NL2034045B1 - Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof - Google Patents

Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof Download PDF

Info

Publication number
NL2034045B1
NL2034045B1 NL2034045A NL2034045A NL2034045B1 NL 2034045 B1 NL2034045 B1 NL 2034045B1 NL 2034045 A NL2034045 A NL 2034045A NL 2034045 A NL2034045 A NL 2034045A NL 2034045 B1 NL2034045 B1 NL 2034045B1
Authority
NL
Netherlands
Prior art keywords
strain
primer group
primer
epidemic
identification
Prior art date
Application number
NL2034045A
Other languages
Dutch (nl)
Inventor
Zhang Jing
Liu Liangbo
Zhou Xia
Liu Yang
Deng Xingmei
Wang Yong
Zhang Hui
Wang Zhen
Guo Jia
Zhang Yu
Original Assignee
Univ Shihezi
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Univ Shihezi filed Critical Univ Shihezi
Priority to NL2034045A priority Critical patent/NL2034045B1/en
Application granted granted Critical
Publication of NL2034045B1 publication Critical patent/NL2034045B1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a primer group and a kit for identifying a Bruce/la epidemic 5 strain and an 82 strain by an LAMP method and application thereof, and belongs to the technical field of molecular biology. In the present invention, a primer includes two outer primers F3 and B3, and two inner primers FIP and BIP, wherein the inner primer FIP has a nucleotide sequence shown in SEQ ID NO. 1; the inner primer BIP has a nucleotide sequence shown in SEQ ID NO. 2; the outer primer F3 has a nucleotide sequence shown in SEQ ID NO. 3; and the outer primer 10 B3 has a nucleotide sequence shown in SEQ ID NO. 4. In the present invention, the LAMP method is adopted for identification, and a Bruce/la epidemic strain in Xinjiang and an 82 vaccine strain can be effectively identified.

