with a 1,350 bp insert in the BamHI site. The insert is a nucleotide sequence that can code for HBsAg.

It encodes part of a putative HBsAg precursor protein and the entire surface antigen and contains 565 bp of 3' non-coding sequences.

Example 4

Production of intermediate plasmid, pMC200, containing the arg3 regulatory region, by combining the yeast arg3 gene with pBR322.

A 3,300 bp yeast DNA fragment specific for the arg3 gene was prepared by digestion of pYe ura3 arg3 with HindIII. The plasmid pYe ura3 arg3 has been described by Grabeel et al., Proe. Nati. Approx. Pollock. U. S., Vol. 78, 5026 (1981). The 3,300 bp fragment was cloned into the HindIII point of pBR322 and transformed into E. coli K12 strain MM294 essentially as described above. Transformants were selected on ampicillin medium and examined for tetracycline resistance. Y,n transformed colony was found to contain plasmid, pMC200, which consists of pBR322 with an insert at the HindIII point. This plasmid contains the arg3 regulatory region which can effect transcription of an HBsAg nucleotide sequence in yeast cells as described in the following examples. E. coli K12 strain MM294 (pMC200) was deposited under the EPC provisions and the Budapest Treaty with the American Type Culture Collection on June 2, 1982 under accession number ATCC39130.

The nucleotide sequence of part of the arg3 gene containing part of the N-terminal coding sequences for ornithine carbamoyl transferase (OCT) and part of the 5<1>untranslated leader region here determined by Huyghen et al., Arch. International Physical. Biochem., Vol 89, B172 (1981). Figure 4 illustrates a 210 bp fragment of known sequence. The 210 bp fragment contains only HincII, BglII and EcoRI sites of the 3,300 bp HindIII yeast DNA insert in pMC200; the start codon for the OCT protein coding sequence is assumed to be the boxed ATG codon. Introduction into the HincII, Bglll or EcoRI sites of the yeast

DNA for coding sequences for HBsAg alone or HBsAg precursor plus HBsAg derived from cloned HBV DNA is expected to result in a gene fusion and production of a hybrid protein transcribed and translated from the arg3 regulatory region provided the gene fusion has the correct orientation for continued translation past the fusion point. Example 5 Production of intermediate plasmids, pRIT10671 and pRIT-106 72, containing HBsAg and regulatory regions by combining pRIT10641 with pMC200.

pMC200, 5 µg was digested with 6.4 units of BglII for 2.5 h at 37°C, diluted with the same volume of a buffer (pH 10.5) containing 0.1 M glycine, 0.01 M MgCl 2 6 H 2 O and 0, 1 mM ZnCl2, and incubated with 0.5 units of calf intestinal alkaline phosphatase for 30 minutes at 37°C to remove 5' terminal phosphate residues. The mixture was extracted twice with buffer-saturated phenol and three times with ether. The DNA was precipitated with ethanol and dissolved in 0.01 M tromethamine buffer (pH 7.5).

pRIT10640, 25 pg, was digested with BamHI to excise the 1,350 bp BamHI fragment of HBV DNA. The 1,350 bp fragment was purified by preparative agarose gel electrophoresis and electroelution. The eluted DNA was removed and concentrated by ethanol precipitation and dissolved in 20 µl of 0.01 M tromethamine buffer (pH 7.0). A 0.3 pg aliquot of the BamHI fragment containing the HBsAg coding sequence was mixed with 0.5 pg of BglII-cut pMC200 and the mixture was ligated by incubation with T4 DNA ligase.

The ligated DNA was used to transform competent cells of E. coli K12 strain MM294. Transformants were selected on agar plates containing 200 pg/ml ampicillin. Twelve resistant colonies were isolated by serial passage on ampicillin agar and plasmids were isolated by the method described by Birnboim et al., Nucl. Acid. Res., Vol. 7, 1513 (1979). Analysis by agarose gel electrophoresis showed that all plasmids were cleaved by HpaI, an indication of insertion of the BamHI fragment and that both orientations of that fragment were present among twelve transformed colonies. The plasmids were isolated by CsCl-ethidium bromide density gradient centrifugation. A plasmid pRIT10671 contained the BamHI fragment fused at the Bglll point in the correct orientation for transcription of the HBsAg coding sequence yielding a 386 amino acid fusion protein consisting of 18 N-! terminal amino acids of OCT, 42 amino acids of the putative<1>HBsAg precursor protein and the 226 amino acids of HBsAg. The fusion protein is HBsAg as shown in Example 8 below. Transformants containing pRIT106 71 are called E. coli K12 strain MM294(pRIT10671). pRIT10671 is illustrated in Figure 5.

