CN109652529B

CN109652529B - Osteoporosis specific miRNA, composition and diagnosis and treatment application thereof

Info

Publication number: CN109652529B
Application number: CN201811608651.3A
Authority: CN
Inventors: 杨承刚; 魏琳; 高舒欣
Original assignee: Gu'an Bojian Biotechnology Co ltd
Current assignee: Gu'an Bojian Biotechnology Co ltd
Priority date: 2018-12-27
Filing date: 2018-12-27
Publication date: 2021-09-24
Anticipated expiration: 2038-12-27
Also published as: CN109652529A

Abstract

The invention relates to an osteoporosis specific miRNA, a composition and diagnosis and treatment application thereof, in particular to application of miR-1468-5p, miR-629-5p and a composition thereof in preparation of osteoporosis diagnosis and treatment preparations. The invention provides a potential molecular marker for accurate diagnosis of clinical postmenopausal osteoporosis, which is characterized in that the applicant discovers miRNA related to osteoporosis through high-throughput sequencing and analysis by using a bioinformatics method, and performs molecular biological verification through a fluorescent quantitative PCR (polymerase chain reaction) experiment and a cell experiment.

Description

Osteoporosis specific miRNA, composition and diagnosis and treatment application thereof

Technical Field

The invention relates to the field of molecular biology, in particular to miRNA related to osteoporosis, a composition and diagnosis and treatment application thereof, and more particularly relates to application of miR-1468-5p, miR-629-5p and a composition thereof in preparation of osteoporosis diagnosis and treatment preparations.

Background

Osteoporosis is a metabolic bone disease characterized by low bone mass and microstructural destruction of bone tissue, leading to increased bone fragility and susceptibility to fracture, and can be divided into primary and secondary types, with primary types being divided into type I and type II, with type I being postmenopausal osteoporosis, occurring in postmenopausal women; type II is found in older adults over 60 years old, with women having a more than 2-fold higher incidence than men. Along with the development trend of the population aging all over the world, the population of osteoporosis patients will become more huge, and social and economic problems brought by osteoporosis complications such as bone pain, fracture and even loss of self-care ability of life are more obvious. The research on molecular mechanisms of occurrence, development, treatment, prevention and the like of osteoporosis has important significance.

MicroRNAs (miRNAs) are short (about 22 nucleotides in length) non-coding RNA molecules that act by disrupting the stable structure of the mRNA or by inhibiting expression of a translation-regulating gene. Mirnas have been reported to be involved in osteoblast generation, and some have been reported to promote osteoclast proliferation and differentiation. The previous researches of the applicant found that some miRNAs are closely related to osteosarcoma and related patents such as ZL 2016726021, ZL2016102717978 and ZL2016100658937 are applied, but the relation between miRNAs and osteoporosis is less researched and needs to be further explored.

In the research, the applicant discovers several miRNAs related to osteoporosis, which have not been reported before, by high-throughput sequencing and analysis by using a bioinformatics method, wherein the expression of miR-1468-5p in a diseased group is lower than that of a control group, and the expression of miR-629-5p in the diseased group is higher than that of the control group, and further, the analysis of the high-throughput sequencing is verified by a fluorescence quantitative PCR (polymerase chain reaction) experimental result, so that miR-1468-5p and miR-629-5p are likely to become new postmenopausal osteoporosis diagnosis markers, the influence of miR-1468-5p and miR-629-5p on osteogenic differentiation is further researched by cell experiments, and the invention provides a potential molecular marker for accurate diagnosis of clinical postmenopausal osteoporosis.

Disclosure of Invention

The invention aims to provide an osteoporosis diagnosis reagent, which detects the transcription condition of miRNA and/or precursor thereof in a sample or the expression of target genes regulated by miRNA, and detects one or more of the miRNA selected from the following: miR-1468-5p and miR-629-5 p.

Preferably, the miRNA is a combination of miR-629-5p and/or miR-1468-5 p.

The miR-1468-5p sequence is shown in a sequence table SEQ ID NO 1, and the miR-1468 sequence is shown in a sequence table SEQ ID NO 2; the miR-629-5p sequence is shown in a sequence table SEQ ID NO 3, and the miR-629-5p precursor sequence is shown in a sequence table SEQ ID NO 4.

The osteoporosis is postmenopausal osteoporosis.

The sample is peripheral blood.

Further, the osteoporosis diagnosis reagent adopts a high-throughput sequencing method and/or a quantitative PCR method and/or a probe hybridization-based method to detect the transcription of miRNA and/or precursor thereof in the sample or an immune method to detect the expression condition of the target gene regulated by mature miRNA in the sample.

