CN111676305A - Specific LAMP primer, kit and method for detecting escherichia coli - Google Patents

Abstract

The invention discloses a specific LAMP primer, kit and method for detecting Escherichia coli. The kit includes 6 loop-mediated isothermal amplification primers: the 6 primers are F3, B3, FIP, BIP, LF and LB, respectively. The nucleotide sequence of F3 is shown in SEQ.ID.No.1, and the nucleotide sequence of B3 The nucleotide sequence of FIP is shown in SEQ.ID.N0.2, the nucleotide sequence of FIP is shown in SEQ.ID.N0.3, and the nucleotide sequence of BIP is shown in SEQ.ID.N0.4, The nucleotide sequence of LF is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6. The invention solves the problems that the existing Escherichia coli detection technology has a long period, high detection cost, and cannot be applied to on-site rapid detection.

Description

Specific LAMP primers, kits and methods for detecting Escherichia coli

technical field

The present invention relates to the field of microorganism detection, and more particularly, to specific LAMP primers, kits and methods for detecting Escherichia coli.

Background technique

Escherichia coli is a commensal bacteria that commonly exists in the gastrointestinal tract of humans and animals, mainly parasitic in the large intestine, accounting for about 0.1% of the intestinal bacteria. Pathogenic Escherichia coli gastrointestinal infections are an important cause of diarrheal outbreaks worldwide, especially in developing countries. With the widespread occurrence of food-borne diseases caused by Escherichia coli, Escherichia coli has become an important detection target for food safety. Therefore, a rapid, sensitive and reliable detection method for E. coli is of great significance for preventing the outbreak of food-borne diseases caused by E. coli.

At present, there are three main types of E. coli detection in food, namely traditional microbial culture identification method, immunological detection method and PCR detection method. Traditional microbial culture is based on bacterial isolation and culture, morphological identification and biochemical reaction to identify bacterial species, with simple operation and high accuracy. However, there are problems such as long culture time and cumbersome operation, so its application is severely limited. Immunological detection methods have good specificity and sensitivity, but there are problems such as long time for antibody preparation and difficult preservation of antibodies. Polymerase chain reaction (PCR) technology has good specificity and sensitivity, and has been widely used in the detection of Escherichia coli. However, this method requires expensive instruments and professional operators, and is not suitable for on-site testing. Therefore, there is an urgent need to develop a rapid, sensitive and reliable detection method for Escherichia coli.

Loop-mediated isothermal amplification (LAMP) is a new nucleic acid amplification technology established by Japanese scholar Notomi et al. in 2000. Its principle is that Bst DNA polymerase with strand displacement activity The original chain is replaced while the new chain is synthesized, thereby preparing a template for the next round of amplification. The amplification process does not require steps such as denaturation and annealing, and can be completed under isothermal conditions. After 20 years of development, this technology has the advantages of strong specificity, high sensitivity, short reaction time, visualization of reaction results, and portable operation. It has a good application prospect in the clinical rapid detection and diagnosis of pathogenic bacteria or diseases.

SUMMARY OF THE INVENTION

The purpose of the present invention is to provide a loop-mediated isothermal amplification primer set, kit and method for detecting Escherichia coli, and design and synthesize 6 specific LAMP primers according to the Escherichia coli fecA gene (GenBank ID: M63115.1) to carry out For detection, the results can be interpreted by adding fluorescent dyes or amplification products to the reaction system and performing agarose gel electrophoresis. The detection method is simple in operation, short in time, high in sensitivity and strong in specificity.

The present invention provides a loop-mediated isothermal amplification (LAMP) primer for detecting Escherichia coli, comprising 6 primers, and the 6 primers are designed for the conserved sequence of Escherichia coli fecA gene (GenBank ID: M63115.1); The 6 primers include F3, B3, FIP, BIP, LF and LB, the nucleotide sequence of F3 is shown in SEQ.ID.No.1, and the nucleotide sequence of B3 is shown in SEQ.ID.No.2 , the nucleotide sequence of FIP is shown in SEQ.ID.No.3, the nucleotide sequence of BIP is shown in SEQ.ID.No.4, and the nucleotide sequence of LF is shown in SEQ.ID.NO.5 The nucleotide sequence of LB is shown in SEQ.ID.NO.6.