Use of pRIT106 as an intermediate plasmid is not essential. E.g. the BamHI fragment could be excised from pRIT10616.

Another plasmid, pRIT10672, contained the BamHI fragment in the wrong orientation for transcription of the HBsAg coding sequence. Trans formants containing this plasmid are called E. coli K12 strain MM294(pRIT10672).

Example 6

Preparation of plasmids, pRIT10673 and pRIT10674 shuttle vectors, by combining pRIT10671 and pRIT10672 with shuttle vector YEpl3.

Vector YEpl3 is an E. coli- S. cerevisiae shuttle vector. It is described by Broach et al, Gene, vol. 8, 121 (1979).

It was provided by J. Hicks, Cold Spring Harbor Laboratories, New York, USA. A small HindIII fragment was excised from the plasmid by digestion with HindIII and the plasmid was religated to produce a derivative plasmid, YEpl3 HindIII containing a single HindIII site. Purified YEpl3 HindIII was digested with HindIII and treated with alkaline phosphatase to inhibit religation. DNA was recovered by phenol extraction and ethanol precipitation.

Purified pRIT10671 and pRIT10672 were digested with BamHI and treated with alkaline phosphatase to inhibit new formation of the pBR322 residue. The treated DNA was further digested with HindIII to release a 4,650 bp HindIII fragment, containing the regulatory region-HBsAg gene fusion, and samples were extracted with phenol and precipitated with ethanol. The DNA preparations derived from pRIT106 71 and pRIT106 72, 0.4 µg of each, were separately mixed with 0.4 µg of HindIII fragmented YEpl3 HindIII and the mixtures were incubated with T4 DNA ligase.

A portion of each of the ligated mixtures was used to transform competent cells of E. coli K12 strain MM2 94. Transformants were selected on amphicillin agar. Transformant colonies were isolated and examined for plasmid content by the method described by Birnboim et al., Nucl. Acid. Res., Vol. 7, 1513 (1979). One transformant colony, E. coli K12 strain MM294(pRITi10673), contained a plasmid, pRIT10673, containing the HindIII fragment from pRIT106 71 inserted into YEpl3 HindIII, in the correct orientation as illustrated in Figure 6. Another transformant colony, E .coli K12 strain MM294 (pRIT10674), contained a plasmid pRIT10674 containing the HindIII fragment from pRIT10672 inserted into YEpl3 HindIII in the wrong orientation.

Example 7

Transformation of yeast with pRIT10673 and pRIT10674.

Plasmids pRIT10673 and pRIT10674 were isolated from clarified lysates of E. coli K12 strain MM294(pRIT10673) and MM294 (pRIT10674) by CsCl-ethidium bromide density gradient centrifugation.

A. S. cerevisiae strain DC5.

The S. cerevisiae strain DC5 (leu 2-3, leu 2-112, his 3, can 1-11) described by Broach et al., Gene, vol. 8, 121 (1979) was obtained from J. Hicks, Cold Spring Harbor Laboratories, New York, U.S.A. and was deposited under the EPC provisions and the Budapest Treat at the American Type Culture Collection in Rockville, Maryland, U.S.A. June 2, 1982 under accession number ATCC 206 30. Cells of strain DC5 were cultured and prepared for transformation by the methods described by Hinnen et al., Proe. Nati. Acad. Pollock. U. S. A., Volume 75,

1929 (1978) except that protoplastization was carried out in 0.8 M sorbitol, 0.03 M (3-mercaptoethanol, and 0.1 M potassium phosphate buffer (pH 7.5) using a mixture of (3- gluco-

uronidase (0.24 units/ml final concentration) and aryl-sulfatase (1.2 units/ml final concentration). Yeast protoplasts were incubated separately with 10 µg pRIT10673 and 10 µg pRIT106 74 and transformants were selected in regeneration

agar that lacked leucine. Colonies growing in the regeneration agar were isolated and streaked onto solid medium containing 0.6 75% yeast nitrogen base medium lacking amino acids, 2% glucose, 2% agar and 80 µg/ml histidine and were grown at 30°C. A colony of strain DC5 had been transformed with pRIT106 73 and is called S. cerevisiae strain DC5 (pRIT10673). Another colony had been transformed with pRIT10674 and is called S. cerevisiae strain DC5(pRIT10674).