Preferably, transcription of miRNA and/or its precursor in the sample is detected by northern hybridization, miRNA expression profiling chip, ribozyme protection analysis technology, RAKE method, in situ hybridization, and microsphere-based flow cytometry.

Preferably, the method for quantitative PCR comprises primers for specific amplification of miRNA and/or its precursor; the probe-based hybridization methods include probes that hybridize to nucleic acid sequences of mirnas and/or precursors thereof.

Further, a primer for amplifying miR-1468-5p is a sequence SEQ ID NO 5; the primer for amplifying miR-629-5p is a sequence SEQ ID NO 6.

The miR-1468-5p regulated target genes comprise DERL2, MTRNR2L3, MTRNR2L8, MTRNR2L6, MTRNR2L9, SEMA3D, BRIX1, SATB2, SRSF2, C12orf73, MMAB, PLXDC1, LYRM7, RPL27A, SYK, PSORS1C2 and AKR1A 1.

The miR-629-5p regulated target genes are HNF4A, HIST1H2AC, ATP5G AC, ZCCHC AC, TP53INP AC, PERP, CFLAR, RASSF AC, TNFRSF10 AC, PTPRB, CARD AC, RAB AC, ZEB AC, AKTIP, ZBTB AC, HOXB AC, ZBTB AC, SDCBP, TFDP AC, PAPD AC, OR2A AC, RSRC AC, IRF2BP AC, EIF1 AC, RTKN, HOXB AC, HIST1H1 AC, TXXC, HIST1H3 AC, HIST1H2 YARN AC, HIST1H2AC, CSNK1 AC, RAB3 AC, DMXC AC, SAGAP AC, SANTEROX AC, SANTF AC, SANTR AC, SANTF AC, SACK AC, SANTF AC, SACK AC, SANTC AC, SACK AC, SANTF AC, SACK AC, SANTC AC, SACK AC, SANTF AC, SACK 36.

The invention also aims to provide the application of the miRNA and/or the precursor thereof in preparing a osteoporosis diagnosis tool.

Preferably, the osteoporosis is postmenopausal osteoporosis.

The object of the present invention is to provide a pharmaceutical composition comprising:

(a) a compound or composition that down-regulates the transcription of miR-629-5p and/or inhibits the activity of a miR-629-5p mature miRNA;

(b) a carrier which can be accepted in pharmacy.

Further, the transcription of miR-629-5p or is reduced and/or the activity of miR-629-5p or is blocked by adopting antisense oligonucleotides, antagomiRs, miRNA sponges, miRNA Erasers, Target Masking and/or multi-Target antisense oligonucleotides.

(a) a compound or composition that up-regulates transcription of miR-1468-5p and/or promotes activity of a miR-1468-5p mature miRNA;

(b) a carrier which can be accepted in pharmacy.

Further, RNA-based microRNA function acquisition technology and/or gene-specific miRNA Mimics technology are/is adopted to up-regulate the transcription of miR-1468-5p and/or promote the activity of mature miRNA thereof. Preferably, miR-1468-5p is upregulated by artificially synthesizing miR-1468-5p mimics or short hairpin RNAs (shRNAs) of mature miRNAs or by regulating promoters.

The application of the pharmaceutical composition in preparing medicaments for preventing and treating osteoporosis.

Preferably, the osteoporosis is postmenopausal osteoporosis.

Defining:

the method for detecting the expression level of miRNA at present mainly comprises miRNA detection methods based on high-throughput sequencing technology, nucleotide hybridization and PCR. The miRNA detection method based on the probe hybridization technology is a direct detection method, does not need to pre-amplify sample RNA, and comprises the technologies of a northern hybridization method, a miRNA expression spectrum chip, a ribozyme protection analysis technology, a RAKE method, in-situ hybridization, microsphere-based flow cytometry and the like.

(1) Northern hybridization

The RNA blotting technique is the most classical experimental method for detecting the RNA size of eukaryote and estimating the abundance of the RNA. The basic principle is as follows: firstly fixing miRNA samples on carriers (such as silicon chips, microspheres or membranes and the like), hybridizing the miRNA samples with labeled probes, washing redundant hybridization probes, and then carrying out signal detection; or fixing a DNA probe complementary with a target miRNA sequence on a carrier, hybridizing the DNA probe with a labeled sample miRNA, and detecting a signal. The signal labeling method comprises isotope labeling, fluorescence labeling, nanogold labeling and the like.

