CN113855696B

CN113855696B - siRNA for targeted inhibition of circ LATS2 gene expression and application thereof

Info

Publication number: CN113855696B
Application number: CN202111258811.8A
Authority: CN
Inventors: 张世能; 郑丹丹; 黄凤婷; 庄燕妍
Original assignee: Sun Yat Sen Memorial Hospital Sun Yat Sen University
Current assignee: Sun Yat Sen Memorial Hospital Sun Yat Sen University
Priority date: 2021-10-26
Filing date: 2021-10-26
Publication date: 2022-09-06
Anticipated expiration: 2041-10-26
Also published as: CN113855696A

Abstract

The invention relates to the technical field of biology, and particularly discloses siRNA for targeted inhibition of circLATS2 gene expression and application thereof. The invention provides an application of a cyclic RNA circ0007590 inhibitor in preparing a medicament for treating pancreatic cancer, wherein the cyclic RNA circ0007590 inhibitor comprises at least one of si-circLATS2-1, si-circLATS2-2 and si-circLATS2-3 for inhibiting the expression of a circ LATS2 gene, and three siRNAs have higher interference efficiency (> 70%); in the HPAF-II cell line, the proliferation, migration and invasion levels of pancreatic cancer cells are obviously inhibited by knocking down the expression level of the circular RNA circ0007590, namely the growth of pancreatic cancer cell lines can be inhibited by down-regulating the expression level of the circular RNA circ 0007590.

Description

siRNA for targeted inhibition of circ LATS2 gene expression and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to siRNA for targeted inhibition of circLATS2 gene expression and application thereof.

Background

Small RNA interference (RNAi) technology is a new approach to suppress gene expression developed in recent years, which is a post-transcriptional silencing process of sequence-specific genes widely present in organisms, initiated by double-stranded RNA (dsrna) homologous to the target gene sequence. The high specificity of RNAi action may specifically inhibit pathogenic mutant alleles without affecting normal allele functions, so RNAi has wide application foreground in gene therapy.

The RNAi mechanism of action is that after double-stranded RNA (dsRNA) is introduced into cells, the dsRNA is cracked into small interfering RNA (siRNA) consisting of 21-25 nucleotides under the action of Dicer enzyme, and the small interfering RNA (siRNA) is combined with intracellular exonuclease, melting enzyme, Argonaute protein and the like to form a ribonucleotide protein complex RISC (RNA-induced thinning complex) with a plurality of subunits, so that the degradation of endogenous homologous mRNA of the cells is mediated in a high-efficiency progressive mode. In mammalian cells, introduction of long double-stranded RNA leads to broad suppression of gene expression, direct application of short double-stranded siRNA mediates RNAi with the same high efficiency, and avoids nonspecific gene suppression effects. The short double-chain siRNA is easy to synthesize by a chemical method, simple and convenient to operate, high in transfection efficiency, small in toxic and side effects on cells or tissues, convenient to prepare in large scale and convenient to apply clinically, and has irreplaceable advantages in the aspect of drug development.

However, due to the influence of factors such as the base distribution of siRNA, the size of free energy at two ends, the secondary structure of target mRNA and the like, the siRNA targeting different targets of the same gene mRNA has obviously different effects of closing gene expression. In the experiment of siRNA silencing specific gene, in order to ensure that siRNA can efficiently degrade target mRNA, multiple siRNAs with different sequences are generally designed and synthesized aiming at the target gene, and effective sequences are screened out from the siRNA. Design and screening of effective siRNA sequence is one of the key points of siRNA mediated RNAi experiment.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provide siRNA for targeted inhibition of circ LATS2 gene expression and application thereof. The siRNA sequence designed by the invention has higher interference efficiency (> 70%), reduces the expression level of cyclic RNA circ0007590, and further inhibits the proliferation, migration and invasion levels of pancreatic cancer cells.