The present invention also provides a loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli, including: 40uM F3 0.08μL, 40uM B3 0.08μL, 100uM FIP 0.32μL, 100uM BIP 0.32μL, 80uM 0.1 μL of LF, 0.1 μL of 80uM LB, F3 and B3, FIP and BIP, and LF and LB are loop-mediated isothermal amplification primers, the nucleotide sequence of F3 is shown in SEQ.ID.NO.1, and the nucleotide sequence of B3 The nucleotide sequence is shown in SEQ.ID.NO.2, the nucleotide sequence of FIP is shown in SEQ.ID.NO.3, the nucleotide sequence of BIP is shown in SEQ.ID.NO.4, and the nucleotide sequence of LF is shown in SEQ.ID.NO.4. The nucleotide sequence of LB is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6.

In the above-mentioned loop-mediated isothermal amplification (LAMP) kit for detecting E. coli, 10×IsothermalAmplification Buffer 2μL, 8U/μL Bst2.0 DNA polymerase 1μL, 100mM MgSO ₄ 0.8μL, 5M betaine 0.8μL, 10 mM dNTPs 2.4 μL and 0.8 μL fluorescent dye, 10×Isothermal Amplification Buffer reaction buffer containing 100 mM potassium chloride, 100 mM ammonium sulfate, 200 mM pH8.8 Tris-HCl, 1% Triton X 100, 20 mM magnesium sulfate.

In the above-mentioned loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli, the fluorescent dye is an aqueous solution of calcein with a final concentration of 16 mM/L.

The present invention also provides a method for detecting Escherichia coli, comprising: extracting genomic DNA of a sample to be detected; constructing a reaction system comprising the following primers: F3, B3, FIP, BIP, LB and LF, wherein the nucleotide sequence of F3 As shown in SEQ.ID.No.1, the nucleotide sequence of B3 is shown in SEQ.ID.N0.2, the nucleotide sequence of FIP is shown in SEQ.ID.N0.3, and the nucleotide sequence of BIP is shown in SEQ.ID.N0.3. The sequence is shown in SEQ.ID.NO.4, the nucleotide sequence of LF is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6; carry out the amplification reaction ; The presence of E. coli is determined by the color change of the fluorescent dye.

The present invention has the following advantages:

(1) The LAMP detection method for detecting Escherichia coli provided by the present invention has designed 6 LAMP-specific primers for rapid amplification and detection of Escherichia coli-specific gene fecA (GenBank ID: M63115.1), so that they have higher specificity .

(2) The minimum detection limit of the LAMP detection method for detecting Escherichia coli provided by the present invention is 5×10 ¹ copies/μL, which is 100 times of the sensitivity of the conventional PCR detection method.

(3) The LAMP detection method for detecting Escherichia coli provided by the present invention is simple to operate, takes a short time, does not require expensive equipment, and is suitable for on-site detection of Escherichia coli.

The reaction result of the invention is simple to detect: by adding the fluorescent dye calcein in the reaction system, the result can be judged by the color change of the reaction system after the reaction, and no lid opening detection is required, thereby effectively preventing the generation of false positive results. In the conventional LAMP method, SYBR Green 1 fluorescent dye needs to be opened after the reaction to achieve visual color development (positive results are yellow-green, negative results are light orange), which is prone to false positive results.

Description of drawings

Figure 1 shows the observation results of adding the fluorescent dye calcein after the loop-mediated isothermal amplification (LAMP) reaction. 1-3 are E. coli recombinant plasmids (PUC57-M63115.1), E. coli (ATCC8739), and E. coli (ATCC 35150), respectively, N: negative control (sterilized water).