Description

PRIMER GROUP, KIT AND METHOD FOR IDENTIFYING BRUCELLA EPIDEMIC STRAIN IN
XINJIANG AND S2 STRAIN AND APPLICATION THEREOF
Technical Field
The present invention belongs to the technical field of Brucella molecular identification, and particularly relates to a primer group, a kit and a method for identifying a Brucella epidemic strain in Xinjiang and an S2 strain and application thereof.
Background Art
Brucellosis is an animal - derived infectious disease which seriously harms the health of people and livestock. After people are infected, persistent infection will occur, “wave heat” and multi - system functional damage might be caused. Severe infection may cause disability and even endanger life. Chronic infection cannot be fundamentally cured. In recent years, the epidemic situation of people and livestock of Brucellosis has rebounded around the world, and has shown in sustained growth trend. Vaccines are the most effective and economical means for preventing and controlling Brucellosis, such as S2-90 which is a live attenuated vaccine independently developed in China and has good immune protection and provides a fundamental material for preventing and controlling Brucellosis. However, S2-90 cannot effectively distinguish natural infection and vaccine immunity and may interfere with quarantine of brucellosis, so that S2-90 cannot be widely applied. It is extremely urgent to establish an effective Brucellosis identification diagnosis method for distinguishing natural infection and vaccine immunity.
Summary of the Invention
In view of this, the present invention provides a primer group, a kit and a method for identifying a Brucella epidemic strain in Xinjiang and an S2 strain and application thereof, and aims to solve the above technical problems.
The present invention provides a primer group for identifying a Brucella epidemic strain in
Xinjiang and an S2 strain. The primer group includes an inner primer pair having nucleotide sequences shown as SEQ ID NO. 1 - 2 and an outer primer pair having nucleotide sequences shown as SEQ ID NO. 3 - 4.
The present invention provides a kit for identifying the Brucella epidemic strain and the S2 strain, and the kit includes the primer group.
The present invention provides a method for identifying the Brucella epidemic strain and the 82 strain, and the method includes: obtaining a to-be-detected DNA sample; performing PCR reaction by the primer group according to claim 1 or 2; and determining the source of the to - be - detected DNA sample according to the PCR reaction result.
The present invention provides application of the primer group in identifying the Brucella epidemic strain in Xinjiang and the S2 vaccine strain.
By adopting the primer group, the kit and the method for identifying the Brucella epidemic strain in Xinjiang and the S2 strain and the application thereof provided by the present invention, the operation is simple and fast, and the identification project can be performed within about 1 h. The method provided by the present invention is good in specificity, and high in sensitivity.
Brief Description of the Drawings
FIG. 1 is a diagram of verifying LAMP specificity by calcein (1 is S2; 2 is a positive control of a Brucella 027 strain; 3 is Salmonella; 4 is Escherichia coli; 5 is S2; and 6 is Ochrobactrumy; and
FIG. 2 illustrates detection electrophoresis of samples with different concentrations after amplification by an LAMP method (M is DNA Marker 1000; 1 is a negative control; 2 is 75 ng/ul; 3is 7.5 pg/l; 4 is 750 pg/pl; 5 is 75 pg/ul; 8 is 7.5 fg/pl; 7 is 750 fg/ul; 8 is 75 fg/ul; 9 is 7.5 ag/ul; 10 is 750 ag/ul; 11 is 75 ag/kl; and 12 is 7.5 ag/ul).
Detailed Description of the Invention
The present invention provides a primer group for identifying a Brucella epidemic strain and an S2 strain by an LAMP method. The primer group includes two outer primers Fz and Bs; and two inner primers FIP and BIP, wherein the inner primer FIP has a nucleotide sequence shown in SEQ ID No. 1; the inner primer BIP has a nucleotide sequence shown in SEQ ID No. 2; the outer primer F3 has a nucleotide sequence shown in SEQ ID No. 3; and the outer primer B: has a nucleotide sequence shown in SEQ ID No. 4.
In the present invention, the inner primer FIP has a nucleotide sequence shown as SEQ ID
No. 1, and the specific sequence is shown as follows:
TGAGAACTTGAACGCGGCCAGTCGCCATGGCTTCAATGC.
In the present invention, the inner primer BIP has a nucleotide sequence shown as SEQ ID
No. 2, and the specific sequence is shown as follows:
TTGTTCGAAACGGTTGCTGCCCGAGGGACGCATAGACGATA.
