CN104975094B - A kind of for diagnosing the test kit of colpitic gardnerella vaginalis - Google Patents
A kind of for diagnosing the test kit of colpitic gardnerella vaginalis Download PDFInfo
- Publication number
- CN104975094B CN104975094B CN201510408127.1A CN201510408127A CN104975094B CN 104975094 B CN104975094 B CN 104975094B CN 201510408127 A CN201510408127 A CN 201510408127A CN 104975094 B CN104975094 B CN 104975094B
- Authority
- CN
- China
- Prior art keywords
- gardnerella vaginalis
- primer
- colpitic
- seqidno
- present
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of for the colpitic gardnerella vaginalis LAMP detection kit of diagnosing bacterial, does it comprise Auele Specific Primer group, Bst? archaeal dna polymerase, reaction buffer and nucleic acid dye.Present invention also offers a kind of gardnerella vaginalis LAMP detection method.Use test kit of the present invention or detection method have high specific, consuming time short, highly sensitive, identify the advantages such as easy, clinical application is extensive.
Description
Technical field
The present invention relates to microorganism detection field, specifically, the present invention relates to a kind of for the colpitic gardnerella vaginalis LAMP detection kit of diagnosing bacterial.
Background technology
Bacterial vaginitis (bacterialvaginosis is called for short BV) is a kind of clinical syndrome changing into feature with normal vaginal microbial flora.In the past due to limited to its understanding, once reported a lot of title, as nonspecific vaginitis, Gardnerella vaginitis, vaginitis hemoptulus vaginalis etc.BV is the modal vaginal infection diseases of the women of child-bearing age, and it can cause the complication such as trachelitis, endometritis, also makes the risk of patient infection HIV virus and premature labor increase.
Gardnerella vaginalis (GardnerellaVaginalis) has comparative advantage in the microorganism species of BV, and content, apparently higher than other abnormal microflora, is the infector of BV.It is a kind of tiny bacillus of Gram-variable, belongs to Gardnerella, and this genus is this bacterial classification only.The normal infectious active period women of this bacterium, part protracted inflammation is not healed, and affects very large on WomanHealth and public health.Therefore to the detection of gardnerella vaginalis to the clinical diagnosis of bacterial vaginitis and treatment very necessary.
Loop-mediated isothermal amplification technique (loop-mediatedisothermalamplificationofDNA, LAMP) is a kind of novel nucleic acid amplification technologies that Japanese scholars Notomi set up in 2000.This technology for target gene 6 zone design 4 primers, utilize there is strand-displacement activity archaeal dna polymerase under constant temperature fast, amplified target gene with high specificity, product is the dumbbell shaped DNA moleculars of two ends with loop-stem structure.Compared with already becoming the PCR method of laboratory conventional sense, LAMP technology had the advantages such as easy and simple to handle, highly sensitive, high specificity, in continuous Improvement and perfection process, be widely used in various Pathogen test.
Summary of the invention
The object of the present invention is to provide a kind of for the colpitic gardnerella vaginalis LAMP detection kit of diagnosing bacterial.
In order to realize object of the present invention, in an aspect, the invention provides a kind of for the colpitic gardnerella vaginalis LAMP detection kit of diagnosing bacterial, it comprises Auele Specific Primer group, reaction buffer, BstDNA polysaccharase and nucleic acid dye, and the nucleotide sequence of wherein said Auele Specific Primer group is as follows:
Outer primer F3:ACGGGTGGTAATGCTGGA (SEQIDNO:1)
Outer primer B3:CTGCATGGACCTTACTACTG (SEQIDNO:2)
Inner primer FIP:TGATAGGACGCGACCCCATCC-CTCCAACTTGACGCATGTCT (SEQIDNO:3)
Inner primer BIP:TAGGCTTCGACGGGTAGCCG-AGGAGTCTGGGCCGTATC (SEQIDNO:4).
Preferably, described reaction buffer is by 10mMdNTP, 10 × ThermoPol reaction buffer, 50mMMgSO
4form with 5mM trimethyl-glycine.
Preferably, described nucleic acid dye is 1000 × SYBRGreenI.
Preferably, test kit of the present invention comprises DNA extraction reagent and positive control and negative control further.
