LU500574B1 - Long Non-coding RNA lncRNA070974 and Application Thereof - Google Patents

Abstract

The invention discloses a long non-coding RNA-lncRNA070974 and an application thereof, belonging to the field of tumor cell biology. It specifically provides an application of long non-coding RNA lncRNA070974 in preparing a preparation for inhibiting the growth of tumor cells, particularly an application of fluorescent quantitative PCR detection reagent for detecting the expression level of long non-coding RNA lncRNA070974. Through cell proliferation test, plate cloning test and flow cytometry, etc., it was found that inhibiting the expression level of lncRNA070974 in cells could result in the in G0/G1 phase arrested and significantly inhibiting cell proliferation. Therefore, the growth of tumor cells can be significantly inhibited by reducing the expression of the lncRNA070974. This also provides a favorable scientific basis for the lncRNA070974 to become a potential inhibitor of various cancer cells and be used for cancer treatment.

Description

DESCRIPTION Long Non-coding RNA IncRNA070974 and Application Thereof

TECHNICAL FIELD The invention relates to the field of tumor cell biology, particularly to a long non-coding RNA-IncRNA070974 and application thereof.

BACKGROUND Hepatocellular carcinoma (HCC) is one kind of malignant tumors occured in the liver. It can be divided into two categories: primary and secondary. The etiology and exact molecular mechanism of primary hepatocellular carcinoma are not completely clear. At present, it is considered that its pathogenesis is a multi-factor and multi-step complex process, which is affected by both environmental and dietary factors. Secondary hepatocellular carcinoma (metastatic hepatocellular carcinoma) could be developed through different ways, such as metastasis with blood and lymph or direct invasion of liver. At present, hepatocellular carcinoma is one of the common malignant tumors in China, and its mortality ranks third among cancer-related tumors. HCC is characterized by hidden onset, high malignancy, rapid progression, easy metastasis, high mortality and poor overall prognosis. Therefore, it is of great clinical significance to reveal the underlying mechanism and develop therapy methods of early metastasis of hepatocellular carcinoma for improving the treatment of hepatocellular carcinoma. At present, the study on the pathogenesis of hepatocellular carcinoma mainly focuses on protein coding genes, involving genetics, epigenetics and related signal pathways. However, the protein coding gene sequence only accounts for less than 1% of the human genome sequence, and most of the transcriptional sequences in the human genome are non-coding RNA. Among these, long non-coding RNAs (IncRNAs) are the most important transcript of non-coding RNAs. It widely exists in various organisms, and with the increase of biological complexity, the proportion of IncRNA sequences in genome increases correspondingly. In addition, IncRNAs acts in cells such as signal, guide, decoy or scaffold molecule of functional protein. It regulates gene expression at multiple levels such as chromatin reconstruction, gene transcription, translation and protein modification. More importantly, the expression and dysfunction of IncRNAs have been associated with many human diseases including malignant tumors. However, how many IncRNAs are expressed in different disease states has always been an important question in scientific research. The invention provides a new technical scheme for studying the IncRNA related to hepatocellular carcinoma and the correlation between the IncRNA and hepatocellular carcinoma.

SUMMARY The object of the present invention is to provide a long non-coding RNA IncRNA070974 and its application, so as to solve the problems in the prior art. The growth of tumor cells can be significantly inhibited by reducing the expression of the long non-coding RNA. The IncRNAO070974 is a potential inhibitor of various cancer cells and is expected to be used for cancer treatment.

To achieve the above object, the present invention provides the following scheme.

The invention provides a long non-coding RNA IncRNA070974. The nucleotide sequence of the long non-coding RNA is shown as SEQ ID NO: 1.

The invention also provides the application of mentioned long non-coding RNA IncRNAO070974 in preparing preparation for inhibiting tumor cell growth.

Preferably, the preparation for inhibiting the growth of tumor cells comprises a fluorescent quantitative PCR detection reagent for detecting the expression level of long non-coding RNA-IncRNA070974. Preferably, the tumor cells are hepatocellular carcinoma cells.

Preferably, the fluorescent quantitative PCR detection reagent preferably contains rapid amplification primers and nested reaction primer sets.

The rapid amplification primers are shown in SEQ ID NO: 2- SEQ ID NO: 5. The nested reaction primer sets are shown as SEQ ID NO: 6- SEQ ID NO: 11. The invention also provides a reagent for detecting cancer cells.

The reagent detects the expression level of IncRNA070974 by fluorescence quantitative PCR.

The reagent for detecting the expression level of IncRNA070974 contains rapid amplification primers and nested reaction primer sets.

The rapid amplification primers are shown as SEQ ID NO: 2- SEQ ID NO: 5. The nested reaction primer sets are shown as SEQ ID NO: 6- SEQ ID NO: 11. Preferably, the samples detected by the reagent are hepatocellular carcinoma cells.