In the present invention, the outer primer F3 has a nucleotide sequence shown as SEQ ID
No. 3, and the specific sequence is shown as follows: CCGAGGTTCTGCCTTCC.
In the present invention, the outer primer Bs has a nucleotide sequence
CTGGAGCGTCTTCTTGTCG shown as SEQ ID No. 4.
The present invention provides a kit for identifying the Brucella epidemic strain in Xinjiang and the S2 strain by the LAMP method. The kit includes the primer group in the above solution, an MgSO: solution, a dNTP solution, a betaine solution, a BST DNA enzyme solution and deionized water.
In the present invention, the concentration of the outer primers and the inner primers is independently and preferably 25 um/l. In the present invention, the outer primers and the inner primers are synthesized by Shanghai XY Biotechnology Company.
In the present invention, the concentration of MgSO. is preferably 6 mmol/l. The present invention has no special limitation on the source of MgSO., and it can be a conventional commercially available product in the field. In the present invention, the concentration of dNTP is preferably 7 mmol/l. In the present invention, the dNTP is purchased from Beijing CoWin
BioSciences. In the present invention, the concentration of betaine is preferably 3 mmol/l. The present invention has no special limitation on the source of betaine, and it can be the conventional commercially available product in the field.
In the present invention, every 25 Jl of reaction system includes the following components: 0.4 pl of the outer primers in the above solution, 2.8 ul of the inner primers in the above solution, 2.5 pl of MgSO,, 1.75 pl of dNTP, 2.0 pl of betaine, 1 pl of BST DNA enzyme and the balance deionized water.
The present invention provides a detection method of the kit in the above solution for identifying the Brucella epidemic strain in Xinjiang and the S2 strain. The detection method includes the following steps: 1) extracting DNA of a to - be - detected bacterium to obtain a DNA template; and 2) mixing 2 Jl of the DNA template in the step 1) with the primer group, the MgSO; solution, the dNTP solution, the betaine solution, the BST DNA enzyme solution and deionized water, carrying out an LAMP reaction, and determining a detection result after the reaction, wherein the LAMP reaction is performed under the conditions that: amplification is performed at a constant temperature of 64.1 - 84.9°C for 60 min, and then the temperature is increased to 80 - 81°C, and the reaction is terminated; and 3) adding 2 ul of the DNA template in the step 1) into the reaction system in the above solution, performing amplification at 64.1 - 84.9°C for 60 min, increasing the temperature to 80 - 81°C, and terminating the reaction.
In the present invention, the DNA of the to - be - detected bacterium is extracted to obtain the DNA template. In the present invention, a method for extracting the DNA of the to - be - detected bacterium is preferably to extract by a bacterial genome DNA extraction kit. The present invention has no special limitation on the source of the extraction kit, and it can be the conventional commercially available product in the field. In an embodiment of the present invention, it is purchased from Beijing Tiangen Biotechnology Stock Company. In the present invention, the method for extracting the DNA of the to - be - detected bacterium is carried out according to a kit specification.
In the present invention, after the DNA template is obtained, 2 pl of the DNA template is mixed with the primer group, the MgSO, solution, the dNTP solution, the betaine solution, the
BST DNA enzyme solution and deionized water for the LAMP reaction, and a detection result is determined after the reaction is finished; the LAMP reaction is performed under the conditions that amplification is performed at the constant temperature of 64.1 - 64.9°C for 60 min, then the temperature is increased to 80 - 81°C, and the reaction is terminated. In the present invention, the amplification temperature is preferably 64.7°C. The reaction termination temperature is preferably 80.5°C. In the present invention, when the DNA template is added to the reaction system, preferably 1 ul of calcein is also added, and the detection result is determined through colour change after the reaction is terminated. Or the detection result can be determined by detection through 3% agarose gel electrophoresis. In the present invention, the calcein is purchased from Beijing Lanpu Bio - tech Company. Agarose powder for agarose gel is purchased from Hong Kong BD Company.