Figure 2 is a schematic diagram of the visualization results of the LAMP specificity experiment. Legend: 1-21 are Escherichia coli recombinant plasmids (PUC57-M63115.1), Escherichia coli (ATCC 8739), Escherichia coli (ATCC 8739), Proteus mirabilis (CVCC1969), Streptococcus uberis (ATCC700407), stop lactation Streptococcus (ATCC12388), Streptococcus agalactiae (ATCC13813), Staphylococcus aureus (CVCC545), Streptococcus pneumoniae (ATCC13883), Staphylococcus epidermidis (ATCC12228), Candida albicans (ATCC 10231), Candida albicans (ATCC 90028) , Pseudomonas aeruginosa (ATCC 15442), Salmonella typhi (ATCC14028), Legionella (ATCC 33152), Shigella sonnei (ATCC 25931), beta-hemolytic streptococcus (CMCC3221), Vibrio parahaemolyticus (CICC) 21528), Salmonella (CICC 2150), Clostridium perfringens (ATCC 13214), Listeria monocytogenes (ATCC 19114). N: Negative control (sterilized water).

Figure 3 is a schematic diagram of the results of PCR-specific gel electrophoresis experiments. In the legend, M: DL 2000 DNA Mark, 1-21 are the positive control E. coli recombinant plasmid (PUC57-M63115.1), E. coli (ATCC 8739), E. coli (ATCC8739), Proteus mirabilis (CVCC1969), uddermis Coccus (ATCC700407), Streptococcus dysgalactiae (ATCC12388), Streptococcus agalactiae (ATCC13813), Staphylococcus aureus (CVCC545), Streptococcus pneumoniae (ATCC13883), Staphylococcus epidermidis (ATCC12228), Candida albicans (ATCC10231), white Candida (ATCC90028), Pseudomonas aeruginosa (ATCC 15442), Salmonella Typhi (ATCC14028), Legionella (ATCC33152), Shigella Sonnei (ATCC 25931), Beta Hemolytic Streptococcus (CMCC 3221), Para Vibrio haemolyticus (CICC21528), Salmonella (CICC 2150), Clostridium perfringens (ATCC 13214), Listeria monocytogenes (ATCC19114). N: Negative control (sterilized water).

Figure 4 is a visualization of the LAMP sensitivity experiment. Legend: 1-8 are E. coli plasmids diluted to 5.0×10 ⁶ copies/μL, 5.0×10 ⁵ copies/μL, 5.0×10 ⁴ copies/μL, 5.0×10 ³ copies/μL, 5.0×10 ² copies, respectively /μL, 5.0×10 ¹ copies/μL, and 5.0×10 ⁰ copies/μL were used as templates, and N was the negative control (sterilized water).

Figure 5 is a graph showing the results of the PCR reaction sensitivity experiment. Legend: M: DL 2000 DNA Mark, 1-8 are E. coli plasmids diluted to 5.0×10 ⁶ copies/μL, 5.0×10 ⁵ copies/μL, 5.0×10 ⁴ copies/μL, 5.0×10 ³ copies/μL, respectively μL, 5.0×10 ² copies/μL, 5.0×10 ¹ copies/μL, and 5.0×10 ⁰ copies/μL were used as templates, and N was the negative control (sterilized water).

Detailed ways

The following examples may enable those skilled in the art to more fully understand the present invention, but do not limit the present invention in any way.