Preferably, described DNA extraction reagent is CTAB extraction buffer, and it is made up of 100mMTris-HClpH8.0,50mMEDTA, 1MNaCl, 1% (v/v) beta-mercaptoethanol, 2%CTAB, pH7.0-7.5.
In one aspect of the method, the present invention also provides a kind of gardnerella vaginalis LAMP detection method, and it comprises the following steps:
(1) in testing sample, add CTAB extraction buffer, conveniently CTAB method extracts DNA;
(2) in PCR pipe, prepare 25 μ l reaction systems, it comprises the outer primer F31 μ l of 5pmol/ μ l, the outer primer B31 μ l of 5pmol/ μ l, the inner primer FIP1 μ l of 40pmol/ μ l, inner primer BIP1 μ l, the reaction buffer 2.5 μ l of 40pmol/ μ l, the BstDNA polysaccharase 1 μ l of 8U/ μ l, template DNA 2 μ l, add water and be supplemented to 25 μ l, and using gardnerella vaginalis genomic dna as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(3) by the PCR pipe in step (2) in 63 DEG C of isothermal reaction 60min;
(4) analysis judges reaction product result: in (3), add 1 μ l nucleic acid dye in gained reaction product, and if reaction solution color is orange, represent that result is negative, if reaction solution color is green, expression result is positive.
In one aspect of the method, present invention also offers Auele Specific Primer group for the preparation of the application in the colpitic gardnerella vaginalis LAMP kit of diagnosing bacterial, the nucleotide sequence of wherein said Auele Specific Primer group is as follows:
Outer primer F3:ACGGGTGGTAATGCTGGA (SEQIDNO:1)
Outer primer B3:CTGCATGGACCTTACTACTG (SEQIDNO:2)
Inner primer FIP:TGATAGGACGCGACCCCATCC-CTCCAACTTGACGCATGTCT (SEQIDNO:3)
Inner primer BIP:TAGGCTTCGACGGGTAGCCG-AGGAGTCTGGGCCGTATC (SEQIDNO:4).
Of the present invention for diagnosing bacterial colpitic gardnerella vaginalis LAMP detection kit and detection method thereof have high specific, consuming time short, highly sensitive, identify the advantages such as easy, clinical application is extensive.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.
The preparation of embodiment 1 test kit of the present invention
1.1 reagent
Primer is synthesized by TIANGEN Biotech (Beijing) Co., Ltd.; BstDNA polysaccharase and 10 × ThermoPol reaction buffer are purchased from NEB; SYBRGreenI is purchased from Invitrogen; All the other PCR reagent and the reagent needed for preparation CTAB extraction buffer are purchased from Sigma.
The preparation of 1.2 test kits:
Obtain following reagent, to prepare test kit of the present invention:
CTAB extraction buffer: according to following formulated: 100mMTris-HClpH8.0,50mMEDTA, 1MNaCl, 1% (v/v) beta-mercaptoethanol, 2%CTAB, adjusted to ph is to 7.0-7.5;
Reaction buffer: according to following formulated: 10mMdNTP, 10 × ThermoPol reaction buffer, 50mMMgSO
4, 5mM trimethyl-glycine;
Primer: outer primer F3, its nucleotide sequence is as shown in SEQIDNO:l; Outer primer B3, its nucleotide sequence is as shown in SEQIDNO:2; Inner primer FIP, its nucleotide sequence is as shown in SEQIDNO:3, and inner primer BIP, its nucleotide sequence is as shown in SEQIDNO:4.Wherein the concentration of outer primer F3 and outer primer B3 is 5pmol/ μ l, and the concentration of inner primer FIP and inner primer BIP is 40pmol/ μ l.
Concentration is the BstDNA polysaccharase of 8U/ μ l;
Nucleic acid dye: 1000 × SYBRGreenI;
Positive control: gardnerella vaginalis genomic dna;
Negative control: 100mMTris-HCl (pH8.0) and 50mMEDTA.
Embodiment 2 gardnerella vaginalis specific detection
2.1LAMP specific detection
Test strains comprises the gardnerella vaginalis being separated from BV patient's vaginal secretions and obtaining, and propionibacterium, purple Zymomonas mobilis and Prey irrigate each 1 strain of bacterium.
