CN111676305A - Specific LAMP primer, kit and method for detecting escherichia coli - Google Patents
Specific LAMP primer, kit and method for detecting escherichia coli Download PDFInfo
- Publication number
- CN111676305A CN111676305A CN202010711226.8A CN202010711226A CN111676305A CN 111676305 A CN111676305 A CN 111676305A CN 202010711226 A CN202010711226 A CN 202010711226A CN 111676305 A CN111676305 A CN 111676305A
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleotide sequence
- escherichia coli
- fip
- bip
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific LAMP primer, a kit and a method for detecting escherichia coli. The kit comprises 6 loop-mediated isothermal amplification primers: the 6 primers are F3, B3, FIP, BIP, LF and LB, respectively, the nucleotide sequence of F3 is shown in SEQ.ID.N0.1, the nucleotide sequence of B3 is shown in SEQ.ID.N0.2, the nucleotide sequence of FIP is shown in SEQ.ID.N0.3, the nucleotide sequence of BIP is shown in SEQ.ID.N0.4, the nucleotide sequence of LF is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6. The invention solves the problems that the existing escherichia coli detection technology is long in period, high in detection cost, incapable of being applied to on-site rapid detection and the like.
Description
Technical Field
The invention relates to the field of microbial detection, in particular to a specific LAMP primer, a kit and a method for detecting escherichia coli.
Background
Escherichia coli (Escherichia coli) is a commensal bacterium which is ubiquitous in the gastrointestinal tract of humans and animals, and mainly parasitizes in the large intestine, accounting for about 0.1% of intestinal bacteria. Pathogenic E.coli gastrointestinal infections are a significant cause of diarrhea outbreaks worldwide, particularly in developing countries. With the widespread occurrence of food-borne diseases caused by escherichia coli, escherichia coli has become an important detection object for food safety. Therefore, the rapid, sensitive and reliable escherichia coli detection method has important significance for preventing outbreak of food-borne diseases caused by escherichia coli.
At present, three main methods for detecting escherichia coli in food are the traditional microbial culture identification method, the immunological detection method and the PCR detection method. The traditional microbial culture is based on bacterial separation and culture, morphological identification and biochemical reaction to identify the bacterial species, and has simple operation and higher accuracy. However, the method has problems such as long culture time and complicated operation, and thus its application is severely limited. The immunological detection method has good specificity and sensitivity, but has the problems of long time for preparing the antibody, difficult storage of the antibody and the like. Polymerase Chain Reaction (PCR) technology has good specificity and sensitivity, and has been widely used in the detection of Escherichia coli. However, this method requires expensive equipment and specialized operators, and is not suitable for field testing. Therefore, the development of a rapid, sensitive and reliable method for detecting Escherichia coli is urgently required.
Loop-mediated isothermal amplification (LAMP) is a novel nucleic acid amplification technology established by Notomi et al, Japan, in 2000, and the principle is that Bst DNA polymerase with strand displacement activity displaces an original strand while synthesizing a new strand, so that a template is prepared for the next round of amplification, and the amplification process can be completed under isothermal conditions without the steps of denaturation, annealing and the like. Through the development of twenty years, the technology has the advantages of strong specificity, high sensitivity, short reaction time, visualized reaction result, portable operation and the like, and has good application prospect in clinical rapid detection and diagnosis of pathogenic bacteria or diseases.
Disclosure of Invention
The invention aims to provide a loop-mediated isothermal amplification primer group, a kit and a method for detecting escherichia coli, wherein 6 specific LAMP primers are designed and synthesized according to an escherichia coli fecA gene (GenBank ID: M63115.1) for detection, and result interpretation can be carried out by adding fluorescent dye or amplification products into a reaction system for agarose gel electrophoresis. The detection method has the advantages of simple operation, short time, high sensitivity and strong specificity.