In order to realize the purpose, the invention adopts the technical scheme that:

the invention provides application of a circular RNA circ0007590 inhibitor in preparation of a medicament for treating pancreatic cancer, wherein a parent gene corresponding to the circular RNA circ0007590 is LATS2 gene, and the circular RNA circ0007590 inhibitor comprises siRNA for inhibiting circLATS2 gene expression.

As a preferred embodiment of the application of the invention, the siRNA comprises at least one of si-circLATS2-1, si-circLATS2-2 and si-circLATS2-3, the sequence of the si-circLATS2-1 is shown in SEQ ID NO.1, the sequence of the si-circLATS2-2 is shown in SEQ ID NO.2, and the sequence of the si-circLATS2-3 is shown in SEQ ID NO. 3.

The invention designs specific siRNA based on circular RNA circ0007590, and experiments show that in an HPAF-II cell line, the expression level of knocking down circular RNAcir 0007590 obviously inhibits the proliferation, migration and invasion levels of pancreatic cancer cells, namely the growth of pancreatic cancer cell strains can be inhibited by down-regulating the expression of circular RNA circ 0007590.

In a second object, the present invention provides a therapeutic agent for pancreatic cancer, which comprises a cyclic RNA circ0007590 inhibitor.

As a preferred embodiment of the therapeutic agent for pancreatic cancer according to the present invention, the therapeutic agent further comprises a pharmaceutically acceptable carrier.

In the above embodiments, the pharmaceutically acceptable carrier includes any and all physiologically compatible solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Examples of pharmaceutically acceptable carriers include one or more of water, saline, phosphate buffered saline, dextran, glycerol, ethanol, and the like, and combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols, or sodium chloride in the composition. The pharmaceutically acceptable carrier may also contain minor amounts of auxiliary substances which enhance the shelf life or effectiveness of the antibody or antibody portion, such as wetting or emulsifying agents, preservatives or buffers.

In a third object, the invention provides siRNA for targeted inhibition of circLATS2 gene expression, which comprises at least one of si-circLATS2-1, si-circLATS2-2 and si-circLATS2-3, wherein the sequence of the si-circLATS2-1 is shown in SEQ ID NO.1, the sequence of the si-circLATS2-2 is shown in SEQ ID NO.2, and the sequence of the si-circLATS2-3 is shown in SEQ ID NO. 3.

The three siRNAs designed by the invention have higher interference efficiency (> 70%), and the interference efficiency of si-circLATS2-1 and si-circLATS2-2 can reach 80%.

As a preferred embodiment of the siRNA for targeted inhibition of circLATS2 gene expression, the nucleotide sequence of the circLATS2 gene is shown in SEQ ID NO. 4.

The fourth purpose of the invention is to provide the application of the siRNA in preparing a medicament for treating pancreatic cancer.

Compared with the prior art, the invention has the following beneficial effects:

the invention provides an application of a cyclic RNA circ0007590 inhibitor in preparing a medicament for treating pancreatic cancer, wherein the cyclic RNA circ0007590 inhibitor comprises at least one of si-circLATS2-1, si-circLATS2-2 and si-circLATS2-3 for inhibiting circLATS2 gene expression, three siRNAs have higher interference efficiency (> 70%), and the interference efficiency of si-circLATS2-1 and si-circLATS2-2 can reach 80%; in the HPAF-II cell line, the proliferation, migration and invasion levels of pancreatic cancer cells are obviously inhibited by knocking down the expression level of the circular RNA circ0007590, namely the growth of pancreatic cancer cell lines can be inhibited by down-regulating the expression level of the circular RNA circ 0007590.