The invention also provides the application of the reagent for detecting cancer cells in preparing the reagent for inhibiting the growth of tumor cells.

The invention discloses the following technical effects: The invention discloses a long non-coding RNA IncRNA070974. Previous study found that intracellular RNA binding protein HuR can bind to a plurality of long non-coding RNA, and the long non-coding RNA-IncRNA070974 is definitely regulated by HuR, and reducing HuR also significantly affects the expression of IncRNA070974 in cells.

Up to now, this long non-coding RNA has not been reported, and the inventor amplified this long non-coding RNA for the first time. In addition, through cell proliferation test, plate cloning test, flow cytometry test, etc., the invention found that inhibiting the level of IncRNA070974 in cells could arrest the cell cycle in GO/G1 phase and significantly inhibit cell proliferation. Therefore, by reducing the expression of the long non-coding RNA, the growth of tumor cells can be significantly inhibited. This also provides a favourable scientific basis for the IncRNA070974 to become a potential inhibitor of various cancer cells and be used for cancer treatment.

BRIEF DESCRIPTION OF THE FIGURES In order to explain the embodiments of the present invention or the technical scheme in the prior art more clearly, the drawings needed in the embodiments will be briefly introduced below. Obviously, the figures in the following description are only some embodiments of the present invention, and for ordinary technicians in the field, other figures can be obtained according to these drawings without paying creative labor.

Figure 1 A full-length amplification electrophoresis map of IncRNA070974; (a) RNA electrophoresis maps of 5' and 3' RACE, (b) electrophoresis map of full length of IncRNA070974 Figure 2 The gene location and sequence conservation analysis of IncRNA070974 on chromosome; (a) location of IncRNA070974 on chromosome, (b) comparative analysis of IncRNAO070974 sequence and vertebrate sequence; (c) the distribution of IncRNA070974 gene in cells Figure 3 Knockdown efficiency analysis of IncRNA070974 Figure 4 Effect of IncRNA070974 knockdown on cell proliferation and cell cycle; (a) CCK-8 experimental analysis showed that inhibiting the expression of IncRNA070974 significantly reduced cell growth; (b) plate cloning experiment verified that knockdown of IncRNA070974 could reduce clone formation; (c) flow cytometry analysis showed that inhibiting IncRNA070974 could result in cell cycle GO/G1 arrested and inhibit cell growth.

DESCRIPTION OF THE INVENTION Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be regarded as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics and embodiments of the present invention.

It should be understood that the terms described in the present invention are only for describing specific embodiments, and are not intended to limit the present invention. In addition, as for the numerical range in the present invention, it should be understood that every intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Intermediate values within any stated value or stated range and every smaller range between any other stated value or intermediate values within the stated range are also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

Unless otherwise stated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention relates. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe methods and/or materials related to the documents. In case of conflict with any incorporated documents, the contents of this specification shall prevail.

Without departing from the scope or intention of the invention, it is obvious to those skilled in the art that many modifications and changes can be made to the specific embodiments of the specification of the invention. Other embodiments derived from the description of the present invention will be apparent to the skilled person. The specification and examples of this application are only exemplary.

As used herein, "comprising", "including", "having", "containing", etc., are all open terms, which means including but not limited to.

With regard to the invention of long non-coding RNA, previous study found that the intracellular RNA binding protein HuR could bind to multiple non-coding long RNA, and the long non-coding RNA-IncRNA070974 was significantly regulated by HuR, and reducing HuR also significantly affected the expression of IncRNA070974 in cells. Through bioinformatics analysis and fluorescence in situ hybridization experiment, it was found that IncRNA070974 is located at the chromosome 1526.3, and its sequence is highly similar to that of primates, but quite different from that of other species. LncRNAO070974 is located in both cytoplasm and nucleus, dominantly distributed in cytoplasm (see Table 14).

The 5'-RACE and 3'-RACE products were obtained by rapid amplification of cDNA ends (RACE). The amplified fragments were identified as 684 bp and 585 bp by 1% agarose gel electrophoresis. The coding function of IncRNA070974 was predicted by the Coding Potential Assessing Tool (CPAT), and its coding ability was 0.0473, indicating that it had no coding function. On the basis of the above results, it is proved that the inventor discovered a new long non-coding RNA IncRNA070974.

The above long non-coding RNA-IncRNA070974 is a newly discovered long non-coding RNA, but the inventor thinks that its coding function is predicted by network software, and its non-coding function may be uncertain due to the existence of various limiting factors in the prior art. Therefore, in order to better and more accurately verify the function of inhibiting the growth of cells (especially tumor cells) by the long non-coding RNA-IncRNA070974, it was found that inhibiting the level of IncRNA070974 in cells can result in the cell cycle arrested in GO/G1 phase and significantly inhibit the proliferation of cells through cell proliferation experiment (Cell Counting Kit-8, CCK8; plate clone and flow cytometry, etc), thus confirming that IncRNA070974 has the function of inhibiting the growth of tumor cells. The specific test verification process is detailed in Embodiment 1.