The test kit using embodiment 1 to prepare detects according to following steps:
(1) be inoculated in by test strains on PDA flat board, after streak culture, collection is also centrifugal, adds 50 μ lCTAB extraction buffers, and conveniently CTAB method extracts DNA;
(2) in PCR pipe, prepare 25 μ l reaction systems, wherein four kinds of each 1 μ l of primer, reaction buffer 2.5 μ l, the BstDNA polysaccharase 1 μ l of 8U/ μ l, step (1) gained template DNA 2 μ l, add water and be supplemented to 25 μ l, and using gardnerella vaginalis genomic dna as positive control, using 100mMTris-HClpH8.0 and 50mMEDTA as negative control;
(3) by PCR pipe in step (2) in 63 DEG C of isothermal reaction 60min;
(4) analysis judges reaction product result: in (3), add 1 μ l1000 × SYBRGreenI in gained reaction product, and if reaction solution color is orange, represent that result is negative, if reaction solution color is green, expression result is positive.
2.2 detected result
All present green in the PCR pipe of gardnerella vaginalis, and its colour developing result making bacterial strain is orange, shows that primer has very strong specificity.
Embodiment 3 gardnerella vaginalis sensitivity technique
3.1LAMP sensitivity technique
Extract gardnerella vaginalis DNA according to the step (1) of embodiment 2, and be diluted to 100ng, 10ng, 1ng, 100pg, 10pg, 1pg, 100fg totally 7 gradients with 10 times of concentration series dilution methods.
LAMP reaction system and reaction conditions and interpretation of result are with step (2)-(4) of embodiment 2.
3.2 detected result
Except DNA concentration be 100fg PCR pipe display orange except, all present green in the PCR pipe of all the other concentration, show that the lowest detection limit of detection method of the present invention reaches 1pgDNA, sensitivity is very high.
Claims (1)
1. primer is for the preparation of the application in the colpitic gardnerella vaginalis LAMP detection kit of diagnosing bacterial, and the nucleotide sequence of wherein said primer is as follows:
Outer primer F3:ACGGGTGGTAATGCTGGA (SEQIDNO:1)
Outer primer B3:CTGCATGGACCTTACTACTG (SEQIDNO:2)
Inner primer FIP:TGATAGGACGCGACCCCATCC-CTCCAACTTGACGCATGTCT (SEQIDNO:3)
Inner primer BIP:TAGGCTTCGACGGGTAGCCG-AGGAGTCTGGGCCGTATC (SEQIDNO:4).
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510672928.9A CN105154570B (en) | 2015-07-13 | 2015-07-13 | A kind of test kit for diagnosing colpitic gardnerella vaginalis |
| CN201510408127.1A CN104975094B (en) | 2015-07-13 | 2015-07-13 | A kind of for diagnosing the test kit of colpitic gardnerella vaginalis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510408127.1A CN104975094B (en) | 2015-07-13 | 2015-07-13 | A kind of for diagnosing the test kit of colpitic gardnerella vaginalis |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510672928.9A Division CN105154570B (en) | 2015-07-13 | 2015-07-13 | A kind of test kit for diagnosing colpitic gardnerella vaginalis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104975094A CN104975094A (en) | 2015-10-14 |
| CN104975094B true CN104975094B (en) | 2016-03-23 |
Family
ID=54272057
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510672928.9A Active CN105154570B (en) | 2015-07-13 | 2015-07-13 | A kind of test kit for diagnosing colpitic gardnerella vaginalis |
| CN201510408127.1A Active CN104975094B (en) | 2015-07-13 | 2015-07-13 | A kind of for diagnosing the test kit of colpitic gardnerella vaginalis |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510672928.9A Active CN105154570B (en) | 2015-07-13 | 2015-07-13 | A kind of test kit for diagnosing colpitic gardnerella vaginalis |
Country Status (1)
| Country | Link |
|---|---|
| CN (2) | CN105154570B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107058483A (en) * | 2016-12-26 | 2017-08-18 | 广州和实生物技术有限公司 | A kind of fluorescence Constant Temperature Detection kit of instant detection gardnerella vaginalis |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1493698A (en) * | 2002-07-02 | 2004-05-05 | 昆明寰基生物芯片开发有限公司 | Determination of one section vagina bacillus Gardner DNA sequence (3) specificity and its application |