Drawings

FIG. 1 is a graph showing the results of detecting the expression level of circular RNA circ0007590 in HPAF-II cell line using qRT-PCR;

FIG. 2 is a graph showing the change in proliferation potency of the pancreatic cancer cell line HPAF-II following the detection of interference with circLATS2 using the CCK-8 assay using si-circLATS2-1, si-circLATS2-2 and si-circLATS 2-3;

FIG. 3 is a graph showing the change in migration ability of the pancreatic cancer cell line HPAF-II after interference with circLATS2 using si-circLATS2-1, si-circLATS2-2, and si-circLATS2-3 using the transwell migration assay (100 μm lower right subscript);

FIG. 4 is a graph showing the change in the ability of a transwell invasion assay to detect interference with the pancreatic carcinoma cell line HPAF-II following the use of si-circLATS2-1, si-circLATS2-2, and si-circLATS2-3 to circLATS2 (100 μm lower right).

Detailed Description

To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments.

In the following examples, the experimental methods used were all conventional methods unless otherwise specified, and the materials, reagents and the like used were commercially available unless otherwise specified.

The gene circLATS2 gene (583nt) corresponding to the circular RNA circ0007590 is selected as a target gene, and the nucleotide sequence of the circLATS2 gene (> hsa _ circ _ 0007590; NM _ 014572; 583nt) is shown in SEQ ID NO. 4.

Example 1

1. Design of siRNA

1) Starting from the AUG start code of the transcript (hsa-circ-0007590), an "AA" duplex was searched and the 19 base sequence at the 3' end was noted as a potential siRNA target site, and both the sense and antisense strands were designed using these 19 bases (excluding AA).

2) Selection of the sequence of interest near the initiation codon or the nonsense region is avoided.

3) The GC content of the siRNA sequence should be about 30% -60%.

4) The design of siRNA is not directed to the 5 'and 3' non-coding regions (UTRs) because of the abundance of regulatory protein binding regions in these regions, and these UTR binding proteins or translation initiation complexes may affect the binding of the siRNA endonuclease complex to the target RNA, and thus the effect of the siRNA.

5) The selected sequences are compared in public databases to ensure that the sequence of interest has no homology to other genes.

6) Potential sequences were compared to the corresponding genomic database, excluding those sequences homologous to other coding sequences/ESTs.

7) Selecting proper target sequences for synthesis, and designing siRNA of 3 target sequences in total to find the most effective siRNA sequence.

Negative control design: the siRNA as a negative control should have the same composition as the selected siRNA sequence but no significant homology to the target gene, and it is common practice to scramble the selected siRNA sequence and also to check whether it has homology to other genes.

2. Preparation of siRNA

The product is produced under the quality standard of ISO9001, and the product is accurately quantified by a spectrophotometer and subjected to CGE purity detection. The double-stranded siRNA existing above contained > 90% and obtained si-circLATS2-1, si-circLATS2-2 and si-circLATS2-3, the nucleotide sequences of which are shown in Table 1.

TABLE 1

Name (R)	Sequence (5 '-3')
		si-circLATS2-1	TATTACCAGAAAGGCTGGA(SEQ ID NO.1)
si-circLATS2-2	ATTACCAGAAAGGCTGGAC(SEQ ID NO.2)
		si-circLATS2-3	TTACCAGAAAGGCTGGACT(SEQ ID NO.3)

3. Transfection of siRNA

Solution A: mix 250 μ l serum free medium +5 μ l lipo2000 and stand for 5 min.

And B, liquid B: 250 μ l serum free medium +5 μ l siRNA (one of si-circLATS2-1, si-circLATS2-2 and si-circLATS 2-3).

Adding solution B into solution A, mixing to obtain solution C, standing at room temperature for 20min, adding solution C into six-well plate, mixing, culturing for 6 hr, replacing complete culture medium containing 10% FBS, and spreading 6-well plate for 12 hr in advance to obtain 2.5 × 10 ⁵ HPAF-II cells were transfected by changing 1.5ml of serum-free medium per well after reaching 30% density, and grouped into si-NC group, si-circLATS2-1 group, si-circLATS2-2 group and si-circLATS2-3 group, and RNA was extracted 72 hours after transfection of siRNA.