Cultures of strains DC5(pRIT10673) and DC5(pRIT10674) were grown in yeast nitrogen base medium plus 80 µg/ml histidine to optical densities of 0.33 to 1.0 at 620 µm. The latter strain can be used as a negative control because it contains the HBsAg coding sequence fused in the wrong orientation to the regulatory region. Cells were isolated by centrifugation, washed with phosphate-buffered saline (PBS) and resuspended in 5 ml PBS plus 1mM phenylmethylsulfonyl fluoride (PMSF) at 20- to 160-fold concentrations. Cells were broken by two passages through a French pressure cell at 83 MPa and the lysate centrifuged at 7,700 x G for 15 minutes and then for 30 minutes at 30,000 x G. The supernatants were isolated and filtered over a Millex GV membrane.

Supernatants were examined for the presence of protein reacting with specific anti-HBsAg antibodies by "Ausria" radioimmunological assay methods. Cleared cell extracts from S. cerevisiae strain DC5(pRIT10673) prepared in this way gave positive reactions in this radiological immunological assay even at 16 to 256 fold dilutions in PBS. In contrast, extracts of strain DC5(pRIT10674) were negative in this assay for the presence of proteins that react with anti-HBsAg antibodies.

l

B. S. cerevisiae strain lcl6 9 7d

S. cerevisiae strain lcl697d was deposited under the EPC provisions and the Budapest Treaty with the American Type Culture Collection on June 2, 1982 under accession number ATCC 2 06 3-1. Using the methods described above, arginine bradytroph strain lcl69 7d ( argJ -, leu 2-1 ) was transformed with pRIT10673 and pRIT10674. A leucine-independent colony of the bradytrophic strain had been transformed with pRIT10673 and is called S. cervisiae strain lcl697d(pRIT-10673). Another leucine-independent colony that had been transformed with pRIT106 74 is called S. cerevisiae strain lcl697d(pRIT10674).

Cultures of strains lcl697d(pRIT10673) and lcl697d(pRIT-106 74) were grown in yeast nitrogen base medium supplemented with 20 µg/ml arginine. The cells were isolated and the cell extract prepared as described above. Cleared cell extracts of strain lcl697d(pRIT10673) gave positive results in the "Ausria" radioimmunoassay at dilutions up to 1/2048, while extracts of strain lcl697d(pRIT10674) were consistently negative in this assay.

From these results it can be concluded that yeast cells of the strains DC5 and lcl697d transformed with pRIT10673 specifically synthesize HBsAg in the form of a fusion protein with HBsAg determinants.

Example 8

Immunization of rabbits with HBsAg from S. cerevisiae strain lc! 697d (pRITl0673).

S. cerevisiae strain lcl697d(pRIT10673) was grown to an optical density at 620 µm of 0.60 and isolated by centrifugation. The cells were resuspended at a 40-fold concentration in PBS plus 1 ml PMSF. A clarified cell extract was prepared as described in Example 7. A clarified cell extract of strain lcl697d(pRIT10674) was prepared in a similar manner. These extracts were used to immunize rabbits. A first group of six rabbits received parenteral injections with 1 ml of extract from strain lcl697d (pRITl0673) mixed with 1 ml of Freund's "complete adjuvant"

on days 0, 9, 15, 30 and 37. A second group of three rabbits received parenteral injections of 1 ml extract from strain lcl697d(pRIT10674) mixed with 1 ml Freund's "complete adjuvant" on the same days. Sera were obtained from both groups on days 0 (pre-immune), 23, 51 and 65, and from the first group on day 44, and examined for the presence of anti-HBsAg antibodies using the "Ausab" radioimmunological assay. The results of these measurements given in table 1 show that 4 out of 6 rabbits receiving injections of extract from strain lcl697d(PRIT10673) produced antibodies directed against HBsAg. None of the three control rabbits that received injections of extract from strain lcl697d(pRIT10674) showed signs of production of anti-HBsAg antibodies. From these results, it can be concluded that extracts of strain lcl697d(pRITl0673) contain HBsAg, which can be used in a vaccine to stimulate protection against HBV infection in humans without serious side effects.