Embodiment 1

1. RNA interference experiment Added 100 pL of opti-MEM medium, 2.5 ul of siRNA (20 uM in concentration, biosynthesized by GenePharma, see Table 17) and 2.5 pL of Lipofectamine ®RNAIMAX reagent (purchased by ThermoFisher) into the 12-well cell plate, mixed gently, added them into a Petri dish and let them stand for 15 min. Spreaded 80,000-100,000 HepG2 cells, added DMEM medium (purchased by Gibico Company) to 1 mL, mixed gently, and put them in a 5% CO; incubator at 37°C for 24 h.

2. RNA extraction and full length of IncRNA070974 clone

RNA was extracted according to the kit instructions by Invitrogen TRIzol method (purchased by Thermo Fisher). With 1000ng of total RNA, reverse transcription was performed according to the kit instructions of primescript™ RT reagent Kit with gDNA Eraser (TakaRa, Japan). Genomic DNA was removed from the RNA extracted in the previous step, and the operation was carried out according to the instructions of 5'-RACE and 3'-RACE kits (TakaRa, Japan). See Table 1 for specific primers.

Table 1 Primer sequence table of RACE technology Primer description Primer sequence (S'-3") 3'RACE adapter (SEQ ID NO: 6) (wherein gcgagcacagaattaatacgactcac N refers to any base of AT G and V refers tataggt12vn to three bases except T.) S'RACE adapter (SEQ ID NO: 7) gcugaugecgaugaaugaacacuge guuugcuggcuuugaugaaa 3'RACE outer primer (SEQ ID NO: 8) atttgacttctatcectattec 3'RACE inner primer (SEQ ID NO: 9) ggtotgatggctcaggectgta S'RACE outer primer (SEQ ID NO: 10) getogagteettagectega S'RACE inner primer (SEQ ID NO: 11) tagtggtgaggggoctttgga Note: wherein V is three bases except T; N represents any base of A, T and G.

The specific operation steps of 5' RLM-RACE are as follows. (1) CIP hydrolyzed the incomplete phosphate group at the 5' end of RNA.

The following reaction system is added into the enzyme-removing centrifuge tube (see Table 2). Table 2 Reagent Dose ug total RNA 10 uL 10x CIP buffer 2 ul Calf intestinal alkaline phosphatase (CIP) 2 ul Enzyme-free ultrapure water To 20 uL

Then mixed well, separated, and incubated at 37°C for 1 h. (2) Stopped CIP reaction, extracted RNA again, and added the following components into the above-mentioned enzyme-removing centrifuge tube (see Table 3). Table 3 Reagent Dose Ammonium acetate buffer 15 ul Enzyme-free ultrapure water 115 ul Acidic phenol: chloroform 150 uL Firstly, the supernatant was transferred to a new 1.5mL enzyme-removing EP tube after vortex and mixing on the oscillator, centrifugation at 4°C and 14000g for 5 min.

Secondly, 150 pL chloroform was added to the supernatant.

The supernatant was transferred to a new 1.5mL enzyme-removing EP tube after vortex and mixing on an oscillator, centrifugation at 4°C and 14000g for 5 min.

Then, took the supernatant, added 150 pL isopropyl alcohol, vortex and mixed evenly, placed on ice for 10 min, centrifuged at 4°C and 14,000g for 20 min.

At last, discarded the supernatant, added 1ml of 75% ethanol to wash the precipitate once, centrifuged at 4°C and 12000rpm for 5 min, discarded the supernatant, evaporated and dried, and then added 15 pL of enzyme-free ultrapure water to dissolve the precipitate. (3) TAP removed the 5'-end cap structure, and added the following components into the enzyme-removing centrifuge tube (see Table 4). Table 4 Reagent Dose RNA recovered in the previous step Sul 10x TAP buffer 1 ul Tobacco acid pyrophosphatase 2 ul Enzyme-free ultrapure water 2 ul Then mixed well, separated and incubated at 37°C for 1 h.

(4) S'RACE Adapter ligation, added the following components into the enzyme-removing centrifuge tube (see Table 5). Table 5 Reagent Dose Product of the previous step 2 uL 5' RACE adapter 1 ul 10x RNA ligation buffer 1 pul T4 RNA ligase (2.5 U/uL) 2 ul Enzyme-free ultrapure water 4 uL Evenly mixed and separated, and incubated at 37°C for 1 h. (5) Reverse transcription: added the following components into the enzyme- removing centrifuge tube (ice operation), as shown in Table 6. Table 6 Reagent Dose Product of the previous step 2 ul dNTP Mix (2.5mM) 4 uL Random 10-mer primer (50 uM) 2yL 10x reverse transcription buffer 2 uL Rnase inhibitor (10U/uL) 1 pL M-MLYV reverse transcriptase 1 pL Enzyme-free ultrapure water To 20 uL Evenly mixed and separated, and incubated at 42°C for 1 h.