The loop-mediated isothermal amplification primer set for detecting Escherichia coli, including the following 6 primers, SEQ.ID.NO.1-6 are given in order: F3 and B3, FIP and BIP, and LF and LB; nucleosides of LF The acid sequence is shown in SEQ.ID.NO.5, the nucleotide sequence of LB is shown in SEQ.ID.NO.6, the nucleotide sequence of F3 is shown in SEQ.ID.NO.1, and the core of B3 is shown in SEQ.ID.NO.1. The nucleotide sequence is shown in SEQ.ID.NO.2, the nucleotide sequence of FIP is shown in SEQ.ID.NO.3, the nucleotide sequence of BIP is shown in SEQ.ID.NO.4, and the primer sequence is shown in SEQ.ID.NO.4. as follows:

The present invention also provides a kit comprising the above primers. In addition, the kit includes 2 μL of 10× Isothermal Amplification Buffer, 1 μL of 8 U/μL Bst 2.0 DNA polymerase, 0.8 μL of 100 mM MgSO ₄ , 0.8 μL of 5M betaine, 2.4 μL of 10 mM dNTPs, and 0.8 μL of Calcein (25×).

The 10×Isothermal Amplification Buffer reaction buffer contains 100 mM potassium chloride, 100 mM ammonium sulfate, 200 mM pH8.8 Tris-HCl, 1% Triton X 100, and 20 mM magnesium sulfate.

Calcein is a fluorescent dye, and it is an aqueous solution of calcein with a final concentration of 16 mM/L.

The present invention also provides a loop-mediated isothermal amplification method for detecting Escherichia coli, comprising the following steps:

(1) Extract the DNA of the sample to be detected;

The bacteria to be tested were cultured with broth medium overnight, 1 ml of bacterial culture solution was drawn, placed in a 1.5 ml centrifuge tube, and centrifuged at 12,000 rpm for 2 min, and the supernatant was discarded. Add 100-120 μL of sterilized water to the centrifuge tube, vortex to mix, heat in boiling water at 95-100 °C for 10 min, and then centrifuge at 12,000 rpm for 2-4 min. Pipette the supernatant into a new centrifuge tube as the template to be tested.

(2) The following combinations were premixed, including 3 pairs of primers F3 and B3, FIP and BIP, and LF and LB in a 20 μL loop-mediated isothermal amplification reaction system.

Set up a loop-mediated isothermal amplification (LAMP) reaction system: pipette 10×Isothermal AmplificationBuffer 2μL, 40uM F3 0.08μL, 40uM B3 0.08μL, 100uM FIP 0.32μL, 100uM BIP 0.32μL, 80uM LF 0.1μL, 80uM LB 0.1μL, 8U/μL Bst 2.0 DNA polymerase 1μL, 100Mm MgSO ₄ 0.8μL, 5M betaine 0.8μL, 10Mm dNTP 2.4μL, test sample DNA 1μL, 0.8μL calcein (25×) in EP tube The nucleotide sequence of LF is shown in SEQ.ID.NO.5, the nucleotide sequence of LB is shown in SEQ.ID.NO.6, and the nucleotide sequence of F3 is shown in SEQ.ID.NO.6. The acid sequence is shown in SEQ.ID.NO.1, the nucleotide sequence of B3 is shown in SEQ.ID.NO.2, the nucleotide sequence of FIP is shown in SEQ.ID.NO.3, and the core of BIP is shown in SEQ.ID.NO.3. The nucleotide sequence is shown in SEQ.ID.NO.4;

(3) The prepared Escherichia coli LAMP reaction system was placed in a constant temperature metal bath, first reacted at 65°C for 30 minutes, and then reacted at 85°C for 2 minutes to inactivate the Bst 2.0 DNA polymerase enzyme to terminate the reaction.

(4) After the end of the LAMP reaction, the negative/positive test results can be interpreted by fluorescence chromogenic method and agarose gel electrophoresis method respectively:

① After the reaction, observe whether the color of the loop-mediated isothermal amplification system changes. If the color of the loop-mediated isothermal amplification reaction system changes to yellow-green, it is a positive reaction, indicating the presence of Escherichia coli in the sample to be tested; If the color of the isothermal amplification reaction system is light orange, it is a negative reaction, indicating that there is no E. coli in the sample to be tested.

②Agarose gel electrophoresis detects the amplification product. If the amplification product of the gradient band is obtained, the sample to be tested contains Escherichia coli; if there is no amplification band, the sample to be tested does not contain Escherichia coli.

