CN103882134A - Primer pair for detecting gardnerella vaginalis, kit and application thereof - Google Patents
Primer pair for detecting gardnerella vaginalis, kit and application thereof Download PDFInfo
- Publication number
- CN103882134A CN103882134A CN201410125746.5A CN201410125746A CN103882134A CN 103882134 A CN103882134 A CN 103882134A CN 201410125746 A CN201410125746 A CN 201410125746A CN 103882134 A CN103882134 A CN 103882134A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- primer pair
- gardnerella vaginalis
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention relates to a primer pair for detecting gardnerella vaginalis, a kit and application thereof. The primer pair disclosed by the invention comprises an upstream primer and a downstream primer, wherein the upstream primer is a sequence segment of SEQ ID NO: 1, and the downstream primer is a sequence segment of a complementary sequence of SEQ ID NO: 1. Gardnerella vaginalis in clinical samples can be rapidly, sensitively and accurately detected by using the specific primer pair disclosed by the invention, so that the primer pair has great significance in the early diagnosis, timely treatment and effective control of reproductive tract infection caused by gardnerella vaginalis.
Description
Technical field
The present invention relates to disease detection technical field, relate in particular to the detection of gardnerella vaginalis, particularly a kind of primer pair for detection of gardnerella vaginalis, test kit and application thereof.
Background technology
Genital tract infection (Reproductive Tract Infection, RTI) refer to that various sex pheromones and parasitic infection are in reproductive tract or through the general designation of one group of infectious diseases of genital tract infection, comprise endogenous, exogenous, the iatrogenic and infection such as spread through sex intercourse, this disease mainly betides breeding time.Genital tract infection disease hazardness relates to all many-sides, shows: (1) harm humans healthy reproduction, the serious consequence causing comprises chronic pelvic inflammatory disease pain, male and female infertility, ectopic pregnancy, ectopic pregnancy and the increase of infected by HIV risk etc.(2) RTI also can bring impact to neonatal health, a lot of sexually transmitted disease (STD)s (as syphilis, gonorrhoea, chlamydozoan, hepatitis B, Human papilloma virus HPV, hsv and virus of AIDS) can be by passing to women's period of pregnancy, term and lactation child, this is called as " vertical transmission ", causes serious consequence to baby's health.RTI also can cause spontaneous abortion, premature rupture of fetal membrane, premature labor and consequent low birthweight and stillborn foetus in addition.In the time that pregnant woman is Patients with Gonorrhea, nearly 35% pregnant result is spontaneous abortion and premature labor, and nearly 10% for enclosing died.When maternity cloth substance untreated, it is 30% that Neonatal Congenital infects probability, has every year thousands of newborn infants therefore and blind.(3) security that genital tract infection sickness influence avoids conception and control birth.(4) genital tract infection also can increase the danger that cervical cancer occurs.(5) genital tract infection can increase the danger of various diseases polyinfection, and for example Patients with Gonorrhea infects 3-5 times that the probability of chlamydozoan, mycoplasma is non-the infected.RTI brings these serious consequences, and the male sex, women individual and their family and even whole community are caused to health problem.Have women of child-bearing age's ratio of reproduction infection symptoms up to 34.1% in China, the past reproduction infection rate of Status of Married Child-bearing aged Women is up to 73%, and reproduction simultaneously catches sickness rate at present also just with 30% speed increase year after year.
Women RTI disease has a strong impact on human reproduction's health, and along with the rising of RTI sickness rate, economic productivity is affected, and the quality of life of a lot of families declines, and RTI has become the Social Events of face of mankind nowadays.
Gardnerella vaginalis (Gardnerellavaginalis, GV) is the main pathogens of the common pathogenic agent of RTI and women's bacterial vaginitis (BV).Bacterial vaginitis is a kind of common clinical syndromes of the women of child-bearing age, below the transition of reproductive tract microorganism species be principal character, show as that the lactobacillus having comparative advantage is had the high density GV of potential pathogenic effects and relevant Institute of Micro-biology replaces.GV can be through spreading through sex intercourse, not only can cause vaginitis and urethritis, also can cause pelvic inflammatory disease, abnormal uterine bleeding and endometritis, amnion and chorion inflammation, amniotic fluid infection, premature rupture of fetal membrane and premature labor, low birthweight infant, puerperal infection and cervical cancer, and with HIV propagation to increase rate relevant.