The product was stored at -20°C.

The random 10-mer primers were purchased from Beijing Weibaoao Biotechnology Co., Ltd.

(6) Outer 5' RLM-RACE PCR, added the following components into 200 uLEP tube (ice operation), see Table 7. Table 7 Reagent Dose Reverse transcription product of the previous step 1 ul 10x PCR buffer 5 uL dNTP Mix 4 uL 5' RACE gene specific outer primer (10 uM) 2 ul Internal primer of 5' RACE (10 uM) 2 uL Heat-resistant DNA polymerase (5 U/uL) 0.25 uL Enzyme-free ultrapure water To 50 uL Evenly mixed and separated, and set the following PCR reaction procedure, as shown in Table 8. Table 8 Stage Number Temperature Time of cycles Pre-degeneration 1 95°C 3 min 95°C 40 ses 60°C 30 ses Amplification 35 72°C 40 ses Extension 1 72°C 5 min The product was stored at -20°C or used in the next experiment.

(7) Inner S'RLM-RACE PCR, added the following components into 200 uLEP tube (ice operation), see Table 9. Table 9 reagent Dose The reaction product of the previous step 1 ul 10x PCR Buffer Sul dNTP Mix 4 uL 5' RACE gene specific outer primer (10 uM) 2 ul Internal primer of 5' RACE (10 uM) 2 uL Heat-resistant DNA polymerase (SU/uL) 0.25 uL Enzyme-free ultrapure water To 50 uL Evenly mixed, separated, and set the PCR reaction program to be the same as Outer 5' RLM-RACE PCR.

The product was stored at -20°C or used in the next experiment. 3' RLM-RACE includes following steps. (1) Reverse transcription: added the following components into the enzyme-removing centrifuge tube, as shown in Table 10. Table 10 Reagent Dose 1 ug total RNA 2 ul dNTP Mix (2.5 mM) 4 uL 3' RACE adapter 2 uL 10x reverse transcription buffer 2 uL RNase inhibitor (10 U/uL) 1 pL M-MLYV reverse transcriptase 1 pL Enzyme-free ultrapure water to 20 uL Evenly mixed, separated, and incubated at 42°C for 1 h.

The product was used in the next experiment. (2) Outer 3'RLM-RACE PCR, the following components were added into 200 uL EP tube (operating on ice), as shown in Table 11.

Table 11 Reagent Dose Reverse transcription system of the previous step 1 ul 10x PCR Buffer Sul dNTP Mix 4 uL 3' RACE gene specific outer primer (10 uM) 2uL Internal primer of 3' RACE (10 uM) 2 ul Heat-resistant DNA polymerase (SU/uL) 0.25 uL Enzyme-free ultrapure water To 50 uL Evenly mixed, separated, and set the PCR reaction program to be the same as Outer 5' RLM-RACE PCR. (3) Inner 3' RLM-RACE PCR, added the following components into 200 uLEP tube (ice operation), see Table 12. Table 12 Reagent Dose The product of the previous step 1 ul 10x PCR buffer 5 uL dNTP Mix 4 uL 3' RACE gene specific outer primer (10 uM) 2uL 3' RACE internal primer (10 uM) 2 uL Heat-resistant DNA polymerase (5 U/uL) 0.25 uL Enzyme-free ultrapure water To 50 uL Evenly mixed, separated, and set the PCR reaction program to be the same as Outer 5' RLM-RACE PCR.

The product was used in the next experiment. (4) Electrophoresis of PCR products 2% agarose gel was prepared (0.4 g agarose powder was added to 40 mL 1xTAE buffer solution, melted in microwave oven, cooled to about 55°C, added with 1 uL Goldview nucleic acid stain, mixed evenly, poured into the gel-making plate), and then solidified and electrophoresed (electrophoresis 120 V, 30 min). (5) Recovery of target fragments

Firstly, the gel after electrophoresis was selected and put into the gel imager.

Then the fragments with the same target size bands were selected, cut with a blade and put into an EP tube.

Secondly, added a proper amount of Binding Buffer (1: 3, that is, 0.1 g gel was added with 300 uL Binding Buffer) (purchased from Shanghai Sheng gong Co., Ltd.). The gel block is completely melted at 55°C on a thermostat.

Then, the above mixed solution was added to HiBind® DNA Mini Column recovery column, and centrifuged at 1000 g for 1 min at room temperature.

The filtrate was discarded, the column was put back into the collecting tube. 700 pL SPW Wash Buffer was added, and centrifuged at 13000 g for 1 min at room temperature, and repeated once.