Example 9 Preparation of plasmid, pRIT10749 containing arg3 regulatory region from pMC200.

Purified pMC200 was digested with HincII and electrophoresed on a 10% acrylamide gel. A 1,940 bp fragment containing the arg3 regulatory region was isolated from the gel by electroelution and ethanol precipitation. About. 4 µg of the fragment was incubated with 0.2 units of Bal31 exonuclease for 1 to 3 seconds at 30°C in 100 µl of buffer (pH 8.0) containing 12.5 mM MgCl2, 12.5 mM CaCl2, 200 mM NaCl, 1 mM EDTA and 200 mM tromethamine-HCl. The treated DNA was extracted with phenol and precipitated with ethanol. A 1 µg aliquot was incubated with T4 DNA polymerase in the presence of deoxynucleotide triphosphates to repair all single-stranded ends and then digested with EcoRI endonuclease. This procedure yielded DNA fragments of varying length due to resection with Bal31. Each fragment had a fixed EcoRI stretch on one end with the other extremity truncated and located some distance from the original HincII site and the OCT protein injection codon. Fragments of approx. 1,480 bp containing arg3 regulatory region was isolated by electrophoresis on a 7.5% acrylamide gel followed by electroelution and ethanol precipitation. This backsplitting regulatory region is preferred because it can provide transcription leading to the synthesis of a protein without OCT amino acid sequences as described in Example 10 below.

In a second series of reactions, pMC200 was digested with XbaI and

The 5' single-stranded ends were filled in, or left truncated, by incubation with T4 DNA polymerase and deoxynucleotide triphosphates. This DNA was digested with EcoRI and a large EcoRi-T4/XbaI fragment of approx. 5,700 bp containing yeast DNA sequences located 3' to the XbaI point, plus pBR322 sequences, were purified by electrophoresis, electroelution and ethanol precipitation. This fragment was mixed with and ligated to 1,480 bp promoter-containing fragments. IN

The ligation mixture was used to transform competent cells of E. coli K12 strain MM294. Transformants were selected on ampicillin agar. Plasmid DNA was isolated from trans-formant colonies by the method described by Birnboim et al., Nucl. Acid. Res., volume 7, 1513, (1979) and it was investigated whether an Xbal point was present at refraction with Xbal. One

XbaI point was present only in such plasmids where the filled XbaI point on a fragment from the second series of reactions was ligated to another fragment from the first series ending in a 3' T residue to restore an XbaI recognition sequence, TCTAGA, in a new position. A plasmid with an XbaI point was identified as pRIT10749. A flowchart illustrating these manipulations can be found in Figure 6. E. coli Kl2 strain MM2 9 4 (pRIT10749) was deposited under the EPC provisions and the Budapest Treaty at the American Type Culture Collection, Rockville, Maryland, U.S.A. of June 2, 1982 under accession number ATCC 39133.

A sample of pRIT10749 was digested with a combination of BstEII and XbaI. The size of the deleted arg 3 regulatory region was estimated to be approx. 210 bp in comparison with pMC200 which was similarly digested with BstEII and XbaI and by reference to the known molecular weights of fragments of phage(£)xl74 DNA described by Fuchs et al. Genes, Volume 4, 1,

(1978).

To determine the DNA sequence of the BstEII-XbaI fragment of pRIT10749, plasmid DNA was used with BstEII, marked with

3 2

Y-P-ATP by replacement and cleaved with Bam HI endonuclease to release a 2000 bp fragment that was purified by electroelution and ethanol precipitation. DNA sequencing of the labeled fragment was performed according to the chemical modification method described by Maxam et al., Methods in Enzymology, vol. 65, 499 (1980). Part of this sequence was found to be CCCATCAACTTGTACACTCGT CTAGA. The underlined nucleotides were from the 5700 bp EcoRI-T4/XbaI fragment. Comparison with the correct region of the DNA sequence shown in fig. 4 indicates that the restored XbaI site is located in the 5' untranslated leader region nine nucleotides upstream of the original HincII site in the pMC200 Yeast DNA insert.