The present invention provides application of the kit in the above solution for identifying the
Brucella epidemic strain in Xinjiang and the S2 strain.
In order to further explain the present invention, the technical solutions provided by the present invention are described in detail below in combination with the embodiments, but they cannot be understood as limiting the scope of protection of the present invention.
i xml versicn=Nl, ON encoding=TUTFE-8" 7 2 <!DOCTYPE ST26SequenceListing PUBLIC "-//WIPO//DTD Sequence Listing 1.3//EN" "ST26Sequencelisting V1 3.dtd"> 3 <3T268equencebisting drdVersion=YV1 3" filsName="Brucella X82 NL Segldist. aml” soïtwaceNems=*WIPO Sagueance? soitwareVersion="2.2.0% productions ie=vR0233-08~28">
A <Applicatioconidentiiflcatlon> <IPOfficeCode>NL</IPOfficelode> & <ApplicationNumerTezt></ApplicetionNumberText»> 7 <FiliogDate></FilingDaLter 8 </Ppplicationidentification> 3 <Bpplicant¥FileReference>WAY-Brucella XS2</ApplicantFileReferencer <Applicantiame languagelode="en">Shihezi University</ApplicantName>
Ld <InventionTlitle languagalode="an">PRIMER GROUP, KIT AND METHOD FOR IDENTIFYING
BRUCELLA EPIDEMIC STRAIN IN XINJIANG AND S2 STRAIN AND APPLICATION
THEREOF/InventionTitie»>
LE <BequencetotalQuantityr>4</SequenceTotalfuantity> 13 <SequernceData seguancaiDNumbhao="1%> id <INSDSeqg> is <INSDSeq length>39</INSDSeq length> 18 <INSDSeq moltype>DNA-/INSDSeg moltype>
Lj ZINSDSeq division>PAT</INSDSeq division» <INSDSeq feabure-table>
Le <INSDFesature> <INSDFeature key>source</INSDFeature key>
Zl <INSDFeature location>l..39</INSDFeature locations ze <INSDFealurse guals> 22 <INSDOQualifier» 24 <IN3DQualifier namedmol type</INSDQualifisr name> <INSDQualifier value>other DNA</IN3DGualifier value> 26 </INSDQuali fier» 27 <INSDQuaiifier id="g2"> 23 <INSDOQualifier namerorganism</INSDQualifier name> a <INSDoualifier value>unidentified</INSDQualifier valuex> </INSDOualifier> 21 </IN3DFeature gualsd 32 </INSDFeature> u 33 </INSDSeg features table» 34 <INSDSeq segquence>tgagaacttgaacgcggccagtecgccatggettcaatge</INSDSeg sequenc e> u u </INSDSear> 38 </SaquenceData> 27 “SequenceData seguencellNMumber="27> 28 <INSDSeg> 38 <INSDSeg length>41</INSDSeq length> <IN3DSeq moltype>DNA</INSDSeq moltyper
AL <INSDSeq division>PAT</INSDSeg division» 4% <INSDSeq feature-table> 43 <INSDFeature> 44 <INSDFeaturs keyrsource</INSDFeaturs key» <INSDFeature location>l..41</INSCFeature location» dh <INSDFeature guels> 477 <INSDOQualifier> 48 <IN3DQualifier name>mol type“/INSDQuali fier name> 48 <INSDQualifier valuerother DNA</INSDQualifier value»
Bi </INSDOualifier>
SL <INSDQualifler ia=’gs">
SY <INSDQualifier name>organism</INSDQualifier name> 52 <INSDOualifier valuerunidentified«/INZDCualifier value» 54 </INSDQualifier> u 35 </INSDFeature guals> 58 </INSDFeatura> 57 </INSDSeu feature-table> 5 <INSDSeq sequsncerttgttegaaacggttgetgcccgagggacgcatagacgata“/INSDSeq zeque nce> 53 </INSDSeo> a0 </SeguenceData> al <SeguenceData sapuencelDNumber="3%">
Ge <INSDSedg> 3 <INSDSeq length>17</INSD3eq lengths
G4 <INSDSeq molitype>DNA</IN3DSeq moltype>
Gh <INSDSeq division>PAT</INSDSeq division» 55 <INSDSeq [eatureriabie> av <INSDFeaturer» 58 <IN3DFeature keyrsource</INSDFeature key> as <IN3DFeature lowation>l..17</INSDFeaturs location»
FO <INSDFeature guals>
FL <INSDOualifier> vz <INSDOQualifier name>mol type</INSDQualifier name>
TE <INSDQualifler valverother DNA</INSDQualifier value»
Ta </INSDQualifiers>
Th <INSDOQualifier id="q8"> jd <IN3DQualifier namevorganism“/INSDQualifier name> 7 <INSDgvalifier valuevunidentified</INSDQualifier valued ia </INSDQuali fier»
VES </INSDFearure quals> ao </INSDFeature> a1 </INSDSeg feature-table> di <INSDSeq sequsnceveegaggttetgeecttee</INSDSeg sequenca> 82 </INEDSey> £4 </SeguenceData> <SeguenceData semuenceIDNumber="gn>
Se <INSDSedg> 57 <INSDSeq length>19</INSD3eq lengths <INSDSeq moltype>DNA</INSDSegq moltype>
Gh <INSDSeq division>PAT</INSDSeq division»
D4 <INSDSeq feature-iable> 33 <INSDFeaturer» 32 <IN3DFeature keyrsource</INSDFeature key> 33 <IN3DFeature lovation>l..19</INSDFeature Locations» 84 <INSDFeature guals>
Sn <INSDOualifier>
Gf <INSDOQualifier name>mol type</INSDQualifier name>
OF <INSDQualifler valverother DNA</INSDQualifier value» 38 </INSDOualifier> 33 <INSDOQualifier id="q8"> 140 <IN3DQualifier namerorganism</INSDQualifiesr name> 101 <INSDQualifier value>unidentified</INsSDoualifier valuer 102 </INSDQualifier» u 1073 </INSDFeature quals> 104 </IN3DFeature>
LOE </INSDSeg feature-table> 108 <INSDSeq sequence>ctggagegtecttettgteg</INSDSeg sequencer 107 </INSDSeo> ine </SeguenceData> ine </5T268eguencalisting>