At last, added 20 uL Elution Buffer in the center of the column, placed it at room temperature for 2 min, centrifuged at 13000 g for 2 min, and collected filtrate, that is, the target product. (6) The target fragments were ligated with T-Vector pMD18. The following components were added into 200 uL EP tube, as shown in Table 13. Table 13 Reagent à Dose

T-Vector pMD 18 1 ul

10xT4 DNA ligase buffer 1 ul

T4 DNA ligase 1 ul

Target DNA product 0.1-0.3 pmoL

Ultrapure water To 10 ul Evenly mixed, separated, and ligated at 16°C overnight.

The full length of IncRNAO070974 was obtained by gene sequencing of the product (completed by

Shanghai sonny biological company) (see Figure 1b, and 1ts nucleotide sequence is shown in SEQ ID NO: 1).

3. Conservation and coding function prediction of IncRNA070974 Firstly, by inputting the full-length sequence of IncRNA070974 into the non- codeNoncode database (http://www.noncode.org/), it was found that the function of LncRNAO070974 had not been studied. Secondly, the genome of IncRNA070974 was mapped on the UCSC database (http://genome.ucsc.edu/), which showed that IncRNA070974 was located in the chromosome 15q26.3 (Figure 2a). Bioinformatics prediction of the cellular localization of IncRNA070974 was made by IncLocator database (http://www.csbio.sjtu.edu.cn/). It was found that IncRNA070974 was distributed in cytoplasm and nucleus, but it accounted for

66.18% in cytoplasm (Table 14). Sequence conservative analysis of IncRNA070974 in 100 species by PhyloP showed that IncRNA070974 had higher homology in primates and lower sequence homology with other species (Figure 2b). In addition, combined with fluorescence in situ hybridization (FISH), it was verified that IncRNA070974 was dominantly located in cytoplasm (Figure 2c). At last, the coding potential of IncRNA070974 was predicted by CPAT (Coding Potential Assessing Tool), and compared with known protein HuR and known IncRNA070974 HAGLROS. It was found that LncRNA070974 had no coding ability (Table 15).

Table 14 Prediction of cell location of IncRNA070974 by LNC Locator database Subcell Score Cytoplasm 0.661751158901 Nucleus 0.235160333424 Ribosome 0.017688645733 Cytoplasmic matrix 0.0687766176258 Exosome 0.0166232443164 Table 15 Prediction of coding ability of IncRNA070974 by CPAT "Gene Coding ability Coding feature "LncRNA070974 0.047294893125689 ~~ No HAGLROS 0.15325554241589 No HuR 0.99980647427438 Yes

4. Fluorescence in situ hybridization (1) Reagent preparation Preparation of pre-hybridization solution and hybridization solution. Mixed the blocking solution and pre-hybridization buffer solution evenly according to the ratio of 1: 99. Mixed the blocking solution and hybridization solution evenly according to the ratio of 1: 99, and incubated them at 37°C until they were transparent and clear. Preparation of permeable solution: 0.5% Triton X-100 PBS. (2) Cell treatment Firstly, prepared a 24-well plate, put a sterile cell slide into it. Added 1x10* cell suspension to each well, and put the plate into incubator for culture. When the cell density was about 60%-70%, added 500 ul. 1x PBS to each well, and washed on the shaking table for 5 min.

Then, added 4% paraformaldehyde, and stood at room temperature for 10 min and washed with PBS for three times.

At last, used 1mL precooled permeate, stood at 4°C for 5 min, and washed with PBS for three times. (3) Probe loading Firstly, 200 uL pre-hybridization solution preheated to clarification was added to each well, and sealed at 37°C for 30 min.

Then, in the dark conditions, restored the storage solution (20 uM) of IncRNA Probe Mix, U6 and 18S internal reference probe to room temperature.

Added 2 uL each to 150 uL of the hybridization solution preheated to clarification, and mixed well.

Thirdly, discarded the pre-hybridization solution, added 150 pL hybridization solution containing probes to each well, and hybridized overnight at 37°C in the dark.

Discarded the hybridization solution, added 500 pL hybridization lotion I (4xSSC containing 0.1% Tween-20) to each well at 42°C in the dark, and washed it lightly for 5 min for three times.

At 42°C in the dark, added 500 pL of hybridization lotion II (2x SSC) and 500 uL of hybridization lotion III (1x SSC) to each well, and washed them lightly for 5 min.

At last, washed with PBS for 3 times, then used DAPI for nuclear staining, and washed with PBS for 3 times. (4) Sealing and observation Took out the clean glass slide, and dropped about 10 uL of anti-fluorescence quencher in the center of the glass slide.

In the dark conditions, carefully took out the cell slide with a tweezer, and reversed it on the glass slide containing fluorescence quencher. The fluorescence was observed under the 40x microscope of fluorescence microscope.

The results showed that IncRNA070974 was distributed in both cytoplasm and nucleus, dominantly located in cytoplasm as shown in Figure 2c.