Positive control and negative control were set up respectively during the detection. Escherichia coli recombinant plasmid (PUC57-M63115.1), Escherichia coli (ATCC 8739) and Escherichia coli (ATCC8739) were used as positive controls, and sterilized water was used as negative control. When judging the results, compare with the positive control and the negative control respectively. If the loop-mediated isothermal amplification reaction system corresponding to the test object and the amplification reaction system corresponding to the positive control are both yellow-green, it is determined that the test object is to be tested. The test result of the object is positive. If the loop-mediated isothermal amplification system corresponding to the test object and the amplification reaction system corresponding to the negative control are both light orange, the test result of the test object to be tested is determined to be negative.

The detection method of the present invention is based on the loop-mediated isothermal amplification technique.

In the present invention, LAMP-specific primers including outer primers (F3 and B3), inner primers (FIP and BIP) and loop primers (LF and LB) are designed for Escherichia coli fecA gene (GenBank: M63115.1). The sample DNA and the established LAMP reaction system were added to a 1.5ml centrifuge tube, placed in a constant temperature metal bath and heated at 65°C for 30min, and then reacted at 85°C for 2min to terminate the reaction. The presence or absence of Escherichia coli in the sample was determined by observing the color change of the reaction system. Experiments have shown that the detection method has a minimum detection limit of 5 copies/μL, which provides a rapid, specific and sensitive method for the detection of Escherichia coli.

1. Design and synthesis of LAMP primers

According to the present invention, the E. coli fecA gene (GenBank: M63115.1) published in the GenBank database is used as the target gene, and it is determined as the E. coli-specific gene after query and alignment in GenBank. Design LAMP-specific primers according to the target gene.

According to the design principle of LAMP primers, the present invention takes the highly conserved gene sequence of Escherichia coli fecA gene (GenBank: M63115.1) as the target gene, and designs 6 LAMP primers, including forward/reverse inner primers (FIP/BIP) , forward/reverse outer primer (F3/B3) and forward/reverse loop primer (LF/LB). The primers were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd. The sequences of the six primers are as follows:

SEQ.ID.NO.1: SA-F3: ACGACGTATTTGAACATGCTGG

SEQ.ID.NO.2: SA-B3: AAGGGGACGGGGATGCC

SEQ.ID.NO.3: SA-FIP:GACGCCAGGGATGCGGTTA-TTTTCCGCCGTGAGGATTTCG

SEQ.ID.NO.4: SA-BIP: CCACGACCTGGCGATGAACTT-TTTCCATCAGGACGGTCGAGC

SEQ.ID.NO.5:SA-LF:ACCTCACGCATGGTGGTTG

SEQ.ID.NO.6: SA-LB: TTGGCATCCGGGGCCT

2. Extraction of bacterial genomic DNA from the sample to be tested

The bacteria to be tested were cultured with broth medium overnight, 1 ml of bacterial culture liquid was drawn, placed in a 1.5 ml centrifuge tube, and centrifuged at 12,000 rpm for 2 min, and the supernatant was discarded. Add 100-120 μL of sterilized water to the centrifuge tube, vortex to mix, heat in boiling water at 95-100 °C for 10 min, and then centrifuge at 12,000 rpm for 2-4 min. Pipette the supernatant into a new centrifuge tube as the template to be tested.

3. Construction of LAMP reaction system (20 μL)

The 10×Isothermal Amplification Buffer reaction buffer contains 100 mM potassium chloride, 100 mM ammonium sulfate, 200 mM pH8.8 Tris-HCl, 1% Triton X 100, and 20 mM magnesium sulfate.

The enzyme was Bst 2.0 DNA polymerase with 8 activity units per microliter and a final concentration of 320 U/μL.

The fluorescent dye was an aqueous solution of calcein with a final concentration of 16 mM/L. 10×Isothermal Amplification Buffer reaction buffer and Bst 2.0 DNA polymerase were purchased from New England Biolabs.