The invention provides a loop-mediated isothermal amplification (LAMP) primer for detecting escherichia coli, which comprises 6 primers, wherein the 6 primers are designed aiming at a conserved sequence of an fecA gene (GenBank ID: M63115.1) of the escherichia coli; the 6 primers comprise F3, B3, FIP, BIP, LF and LB, wherein the nucleotide sequence of F3 is shown as SEQ.ID.N0.1, the nucleotide sequence of B3 is shown as SEQ.ID.N0.2, the nucleotide sequence of FIP is shown as SEQ.ID.N0.3, the nucleotide sequence of BIP is shown as SEQ.ID.N0.4, the nucleotide sequence of LF is shown as SEQ.ID.NO.5, and the nucleotide sequence of LB is shown as SEQ.ID.NO.6.
The invention also provides a loop-mediated isothermal amplification (LAMP) kit for detecting escherichia coli, which comprises: f30.08 mu L of 40uM, B30.08 mu L of 40uM, FIP 0.32 mu L of 100uM, BIP 0.32 mu L of 100uM, LF 0.1 mu L of 80uM, LB 0.1 mu L of 80uM, F3 and B3, FIP and BIP and LF and LB are loop-mediated isothermal amplification primers, the nucleotide sequence of F3 is shown as SEQ ID.NO.1, the nucleotide sequence of B3 is shown as SEQ ID.NO.2, the nucleotide sequence of FIP is shown as SEQ ID.NO.3, the nucleotide sequence of BIP is shown as SEQ ID.NO.4, the nucleotide sequence of LF is shown as SEQ ID.NO.5, and the nucleotide sequence of LB is shown as SEQ ID.NO. 6.
The loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli also comprises 10 × Isothermalamplification Buffer 2 μ L, 8U/. mu.L Bst2.0DNA polymerase 1 μ L, 100mM MgSO40.8. mu.L, 5M betaine 0.8. mu.L, 10mM dNTP 2.4. mu.L and 0.8. mu.L of a fluorescent dye, wherein 10 × Isotermal Amplification Buffer reaction Buffer contains 100mM chlorinePotassium chloride, 100mM ammonium sulfate, 200mM Tris-HCl pH8.8, 1% Triton X100, 20mM magnesium sulfate.
In the loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli, the fluorescent dye is calcein aqueous solution with the final concentration of 16 mM/L.
The invention also provides a method for detecting escherichia coli, which comprises the following steps: extracting the genomic DNA of a sample to be detected; constructing a reaction system comprising the following primers: f3, B3, FIP, BIP, LB and LF, wherein the nucleotide sequence of F3 is shown in SEQ.ID.N0.1, the nucleotide sequence of B3 is shown in SEQ.ID.N0.2, the nucleotide sequence of FIP is shown in SEQ.ID.N0.3, the nucleotide sequence of BIP is shown in SEQ.ID.N0.4, the nucleotide sequence of LF is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6; carrying out an amplification reaction; the presence or absence of E.coli is determined by the color change of the fluorescent dye.
The invention has the following advantages:
(1) the LAMP detection method for detecting the escherichia coli provided by the invention designs 6 LAMP specific primers for quickly amplifying and detecting the escherichia coli specific gene fecA (GenBank ID: M63115.1), so that the primers have higher specificity.
(2) The LAMP detection method for detecting escherichia coli provided by the invention has the lowest detection limit of 5 × 101copies/. mu.L, 100 times the sensitivity of the conventional PCR detection method.
(3) The LAMP detection method for detecting the escherichia coli provided by the invention is simple to operate, short in time consumption, free of expensive equipment and suitable for field detection of the escherichia coli.
The reaction result of the invention is simple to detect: by adding the fluorescent dye calcein into the reaction system, the result can be judged through the color change of the reaction system after reaction, cover opening detection is not needed, and the generation of false positive results is effectively prevented. In the conventional LAMP method, after the reaction is finished, a cover is opened, and SYBR Green 1 fluorescent dye is added to achieve visual color development (the positive result is yellow Green, and the negative result is light orange), so that a false positive result is easy to occur.
Drawings
FIG. 1 shows the results of the addition of calcein, a fluorescent dye, after a loop-mediated isothermal amplification (LAMP) reaction. Wherein 1-3 are respectively Escherichia coli recombinant plasmid (PUC57-M63115.1), Escherichia coli (ATCC8739) and Escherichia coli (ATCC 35150), N: negative control (sterilized water).