5. Fluorescence quantitative PCR Used SYBR®RPremix Ex TaqTM II kit, using primers described in Table 16 below. Table 16 “Gene Sequence B-actin Forward (SEQ ID NO: 2) 5’- ggcaccacaccttctacaat -3” Reverse (SEQ ID NO: 3) 5’- gectggatageaacgtacat -3° LncRNAO70974 Forward (SEQ ID NO: 4) 5’- gttgctttectcgeacgaac-3° Reverse (SEQ ID NO: 5) 5’- gtgtggctggtetgtagtge-3° Then, according to the instructions, added the system, and proceeded in the BioRad instrument according to the following procedures. 95°C 3 min, (95°C 5 s, 60°C 30 s, 72°C 40 s, 40 cycles), 72°C 5 min, 95°C 15s, 60°C 1 min, 95°C 15 s. The relative expression level of genes after reaction was calculated according to 27%(ACt value =Ctuarget - Ctintemal reference, AACt value =ACtexperimental group-ACTeontrol group), and the relative expression level of genes was obtained. Taking actin gene as control gene, the interference efficiency of si-IncRNA070974-2 was the highest, reaching over 99% (see Figure 3). SIRNA-2 was used for later functional verification, and the specific sequence is shown in Table 17.

Table 17 Interference sequence of LNC RNA 070974 ‘Genename Forward (5—3') ~~ Reverse(5—3) 0 ‘Negative control uucuccgaacgugucacgutt ~~ acgugacacguucggagaatt siRNA-1 ccauucucuagcaucuuaatt uuaagaugcuagagaauggtt siRNA-2 ccuuccugguuggeuguuutt aaacagccaaccaggaaggtt siRNA-3 ccucccaauuugagaguaatt uuacucucaaauugggaggtt “6. Cell proliferation detection by CCK8 (1) After treating HepG2 cells with si-control or si-RNA2 for 48 h, the cell density 1s about 70%-80%. (2) Trypsin digestion was carried out on two groups of cells, and 2000 cells were taken, respectively. And added into 96-well plate, after the cells adhered to the wall. (3) Discarded the old culture medium, added 100 pL of 10% CCK-8 reagent detection solution to each well, and put the cells back into the incubator for incubation for 2h. (5) The absorbance at 450 nm was detected by microplate reader at O h, 24 h, 48 h and 72 h to reflect the number of living cells. The result showed that the growth of si-IncRNA070974-2 cells was obviously inhibited after 24 hours of culture, and the inhibition was more significantly with the extension of time (Figure 4a).

7. Plate cloning experiment (1) After treating HepG2 cells with si-control or si-RNA2 for 48 h, the cell density was about 70%-80%. (2) Trypsin digestion was carried out on the two groups of cells, and 3000 cells were taken respectively and added to the 6-well plate, cultured in the incubator at 37°C and 5%CO, for 7 days, and then changed to normal medium (10%FBS complete medium). After continuing to culture for 7 days, the clones grew into visible clones.

(3) Washed with PBS twice, added 4% paraformaldehyde to fix at room temperature for min, discarded the fixing solution, and then dyed with 500 uL crystal violet for 30 min. (4) Discarded that dyeing solution, washed the unbound dyeing solution with double distilled water, and dried at room temperature. (5) Took photos under microscope and calculated the number of monoclonal antibodies. The result showed that the number of monoclonal antibodies in si-IncRNA070974 group decreased significantly, which indicated that decreasing IncRNA070974 could significantly inhibit cell growth (Figure 4b).

8. Cell cycle detection: (1) After treating HepG2 cells with si-control or si-RNA2 for 48 h, discarded the old culture medium, washed the cells twice with 1mL PBS, added 500 pL trypsin digestion solution without EDTA, digested the cells at room temperature for 5 min. Transfered the cells to a 1.5 mL EP tube, centrifuged at 4°C at 2000 rpm for 5 min, discarded the supernatant, and collected the cell precipitate. (2) Added 1mL of pre-cooled PBS, centrifuged at 4°C and 1500 rpm for 5 min, discarded supernatant, washed cell precipitate, and repeated once. (4) Added 300 uL of pre-cooled PBS to resuspend the cell precipitate, slowly adding 700 uL of pre-cooled ethanol, shaked the EP tube, avoided that the cells are difficult to become single cells, and fixed the cells overnight at 4°C. (5) Centrifuged the fixed cells at 4°C and 1500 rpm for 5 min, and discarded the supernatant.

(6) Added 1mL of pre-cooled PBS, centrifuged at 4°C and 1500 rpm for 5 min, discarded supernatant, washed cell precipitate, and repeated once. (7) Added 500 uL DNA staining solution, vortex for 5-10 seconds, mixed well, and incubated for 30 min at room temperature in the dark. (8) Selected the lowest loading speed, detected the cells on flow cytometer, and analyze the changes of cell cycle.