Claims (10)

CONCLUSIESCONCLUSIONS 1. Een primergroep voor de identificatie van een epidemische Brucella-stam in Xinjiang en een S2-stam, welke primergroep een binnenprimerpaar met nucleotidesequenties zoals 5 weergegeven als Seq Id nrs. 1 - 2 en een buitenprimerpaar met nucleotidesequenties weergegeven als Seq Id nrs. 3 — 4 omvat.1. A primer group for the identification of an epidemic Brucella strain in — 4 includes. 2. De primergroep volgens conclusie 1, waarbij een te detecteren monster onder toepassing van de primergroep door middel van de LAMP-methode wordt onderworpen aan PCR- vermeerdering.The primer group according to claim 1, wherein a sample to be detected is subjected to PCR amplification using the primer group by means of the LAMP method. 3. Een samengestelde set voor de identificatie van een epidemische Brucella-stam en de S2- stam, die de primergroep volgens conclusie 1 omvat.A composite kit for the identification of an epidemic Brucella strain and the S2 strain, comprising the primer group according to claim 1. 4. De samengestelde set volgens conclusie 3, waarbij de concentratie van het buitenprimerpaar en het binnenprimerpaar onafhankelijk van elkaar 25 uM bedraagt.The composite set according to claim 3, wherein the concentration of the outer primer pair and the inner primer pair is independently 25 µM. 5. De samengestelde set volgens conclusie 4, waarbij elk systeem van 25 ul 0,5 pl van de buitenprimers en 3,5 ul van de binnenprimers bevat.The assembled kit of claim 4, wherein each 25 µl system contains 0.5 µl of the outer primers and 3.5 µl of the inner primers. 6. Een werkwijze voor de identificatie van de epidemische Brucella-stam in en de S2-stam, welke werkwijze omvat: — het verkrijgen van een te detecteren DNA-monster; — het uitvoeren van een PCR-reactie met de primergroep volgens conclusie 1; en — het bepalen van de bron van het te detecteren DNA-monster aan de hand van het resultaat van de PCR-reactie.6. A method for the identification of the epidemic Brucella strain in and the S2 strain, which method comprises: — obtaining a DNA sample to be detected; - carrying out a PCR reaction with the primer group according to claim 1; and — determining the source of the DNA sample to be detected based on the result of the PCR reaction. 7. De werkwijze voor de identificatie volgens conclusie 8, waarbij de PCR-reactie wordt uitgevoerd onder de volgende omstandigheden: — het uitvoeren van amplificatie bij een constante temperatuur van 63,9 - 64,7°C gedurende 55 minuten, gevolgd door — het verhogen van de temperatuur tot 80 - 81°C waarbij de reactie wordt beëindigd.The identification method according to claim 8, wherein the PCR reaction is carried out under the following conditions: - performing amplification at a constant temperature of 63.9 - 64.7°C for 55 minutes, followed by - increasing the temperature to 80 - 81°C terminating the reaction. 8. De werkwijze voor de identificatie volgens conclusie 6, waarbij de detectie wordt uitgevoerd door middel van elektroforese met een 3%'s agarose gel.The identification method according to claim 6, wherein the detection is carried out by electrophoresis with a 3% agarose gel. 9. De werkwijze voor de identificatie volgens conclusie 6, waarbij de werkwijze verder omvat:The method of identification according to claim 6, wherein the method further comprises: — het toevoegen van 1 pl calceïne in een PCR-reactiesysteem, en — het bepalen van het detectieresultaat door kleurverandering nadat de reactie is beëindigd.— adding 1 µl of calcein into a PCR reaction system, and — determining the detection result by color change after the reaction has ended. 10. Toepassing van de primergroep volgens conclusie 1 bij de identificatie van de epidemische Brucella-stam en de S2-stam.Use of the primer group according to claim 1 in the identification of the epidemic Brucella strain and the S2 strain.
NL2034045A 2023-01-30 2023-01-30 Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof NL2034045B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
NL2034045A NL2034045B1 (en) 2023-01-30 2023-01-30 Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
NL2034045A NL2034045B1 (en) 2023-01-30 2023-01-30 Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof

Publications (1)