FIG. 2 is a diagram showing the visualized result of LAMP specificity experiment. Legend: wherein 1-21 are respectively Escherichia coli recombinant plasmid (PUC57-M63115.1), Escherichia coli (ATCC8739), Proteus mirabilis (CVCC1969), Streptococcus uberis (ATCC700407), Streptococcus dysgalactiae (ATCC12388), Streptococcus agalactiae (ATCC13813), Staphylococcus aureus (CVCC545), Streptococcus pneumoniae (ATCC13883), Staphylococcus epidermidis (ATCC12228), Candida albicans (ATCC10231), Candida albicans (ATCC90028), Pseudomonas aeruginosa (ATCC 15442), Salmonella typhi (ATCC14028), Legionella (ATCC33152), Shigella sonnei (ATCC 25931), hemolytic streptococcus B (CMCC3221), Vibrio parahaemolyticus (CICC21528), Salmonella (CICC 2150), Clostridium perfringens (ATCC 13214), Listeria monocytogenes (ATCC 19114). N: negative control (sterilized water).
FIG. 3 is a diagram showing the results of PCR-specific gel electrophoresis. Legend, where M: DL 2000DNA Mark, 1-21 are positive control E.coli recombinant plasmid (PUC57-M63115.1), E.coli (ATCC8739), Proteus mirabilis (CVCC1969), Streptococcus uberis (ATCC700407), Streptococcus dysgalactiae (ATCC12388), Streptococcus agalactiae (ATCC13813), Staphylococcus aureus (CVCC545), Streptococcus pneumoniae (ATCC13883), Staphylococcus epidermidis (ATCC12228), Candida albicans (ATCC10231), Candida albicans (ATCC90028), Pseudomonas aeruginosa (ATCC 42), Salmonella typhi (ATCC14028), Legionella (ATCC33152), Shigella sonnei (ATCC 25931), hemolytic streptococcus type B (CMCC3221), Vibrio parahaemolyticus (CICC21528), Salmonella (CICC 2150), Clostridium perfringens (ATCC 13214), Listeria monocytogenes (ATCC19114), respectively. N: negative control (sterilized water).
FIG. 4 is a visual chart of LAMP sensitivity experiment, in which 1-8 are E.coli plasmids diluted to 5.0 × 106copies/μL、5.0×105copies/μL、5.0×104copies/μL、5.0×103copies/μL、5.0×102copies/μL、5.0×101copies/μL、5.0×100copies/. mu.L was used as template and N was negative control (sterile water).
FIG. 5 is a graph showing the results of PCR reaction sensitivity experiments, wherein M: DL 2000DNA Mark, 1-8 are E.coli plasmid dilutions to 5.0 × 106copies/μL、5.0×105copies/μL、5.0×104copies/μL、5.0×103copies/μL、5.0×102copies/μL、5.0×101copies/μL、5.0×100copies/. mu.L was used as template and N was negative control (sterile water).
Detailed Description
The following examples are presented to enable those skilled in the art to more fully understand the present invention and are not intended to limit the invention in any way.
The loop-mediated isothermal amplification primer group for detecting escherichia coli comprises the following 6 primers which are shown as SEQ.ID.NO.1-6 in sequence: f3 and B3, FIP and BIP, and LF and LB; the nucleotide sequence of LF is shown as SEQ.ID.NO.5, the nucleotide sequence of LB is shown as SEQ.ID.NO.6, the nucleotide sequence of F3 is shown as SEQ.ID.NO.1, the nucleotide sequence of B3 is shown as SEQ.ID.NO.2, the nucleotide sequence of FIP is shown as SEQ.ID.NO.3, the nucleotide sequence of BIP is shown as SEQ.ID.NO.4, and the primer sequences are as follows:
in addition, the kit also comprises 10 × Isothermalamplification Buffer 2 muL, 8U/muL Bst2.0DNA polymerase 1 muL and 100mM MgSO40.8. mu.L, 5M betaine 0.8. mu.L, 10mM dNTP 2.4. mu.L and 0.8. mu.L calcein (25 ×).