The results showed that the cell cycle was arrested in GO/G1 phase, which indicated that decreasing the level of IncRNA070974 could arrest the cell cycle in GO/G1 phase and inhibit cell growth.

Therefore, flow cytometry analysis showed that IncRNA070974 could inhibit cell proliferation (Figure 4c). The above embodiments only describe the preferred mode of the invention, but do not limit the scope of the invention.

On the premise of not departing from the design spirit of the invention, various modifications and improvements made by ordinary technicians in the field to the technical scheme of the invention shall fall within the protection scope determined by the claims of the invention.

20210825 PT1388 2021-5042 Sequence listing.txt LU500574

1 SEQUENCE LISTING

2

3<110> Wenzhou Medical University

4

5<120> Long Non-coding RNA IncRNA070974 and Application Thereof

6

7<130> PT1388LU

8

9<160> 11

11<170> BiSSAP 1.3.6

12

13<210> 1

14 <211> 2008

15<212> DNA

16<213> Artificial Sequence

17

18

19 <220> 20<223> seql 21 22<400> 1 23 tagagcgaga ccctgtctca atcaatcaat caaaaacgac agagatagat agatagatga 60 24 tagattgata gatgatagat agatagatag atagatagat agatagatag atagcaacat 120 26 27 ggtctaaatg agtctaggag tggagtgtcc ttgaacttgg ggagaccacc ctccactgceca 180 28 29 tttgcattat tgatactatg gctggagagg gccttttgcc taaaagcttg gagtatgttg 240

31 gggcccecececga gagcaggtga gggccagagg ttcagatcag aggatggaaa aaggaggtgg 300 32

33 agaacaggaa agaaaaacat tttaataaga acaagcaggg gtgatggaaa gtatacacca 360 34 aggccattct ctagcatctt aaggttctgce ccagccaget gggaggccac tgggcactgg 420 36

37 ctgctggggg gaaaggaaga atctgctcce ctaccccage cttcactgtt getttecteg 480 38

39 cacgaacccc agactctatc cttcctggtt ggctgtttaa gteoetttact gacaccccag 540 40

41 gctttgtgge ttatctgagc acagaacagc atccttagat ggtacagcac tgagcaccca 600 42

43 ccttagatcc taggattcag tcccaccatce caaagcccct caccactaca gaccagccac 660 44

45 actaagggtg accagatatc ttagacteccc ttttgaaaca acaggaacca aagtgcccag 720 46

47 ggcagagaac atcctgttgc caaaatagtg gttctcaacc agggatgact tttgtcttcc 780 48

49 aggggacatt tggcaacgtc tggagacatt ttgggttgtc acaactggaa ggatgtactc 840 50

51 acatccagtg ggtggaggcc aggaatgctg ctaagcaccc tgcaatgcac agcagccccce 900 52

53 atgacaaaga actgtccaga ccaaaatgtc aatagtgccg aggttgagaa attccggcca 960 54

55 aaagaaatgg aatcaaaaaa gaaaattgtt tgcaacttca tagagatacc ctcaatgaat 1020 56

57 aaaaccacat atggtttgac ttctgtccct gttoctatgc tgaagggaaa cttgtacaac 1080 58

59tttccetttt taaagtaaag agataccacc ccactctttt ttttttttaa acacagcaac 1140 60

Page 1

20210825 PT1388 2021-5042 Sequence listing.txt LU500574 61 agaagggccc caagttaaaa ccagctctcce agcctaagga ctccacctgg tggtectcetce 1200 62 63 tggaattaaa tgaagttgag gttttatttt gtttaatttt ttcattattc agttattttg 1260 64 65 tttaacattt ttagttattt tgtttaaatt tttagttatt ttaactttta agttatttta 1320 66 67 tttcttagtt attttaactt gttattttaa tttttttagt tattttaact ttttaaagtt 1380 68 69 attttaattc tttagttatt ttgtttaact tttttagttt ttttagttaa acaaaagttg 1440 70 71 cagtgaccgg ggcaggtgtg atggctcagg cctgtaatcec cagcactttg ggaggccgag 1500 72 73 gcagggacag ggggcagggg aaatcacttc ttaggtcagg agctcaagac cagcctggcea 1560 74 75 aacatgacaa aaccccgtct ctactaaaaa tataaaaatc agccaggcat ggtggcgage 1620 76 77 gcctgtaatc ccagctactt gagaggctga ggcacgagaa tcacttgaac ctcatgttat 1680 78 79 tcctcatgag gcggaggttg cagtgagccg agattacgec actgtactec agectgggea 1740 80 81 acagagcgag actccatctc agaaaacaaa gaagttccaa gtacaataca aagaaattcc 1800 82 83 ctcccaattt gagagtaagt tgccgatata ccctatgacc gecccccccee cgccaatact 1860 84 85 tcagtgggta tttcctatga acaacgacat tctccggcac agccatcaga ctcaggaaat 1920 86 87 taacatcggt atgttattac catcaaccct ctgactgaat tctagttctg ccagttgtcc 1980 88 89 caataaagtt cttagcaaaa aaaaaaaa 2008 90 91 92 <210> 2 93 <211> 20 94 <212> DNA 95 <213> Artificial Sequence 96 97 98 <220> 99 <223> Seq2 100 101 <400> 2 102 ggcaccacac cttctacaat 20 103 104 105 <210> 3 106 <211> 20 107 <212> DNA 108 <213> Artificial Sequence 109 110 111 <220> 112 <223> Seq3 113 114 <400> 3 115 gcctggatag caacgtacat 20 116 117 118<210> 4 119 <211> 20 120 <212> DNA