4. Detection of Amplification Products

The recombinant plasmids and various standard strains were cultured overnight, and the total genomic DNA of the recombinant plasmids and standard strains was extracted and added to the reaction system as amplification templates. The reaction process was as follows: The prepared LAMP reaction system was placed in a constant temperature metal bath. React at ℃ for 30 min, and then react at 85 ℃ for 2 min to inactivate Bst 2.0 DNA polymerase to terminate the reaction.

A fluorescent dye was added to the LAMP reaction system before the reaction, and the color change of the LAMP reaction system was observed with the naked eye. The reaction system was yellow-green as a positive result, and light orange as a negative result (see Figure 1).

The reaction system will form a large amount of pyrophosphate during nucleic acid amplification. Before the amplification reaction, manganese ions in calcein bind to calcein resulting in fluorescence quenching, and the dye color is light orange. When a large amount of pyrophosphate ions are generated during the amplification process, manganese ions combine with pyrophosphate ions to form manganese pyrophosphate to release calcein. The free calcein can autofluoresce to generate a fluorescent signal, and the color of the dye changes to yellow-green. That is, the LAMP reaction amplifies a large amount of DNA, and the addition of calcium-yellow green reacts with a yellow-green color.

5. LAMP specificity experiments

The recombinant plasmids of Escherichia coli (PUC57-M63115.1), Escherichia coli (ATCC 8739), Escherichia coli (ATCC8739) and Proteus mirabilis (CVCC1969), Streptococcus uberis (ATCC700407), Streptococcus dysgalactiae (ATCC12388), Streptococcus (ATCC13813), Staphylococcus aureus (CVCC545), Streptococcus pneumoniae (ATCC13883), Staphylococcus epidermidis (ATCC12228), Candida albicans (ATCC10231), Candida albicans (ATCC90028), Pseudomonas aeruginosa (ATCC 15442) ), Salmonella Typhi (ATCC 14028), Legionella (ATCC33152), Shigella Sonnei (ATCC 25931), Beta-hemolytic Streptococcus (CMCC 3221), Vibrio parahaemolyticus (CICC21528), Salmonella (CICC 2150), Clostridium perfringens (ATCC 13214), Listeria monocytogenes (ATCC19114) (all ATCC strains used in the present invention were purchased from the American Culture Collection, CVCC strains were purchased from the China Forestry Microorganisms Collection and Management Center, CMCC The bacterial strains were all purchased from the China Medical Microorganism Culture Collection and Management Center, and the CICC strains were purchased from the China Microorganism Culture Collection and Management Center) genomic DNA as a reaction template, and the LAMP detection was established according to the above reaction system and conditions. LAMP detection method, specific test. The E. coli recombinant plasmid (PUC57-M63115.1) and the genomic DNA of the E. coli standard strain were set as positive controls, and 18 non-target strains and sterilized water were set as negative controls. The results showed that only the reaction system of the E. coli recombinant plasmid (PUC57-M63115.1) and the genome of the E. coli standard strain showed positive reactions, and the rest were negative (see Figure 2). The PCR-specific reaction results showed that the E. coli recombinant plasmid (PUC57-M63115.1) and the genome of the E. coli standard strain appeared bright bands, and the rest did not appear bands (see Figure 3).

6. LAMP Sensitivity Experiment

The plasmid containing the E. coli fecA gene was diluted 10-fold to 5.0×10 ⁶ copies/μL, 5.0×10 ⁵ copies/μL, 5.0×10 ⁴ copies/μL, 5.0×10 ³ copies/μL, 5.0×10 ² copies/μL, 5.0×10 ¹ copies/μL, and 5.0×10 ⁰ copies/μL were used as templates for sensitivity test, and sterilized water was used as negative control. Sensitivity of the detection method. The results show that the detection limit of E. coli LAMP can reach 5×10 ¹ copies/μL (see Figure 4), and the minimum detection limit of PCR method is 5×10 ³ copies/μL (see Figure 5). The LAMP assay is 100 times more sensitive than the PCR assay.