4. Extraction of RNA

1. Cracking

Cell extraction RNA is removed from the culture solution in the culture dish, 1ml of TRIzol is added, the cell is moved to an EP tube after falling off, the cell is fully blown and beaten and mixed evenly, and the cell is incubated on ice for 15 min;

2. phase separation

1) Adding 200 μ l chloroform into 1ml TRIzol, shaking the tube with hand for 15s, and incubating on ice for 2-3 min;

2) centrifuging: placing the EP tube in a centrifuge at 12000g × 15min at 2-8 deg.C;

3) after centrifugation, the mixture separated into a lower red phenol-chloroform phase, an intermediate phase and an upper colorless water phase, wherein the RNA is present in the aqueous phase;

RNA precipitation

1) Transferring the aqueous phase obtained above to a new tube; note: when the water phase is transferred, the gun tip moves downwards along with the downward movement of the liquid level, the disturbance of layering is avoided, the slow suction is carried out, the suction to the intermediate phase and the lower organic phase is avoided, and about 400 mu l of suction is obtained;

2) adding 500 μ l isopropanol, mixing, and incubating on ice for 10 min;

3) centrifuging: centrifuging at 12000rpm for 10min at 2-8 deg.C;

4) white precipitates are formed on the side surface and the bottom of the tube after centrifugation; note: if the RNA precipitation is less, the centrifugation time can be properly increased;

RNA washing

1) Discarding the supernatant, adding 1ml of 75% ethanol for washing; note: adding 75% ethanol gently, keeping the RNA precipitate in situ as far as possible without blowing off the RNA precipitate;

2) centrifuging: centrifuging at 7500rpm at 2-8 deg.C for 5 min;

3) removing supernatant by suction, drying at room temperature for 5-10min, dissolving with RNase free water, and storing at-70 deg.C; note: close attention was paid to the degree of drying of the RNA pellet, not to complete drying. RNA precipitate with optimal dryness was white translucent.

5. Measuring concentration

Taking 2 μ l RNA precipitate in an enzyme labeling instrument, taking RNase-free water as a blank control, and measuring OD260/280 value (the OD260/280 value is regarded as high purity at 1.8-2.0); the concentrations were adjusted to about 500ng/ml, and too high a concentration was measured after dilution.

Note: extracting RNA, transferring to-80 deg.C, converting to DNA, and transferring to-20 deg.C;

6. reverse transcription

10ul line 500ng RNA +2ul 5 XT Buffer + RNAfree water

Reverse transcription conditions: 15min at 37 ℃; 5s at 85 ℃; storing at 4 ℃;

7. real-time quantitative pcr (qpcr):

1) prepare 1.5ml EP tubes on ice (several tubes for several genes, each labeled with gene type);

2) taking out the primer and the cDNA in a refrigerator at the temperature of-20 ℃, melting, and preparing a reaction system;

the sequence of the upstream primer is as follows: CCCGCGTAATGGCTGAGCA (SEQ ID NO. 5);

the sequence of the downstream primer is as follows: GATCGTGTGACGCAAGTCAAG (SEQ ID NO. 6).

10ul reaction system ═ 1ul cDNA +9ul (3.2ul water +5ul 2 XSYBR +0.4ul upstream primer +0.4ul downstream primer)

3) The PCR Program was chosen as follows:

95.0 ℃, 00: 30-cycle 2:95.0 ℃, 00: 05-cycle 1:60.0 ℃, 00: 30-cycle 1:72.0 ℃, 00: 30; for a total of 40 cycles.

RNAi interference efficiency test results refer to figure 1, RNA is extracted after siRNA is transfected for 72h, the expression quantity of circ _0007590 is detected by adopting a qRT-PCR method, a si-NC group is used as a control group, beta-actin is used as an internal reference gene, wherein the si-circLATS2-1 group, the si-circLATS2-2 group and the si-circLATS2-3 group can obviously inhibit the expression of LATS2 genes, and the effect of inhibiting the expression of LATS2 genes by the si-circLATS2-1 group is optimal.