Wherein the 10 × Isothermal Amplification Buffer reaction Buffer contains 100mM potassium chloride, 100mM ammonium sulfate, 200mM Tris-HCl pH8.8, 1% Triton X100, and 20mM magnesium sulfate.
Calcein is a fluorescent dye, and is a calcein water solution with a final concentration of 16 mM/L.
The invention also provides a loop-mediated isothermal amplification method for detecting escherichia coli, which comprises the following steps:
(1) extracting DNA of a sample to be detected;
the bacteria to be tested were cultured overnight in broth medium, 1ml of the bacterial culture was aspirated, centrifuged at 12000rpm in a 1.5ml centrifuge tube for 2min, and the supernatant was discarded. Adding 100-120 mu L of sterilized water into a centrifuge tube, uniformly mixing by vortex, heating in boiling water at 95-100 ℃ for 10min, and then centrifuging at 12000rpm for 2-4 min. And (5) sucking the supernatant into a new centrifugal tube to be used as a template to be detected.
(2) The following combinations were premixed, including 3 pairs of primers F3 and B3, FIP and BIP, and LF and LB in a 20. mu.L loop-mediated isothermal amplification reaction system.
A loop-mediated Isothermal amplification (LAMP) reaction was set up by pipetting 10 × Isothermal amplification buffer 2. mu.L, 40uM F30.08. mu.L, 40uM B30.08. mu.L, 100uM FIP 0.32. mu.L, 100uM BIP 0.32. mu.L, 80uM LF 0.1. mu.L, 80uM LB 0.1. mu.L, 8U/. mu.L Bst2.0DNA polymerase 1. mu.L, 100Mm MgSO40.8 mu L, 0.8 mu L of 5M betaine, 2.4 mu L of 10Mm dNTP, 1 mu L of DNA of a sample to be tested, 0.8 mu L of calcein (25 ×) in an EP tube, supplementing sterile water to 20 mu L, and centrifuging for later use, wherein the nucleotide sequence of LF is shown as SEQ ID No.5, the nucleotide sequence of LB is shown as SEQ ID No.6, the nucleotide sequence of F3 is shown as SEQ ID No.1, the nucleotide sequence of B3 is shown as SEQ ID No.2, the nucleotide sequence of FIP is shown as SEQ ID No.3, and the nucleotide sequence of BIP is shown as SEQ ID No. 4;
(3) the prepared LAMP reaction system of the escherichia coli is placed in a constant-temperature metal bath, the reaction is firstly carried out at 65 ℃ for 30min, and then the reaction is carried out at 85 ℃ for 2min so that Bst2.0DNA polymerase enzyme is inactivated and the reaction is terminated.
(4) After the LAMP reaction is finished, judging and reading the negative/positive detection result by using a fluorescence color development method and an agarose gel electrophoresis method respectively:
observing whether the color of the loop-mediated isothermal amplification system changes after the reaction is finished, and if the color of the loop-mediated isothermal amplification reaction system changes to yellow green, the reaction is positive, which indicates that escherichia coli exists in a sample to be detected; if the color of the loop-mediated isothermal amplification reaction system is light orange, the reaction is negative, which indicates that no escherichia coli exists in the sample to be detected.
Detecting the amplification product by agarose gel electrophoresis, wherein if the amplification product of the gradient sample strip is obtained, the sample to be detected contains escherichia coli; if the amplified band does not exist, the sample to be detected does not contain the Escherichia coli.
A positive control and a negative control are respectively set during detection, an escherichia coli recombinant plasmid (PUC57-M63115.1), escherichia coli (ATCC8739) and escherichia coli (ATCC8739) are used as positive controls, and sterilized water is used as a negative control. And when the result is judged, comparing the result with a positive control and a negative control respectively, if the loop-mediated isothermal amplification reaction system corresponding to the object to be detected and the amplification reaction system corresponding to the positive control are both in yellow green, judging that the detection result of the object to be detected is positive, and if the loop-mediated isothermal amplification reaction system corresponding to the object to be detected and the amplification reaction system corresponding to the negative control are both in light orange, judging that the detection result of the object to be detected is negative.