EXAMPLE 10.

Preparation of plasmids, pRIT10759 and pRIT10761, containing BHsAg and regulatory regions, by combining pRIT10749 with pRIT10601

pRIT10601 was digested with Hhal endonuclease and electrophoresed on a 7.5% acrylamide gel. A 1100 bp fragment was isolated by electroelution and ethanol precipitation. The DNA sequence of part of this fragment contains sequences corresponding to the known N-terminal amino acid sequence of BHsAg of the ayw serotype as described by Peterson et al., Viral Hepatitis, G.N. Vyas, S.N. Cohen and R. Schmid, Eds., Franklin Institute Press, Philadelphia, U.S.A., 1978, p. 569. The fragment contains 6 nucleotides located 5' to the BHsAg start codon, the complete HBsAg coding sequence and approx. 390 3' untranslated nucleotides....Ii

DNA of plasmid pRITI10749 was digested with XbaI and approx. 400 ng 1 of this DNA was mixed with approx. 280 ng of the purified Hhal fragment. The mixture was incubated with 0.5 units of T4 DNA polymerase for 30 min at 37°C in 20 µl of buffer (pH 7.5) containing 20 mM tromethamine-HCl, 10 mM MgCl 2 , 1 mM dithiothreitol and 3 3 mM of each of dATP, dCTP, dGTP and dTTP. To this reaction mixture was added 2.5 µl of 1 mM ATP, 2.5 µl of 10 mM EDTA and 2 µl (2 units) of T4 DNA ligase, and the mixture was incubated for 16 hours at 15°C.

The ligated mixture was used to transform competent cells of E_. coli K12 strain MM294 as selection was made for ampicillin-resistant transformants. Plasmid preparations were made from several of these transformants and analyzed by restriction endonuclease digestion and gel electrophoresis. The results showed that the truncated HBV fragment was inserted in both possible orientations in the XbaI-broken pRIT10749. One such plasmid, pRIT10761 contained the 1100 bp insert in the correct orientation for transcription of the HBsAg sequence from the arg<3-> promoter and yielded a 271 bp fragment after sequence digestion with BstEII and XbaI. This is illustrated in fig. 7. Another plasmid, pRIT10759 contained the insert in the wrong orientation and gave rise to an estimated 1175 bp fragment after digestion with a combination of BstEII and YbaI endonucleases. The nucleotide sequence at the arg 3 regulatory HBsAg insert was examined for pRIT10761 by sequencing the 271 bp BstEII-XbaI fragment using the chemical modification methods of Maxam et al., Methods in Enzymology, Vol. 65, 499 (1980), after replacement labeling of the XbaI end with γ~ 32 P-ATP. The measured sequence for the arg 3 regulatory region - HBsAg junction is TACACTCGTCTACTGAAC ATG. It can be seen that the XbaI restriction site was not completely repaired by the T4 DNA polymerase and that a guanm residue was lost. The arg 3 untranslated leader region is immediately followed by 6 nucleotides of HBV origin, CTGAAC, followed by the HBsAg initiation codon, ATG, and the coding sequence for the HBsAg structural gene. The HBsAg initiation codon is the first initiation codon found downstream of the arg 3 promoter. Therefore, translation of mRNA transcripts written from DNA will begin at that codon and the HBsAg that is synthesized will lack external amino acid residues. The HBsAg that is synthesized is not a fusion protein; it is essentially structurally identical to authentic HBsAg.

EXAMPLE 11

Preparation of plasmid pRIT10764 and pRIT10765 by combining pRIT10761 with YEpl3 HindIII.