The three siRNA sequences designed by the invention have higher interference efficiency (> 70%), the interference efficiency of si-circLATS2-1 and si-circLATS2-2 can reach 80%, and the experimental result refers to FIG. 1.

Example 2

The invention adopts CCK-8 experiment to research the proliferation capacity of HPAF-II cell line after siRNA interference of circLATS 2. The experimental raw data are shown in table 2. The results of the experiment are shown in FIG. 2. The specific experimental method is as follows:

removing the culture medium, washing with PBS for 2 times, adding pancreatin for digestion, adding the culture medium, and blowing to disperse and mix the cells; count by adding 20ul of cell suspension to the cell count plate. Preparation of 2X 10 ⁴ Cell suspension in ml, at 9100ul of cell suspension was added to each well of the 6-well plate. Incubation was continued for 3h with the mixed medium of CCK-8: complete medium (1: 10) replaced at 0, 24, 48, 72, 96h after plating, respectively. The absorbance value (OD value) was measured at 450nm using an enzyme-linked immunoassay analyzer (Thermo MK3, USA). GraphPad mapping was applied.

TABLE 2

As can be seen from FIG. 2, the OD450 over time (24 hours to 96 hours) was lower compared to si- -NC, si-circLATS2-1, si-circLATS2-2, and si-circLATS2-1 and si-circLATS 2-3.

Example 3

The invention adopts a transwell migration experiment to explore and research the migration capacity of the HPAF-II cell line after siRNA interference with circLATS 2.

After the cells had been cultured to a logarithmic growth phase, the cells were digested, washed once with PBS followed by serum-free medium, suspended in serum-free medium, counted and adjusted to a concentration of 2X 10 ⁵ Per ml; 600-800. mu.l of a culture medium containing 10% FBS was added to the lower chamber (i.e., the bottom of the 24-well plate), 100. mu.l of a cell suspension was added to the upper chamber, and the incubation was continued for 24 hours in the incubator; carefully taking out the chamber with forceps, blotting the upper chamber liquid, transferring to a well into which about 800. mu.l of 4% paraformaldehyde was previously added, and fixing at room temperature for 30 minutes; taking out chamber, sucking dry the fixing liquid in the upper chamber, transferring to a hole which is pre-added with about 800 microliter of 0.1% crystal violet, and dyeing for 30 minutes at room temperature; washing and soaking the upper chamber with clear water for a plurality of times, taking out the chamber, sucking the liquid in the upper chamber, and carefully wiping off the cells on the surface of the membrane at the bottom of the upper chamber by using a wet cotton stick; take pictures under microscope. The results of the experiment are shown in FIG. 3.

Example 4

The invention adopts a transwell invasion experiment to explore and research the invasion capacity of the HPAF-II cell line after siRNA interference with circLATS 2.

Melting the Matrigel glue at 4 ℃ overnight; diluting Matrigel with a serum-free medium pre-cooled at 4 ℃ to a final concentration of 1mg/ml, and performing an ice operation; in the chamber bottomAdding 100. mu.l of diluted Matrigel vertically, and incubating at 37 ℃ for 4-5 hours to dry into a gel; digesting the cells with pancreatin, washing the cells with PBS and then with serum-free medium, suspending the cells with serum-free medium, counting, adjusting the concentration to 2X 10 ⁵ Per ml; 600-800. mu.l of a culture medium containing 10% FBS was added to the lower chamber (i.e., the bottom of the 24-well plate), 100. mu.l of a cell suspension was added to the upper chamber, and the incubation was continued for 24 hours in the incubator; carefully take out the chamber with forceps, suck the upper chamber liquid dry, move to a well pre-filled with about 800. mu.l of 4% paraformaldehyde, and fix for 30 minutes at room temperature; taking out chamber, sucking dry the fixing liquid in the upper chamber, transferring to a hole which is pre-added with about 800 μ l of 0.1% crystal violet, and dyeing for 30 minutes at room temperature; washing and soaking the upper chamber with clear water for a plurality of times, taking out the chamber, sucking the liquid in the upper chamber, and carefully wiping off the cells on the surface of the membrane at the bottom of the upper chamber by using a wet cotton stick; take pictures under microscope. The results of the experiment are shown in FIG. 4.