The detection method of the invention is carried out based on a loop-mediated isothermal amplification technology.
The invention designs LAMP specific primers comprising outer primers (F3 and B3), inner primers (FIP and BIP) and loop primers (LF and LB) aiming at escherichia coli fecA gene (GenBank: M63115.1). Adding the sample DNA and the established LAMP reaction system into a 1.5ml centrifuge tube, placing the centrifuge tube in a constant-temperature metal bath, heating the centrifuge tube at 65 ℃ for 30min, and then reacting the centrifuge tube at 85 ℃ for 2min to terminate the reaction. The presence or absence of E.coli in the sample was determined by observing the color change of the reaction system. Experiments prove that the detection method has the lowest detection limit of 5 copies/mu L, and provides a quick, specific and sensitive method for detecting escherichia coli.
Design and Synthesis of LAMP primers
The invention determines the special gene of the Escherichia coli by using the FecA gene (GenBank: M63115.1) of the Escherichia coli published in the GenBank database as a target gene and inquiring and comparing the target gene in the GenBank. And designing LAMP specific primers according to the target genes.
According to the LAMP primer design principle, a gene sequence with high conservation of escherichia coli fecA gene (GenBank: M63115.1) is used as a target gene, and 6 LAMP primers are designed, wherein the LAMP primers comprise a forward/reverse inner primer (FIP/BIP), a forward/reverse outer primer (F3/B3) and a forward/reverse loop primer (LF/LB). The primers were synthesized by Biotechnology engineering (Shanghai) GmbH, 6 primers with the following sequences:
SEQ.ID.NO.1：SA-F3：ACGACGTATTTGAACATGCTGG
SEQ.ID.NO.2：SA-B3：AAGGGGACGGGGATGCC
SEQ.ID.NO.3：SA-FIP：GACGCCAGGGATGCGGTTA-TTTTCCGCCGTGAGGATTTCG
SEQ.ID.NO.4：SA-BIP：CCACGACCTGGCGATGAACTT-TTTCCATCAGGACGGTCGAGC
SEQ.ID.NO.5：SA-LF：ACCTCACGCATGGTGGTTG
SEQ.ID.NO.6：SA-LB：TTGGCATCCGGGGCCT
2. extraction of bacterial genome DNA of sample to be detected
The bacteria to be tested were cultured overnight in broth medium, 1ml of the bacterial culture broth was aspirated, centrifuged at 12000rpm in a 1.5ml centrifuge tube for 2min, and the supernatant was discarded. Adding 100-120 mu L of sterilized water into a centrifuge tube, uniformly mixing by vortex, heating in boiling water at 95-100 ℃ for 10min, and then centrifuging at 12000rpm for 2-4 min. And (5) sucking the supernatant into a new centrifugal tube to be used as a template to be detected.
3. Construction of LAMP reaction System (20. mu.L)
Wherein the 10 × Isothermal Amplification Buffer reaction Buffer contains 100mM potassium chloride, 100mM ammonium sulfate, 200mM Tris-HCl pH8.8, 1% Triton X100, and 20mM magnesium sulfate.
The enzyme is Bst2.0DNA polymerase containing 8 activity units per microliter at a final concentration of 320U/. mu.L.
The fluorescent dye is calcein water solution with the final concentration of 16 mM/L. 10 × Isothermal AmplifietionBuffer reaction buffer and Bst2.0DNA polymerase were purchased from New England Biolabs.
4. Detection of amplification products
The recombinant plasmid and various standard strains are cultured overnight, the recombinant plasmid and the total genomic DNA of the standard strains are extracted and used as amplification templates to be added into a reaction system, and the reaction process is as follows: the prepared LAMP reaction system is placed in a constant-temperature metal bath, and the reaction is firstly carried out at 65 ℃ for 30min and then at 85 ℃ for 2min so as to inactivate Bst2.0DNA polymerase and terminate the reaction.