Publication Number Publication Date
NL2034045B1 true NL2034045B1 (en) 2023-09-11

Family

ID=85222211

Family Applications (1)

Application Number Title Priority Date Filing Date
NL2034045A NL2034045B1 (en) 2023-01-30 2023-01-30 Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof

Country Status (1)

Country Link
NL (1) NL2034045B1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103276061A (en) * 2013-04-28 2013-09-04 华南农业大学 Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof
CN109055589A (en) * 2018-10-08 2018-12-21 石河子大学 A kind of LAMP method identifies brucella epidemic strain and S2 plants of primer, kit and its application

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103276061A (en) * 2013-04-28 2013-09-04 华南农业大学 Kit having LAMP nucleic acid test strips and used for detecting brucella spp., and application thereof
CN109055589A (en) * 2018-10-08 2018-12-21 石河子大学 A kind of LAMP method identifies brucella epidemic strain and S2 plants of primer, kit and its application

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
W. PAN ET AL: "Development and Application of the Novel Visual Loop-Mediated Isothermal Amplification of Omp25 Sequence for Rapid Detection of Brucella sp.", JOURNAL OF ANIMAL AND VETERINARY ADVANCES, vol. 10, no. 16, 1 January 2011 (2011-01-01), pages 2120 - 2126, XP055447312 *

Similar Documents

Publication Publication Date Title
CN111020049B (en) Rapid constant-temperature detection method, primer group and kit for staphylococcus aureus
Bueschel et al. Prevalence of cpb2, encoding beta2 toxin, in Clostridium perfringens field isolates: correlation of genotype with phenotype
CN107012131B (en) Manganese peroxidase, gene thereof and application of manganese peroxidase in mycotoxin detoxification
Keto-Timonen et al. Efficient DNA fingerprinting of Clostridium botulinum types A, B, E, and F by amplified fragment length polymorphism analysis
Cimon et al. Molecular epidemiology of airway colonisation by Aspergillus fumigatus in cystic fibrosis patients
CN110709512A (en) Manganese peroxidase, gene thereof and application of manganese peroxidase in mycotoxin detoxification
NL2034045B1 (en) Primer group, kit and method for identifying brucella epidemic strain in xinjiang and s2 strain and application thereof
CN113293225A (en) Primer probe combination capable of specifically recognizing aspergillus, penicillium and fusarium and application thereof
CN110172526B (en) Kit for rapidly identifying toxigenic genotype of fusarium graminearum and application thereof
CN104911275B (en) A kind of bacterial vaginitis detection kit
CN102154477B (en) LAMP (Loop-mediated Isothermal Amplification) kit for detecting mycoplasma hyopneumoniae and preparation method thereof
NL2034043B1 (en) Primer group, kit and method for identifying brucella epidemic strain and m5 strain and application thereof
CN113046476A (en) Primer composition and kit for rapidly detecting N501Y mutation of novel coronavirus
CN110541043A (en) Kit for detecting African trypanosoma brucei and application thereof
Luther et al. Elucidation of the DNA sequence of Streptococcus uberis adhesion molecule gene (sua) and detection of sua in strains of Streptococcus uberis isolated from geographically diverse locations
CN116926214A (en) Primer, kit and method for detecting cheese bacillus paracasei based on polymerase spiral amplification technology
CN111676305A (en) Specific LAMP primer, kit and method for detecting escherichia coli
KR101828574B1 (en) Polymerase chain reaction primer sets for detecting salmonella and method for simultaneous detection of multiple species of salmonella using the same
CN106868147B (en) Molecular detection primer for sigatoka bacteria and rapid detection method thereof
CN111593048B (en) Primer combination, kit, amplification method and application in A19 vaccine detection
CN114032336A (en) Method and kit for detecting cucumber mosaic virus
CN111088377A (en) Rapid constant-temperature detection method of staphylococcus aureus, primer group and application
CN110616270A (en) COI gene sequence-based molecular identification method of beta and beta
CN114045331B (en) Primer for multiplex PCR identification of Bungarus Parvus medicinal material, standard decoction and traditional Chinese medicine formula particles, application thereof and identification method
CN104975094B (en) A kind of for diagnosing the test kit of colpitic gardnerella vaginalis