At present the laboratory diagnosis of GV is mainly found to clues cell (staining), amine test, isolated culture, vapor-phase chromatography, immunofluorescence technique, polymerase chain reaction technique and molecular hybridization probe method etc. with direct smear.Rear three kinds of methods require special experimental installation and technology, and general difficulty is promoted in common lab.The many factors such as gram staining method is subject to microscope, collection of specimens and operator's experience, subjectivity is strong; Amine test paper method detection sensitivity is not only low than gram staining method, and also lower than clinical detection, adds that the stable time for reading of amine test paper is shorter, is not suitable for using clinically; Gardnerella vaginalis anaerobism, high to nutritional requirement, separation and Culture length consuming time, cultivates difficulty; Vapor-phase chromatography complex operation, experimentation cost is higher.Have report enzyme labeled staphylococcus A proteins to detect Gardnerella antibody in serum, positive rate is on the low side; Enzyme assay (Prolyl iminopeptidase is the specificity marker enzyme of BV) specificity is lower.Have been reported, clonal expression vaginolysin(writes a Chinese character in simplified form VLY, the cytoplasmic specific antigens of Gardnerella), after purifying, immune animal obtains polyclonal antibody, set up ELISA method and detect gardnerella vaginalis, although this method susceptibility is high, polyclonal antibody specificity is not very high.
It is the important germ of women BV that GV has been identified, in close relations with bad pregnancy outcome and women's interstitial cystitiss etc. such as tubal pregnancy, premature rupture of fetal membrane and newborn infant's premature labors.In recent years, along with factors such as the changes of social development, people's living environment and traditional culture idea, venereal disease pathogenic infection rate increases, BV sickness rate has the trend increasing year by year, so set up quick, sensitive, direct inspection gardnerella vaginalis from clinical samples exactly, be of great importance for early diagnosis, treatment and the control of BV.
From the eighties in last century, the deepening continuously of molecular biology research, round pcr starts to be widely used in microorganism field, and this sensitivity is good, specificity is high, simple to operate, quick, has shortened to a great extent Diagnostic Time.
Summary of the invention
For the deficiencies in the prior art, the inventor has determined the conserved sequence of one section of gardnerella vaginalis by PCR method, can detect the infection of gardnerella vaginalis by detecting this section of conserved sequence, and described conserved sequence has the sequence shown in SEQ ID NO:1.Therefore, the object of the present invention is to provide a kind of primer pair for detection of gardnerella vaginalis, comprise PCR detection kit and the application thereof of described primer pair.Use the Auele Specific Primer of gardnerella vaginalis provided by the invention to can detect quick, sensitive, exactly gardnerella vaginalis from clinical sample, this for early diagnosis, in time treatment and effectively control reproductive tract gardnerella vaginalis infect extremely meaningful.
In first aspect, the invention provides a kind of primer pair for detection of gardnerella vaginalis, comprise upstream primer and downstream primer, described upstream primer is one section of sequence on SEQ ID NO:1, and described downstream primer is one section of sequence on the complementary sequence of SEQ ID NO:1.
The inventor finds by research, SEQ ID NO:1 is one section of sequence on gardnerella vaginalis genome with high conservative, and than other sequence fragment on gardnerella vaginalis genome, this sequence fragment more easily increases, and the sample of taking from human body (as female sex organs) by design primer pair for this sequence fragment carries out pcr amplification can judge the infection conditions of gardnerella vaginalis.Contriver has designed multipair primer for this sequence fragment and has carried out pcr amplification, all can obtain the amplified production of expection.And carry out pcr amplification for other the several sequence fragment design primers on gardnerella vaginalis genome, do not obtain the amplified production of expection.Illustrate that SEQ ID NO:1 of the present invention is the sequence fragment that is easy to amplification, can be used in the infection of determining gardnerella vaginalis.
As the preferred technical solution of the present invention, the sequence length of described upstream primer and downstream primer is 12-30 base, for example 12 bases, 15 bases, 16 bases, 18 bases, 20 bases, 22 bases, 25 bases, 27 bases or 29 bases etc.