Before the reaction, a fluorescent dye is added into the LAMP reaction system, the color change of the LAMP reaction system is observed by naked eyes, the result that the reaction system is yellow green is positive, and the result that the reaction system is light orange is negative (see figure 1).
The reaction system can form a large amount of pyrophosphate in the process of nucleic acid amplification. Binding of manganese ions in calcein to calcein prior to the amplification reaction results in quenching of fluorescence with the dye being light orange in color. When a large amount of pyrophosphate ions are generated in the amplification process, the manganese ions and the pyrophosphate ions are combined to form manganese pyrophosphate, so that calcein is released, free calcein can perform autofluorescence to generate a fluorescence signal, and the color of the dye is changed into yellow green. Namely, a large amount of DNA is amplified by LAMP reaction, and is yellow-green after being added with calcium to react.
LAMP specificity experiment
Escherichia coli recombinant plasmid (PUC57-M63115.1), Escherichia coli (ATCC8739) and Proteus mirabilis (CVCC1969), Streptococcus uberis (ATCC700407), Streptococcus dysgalactiae (ATCC12388), Streptococcus agalactiae (ATCC13813), Staphylococcus aureus (CVCC545), Streptococcus pneumoniae (ATCC13883), Staphylococcus epidermidis (ATCC12228), Candida albicans (ATCC10231), Candida albicans (ATCC90028), Pseudomonas aeruginosa (ATCC 15442), Salmonella typhi (ATCC14028), Legionella (ATCC33152), Shigella sonnei (ATCC 25931), type B hemolytic streptococcus (CMCC3221), Vibrio parahaemolyticus (CICC21528), Salmonella (CICC 2150), Clostridium perfringens (ATCC 13214), Listeria monocytogenes (ATCC19114) (all ATCC strains used in the present invention are purchased from American type collection, CVCC strains are purchased from American type collection, CMCC strains are purchased from China medical microorganism strain preservation management center, CICC strains are purchased from China microorganism strain preservation management center) as reaction templates, LAMP detection is established according to the reaction system and conditions, and an LAMP detection method is established according to the reaction system and conditions for specific tests. The Escherichia coli recombinant plasmid (PUC57-M63115.1) and the genome DNA of the Escherichia coli standard strain are set as positive controls, and 18 non-target strains and sterilized water are set as negative controls. As a result, only the reaction system of the Escherichia coli recombinant plasmid (PUC57-M63115.1) and the genome of the Escherichia coli standard strain showed positive reactions, and the others showed negative reactions (see FIG. 2). The PCR-specific reaction results showed that the E.coli recombinant plasmid (PUC57-M63115.1) and the E.coli standard strain genome showed bright bands, and the rest showed no bands (see FIG. 3).
LAMP sensitivity experiment
The plasmid containing E.coli fecA gene was diluted 10-fold in gradient to 5.0 × 106copies/μL、5.0×105copies/μL、5.0×104copies/μL、5.0×103copies/μL、5.0×102copies/μL、5.0×101copies/μL、5.0×100The sensitivity test is carried out by taking copies/mu L as a template, sterilized water is used as negative control, LAMP detection is carried out according to the reaction system and the conditions to determine the sensitivity of the established Escherichia coli LAMP detection method, and the result shows that the lowest detection limit of the Escherichia coli LAMP detection method can reach 5 × 101copies/. mu.L (see FIG. 4), the lowest detection limit of the PCR method is 5 × 103copies/. mu.L (see FIG. 5), the sensitivity of the established LAMP detection method is 100 times higher than that of the PCR detection method.
Those skilled in the art will appreciate that the above embodiments are merely exemplary embodiments and that various changes, substitutions, and alterations can be made without departing from the spirit and scope of the application.