PRIT10761 and pRIT10759 were separately digested with Pstl and BamHI

to destroy the pBR322 replicon remnant and then with HindIII to release the DNA fragment with inserted HBV DNA and the regulatory region. The DNAs were extracted with phenyl, precipitated with ethanol and dissolved in buffer (pH 7.5) containing 0.01 M tromethamine-HCl and 0.001 ff EDTA. A 0.6 µg portion of each DNA preparation was separately mixed with 0.3 µg of HindIII-digested, alkaline phosphatase-treated DNA from YEpl3 HindIII prepared as described above and the mixture was ligated.

The ligated mixture was used to transform competent cells of E± coli K12 strain MM294 with selection being made for ampicillin-resistant transformants. One transformant was shown to contain a plasmid, pRIT10764, consisting of the HindIII fragment from pRIT10761 inserted into YEpl3HindIII. A further transformant was shown to contain a plasmid, pRIT10765, consisting of the HindIII fragment from pRIT10759 inserted into YEp 13HindIII. A flow diagram illustrating the preparation of pRIT10761 and pRIT10764 can be found in Fig. 7.

EXAMPLE 12

Transformation of yeast with pRTI10764 and pRIT10765

pRIT10764 and pRIT10765 were isolated from cultures of transformants prepared in Example 11 by CsCl-ethidium bromide density gradient centrifugation, and 10 µg of each was used to transform cells of yeast strain lcl697d as described in

example 7 when selection was made for leucine-independent transformants on regeneration agar. One leucine-unav-

adherent colony derived from these transformants is called strain lcl697d(pRIT10764). Another transformant is called S. cerevisiae strain lcl697d(pRIT10765). Cultures of these strains were grown at 30°C in yeast nitrogen base medium supplemented with 2% glucose and 20 µg/ml arginine to an optical density at 620 µm of 0.80 to 0.88. Cells were harvested and cell-free extracts were prepared and measured for HBsAg by "Austria" radioimmunoassay as described in Example 7. Extracts of lcl697d(pRIT10764) gave positive results

in this assay at dilutions in PBS of up to 1/1024, while undiluted extracts from strain lcl697d(pRIT10765) were consistently negative in this assay. From the genetic and radioimmunological material it is concluded that cells of S^cerevisiae strain lcl697d(pRIT10764) synthesize HBsAg which can be used in a vaccine to stimulate protection against HBV infections in humans without serious side effects.

Claims (30)