(2) miRNA expression profile chip

The principle is also the use of labeled probes to detect target molecules on a solid support. By designing miRNA genes and internal reference sequences on the chip, the expression level of the corresponding miRNA in the sample can be accurately analyzed. The gene chip has the advantage of high flux, and can detect all the expressions of hundreds of genes in the same sample at one time. Liquid phase chips (Liquid chips) developed by Luminex corporation are also called Multi-functional suspension array (MASA), and are a new generation of biochip technology. The liquid phase chip system is formed by taking a plurality of small spheres as main substrates, wherein each small sphere is fixed with different probe molecules, each spherical substrate for marking the probes is provided with a unique color number in order to distinguish different probes, and the small spheres are suspended in a liquid phase system to form the liquid phase chip system. The system can simultaneously carry out rapid qualitative and quantitative analysis on a plurality of different molecules in the same micro sample, and the detection technology is called as FMAP (Flexible multianalyte profiling) technology. The molecular hybridization is carried out in a suspension solution, and the detection speed is extremely high.

(3) Ribozyme Protection Assay (RPA)

The miRNA detection can also adopt a ribozyme protection analysis technology, the marked probe and an RNA sample to be detected are mixed, hybridization is carried out after thermal denaturation, the unhybridized RNA and redundant probe are digested by single-stranded nuclease, the protected RNA molecule is purified after the nuclease is thermally inactivated, and finally the probe is separated through denaturing PAGE electrophoresis and is developed. The new method based on liquid phase hybridization is simple and rapid, has high sensitivity, but can only be used for analyzing the known miRNA.

(4) RAKE method

RAKE (RNA-mediated array-based Klenow enzyme) is a method of hybridizing miRNA with an immobilized DNA probe using Klenow fragment of DNA polymerase I on the basis of miRNA microarray. The RAKE can sensitively and specifically detect the miRNA, and is suitable for rapidly screening all known miRNAs in a large quantity. Can detect the miRNA expression profile in specific cells. Moreover, the RAKE method also allows miRNA to be isolated from formalin-fixed paraffin-embedded tissues and analyzed, opening the door to miRNA analysis from archived specimens.

(5) In situ hybridization (in situ hybridization)

The in situ hybridization technology can intuitively understand the miRNA expression mode, is a simpler method for observing the time-space expression of the miRNA, and the common marking mode comprises digoxin, biotin, fluorescent marking and the like. Locked Nucleic Acid based in situ hybridization (LNA) based in situ hybridization (LNA-ISH) is currently the most widely used probe format.

(6) Microsphere-based flow cytometry

The method organically combines flow cytometry detection and chip technology, and has the characteristics of high flux, high detection speed, high sensitivity, good specificity and the like.

(7) Real-time fluorescent quantitative PCR technology (Real-time PCR, RT-PCR)

The fluorescence detection PCR instrument can draw a dynamic change curve for the accumulation rate of the amplified sequence in the whole PCR process. The greater the initial concentration of target sequence in the reaction mixture, the fewer PCR cycles (typically expressed in terms of a particular threshold cycle number Ct) are required to obtain a particular yield of amplified product. Since mirnas are only 22 nt in length, conventional qRT-PCR is not suitable for amplifying such short fragments. There are several real-time quantitative PCR methods for miRNA, such as tailing method, neck ring method, etc. The neck ring method is an ideal miRNA detection qRT-PCR method: firstly, designing a special stem-loop structure primer, carrying out reverse transcription by taking miRNA to be detected as a template to synthesize a first cDNA chain, wherein one end of the cDNA is a stem-loop primer, the stem-loop structure is opened to increase the length of the cDNA, and then designing a primer by taking the synthesized cDNA as a template to carry out real-time quantitative PCR amplification. qRT-PCR has the advantages of high specificity, good sensitivity, rapidness, simplicity and the like.

(8) Sequencing method

Most known mirnas are found and identified by cDNA clone sequencing. The method requires that a cDNA library of miRNA is constructed firstly, then PCR amplification is carried out, and an amplification product is cloned to an expression vector for sequencing. Takada developed an improved amplification cloning method (miRNA amplification profiling, mRAP) in which a linker was first ligated to the 3' end of the miRNA, followed by reverse transcription using a reverse transcription primer complementary to the linker. Because a particular reverse transcriptase has terminal deoxynucleotidase activity, some nucleotides (mainly deoxycytidylic acid) will be ligated to the 3' end of the reverse transcribed cDNA strand. After annealing of the 5' end linker to the poly (C) sticky end of the cDNA strand, PCR amplification of the cDNA can be achieved by adding a pair of common primers. Because mRAP is highly sensitive, the expression level of miRNA in a small amount of tissues can be directly detected by using cloning and sequencing technology. The tag sequence cloning method is a mirage (miRNA SAGE) cloning method which is developed on the basis of a gene expression Series Analysis (SAGE) technology and has higher detection efficiency.