Those skilled in the art should understand that the above embodiments are only exemplary embodiments, and various changes, substitutions and alterations may be made without departing from the spirit and scope of the present application.

sequence listing

<110> Ningxia University

<120> Specific LAMP primers, kits and methods for detecting Escherichia coli

<130> HP200297LZ

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 1

acgacgtatt tgaacatgct gg 22

<210> 2

<211> 17

<212> DNA

<213> Artificial Sequence

<400> 2

aaggggacgg ggatgcc 17

<210> 3

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 3

gacgccaggg atgcggttat tttccgccgt gaggatttcg 40

<210> 4

<211> 42

<212> DNA

<213> Artificial Sequence

<400> 4

ccacgacctg gcgatgaact ttttccatca ggacggtcga gc 42

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 5

acctcacgca tggtggttg 19

<210> 6

<211> 16

<212> DNA

<213> Artificial Sequence

<400> 6

ttggcatccg gggcct 16

Claims (5)

1. a loop-mediated isothermal amplification (LAMP) primer for detecting Escherichia coli, is characterized in that, comprises 6 primers, and described 6 primers are directed to the conservative sequence design of Escherichia coli fecA gene (GenBank: M63115.1); The 6 primers include F3, B3, FIP, BIP, LF and LB, the nucleotide sequence of F3 is shown in SEQ.ID.No.1, and the nucleotide sequence of B3 is shown in SEQ.ID.No.2. The nucleotide sequence of FIP is shown in SEQ.ID.No.3, the nucleotide sequence of BIP is shown in SEQ.ID.No.4, and the nucleotide sequence of LF is shown in SEQ.ID.NO.5 As shown, the nucleotide sequence of LB is shown in SEQ.ID.NO.6. 2. A loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli, characterized in that, comprising: F30.08μL of 40uM, B30.08μL of 40uM, FIP 0.32μL of 100uM, BIP 0.32μL of 100uM, 80uM LF 0.1μL, 80uM LB 0.1μL, F3 and B3, FIP and BIP, and LF and LB are loop-mediated isothermal amplification primers, the nucleotide sequence of F3 is shown in SEQ.ID.NO.1, B3 The nucleotide sequence of FIP is shown in SEQ.ID.NO.2, the nucleotide sequence of FIP is shown in SEQ.ID.NO.3, and the nucleotide sequence of BIP is shown in SEQ.ID.NO.4, The nucleotide sequence of LF is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6. 3. The loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli according to claim 2, further comprising 2 μL of 10 × Isothermal Amplification Buffer, 1 μL of 8U/μL _Bst2.0 DNA polymerase, 100 mM MgSO 0.8 μL, 5M Betaine 0.8 μL, 10 mM dNTPs 2.4 μL and 0.8 μL Fluorescent Dye in 10× Isothermal Amplification Buffer Reaction Buffer containing 100 mM KCl, 100 mM Ammonium Sulfate, 200 mM pH8.8 Tris-HCl, 1% Triton X 100 , 20mM magnesium sulfate. 4. The loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli according to claim 3, wherein the fluorescent dye is an aqueous solution of calcein with a final concentration of 16 mM/L. 5. A method for detecting Escherichia coli, comprising: Extract the genomic DNA of the sample to be tested; Construct a reaction system including the following primers: F3, B3, FIP, BIP, LB and LF, wherein the nucleotide sequence of F3 is shown in SEQ.ID.No.1, and the nucleotide sequence of B3 is shown in SEQ.ID. No.2, the nucleotide sequence of FIP is shown in SEQ.ID.No.3, the nucleotide sequence of BIP is shown in SEQ.ID.No.4, and the nucleotide sequence of LF is shown in SEQ.ID .NO.5, the nucleotide sequence of LB is shown in SEQ.ID.NO.6; carry out an amplification reaction; The presence or absence of E. coli was determined by the color change of the reaction system.

Images