Sequence listing
<110> Ningxia university
<120> specific LAMP primer, kit and method for detecting escherichia coli
<130>HP200297LZ
<160>6
<170>SIPOSequenceListing 1.0
<210>1
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
acgacgtatt tgaacatgct gg 22
<210>2
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
<210>3
<211>40
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
gacgccaggg atgcggttat tttccgccgt gaggatttcg 40
<210>4
<211>42
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ccacgacctg gcgatgaact ttttccatca ggacggtcga gc 42
<210>5
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
<210>6
<211>16
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
Claims (5)
1. A loop-mediated isothermal amplification (LAMP) primer for detecting escherichia coli is characterized by comprising 6 primers, wherein the 6 primers are designed aiming at a conserved sequence of an fecA gene (GenBank: M63115.1) of the escherichia coli; the 6 primers comprise F3, B3, FIP, BIP, LF and LB, wherein the nucleotide sequence of F3 is shown as SEQ.ID.N0.1, the nucleotide sequence of B3 is shown as SEQ.ID.N0.2, the nucleotide sequence of FIP is shown as SEQ.ID.N0.3, the nucleotide sequence of BIP is shown as SEQ.ID.N0.4, the nucleotide sequence of LF is shown as SEQ.ID.NO.5, and the nucleotide sequence of LB is shown as SEQ.ID.NO.6.
2. A loop-mediated isothermal amplification (LAMP) kit for detecting Escherichia coli, comprising: f30.08 mu L of 40uM, B30.08 mu L of 40uM, FIP 0.32 mu L of 100uM, BIP 0.32 mu L of 100uM, LF 0.1 mu L of 80uM, LB 0.1 mu L of 80uM, F3 and B3, FIP and BIP and LF and LB are loop-mediated isothermal amplification primers, the nucleotide sequence of F3 is shown as SEQ ID.NO.1, the nucleotide sequence of B3 is shown as SEQ ID.NO.2, the nucleotide sequence of FIP is shown as SEQ ID.NO.3, the nucleotide sequence of BIP is shown as SEQ ID.NO.4, the nucleotide sequence of LF is shown as SEQ ID.NO.5, and the nucleotide sequence of LB is shown as SEQ ID.NO. 6.
3. The loop-mediated Isothermal Amplification (LAMP) kit for detecting E.coli according to claim 2, further comprising 10 × Isotermal Amplification Buffer 2. mu.L, 8U/. mu.L Bst2.0DNA polymerase 1. mu.L, 100mM MgSO40.8. mu.L, 5M betaine 0.8. mu.L, 10mM dNTP 2.4. mu.L and 0.8. mu.L of a fluorescent dye, wherein the 10 × IsotermalAmplification Buffer reaction contains 100mM potassium chloride, 100mM ammonium sulfate, 200mM Tris-HCl pH8.8, 1% Triton X100, 20mM magnesium sulfate.
4. The loop-mediated isothermal amplification (LAMP) kit for detecting E.coli according to claim 3, wherein the fluorescent dye is an aqueous calcein solution with a final concentration of 16 mM/L.
5. A method of detecting e.coli comprising:
extracting the genomic DNA of a sample to be detected;
constructing a reaction system comprising the following primers: f3, B3, FIP, BIP, LB and LF, wherein the nucleotide sequence of F3 is shown in SEQ.ID.N0.1, the nucleotide sequence of B3 is shown in SEQ.ID.N0.2, the nucleotide sequence of FIP is shown in SEQ.ID.N0.3, the nucleotide sequence of BIP is shown in SEQ.ID.N0.4, the nucleotide sequence of LF is shown in SEQ.ID.NO.5, and the nucleotide sequence of LB is shown in SEQ.ID.NO.6;
carrying out an amplification reaction;
the presence or absence of E.coli was determined by the color change of the reaction system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010711226.8A CN111676305A (en) | 2020-07-22 | 2020-07-22 | Specific LAMP primer, kit and method for detecting escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010711226.8A CN111676305A (en) | 2020-07-22 | 2020-07-22 | Specific LAMP primer, kit and method for detecting escherichia coli |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111676305A true CN111676305A (en) | 2020-09-18 |
Family
ID=72438119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010711226.8A Pending CN111676305A (en) | 2020-07-22 | 2020-07-22 | Specific LAMP primer, kit and method for detecting escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111676305A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112322763A (en) * | 2020-12-03 | 2021-02-05 | 华中农业大学 | LAMP primer for detecting escherichia coli F17 pilus adhesin gene and application thereof |