Page 2

20210825 PT1388 2021-5042 Sequence listing.txt LU500574 121 <213> Artificial Sequence 122 123 124 <220> 125 <223> Seq4 126 127 <400> 4 128 gttgctttcc tcgcacgaac 20 129 130 131 <210> 5 132 <211> 20 133 <212> DNA 134 <213> Artificial Sequence 135 136 137 <220> 138 <223> Seq5 139 140 <400> 5 141 gtgtggctgg tctgtagtgg 20 142 143 144 <210> 6 145 <211> 57 146 <212> DNA 147 <213> Artificial Sequence 148 149 150 <220> 151 <223> N refers to any base of AT G 152 153 <400> 6 154 gcgagcacag aattaatacg actcactata ggtvnvnvnv nvnvnvnvnv nvnvnvn 57 155 156 157 <210> 7 158 <211> 45 159 <212> DNA 160 <213> Artificial Sequence 161 162 163 <220> 164 <223> /note="combined DNA/RNA molecule" 165 /note="Seq7" 166 167 <400> 7 168 gcugauggcg augaaugaac acugcguuug cuggcuuuga ugaaa 45 169 170 171 <210> 8 172 <211> 22 173 <212> DNA 174 <213> Artificial Sequence 175 176 177 <220> 178 <223> /note="combined DNA/RNA molecule" 179 /note="Seq8" 180

Page 3

20210825 PT1388 2021-5042 Sequence listing.txt LU500574 181 <400> 8 182 gtttgacttcec tgtccctgtt cc 22 183 184 185 <210> 9 186 <211> 22 187 <212> DNA 188 <213> Artificial Sequence 189 190 191 <220> 192 <223> /note="combined DNA/RNA molecule" 193 /note="Seq9" 194 195 <400> 9 196 ggtgtgatgg ctcaggcctg ta 22 197 198 199 <210> 10 200 <211> 20 201 <212> DNA 202 <213> Artificial Sequence 203 204 205 <220> 206 <223> /note="combined DNA/RNA molecule" 207 /note="Seg1l0" 208 209 <400> 10 210 ggtggagtcc ttaggctgga 20 211 212 213<210> 11 214 <211> 20 215 <212> DNA 216<213> Artificial Sequence 217 218 219 <220> 220 <223> /note="combined DNA/RNA molecule" 221 /note="Seqll" 222 223 <400> 11 224 tagtggtgag gggctttgga 20 225 226 227

Page 4

Claims (8)

CLAIMS:

1. A long non-coding RNA-IncRNA070974, characterized in that the nucleotide sequence of the long non-coding RNA is shown in SEQ ID NO: 1.

2. Application of the long non-coding RNA IncRNA070974 according to claim 1 in preparing a preparation for inhibiting the growth of tumor cells.

3. The application according to claim 2, characterized in that the preparation for inhibiting the growth of tumor cells comprises a fluorescent quantitative PCR detection reagent for detecting the expression level of long non-coding RNA IncRNA070974.

4. The application according to claim 3, characterized in that the tumor cells are hepatocellular carcinoma cells.

5. The application according to claim 3, characterized in that the fluorescent quantitative PCR detection reagent contains rapid amplification primers and nested reaction primer sets, and the rapid amplification primers are shown as SEQ ID NO: 2- SEQ ID NO: 5; the nested reaction primer sets are shown as SEQ ID NO: 6- SEQ ID NO: 11.

6. À reagent for detecting cancer cells, characterized in that the reagent detects the expression level of IncRNA070974 according to claim 1 by fluorescence quantitative PCR, and the reagent for detecting the expression level of IncRNA070974 by fluorescence quantitative PCR contains rapid amplification primers and nested reaction primer sets, wherein the rapid amplification primers are shown as SEQ ID NO: 2- SEQ ID NO: 5; the nested reaction primer sets are shown as SEQ ID NO: 6- SEQ ID NO: 11.

7. The reagent for detecting cancer cells according to claim 6, characterized in that the samples detected by the reagent are hepatocellular carcinoma cells.

8. Application of the reagent for detecting cancer cells according to any one of claims 6-7 in preparing a reagent for inhibiting tumor cell growth.