As the preferred technical solution of the present invention, 5 ' end of described upstream primer originates in first base of SEQ ID NO:1; 5 ' of described downstream primer is held last base complementrity of first base and SEQ ID NO:1.Wherein, first base of SEQ ID NO:1 i.e. the first base of 5 ' end, and last base i.e. the first base of 3 ' end.Such pair of primers can amplify the full length sequence of SEQ ID NO:1, and length is 219bp.
As the preferred technical solution of the present invention, the size of the pcr amplification product of described upstream primer and downstream primer is 120-219bp, for example 125bp, 138bp, 147bp, 154bp, 168bp, 179bp, 185bp, 193bp, 199bp, 208bp or 215bp, preferably 160-219bp, more preferably 189-219bp.The size of pcr amplification product is the determining positions in SEQ ID NO:1 sequence by primer pair specifically.
As the preferred technical solution of the present invention, the amplified production of described primer pair is SEQ ID NO:1, SEQ ID NO:8, SEQ ID NO:13 or SEQ ID NO:18, and size is respectively 219bp, 213bp, 200bp and 189bp.
As the preferred technical solution of the present invention, described upstream primer is selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14 or SEQ ID NO:16; Described downstream primer is selected from SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:15 or SEQ ID NO:17.Can from the concrete example of upstream primer, select a primer and a primer pairing of selecting from the concrete example of downstream primer to carry out pcr amplification.
As the preferred technical solution of the present invention, described primer pair is selected from following any one:
(a) described upstream primer is SEQ ID NO:2, and described downstream primer is SEQ ID NO:3;
(b) described upstream primer is SEQ ID NO:4, and described downstream primer is SEQ ID NO:5;
(c) described upstream primer is SEQ ID NO:6, and described downstream primer is SEQ ID NO:7;
(d) described upstream primer is SEQ ID NO:9, and described downstream primer is SEQ ID NO:10;
(e) described upstream primer is SEQ ID NO:11, and described downstream primer is SEQ ID NO:12;
(f) described upstream primer is SEQ ID NO:14, and described downstream primer is SEQ ID NO:15;
(g) described upstream primer is SEQ ID NO:16, and described downstream primer is SEQ ID NO:17.
The inventor uses 7 pairs of primers in (a)～(g) to carry out pcr amplification, obtain respectively the amplified production of 219bp, 219bp, 213bp, 213bp, 200bp, 200bp and 189bp, conform to expection, therefore can use these 7 pairs of primers as the primer pair that detects gardnerella vaginalis infection.
In second aspect, the invention provides a kind of PCR detection kit of gardnerella vaginalis, comprise the primer pair described in first aspect.
As the preferred technical solution of the present invention, described PCR detection kit also comprises PCR damping fluid, MgCl
2solution, dNTPs and Taq archaeal dna polymerase.
In the third aspect, the invention provides primer pair described in a kind of first aspect at the Auele Specific Primer of the PCR detection kit as gardnerella vaginalis or as the application in the gene chip probes sequence of gardnerella vaginalis.
Beneficial effect of the present invention is: the inventor studies the conserved sequence SEQ ID NO:1 that has found one section of gardnerella vaginalis, this section of conserved sequence is easy to amplification, there is the gardnerella vaginalis specificity of height, the primer pair that the present invention is directed to this sequences Design, use primer pair amplification clinical sample provided by the invention, can from clinical sample, detect quick, sensitive, exactly gardnerella vaginalis, for early diagnosis, in time treatment and effectively control reproductive tract gardnerella vaginalis infect extremely meaningful.
Brief description of the drawings
Fig. 1 is the pcr amplification product qualification result figure of the primer pair amplification clinical samples of the embodiment of the present invention 1, wherein swimming lane Mr is DNA Marker, the product of swimming lane 1 and 2 for increasing from clinical positive (gardnerella vaginalis infection) DNA, the negative contrast of swimming lane 3.
Fig. 2 is the sequencing result figure of the embodiment of the present invention 1 positive amplified production, and wherein, the sequence on order-checking collection of illustrative plates between the 168th C to 386 T is the sequence of PCR product, consistent with the reverse complementary sequence of estimating sequence.
Fig. 3 is Blast comparison result in the sequencing result of the embodiment of the present invention 1 positive amplified production and ncbi database.