In the HPAF-II cell line, the proliferation, migration and invasion levels of pancreatic cancer cells are obviously inhibited by knocking down the expression level of the circular RNA circ0007590, namely the growth of pancreatic cancer cell lines can be inhibited by down-regulating the expression level of the circular RNA circ 0007590.

Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.

SEQUENCE LISTING

<110> grand era memorial Hospital of Zhongshan university

<120> siRNA for targeted inhibition of circLATS2 gene expression and application thereof

<130> 2021.10.19

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 1

tattaccaga aaggctgga 19

<210> 2

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 2

attaccagaa aggctggac 19

<210> 3

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 3

ttaccagaaa ggctggact 19

<210> 4

<211> 583

<212> DNA

<213> Artificial Synthesis

<400> 4

gctggactct gtgaagctga gcaggagcag atgcggaaga tcctctacca gaaagagtct 60

aattacaaca ggttaaagag ggccaagatg gacaagtcta tgtttgtcaa gatcaaaacc 120

ctggggatcg gtgcctttgg agaagtgtgc cttgcttgta aggtggacac tcacgccctg 180

tacgccatga agaccctaag gaaaaaggat gtcctgaacc ggaatcaggt ggcccacgtc 240

aaggccgaga gggacatcct ggccgaggca gacaatgagt gggtggtcaa actctactac 300

tccttccaag acaaagacag cctgtacttt gtgatggact acatccctgg tggggacatg 360

atgagcctgc tgatccggat ggaggtcttc cctgagcacc tggcccggtt ctacatcgca 420

gagctgactt tggccattga gagtgtccac aagatgggct tcatccaccg agacatcaag 480

cctgataaca ttttgataga tctggatggt cacattaaac tcacagattt cggcctctgc 540

actgggttca ggtggactca caattccaaa tattaccaga aag 583

<210> 5

<211> 19

<212> DNA

<213> Artificial Synthesis

<400> 5

cccgcgtaat ggctgagca 19

<210> 6

<211> 21

<212> DNA

<213> Artificial Synthesis

<400> 6

gatcgtgtga cgcaagtcaa g 21

Claims

1. The application of the circular RNA circ0007590 inhibitor in preparing the medicine for treating pancreatic cancer is characterized in that a parent gene corresponding to the circular RNA circ0007590 is LATS2 gene, and the circular RNA circ0007590 inhibitor is at least one of si-circLATS2-1 shown in SEQ ID NO.1, si-circLATS2-2 shown in SEQ ID NO.2 and si-circLATS2-3 shown in SEQ ID NO. 3.

2. A therapeutic drug for pancreatic cancer, which comprises a cyclic RNA circ0007590 inhibitor, wherein the cyclic RNA circ0007590 inhibitor is at least one of si-circLATS2-1 shown in SEQ ID NO.1, si-circLATS2-2 shown in SEQ ID NO.2, and si-circLATS2-3 shown in SEQ ID NO. 3.

3. The therapeutic of claim 2 further comprising a pharmaceutically acceptable carrier.

4. An siRNA for targeted inhibition of circLATS2 gene expression, which comprises at least one of si-circLATS2-1, si-circLATS2-2 and si-circLATS2-3, wherein the sequence of the si-circLATS2-1 is shown as SEQ ID NO.1, the sequence of the si-circLATS2-2 is shown as SEQ ID NO.2, and the sequence of the si-circLATS2-3 is shown as SEQ ID NO. 3.

5. The siRNA of claim 4 wherein the nucleotide sequence of the circLATS2 gene is set forth in SEQ ID No. 4.

6. Use of the siRNA of claim 4 or 5 for the preparation of a medicament for the treatment of pancreatic cancer.