1. Method for the production of a recombinant DNA molecule containing a nucleotide sequence which can code for HBsAg and which can be expressed in yeast, characterized by connecting a nucleotide sequence which can code for HBsAg with a regulatory region originating from 3 the yeast's arg gene. 2. Method according to claim 1, characterized in that the HBsAg sequence is connected in a position in relation to the regulatory region so that HBsAg is synthesized by expression of the HBsAg sequence without extraneous amino acid residues. 3. Method according to claim 1, characterized in that the regulatory region is formed from breaking pYe ura3 arg3 with a restriction endonuclease. 4.. Method according to claim 1, characterized in that the regulatory region is formed from breaking pYE ura3 arg3 with HindIII restriction endonuclease during production of a 3300 bp yeast DNA fragment containing the arg3 gene. 5. Method according to claim 1, characterized in that the HBsAg sequence and the regulatory region are inserted into a vector. 6. Method according to claim 1, characterized in that HBV DNA is treated with BamHI restriction endonuclease to produce the HBsAg sequence. 7. Method according to claim 5, characterized in that a BamHI fragment from HBV is inserted into DNA extracted from Dane particles of adw serotype in Bglill- point to a HindIII fragment of the regulatory region prior to insertion into a vector. 8. Method according to claim 5, characterized in that one inserts an Hhal fragment derived from a connected pair of BamHI fragments of HBV DNA extracted from Dane particles of ayw serotype in the XbaI point of the vector which is a 1480 bp fragment of pMC200 containing the regulatory region and with an EcoRI stretch on one end and terminating in a 3' T residue on the other end which is blunted, ligated with a 5700 bp XbaI-EcoRI fragment of pMC200 after DNA polymerase repair of The XbaI point in the 5700 bp fragment. 9. Method according to claim 6, characterized in that a BamHI fragment of HBV DNA extracted from Dane particles of adw serotype is connected to the regulatory region. 10. Method according to claim 6, characterized in that an Ilhal fragment derived from a connected pair of BamHI fragments of HBV DNA extracted from Dane particles of ayw serotype is connected to the regulatory region. 11. Method according to claim 7, characterized in that the HindIII fragment is first inserted into pBR322. 12. Method according to claim 7, characterized in that the HindIII fragment containing the HBsAg insert and the regulatory region is further released by treatment with HindIII and the HindIII fragment is inserted into a yeast vector. 13. Method according to claim 8, characterized in that one processes the connected 1480 bp-5700 ; ! bi β fragments with HindIII to excise a HindIII fragment carrying the HBsAg sequence and regulatory region and insert the HindIII fragment into a yeast vector. 14. Method according to claim 9, characterized in that the BamHI fragment is inserted into the Bglll point of the regulatory region. 15. Method according to claim 10, characterized in that one connects the HhaI fragment with the regulatory region at the XbaI point to a 1480 bp fragment of pMC200 containing the regulatory region and with an EcoRI extension at one end and terminating in a 3 <1> T- residue at the other end ligated to a 5700 bp XbaI-EcoRI fragment of pMC200 after polymerase repair of the XbaI point in the 5700 bp fragment. 16. Method according to claim 11, characterized in that the HindIII fragment containing the HBsAg sequence and the regulatory region is released by treatment with HindIII and the HindIII fragment is inserted into a yeast vector. 17. Method according to claim 13, characterized in that the yeast vector is YEpl3 which has previously been modified by excision of a HindIII fragment. 18. i1' Method according to claim 16, characterized in that the yeast vector used is YEpl3 which has been previously modified by excision of a HindIII fragment. 19. Method for the production of HBsAg, characterized in that a recombinant DNA molecule comprising a nucleotide sequence that can code for HBsAg and a regulatory region derived from the yeast arg3 gene that can cause transcription of the HBsAg sequence in yeast is inserted into yeast cells, the yeast is cultivated and isolates the HBsAg that is produced. 20. Method for producing HBsAg according to claim 19, characterized in that HBsAg-seqkn-_ sen is placed in such a way in relation to the regulatory region that HBsAg is synthesized by expression of the HBsAg sequence essentially without extraneous amino acid residues. 21. Method for producing HBsAg according to claim 1, characterized in that the HBsAg sequence is a BamHI fragment of HBV DNA extracted from Dane particles of adw serotype and inserted into the Bglll point of the yeast regulatory region. 22. Process for the production of HBsAg according to claim 1, characterized in that as HBsAg an Hhal fragment derived from a connected pair of BamHI fragments of HBV DNA extracted from Dane particles of ayw serotype and inserted into the Xbal point in a molecule with the 1480 bp fragment joined to a 5700 bp XbaI-EcoRI fragment of pMC200 after polymerase repair of the XbaI point in the 5700 bp fragment, and where the regulatory region is a 1480 bp fragment of pMC200 with an EcoRI stretch on one end and ending in a 3 <1> T-residue on the other end which is blunted. 23. Method according to claim 19, characterized in that S. cerevisiae strain DC5 or lcl697d is used as yeast. 24. Method according to claim 20, characterized in that J3 is used as yeast. cerevisiae strain DC5 or lcl697d. 25. Method according to claim 21, characterized in that S. cerevisiae strain DC5 or lcl697d is used as yeast. 26. Method according to claim 21, characterized in that the arginine biosynthesis pathway is derepressed in the yeast. 27. Method according to claim 22, characterized in that the arginine biosynthesis pathway is derepressed in the yeast. 28. Method according to claim 22, characterized in that S_ is used as yeast. cerevisiae strain lcl697d. 29. Method for producing a vector comprising the yeast arg_3 regulatory region and a restriction point close to this so that a protein synthesized by expression of a coding sequence inserted in the restriction point lacks foreign amino acid residues, characterized by assembling the regulatory region, which is a 148o bp fragment of pMC200 with an EcoRI stretch on one end and ending in a 3' T residue on the other end that is blunted, with a 5700 bp XbaI-EcoRI fragment of pMC200 after polymerase repair of the XbaI point of the 5700 bp fragment. 30. Method for producing a hepatitis B virus vaccine, characterized in that HBsAg is produced by a method according to claims 19 - 29.