Embodiment
Below in conjunction with embodiment, embodiment of the present invention are described in detail.It will be understood to those of skill in the art that following examples are only the preferred embodiments of the present invention, so that understand better the present invention, thereby should not be considered as limiting scope of the present invention.
Experimental technique in following embodiment, if no special instructions, is ordinary method; Experiment material used, if no special instructions, is and is purchased available from routine biochemistry chemical reagent work.
In embodiment, pMD18-T carrier, PCR buffer, MgCl
2, dNTPs, Taq archaeal dna polymerase and DNA Ligation Kit be purchased from Takara(Dalian), DNeasy Plant Mini Kit is purchased from Qiagen company.Test kit is stored in-20 DEG C, avoids multigelation as far as possible.
Embodiment 1:
The present embodiment is using ATAGGCGATTGCGCTTACGAAG(SEQ ID NO:2) and CACGTCTTCGCTTGCACAAAG(SEQ ID NO:3) as primer pair amplification clinical sample.
(1) pcr amplification reaction
Be ready to 3 PCR reaction tubess, add wherein respectively clinical positive DNA and negative control sample, add respectively subsequently 0.1 μ L Taq enzyme, 0.8 μ L dNTPs(2.5mM), 1 μ L PCR buffer (10*PCR buffer), 0.6 μ L MgCl
2(25 μ M), 0.1 μ L upstream primer (100 μ M) and 0.1 μ L downstream primer (100 μ M), use ddH
2o is supplemented to cumulative volume 10 μ L.Place on PCR instrument adding excellent PCR pipe, PCR reaction parameter (in table 1) is set, increase; After reaction finishes, identify with 1% sepharose, result is as Fig. 1, and sample size result conforms to expectation size, and negative findings is normal.
Table 1PCR reaction parameter
(2) clone of PCR product transforms
After the PCR product test kit obtaining in (1) is purified, be connected and spend the night with pMD18-T carrier with the Solution I of DNA Ligation Kit, then get 10 μ L and connect product conversion intestinal bacteria, upper in LB solid culture plate (containing 50 μ g/mL Amp), be inverted overnight incubation for 37 DEG C.
Get the positive monoclonal bacterium colony on LB culture plate, be inoculated into amplification cultivation in LB liquid nutrient medium, the qualification of checking order, sequencing result is as Fig. 2, fragment length 219bp, sequence is as shown in SEQ ID NO:1.
Blast in sequencing result and ncbi database is compared, and result as shown in Figure 3, shows the sequence complete complementary homology on itself and gardnerella vaginalis.
The present embodiment is using ATAGGCGATTGCGCTTACGAAGTTAC(SEQ ID NO:4) and CACGTCTTCGCTTGCACAAAGAC(SEQ ID NO:5) as primer pair amplification clinical sample.
Adopt system and the program of embodiment 1 to carry out pcr amplification, qualification that PCR product cloning is transformed and checked order, fragment length 219bp, sequence is as shown in SEQ ID NO:1.
The present embodiment is using GGCGATTGCGCTTACGAAGTTAC(SEQ ID NO:6) and GTCTTCGCTTGCACAAAGAC(SEQ ID NO:7) as primer pair amplification clinical sample.
Adopt system and the program of embodiment 1 to carry out pcr amplification, qualification that PCR product cloning is transformed and checked order, fragment length 213bp, sequence is as shown in SEQ ID NO:8.
Embodiment 4
The present embodiment is using GGCGATTGCGCTTACGAAG(SEQ ID NO:9) and GTCTTCGCTTGCACAAAG(SEQ ID NO:10) as primer pair amplification clinical sample.
Adopt system and the program of embodiment 1 to carry out pcr amplification, qualification that PCR product cloning is transformed and checked order, fragment length 213bp, sequence is as shown in SEQ ID NO:8.
Embodiment 5
The present embodiment is using CGCTTACGAAGTTACTTTAAAAGC(SEQ ID NO:11) and CGCTTGCACAAAGACTAAATCTTG(SEQ ID NO:12) as primer pair amplification clinical sample.
Adopt system and the program of embodiment 1 to carry out pcr amplification, qualification that PCR product cloning is transformed and checked order, fragment length 200bp, sequence is as shown in SEQ ID NO:13.
Embodiment 6
The present embodiment is using CGCTTACGAAGTTACTTTAAAAG(SEQ ID NO:14) and CGCTTGCACAAAGACTAAATC(SEQ ID NO:15) as primer pair amplification clinical sample.
Adopt system and the program of embodiment 1 to carry out pcr amplification, qualification that PCR product cloning is transformed and checked order, fragment length 200bp, sequence is as shown in SEQ ID NO:13.
Embodiment 7
The present embodiment is using CGAAGTTACTTTAAAAGCTAGTG(SEQ ID NO:16) and GCACAAAGACTAAATCTTGATTG(SEQ ID NO:17) as primer pair amplification clinical sample.
Adopt system and the program of embodiment 1 to carry out pcr amplification, qualification that PCR product cloning is transformed and checked order, fragment length 189bp, sequence is as shown in SEQ ID NO:18.
Comparative example 1
The present embodiment is using the pair of primers GslaF:CAATGCTGCGTAGTGTCTGC(SEQ ID NO:19 on Sialidase A gene) and GslaR:CCAGCGAACAAGCGTTTCAAAC(SEQ ID NO:20) as primer pair amplification clinical sample.
Expection should obtain the amplified production of 316bp, the respective segments and actual result does not increase.
Comparative example 2
The present embodiment is using the pair of primers GalfF:ATGGGCGCGAATTACGAGAT(SEQ ID NO:21 on a-L-fucosidase gene) and GalfR:GCTGTTTCAACGTGTTGTCCT(SEQ ID NO:22) as primer pair amplification clinical sample.
Expection should obtain the amplified production of 217bp, the respective segments and actual result does not increase.
Comparative example 3
The present embodiment is using the pair of primers GgalF:TTGGCATATGGTGGCGACTT(SEQ ID NO:23 on beta-galactosidase gene) and GgalR:TACTGTTCCAACGGCCACTC(SEQ ID NO:24) as primer pair amplification clinical sample.
Expection should obtain the amplified production of 311bp, the respective segments and actual result does not increase.
Comparative example 4
The present embodiment is using the pair of primers GmetF:AGCAATGTCTGTTCTCGGCAT(SEQ ID NO:25 on Methicillin resistance protein gene) and GmetR:ATCGCACTAAACCCAGCAAGAAG(SEQ ID NO:26) as primer pair amplification clinical sample.
Expection should obtain the amplified production of 330bp, the respective segments and actual result does not increase.
Comparative example 1-4 shows, on gardnerella vaginalis there is certain difficulty in the amplification of sequence, and the sequence SEQ ID NO:1 that the present invention finds is easy to amplification, high conservative, specificity is high, be suitable as and detect the target that gardnerella vaginalis infects, the primer pair for the SEQ ID NO:1 provided by the invention respective segments that can successfully increase, realizes the detection that gardnerella vaginalis infects.
Applicant's statement, the present invention illustrates detailed features of the present invention and method detailed by above-described embodiment, but the present invention is not limited to above-mentioned detailed features and method detailed, do not mean that the present invention must rely on above-mentioned detailed features and method detailed could be implemented.Person of ordinary skill in the field should understand, any improvement in the present invention is selected the selection of the equivalence replacement of component and the interpolation of ancillary component, concrete mode etc., within all dropping on protection scope of the present invention and open scope to the present invention.
Claims (10)
1. for detection of a primer pair for gardnerella vaginalis, comprise upstream primer and downstream primer, described upstream primer is one section of sequence on SEQ ID NO:1, and described downstream primer is one section of sequence on the complementary sequence of SEQ ID NO:1.
2. primer pair according to claim 1, is characterized in that, the sequence length of described upstream primer and downstream primer is 12-30 base.
3. primer pair according to claim 1 and 2, is characterized in that, 5 ' end of described upstream primer originates in first base of SEQ ID NO:1; 5 ' of described downstream primer is held last base complementrity of first base and SEQ ID NO:1.
4. primer pair according to claim 1 and 2, is characterized in that, the size of the pcr amplification product of described upstream primer and downstream primer is 120-219bp, preferably 160-219bp, more preferably 189-219bp.
5. according to the primer pair described in claim 1-4 any one, it is characterized in that, the amplified production of described primer pair is SEQ ID NO:1, SEQ ID NO:8, SEQ ID NO:13 or SEQ ID NO:18.
6. according to the primer pair described in claim 1-5 any one, it is characterized in that, described upstream primer is selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:14 or SEQ ID NO:16; Described downstream primer is selected from SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:15 or SEQ ID NO:17.
7. according to the primer pair described in claim 1-6 any one, it is characterized in that, described primer pair is selected from following any one:
(a) described upstream primer is SEQ ID NO:2, and described downstream primer is SEQ ID NO:3;
(b) described upstream primer is SEQ ID NO:4, and described downstream primer is SEQ ID NO:5;
(c) described upstream primer is SEQ ID NO:6, and described downstream primer is SEQ ID NO:7;
(d) described upstream primer is SEQ ID NO:9, and described downstream primer is SEQ ID NO:10;
(e) described upstream primer is SEQ ID NO:11, and described downstream primer is SEQ ID NO:12;
(f) described upstream primer is SEQ ID NO:14, and described downstream primer is SEQ ID NO:15;
(g) described upstream primer is SEQ ID NO:16, and described downstream primer is SEQ ID NO:17.
8. a PCR detection kit for gardnerella vaginalis, comprises the primer pair described in claim 1-7 any one.
9. test kit according to claim 8, is characterized in that, also comprises PCR damping fluid, MgCl
2solution, dNTPs and Taq archaeal dna polymerase.
10. the primer pair described in a claim 1-7 any one is at the Auele Specific Primer of the PCR detection kit as gardnerella vaginalis or as the application in the gene chip probes sequence of gardnerella vaginalis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410125746.5A CN103882134A (en) | 2014-03-31 | 2014-03-31 | Primer pair for detecting gardnerella vaginalis, kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410125746.5A CN103882134A (en) | 2014-03-31 | 2014-03-31 | Primer pair for detecting gardnerella vaginalis, kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103882134A true CN103882134A (en) | 2014-06-25 |
Family
ID=50951251
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410125746.5A Pending CN103882134A (en) | 2014-03-31 | 2014-03-31 | Primer pair for detecting gardnerella vaginalis, kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103882134A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911275A (en) * | 2015-07-13 | 2015-09-16 | 徐晶 | Bacterial vaginitis detection kit |
| CN105154570B (en) * | 2015-07-13 | 2016-06-08 | 武汉迪安医学检验所有限公司 | A kind of test kit for diagnosing colpitic gardnerella vaginalis |
| CN107058483A (en) * | 2016-12-26 | 2017-08-18 | 广州和实生物技术有限公司 | A kind of fluorescence Constant Temperature Detection kit of instant detection gardnerella vaginalis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010062001A1 (en) * | 2008-11-25 | 2010-06-03 | Goodgene Inc. | Dna chip, kit for detecting or genotyping bacteria causing sexually transmitted diseases, genotyping antibacterial drug resistance and detecting or genotyping method using the same |
| CN103333961A (en) * | 2013-06-19 | 2013-10-02 | 兰州百源基因技术有限公司 | Primer, probe and method for detecting gardnerella vaginalis and kit |
-
2014
- 2014-03-31 CN CN201410125746.5A patent/CN103882134A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010062001A1 (en) * | 2008-11-25 | 2010-06-03 | Goodgene Inc. | Dna chip, kit for detecting or genotyping bacteria causing sexually transmitted diseases, genotyping antibacterial drug resistance and detecting or genotyping method using the same |
| CN103333961A (en) * | 2013-06-19 | 2013-10-02 | 兰州百源基因技术有限公司 | Primer, probe and method for detecting gardnerella vaginalis and kit |
Non-Patent Citations (3)
| Title |
|---|
| ALEX VAN BELKUM ET.AL: "Development of a sepcies-specific polymerase chain reaction assay for gardnerella vaginalis.", <MOLECULAR AND CELLULAR PROBES>, 30 June 1995 (1995-06-30), pages 167 - 174 * |
| CARL J YEOMAN ET.AL: "Comparative genomics of gardenerella vaginalis strains reveals substantial differences in metabolic and virulence potential.", <PLOS ONE>, 26 July 2010 (2010-07-26), pages 12411 * |
| M. REZA ZARI¡ARD ET.AL: "Detection of bacterial vaginosis-related organisms by real-time PCR for Lactobacilli, Gardnerella vaginalis and Mycoplasma hominis.", <FEMS IMMUNOLOGY AND MEDICAL MICROBIOLOGY>, 31 December 2002 (2002-12-31), pages 277 - 281, XP002442546, DOI: doi:10.1111/j.1574-695X.2002.tb00634.x * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104911275A (en) * | 2015-07-13 | 2015-09-16 | 徐晶 | Bacterial vaginitis detection kit |
| CN104911275B (en) * | 2015-07-13 | 2016-02-17 | 北京医研伙伴医学研究所有限公司 | A kind of bacterial vaginitis detection kit |
| CN105154570B (en) * | 2015-07-13 | 2016-06-08 | 武汉迪安医学检验所有限公司 | A kind of test kit for diagnosing colpitic gardnerella vaginalis |
| CN107058483A (en) * | 2016-12-26 | 2017-08-18 | 广州和实生物技术有限公司 | A kind of fluorescence Constant Temperature Detection kit of instant detection gardnerella vaginalis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Endometrial microbiota in infertile women with and without chronic endometritis as diagnosed using a quantitative and reference range-based method | |
| Frazier et al. | Seroprevalence and comparison of isolates of endometriotropic bovine herpesvirus-4 | |
| CN103409558B (en) | For detecting the multiple PCR primer group of Porcine epidemic diarrhea virus, transmissible gastro-enteritis virus and porcine rotavirus simultaneously | |
| Kampa et al. | Bovine herpesvirus type 1 (BHV-1) and bovine viral diarrhoea virus (BVDV) infections in dairy herds: self clearance and the detection of seroconversions against a new atypical pestivirus | |
| CN112301169B (en) | Primer group, probe group and kit for synchronously detecting pathogens related to multiple genital tract infections | |
| Koskimaa et al. | The presence of human papillomavirus (HPV) in placenta and/or cord blood might result in Th2 polarization | |
| JP2019013254A (en) | Cell mediated immune response assay | |
| CN103882134A (en) | Primer pair for detecting gardnerella vaginalis, kit and application thereof | |
| Bala et al. | Identification of strain diversity and phylogenetic analysis based on two major essential proteins of Orf viruses isolated from several clinical cases reported in Malaysia | |
| Ebrahimi et al. | Shedding rates and seroprevalence of brucella melitensis in lactating goats of shahrekord, iran | |
| CN103882133A (en) | Primer pair for detecting ureaplasma urealyticum, kit and application thereof | |
| Monavari et al. | Detection of cytomegalovirus (CMV) antibodies or DNA sequences from ostensibly healthy Iranian mothers and their neonates | |
| Al-Rubayie et al. | Detection of border disease in ovine using ELISA in Iraq | |
| Yang et al. | Presence of gammaherpesvirus BoHV-4 in endometrial cytology samples is not associated with subclinical endometritis diagnosed at artificial insemination in dairy cows | |
| Kiravu et al. | Evaluation of CD103 (αEβ7) integrin expression by CD8 T cells in blood as a surrogate marker to predict cervical T cell responses in the female genital tract during HIV infection | |
| CN104278080A (en) | Real-time fluorescent quantitative PCR detection kit for rapidly detecting Chlamydia trachomatis and application | |
| CN103215389A (en) | Porcine reproductive and respiratory syndrome and porcine Japanese B encephalitis dual one-step RT-PCR (Reverse Transcription-Polymerase Chain Reaction) diagnosis kit | |
| Bobade et al. | Virulence gene profiling and serotyping of Listeria monocytogenes from infertility cases of women | |
| Günal et al. | A preliminary report of relationship between abortion and Q fever in Central Black Sea Region Turkish woman | |
| CN103882135A (en) | Primer pair for detecting candida albicans, kit and application thereof | |
| Perelygina et al. | Differences in establishment of persistence of vaccine and wild type rubella viruses in fetal endothelial cells | |
| CN112646900A (en) | Group B streptococcus nucleic acid colloidal gold immunochromatographic assay detection primer and kit | |
| Kosič et al. | Fetal death from SARS-CoV-2 mediated acute placental failure | |
| El-Mahallawy et al. | Coxiella burnetii infections among small ruminants in Ismailia Governorate | |
| Elhassan et al. | Bovine herpes virus-1 (BoHV-1) detection in dairy cattle with reproductive problems in Sudan. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140625 |