| CN116144808A (en) * | 2022-10-18 | 2023-05-23 | 四川大学 | Primer combination for quick nucleic acid detection of escherichia coli and detection method |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101153331A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting bacillus coli O157:H7 |
| CN110229916A (en) * | 2019-06-06 | 2019-09-13 | 昆明理工大学 | A kind of primer of Escherichia coli specific gene and the method for detecting Escherichia coli |
| CN111378772A (en) * | 2020-03-27 | 2020-07-07 | 宁夏大学 | Specific LAMP primer, kit and method for detecting streptococcus uberis |
-
2020
- 2020-07-22 CN CN202010711226.8A patent/CN111676305A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101153331A (en) * | 2007-09-21 | 2008-04-02 | 珠海市疾病预防控制中心 | Primer, detection method and detection reagent kit for detecting bacillus coli O157:H7 |
| CN110229916A (en) * | 2019-06-06 | 2019-09-13 | 昆明理工大学 | A kind of primer of Escherichia coli specific gene and the method for detecting Escherichia coli |
| CN111378772A (en) * | 2020-03-27 | 2020-07-07 | 宁夏大学 | Specific LAMP primer, kit and method for detecting streptococcus uberis |
Non-Patent Citations (6)
| Title |
|---|
| BRUNHILDE VAN HOVE, ET AL: "Novel Two-Component Transmembrane Transcription Control:Regulation of Iron Dicitrate Transport in Escherichia coli K-12", 《JOURNAL OF BACTERIOLOGY》 * |
| MAGDALENA PILARCZYK-ZUREK1: "The dual role of Escherichia coli in the course of ulcerative colitis", 《BMC GASTROENTEROL》 * |
| SHLOMO E. BLUM, ET AL: "Postgenomics Characterization of an Essential Genetic Determinant of Mammary Pathogenic Escherichia coli", 《MBIO》 * |
| VOLKMAR BRAUN,ET AL: "Transmembrane transcriptional control (surface signalling) of the Escherichia coli Fec type", 《FEMS MICROBIOLOGY REVIEWS》 * |
| 岳慧贤,等: "部分革兰氏阴性菌胞外功能sigma 因子结构与调控铁离子的利用机制", 《中国生物化学与分子生物学报》 * |
| 府伟灵: "《临床精准分子诊断学》", 31 May 2020, 上海:上海交通大学出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112322763A (en) * | 2020-12-03 | 2021-02-05 | 华中农业大学 | LAMP primer for detecting escherichia coli F17 pilus adhesin gene and application thereof |
| CN116144808A (en) * | 2022-10-18 | 2023-05-23 | 四川大学 | Primer combination for quick nucleic acid detection of escherichia coli and detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106367500B (en) | Method for rapidly detecting vibrio vulnificus at constant temperature, primer and application | |
| CN110195121B (en) | CPA primer, kit and detection method for detecting methicillin-resistant staphylococcus aureus | |
| CN111518934A (en) | Rapid detection method and kit for escherichia coli and 6 pathogenic genes | |
| CN111676305A (en) | Specific LAMP primer, kit and method for detecting escherichia coli | |
| CN106367493B (en) | Method, primer and application for rapid constant-temperature detection of salmonella | |
| CN110863061A (en) | Specific LAMP primer, kit and method for detecting staphylococcus aureus | |
| CN111073985B (en) | Rapid constant-temperature detection method, primer group and kit for salmonella | |
| CN106434887A (en) | Method, primers and kit for rapid constant-temperature detection of staphylococcus aureus | |
| CN110846428A (en) | Specific LAMP primer, kit and method for detecting streptococcus agalactiae | |
| CN116640867B (en) | Primer pair and probe combination for detecting streptococcus agalactiae by RAA-LFD and application of primer pair and probe combination | |
| CN106367499B (en) | Method, primer and kit for rapidly detecting vibrio vulnificus at constant temperature | |
| CN116640867A (en) | Primer pair and probe combination for detecting streptococcus agalactiae by RAA-LFD and application of primer pair and probe combination | |
| CN113621689A (en) | CPA primer, detection kit and detection method of listeria monocytogenes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200918 |