| CN1495265A (en) * | 2002-07-02 | 2004-05-12 | 昆明寰基生物芯片开发有限公司 | Definition of Gardner's bacillus DNA sequence (1) specificity of vagina and its application |
| CN1493699A (en) * | 2002-07-02 | 2004-05-05 | 昆明寰基生物芯片开发有限公司 | Determination of one section vagina bucillus Gardner DNA sequence (2) specificity and its application |
| GB0601302D0 (en) * | 2006-01-23 | 2006-03-01 | Semikhodskii Andrei | Diagnostic methods and apparatus |
| CN103882134A (en) * | 2014-03-31 | 2014-06-25 | 深圳意达凯生物科技有限公司 | Primer pair for detecting gardnerella vaginalis, kit and application thereof |
-
2015
- 2015-07-13 CN CN201510672928.9A patent/CN105154570B/en active Active
- 2015-07-13 CN CN201510408127.1A patent/CN104975094B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN105154570A (en) | 2015-12-16 |
| CN105154570B (en) | 2016-06-08 |
| CN104975094A (en) | 2015-10-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107746879A (en) | Detect RPA primers, probe, kit and the detection method of staphylococcus aureus | |
| CN110106285B (en) | Internal reference-containing dual isothermal nucleic acid amplification method for rapidly detecting 3-type human adenovirus | |
| US20090226895A1 (en) | Method of detecting vibrio parahaemolyticus via real-time PCR-hybridization | |
| CN111118211A (en) | Bovine sarcoidosis detection kit and method based on loop-mediated isothermal amplification technology | |
| CN104561358B (en) | A kind of Herba Dendrobii Phytophthora nicotianae Breda LAMP detection kit and detection method | |
| CN110791592A (en) | Primer and kit for rapidly detecting African swine fever virus | |
| CN104911275B (en) | A kind of bacterial vaginitis detection kit | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN105200162A (en) | HRM detection method for rapidly distinguishing HP-PRRS live vaccine JXA1-R strains and wild strains and primer of HRM detection method | |
| CN104328175A (en) | Loop-mediated isothermal amplification (LAMP) primers, kit and method for detecting mouse Klebsiella pneumoniae | |
| AU2020101818A4 (en) | A novel LAMP method, primer set and kit for SNP detection | |
| CN104975094B (en) | A kind of for diagnosing the test kit of colpitic gardnerella vaginalis | |
| CN113846185A (en) | Primer composition and kit for rapid detection of new coronavirus E484K/Q, K417N/T variation | |
| CN104328174A (en) | LAMP (loop-mediated isothermal amplification) primers, kit and method for detecting murine klebsiella pneumoniae | |
| CN115747361B (en) | Real-time fluorescence MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN103937889B (en) | A kind of Arcanobacterium pyogenes LAMP detection primer and detection method | |
| CN114134218B (en) | Fluorescent detection method based on CRISPR-Cas12a | |
| CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production | |
| CN105624284A (en) | Klebsiella pneumonia fluorescent PCR detection reagent kit | |
| CN108130385A (en) | A kind of human cytomegalovirus kit for detecting nucleic acid | |
| CN110157836B (en) | Primer, probe and method for detecting IBRV and BVDV | |
| CN109913544B (en) | Real-time fluorescent quantitative PCR kit for auxiliary diagnosis of tuberculous pleurisy and application thereof | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof | |
| CN117025807B (en) | RPA-CRISPR/Cas12a primer group, gRNA and probe, kit and detection method | |
| CN116904616B (en) | Real-time fluorescence PCR detection primer and probe for fasciola platycladi, and detection method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| CB03 | Change of inventor or designer information |
Inventor after: Qiang Jianxin Inventor after: Lin Xiuwen Inventor after: Tian Mingmin Inventor after: Xie Bing Inventor before: Wang Ailing |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20160226 Address after: Suzhou City, Jiangsu province 215300 town Kunshan City Jin Yang Lu No. 15 financial Park Building No. 15 Applicant after: WANG AILING Address before: 067000 No. 9, West Zone, hi tech Industrial Development Zone, Hebei, Chengde Applicant before: Wang Ailing |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |