LU501549B1

LU501549B1 - siRNA FOR INTERFERING WITH DNALI1 GENE EXPRESSION AND USE THEREOF IN INHIBITING CELL PROLIFERATION AND MIGRATION

Info

Publication number: LU501549B1
Application number: LU501549A
Authority: LU
Inventors: Gongzhen Liu
Original assignee: Univ Linyi
Priority date: 2022-02-24
Filing date: 2022-02-24
Publication date: 2023-08-24

Abstract

The present disclosure provides an siRNA for interfering with DNALI1 gene expression and use thereof in inhibiting cell proliferation and migration. The present disclosure designs and synthesizes three pairs of siRNAs for targeted inhibition of DNALI1 gene expression, which are DNALI1-siRNA-66, DNALI1-siRNA-426, and DNALI1-siRNA-777, respectively, and expression vectors thereof in an HEK-293 cell are successfully constructed. When the siRNA provided by the present disclosure enters a cell, the DNALI1 gene expression can be effectively and specifically interfered, and thus cell proliferation and migration are effectively inhibited. The present disclosure fills in the blank that there is no siRNA sequence for interfering with DNALI1 gene expression; moreover, the siRNA can effectively interfere with the expression of target gene DNALI1, playing a role in treating or preventing possible diseases caused by DNALI1 gene expression, and laying a foundation for research on the mechanism of DNALI1 gene in cell proliferation and migration and future applied research.

Description

BL-5418 1 siRNA FOR INTERFERING WITH DNALI1 GENE EXPRESSION AND USE THEREOF | >49

IN INHIBITING CELL PROLIFERATION AND MIGRATION

TECHNICAL FIELD

[01] The present disclosure belongs to the field of molecular genetics, and particularly relates to an siRNA for interfering with DNALI1 gene expression and use thereof in inhibiting cell proliferation and migration.

BACKGROUND ART

[02] RNA interference (RNAi) is a double-stranded RNA-mediated process of post-transcriptional silencing of a homologous target gene. RNAi can induce mRNA degradation of the endogenous target gene by artificially introducing double-stranded RNA with the same sequence as the endogenous target gene, thereby achieving the objective of reducing gene expression. The

RNAi phenomenon is also a defense mechanism that is evolutionarily conservative against the transgenic or foreign virus invasion. Although the research time of RNAi technology is relatively short, the technology is an emerging gene disruption technology with high specificity, high interference efficiency, and simple operation, and is widely used in medical research on viral infection, cancer, dominant genetic diseases, and the like. Further, the technology can screen drug target genes in a high-throughput manner, and promote gene therapy and new drug development.

Therefore, small interfering RNA (siRNA) is also called a "drug for treating diseases". In recent years, scientists have used RNAI technology to select specific target genes to synthesize effective siRNAs, and transform the siRNAs into specific cells by transfection, so that the siRNAs can efficiently act in host cells and silence the expression of related genes. Such means can not only analyze the function of genes in mammals at the genomic level, but also identify a plurality of genes related to diseases more quickly, so that the network system of gene regulation in organisms can be better investigated. Therefore, the RNAi technology has become the most effective means for investigating gene functions and the most attractive method for targeted gene therapy. At present, the healing function of siRNA in pathological changes in mammalian cells, organs and living bodies indicates that RNAi will be widely used in the treatment of human diseases in the near future.

Therefore, the research and application of siRNA may have extremely important theoretical and practical significance, and will have a profound impact on the development of medical biology.

[03] Cell proliferation, migration, and invasion are changing processes of molecular biology that are involved in a plurality of factors and completed through a plurality of steps. Some cells with strong migration ability can make themselves overcome cell-cell and cell-matrix adhesion and invade surrounding tissues; strongly invasive cells usually reduce the cell-cell adhesion and

BL-5418 2 disconnect intercellular communication by a plurality of cell synapses. Therefore, research once A0 proliferation, migration, and invasion is of very great importance for diseases, cell applications, and the like.

[04] DNALII gene, located on chromosome 4 and composed of six exons, is mainly expressed in the testis. However, little research has been done on this gene so far. Hence, the function of this gene is not fully understood. Studies have found that the DNALI1 gene may play a dynamic role in flagellar movement, and expression thereof may also be associated with recurrence following surgery for hepatocellular carcinoma. Some researchers have found lower levels of DNALI1 transcript are observed in different mouse tissues (cilia and skeletal muscle). However, up to now, there has been no disclosure of siRNA sequences that interfere with DNALI1 gene expression and related research or patents.

SUMMARY

[05] An objective of the present disclosure is to provide an siRNA for interfering with DNALI1 gene expression and use thereof in inhibiting cell proliferation and migration. The present disclosure designs and synthesizes three pairs of siRNAs for targeted inhibition of the expression of

DNALII gene, and successfully constructs expression vectors thereof in HEK-293 cells; meanwhile, use of these siRNAs can effectively and specifically interfere with DNALI1 expression, thereby effectively inhibiting cell proliferation and migration.

[06] To achieve the above objective, the present disclosure is implemented by the following technical solutions:

[07] The present disclosure provides a DNALI1-siRNA-66 for interfering with DNALI1 gene expression, where the DNALI1-siRNA-66 for interfering with DNALI1 gene expression has the following nucleotide sequences:

[08] sense strand: 5’-CCGCAGACTCTTTGCTCAATT-3’ (SEQ ID NO: 1),

[09] antisense strand: S'-TTGAGCAAAGAGTCTGCGGTT-3' (SEQ ID NO: 2).

[10] The present disclosure provides a DNALI1-siRNA-426 for interfering with DNALII gene expression, where the DNALI1-siRNA-426 for interfering with DNALI1 gene expression has the following nucleotide sequences:

[11] sense strand: 5’-GCAGGGAACTCTACTCACATT-3’ (SEQ ID NO: 3),

[12] antisense strand: 5'-TGTGAGTAGAGTTCCCTGCTT-3' (SEQ ID NO: 4).

[13] The present disclosure provides a DNALI1-siRNA-777 for interfering with DNALII gene expression, where the DNALI1-siRNA-777 for interfering with DNALI1 gene expression has the following nucleotide sequences:

[14] sense strand: 5’-GAACAAATCAGCAGCTGAATT-3’ (SEQ ID NO: 5),

BL-5418 3

[15] antisense strand: 5'-TTCAGCTGCTGATTTGTTCTT-3’ (SEQ ID NO: 6). HUS0T549

[16] The present disclosure further provides use of the siRNA for interfering with DNALI1 gene expression in the preparation of a formulation for inhibiting cell proliferation and migration.

[17] Further, the use may include the following steps:

[18] step 1, transfecting the DNALII-siRNA-66, the DNALII-siRNA-426, or the

DNALI1-siRNA-777 into a cell, and lysing to obtain total RNA;

[19] step 2, synthesizing a first strand cDNA by reverse transcription using the total RNA in step 1 as a template;

[20] step 3, using the cDNA in step 2 as a template, conducting RT-PCR to detect inhibition efficiency of the DNALI1-siRNA against DNALI1 expression; and

[21] step 4, transfecting DNALI1-siRNA having the highest inhibition efficiency in step 3 into a cell to prepare a formulation for inhibiting cell proliferation and migration.

[22] Further, the DNALI1-siRNA in step 1 may have a concentration of 20 pmol.

[23] Further, the amount of the total RNA amount in step 2 may be 10 ng to 2 ug.

[24] Further, an RT-PCR system in step 3 may be 20 ul, including: 20-100 ng of a cDNA template, 1 ul of a forward primer, 1 ul of a reverse primer, and 10 ul of SuperReal PreMix. Plus, making up to 20 ul with RNase-free ddHzO.

[25] Further, an RT-PCR program in step 3 may be: initial denaturation at 95°C for 15 min; 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s.

[26] Compared with the prior art, the present disclosure has the following advantages and beneficial effects:

[27] (1) The present disclosure designs and synthesizes three pairs of siRNAs for targeted inhibition of DNALI1 gene expression, which can effectively and specifically interfere with the

DNALII expression, and fills in the blank that there is no siRNA sequence for interfering with

DNALII gene expression at present;

[28] (2) The present disclosure inhibits the cell proliferation and migration by RNAi-specific inhibition of the DNALI1 gene at the cellular level, thereby inhibiting, alleviating or preventing possible diseases caused by the DNALII gene, and laying a foundation for research on the mechanism of the DNALII gene in cell proliferation and migration and future applied research.

BRIEF DESCRIPTION OF THE DRAWINGS

[29] FIG 1 illustrates a 24-hour effect comparison of siRNA interference with DNALI1 gene expression in different DNALI1-siRNA transfected cells of the present disclosure.

[30] FIG 2 illustrates a 48-hour effect comparison of siRNA interference with DNALI1 gene expression in different DNALI1-siRNA transfected cells of the present disclosure.

BL-5418 4

[31] FIG 3 illustrates a comparison of cell proliferation ability in different DNALII-siRNA 549 transfected groups of the present disclosure.

[32] FIG 4 illustrates a comparison of cell migration ability in different DNALI1-siRNA transfected groups of the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[33] The technical solutions of the present disclosure will be further described in detail below in conjunction with specific examples.

[34] Example 1: Design and synthesis of siRNA target sequences

[35] The DNALII gene sequence was obtained from GenBank. According to the siRNA design principle, three interfering target sequences were screened, designed and synthesized for the conservative region of DNALI1 gene sequence, and named as DNALI1-siRNA-66,

DNALI1-siRNA-426, and DNALI1-siRNA-777, respectively. At the same time, nonsense sequences that were not directed to any gene were designed to serve as a negative control (siFAM).

The sequences are shown in Table 1.

[36] Table 1 The design and synthesis of siRNA sequences

Gene siRNA name Sense (57-37) Antisense (57-3) name

DNALI11-siRNA-66 ~~ CCGCAGACTCTTTGCTCAATT TTGAGCAAAGAGTCTGCGGTT (SEQ ID NO: 1) (SEQ ID NO: 2)

DNALI11-siRNA-426 GCAGGGAACTCTACTCACATT TGTGAGTAGAGTTCCCTGCTT (SEQ ID NO: 3) (SEQ ID NO: 4)

DNALI1

DNALI11-siRNA-777 GAACAAATCAGCAGCTGAATT TTCAGCTGCTGATTTGTTCTT (SEQ ID NO: 5) (SEQ ID NO: 6) siFAM ACGTGACACGTTCGGAGAATT ACGTGACACGTTCGGAGAATT (SEQ ID NO: 7) (SEQ ID NO: 8)

[37] Example 2: Cell culture and transfection

[38] Using Dulbecco's Modified Eagle Medium (DMEM) supplemented with fetal bovine serum (FBS) and antibiotics, HEK-293 cells were cultured in a constant temperature incubator containing 5% CO; at 37°C; as the cell growth rate reached 70-90%, the cells were digested with 0.25% trypsin and passed. One day before transfection, the cells were seeded on a 24-well plate at 4-5 x 10* cells/well, and 0.5 ml of DMEM was added to each well. During transfection, 20 pmol of

DNALI1-siRNA was added to 50 ul of serum-free DMEM, and gently mixed well; meanwhile, 1 ul of Lipofectamin 2000 reagent was diluted with 50 ul of serum-free DMEM, gently mixed well, and

BL-5418 5 allowed to stand at room temperature for 5 min. Subsequently, the diluted DNALII-siRNAs was 9 gently mixed well with the transfection reagent, and allowed to stand at room temperature for 20 min to form an siRNA/Lipofectamin 2000 complex. 100 ul of the complex was added to a 24-well plate containing cells, and the cell culture plate was gently shaken back and forth. The cells were incubated in a 5% CO» incubator at 37°C for 24-48 h, and the cells were collected for other detection after transfection. If the cell line is sensitive, the complex may be removed, and the medium may be changed 4-6 h after incubation.

[39] Example 3: Detection of inhibition efficiency of siRNA

[40] (1) Total RNA extraction

[41] Directly, the cells were lysed by adding TRNzol reagent (11 ml/well) to the culture plate, and a sampler was used for pipetting several times; a homogenate sample was allowed to stand at 15-30°C for 5 min to completely separate a nucleic acid-protein complex. Every time 1 ml of

TRNzol was consumed, 0.2 ml of chloroform was added; tube cap was covered; the tube was shaken vigorously for 15 s, allowed to stand at room temperature for 3 min, placed in a 4°C centrifuge for centrifugation at 12,000 rpm for 10-15 min. At the moment, the sample was divided into three layers: yellow organic phase, intermediate layer, and upper colorless aqueous phase; RNA was mainly in the aqueous phase, and the aqueous phase (about 600 ul) was transferred to a new centrifuge tube. An equal volume of isopropanol was added to the resulting aqueous phase solution and mixed well; the mixture was allowed to stand at room temperature for 20-30 min, and centrifuged at 4°C and 12,000 rpm for 10 min to discard the supernatant. The pellets were washed with 1 ml of 75% ethanol, and centrifuged at 4°C and 5,000 rpm for 3 min to discard the supernatant. After the pellets were left to dry at room temperature, the mixture was mixed with 30-100 ul of RNase-free ddH,O, pipetted and mixed well repeatedly to sufficiently dissolve the

RNA.

[42] (2) Synthesis of first strand cDNA by reverse transcription

[43] Template RNA was thawed on ice; 5x gDNA Buffer, FQ-RT Primer Mix, 10x Fast RT

Buffer, and RNase-free ddH,O were thawed at room temperature, respectively, and quickly placed on ice after thawing. Before use, each solution was vortexed, mixed well, and briefly centrifuged to collect the fluid remaining on the tube wall. A mixture was prepared according to the genomic DNA removal system in Table 2, followed by thoroughly mixing. The mixture was centrifuged briefly, incubated at 42°C for 3 min, and placed on ice.

[44] __ Table 2 gDNA removal reaction system

Composition System 5xgDNA Buffer 2 ul

Total RNA 10 ng-2 ug

BL-5418 6

RNase-Free ddH,O To 10 ul 001568

[45] The mixture was prepared according to the reverse transcription reaction system in Table 3.

The mixture in the reverse transcription reaction was added to the reaction mixture in the gDNA removal step, and thoroughly mixed. After incubation at 42°C for 15 min and at 95°C for 3 min, cDNA was obtained and stored at low temperature.

[46] Table 3 The reverse transcription reaction system

Composition System 10x Fast RT Buffer 2 ul

RT Enzyme Mix Iw

FQ-RT Primer Mix 2 ul

RNase-Free ddH,O To 10 ul

[47] (3) Fluorescence quantitative PCR experiment

[48] The reaction mixture was prepared on ice according to the RT-PCR system in Table 4, and all reagents were mixed at room temperature and thoroughly mixed.

[49] Table 4 RT-PCR system

Composition 20 pl System 2x SuperReal PreMix Plus 10 ul

Forward primer (10 uM) 0.6 ul

Reverse primer (10 uM) 0.6 ul cDNA template 20-100 ng

RNase-Free ddH,O To 20 ul

[50] The reaction system was placed in a fluorescence quantitative PCR detection system, and set up according to the RT-PCR program in Table 5 to start the reaction. [S1] Table 5 RT-PCR program

Stage Number of Temperature Time Content Fluorescence signal cycles acquisition

Initial 1x 95°C 15 Initial No denaturation min denaturation

PCR 40% 95°C 10s Denaturation No 60°C 30s Annealing Yes 72°C 30s Extension No

Melting/Dissociation Curve Stage

[52] The results of RT-PCR detection of siRNA interference with DNALI1 gene expression are shown in FIGS. 1 to 3. The results showed that compared with the control group, the expression

BL-5418 7 levels of DNALI1 mRNA in three DNALI1-siRNA transfection groups were lower than those inthe 549 control group at 24 and 48 h; herein, the DNALI1 gene expression level was minimized at 48 h in the DNALI1-siRNA-66 group, followed by DNALII-siRNA-777, indicating that the

DNALI1-siRNA-66 had the highest interference efficiency with DNALII gene at 48 h and the best effect.

[53] Example 4: Cell proliferation assay

[54] The cells transfected with DNALI1-siRNA-66 were mixed with 100 ul of cell suspension in each well of a 96-well plate, where six replicate wells were set and the cells were cultured overnight in a constant temperature incubator containing 5% CO» at 37°C; at 1-7 after culture, 10 ul of CCK8 was added to each well and the cells were incubated in the constant temperature incubator containing 5% CO» at 37°C for 2 h; a microplate reader was used to measure the absorbance value (OD450) of each well at 450 nm; cell proliferation curves were plotted as a function of the absorbance value versus time (days).

[55] The results of detection of cell proliferation by CCK-8 are shown in FIG 3. Compared with the control group, the proliferation ability of the cells after silencing the DNALI1 expression was gradually weakened with time, indicating that siRNA interference with DNALII gene expression can inhibit cell proliferation ability.

[56] Example 5: Cell migration assay

[57] Target DNALI1-siRNA-66 transfected cells effectively interfered by siRNA and control cells were selected for culture; cells transfected with DNALI1-siRNA in log phase were routinely digested and centrifuged, the supernatant was discarded, the cells were suspended with serum-free

DMEM to prepare a single cell suspension, and the density was adjust to 5 x 10° cells/ml. 200 ul of the cell suspension was added to the upper layer of each Transwell chamber, and 700 ul of DMEM supplemented with 10% FBS was added along the inner wall of the lower layer to avoid bubbling; incubation was carried out in a constant temperature incubator containing 5% CO; at 37°C for 16 h.

The Transwell chambers were removed, the cells were carefully wiped off the upper surface of the chamber filter membrane with a cotton swab; the chamber was fixed in methanol for 15 min, washed with PBS thrice to remove residual methanol, and stained in 0.2% crystal violet stain for 20 min, and washed thrice with PBS to remove excess stain, and the cells were observed and photographed under a microscope.

[58] The results of the cell migration observed by the Transwell migration assay are shown in

FIG 4. Compared with the control group, the migration ability of the cells after the siRNA interference with the DNALII gene expression was weakened.

[59] The above examples are only intended to illustrate, but not to limit, the technical solutions of the present disclosure; although the present disclosure has been described in detail with reference

BL-5418 8 to the foregoing examples, for those of ordinary skill in the art, the technical solutions of a foregoing examples may still be modified, or some of the technical features may be equivalently substituted; these modifications or substitutions do not cause the essence of the corresponding technical solutions to depart from the spirit and scope of the technical solutions claimed by the present disclosure.

BL-5418 9

LU501549

SEQUENCE LISTING

<110> Shandong Institute of parasitic Diseases <120> siRNA FOR INTERFERING WITH DNALI1 GENE EXPRESSION AND USE

THEREOF

IN INHIBITING CELL PROLIFERATION AND MIGRATION

<130> HKJU202112912 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the sense strand for DNALI11-siRNA-66 <400> 1 ccgeagactce tttgetcaat t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the antisense strand for DNALI11-siRNA-66 <400> 2

BL-5418 10

LU501549 ttgagcaaag agtctgcget t 21 <210> 3 <I> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the sense strand for DNALI11-siRNA-426 <400> 3 gcagggaact ctactcacat t 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the antisense strand for DNALI11-siRNA-426 <400> 4 tgtgagtaga gttccetget t 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the sense strand for DNALI11-siRNA-777

BL-5418 11

LU501549 <400> 5 gaacaaatca gcagctgaat t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the antisense strand for DNALI11-siRNA-777 <400> 6 ttcagctect gatttgttet t 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the sense strand for siFAM <40@> 7 acgtgacacg ttcggagaat t 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of the antisense strand for siFAM

BL-5418 12

LU501549 <400> 8 acgtgacacg ttcggagaat t 21

Claims

BL-5418 13 CLAIMS LU501549

1. Use of an siRNA for interfering with DNALI1 gene expression in the preparation of a formulation for inhibiting cell proliferation and migration, wherein the cell is an HEK-293 cell; the siRNA for interfering with DNALII gene expression is DNALI1-siRNA-66, DNALI1-siRNA-426, or DNALI1-siRNA-777; the DNALI1-siRNA-66 for interfering with DNALI1 gene expression has the following target sequences: sense strand: 5’-CCGCAGACTCTTTGCTCAATT-3’ (SEQ ID NO: 1), antisense strand: 5-TTGAGCAAAGAGTCTGCGGTT-3' (SEQ ID NO: 2); the DNALI1-siRNA-426 for interfering with DNALI1 gene expression has the following target sequences: sense strand: 5’-GCAGGGAACTCTACTCACATT-3’ (SEQ ID NO: 3), antisense strand: 5'-"TGTGAGTAGAGTTCCCTGCTT-3' (SEQ ID NO: 4); the DNALI1-siRNA-777 for interfering with DNALI1 gene expression has the following target sequences: sense strand: 5’-GAACAAATCAGCAGCTGAATT-3’ (SEQ ID NO: 5), antisense strand: 5'-TTCAGCTGCTGATTTGTTCTT-3' (SEQ ID NO: 6); and the use specifically comprises the following steps: step 1, transfecting the DNALII-siRNA-66, the DNALI1-siRNA-426, or the DNALI1-siRNA-777 into a cell, and lysing to obtain total RNA; step 2, synthesizing a first strand cDNA by reverse transcription using the total RNA in step 1 as a template; step 3, using the cDNA in step 2 as a template, conducting RT-PCR to detect inhibition efficiency of the DNALI1-siRNA against DNALI1 expression; and step 4, transfecting DNALI1-siRNA having the highest inhibition efficiency in step 3 into a cell to prepare a formulation for inhibiting cell proliferation and migration.

2. The use according to claim 1, wherein the DNALI1-siRNA in step 1 has a concentration of 20 pmol.

3. The use according to claim 1, wherein the amount of the total RNA in step 2 is 10 ng to 2 ug.

4. The use according to claim 1, wherein an RT-PCR system in step 3 is 20 ul, comprising: 20-100 ng of a cDNA template, 1 pl of a forward primer, 1 ul of a reverse primer, and 10 pl of

BL-5418 14 LU501549 SuperReal PreMix. Plus, making up to 20 ul with RNase-free ddH,O.

5. The use according to claim 1, wherein an RT-PCR program in step 3 is: initial denaturation at 95°C for 15 min; 40 cycles of denaturation at 95°C for 10 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s.