High-throughput sequencing (also called next generation sequencing) is a revolutionary change to the conventional sequencing, and can perform sequence determination on hundreds of thousands to millions of DNA molecules at a time, thereby greatly improving the sequencing efficiency. The large-scale sequencing technology greatly improves the reading speed of genetic information of a plurality of species, and provides guarantee for acquiring sequence information of all miRNA and decrypting miRNA maps. High throughput sequencing at the same time makes it possible to perform a detailed global analysis of the transcriptome and genome of a species and is therefore also referred to as deep sequencing. Representative of high throughput sequencing platforms are the 454 sequencer (Roch GSFLX sequencer) by Roche (Roche), the Solexa Genome Analyzer (Illumina Genome Analyzer) by Illumina, and the SOLiD sequencer (ABI SOLiD sequencer) by ABI.

An RNA-based microRNA gain of function technique is to increase the level of miRNAs by exogenous supplementation of precursor substances for their synthesis. For example, short hairpin-like RNA (shRNA) consistent with the sequence of an endogenous miRNA can be artificially synthesized, polymerase II or III is used as a promoter, a virus is used as a vector to transfect cells, and the cells are modified by Dicer enzyme and then loaded into RISC to perform the function, which is equivalent to increasing the level of pre-miRNA, so that the effect is stable and durable.

The gene specificity miR Mimics technology avoids nonspecific action of miRNA and genes. The artificially synthesized specific oligonucleotide chain complementarily combined with the 3' UTR of the target gene can play the same post-transcriptional regulation role as miRNA.

The pharmaceutically acceptable carrier included in the pharmaceutical composition of the present invention is a carrier generally used in the preparation, and includes lactose (lactose), dextrose (dextrose), sucrose (sucrose), sorbitol (sorbitol), mannitol (mannitol), starch, gum arabic, calcium phosphate, alginate (alginate), gelatin (gelatin), calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone (polyvinylpyrrolidone), cellulose (cellulose), water, syrup, methyl cellulose (methyl cellulose), methyl hydroxybenzoate (methyl hydroxybenzoate), propyl hydroxybenzoate (propyl hydroxybenzoate), talc, magnesium stearate (magnesium stearate), mineral oil (mineral oil), and the like, but is not limited thereto.

The pharmaceutical compositions of the present invention are formulated according to methods that can be readily practiced by those of ordinary skill in the art using pharmaceutically acceptable carriers and/or excipients, and can be prepared in unit dosage form or in multi-volume containers. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oily or aqueous medium, or may be in the form of a extract, powder, granule, tablet or capsule, and may further include a dispersant or stabilizer.

Drawings

FIG. 1 is a network diagram of miR-1468-5p-mRNA targeting relationship

FIG. 2 is a network diagram of miR-629-5p-mRNA targeting relationship

FIG. 3 is a graph of miR-629-5p and miR-1468-5p differential expression

FIG. 4 is a graph for detecting the influence of miR-629-5p and miR-1468-5p on the osteogenic capacity of hMSCs

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. Those of ordinary skill in the art will understand that: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening of MiRNAs associated with postmenopausal osteoporosis

1. Sample collection

Blood samples were collected from 30 healthy persons and postmenopausal osteoporotic patients each. Standing EDTA anticoagulation tube for 10min, centrifuging to separate serum, and storing at-20 deg.C. All the specimens were obtained with the consent of the tissue ethics committee. 5 samples are taken for detection and analysis of miRNA expression profiles, differential expression gene screening is carried out, and large sample verification experiments are carried out on all 30 samples.

Exclusion criteria: those who undergo premature menopause; patients with secondary osteoporosis caused by endocrinopathy, hematopathy, connective tissue disease, drug and nutritional diseases; metabolic bone diseases, chronic liver and kidney diseases, and other diseases interfering with bone metabolism; patients who have recently taken estrogen, calcium, diphosphate, vitamin D, etc.; patients with diabetes; patients with hypertension; combined with severe cardiovascular and cerebrovascular diseases.

2. Extraction of total RNA from samples

Total RNA was extracted using a blood RNA extraction kit from Invitrogen.

3. Quality analysis of RNA samples (NanoDrop 1000 Spectrophotometer)

Detecting an RNA sample by a NanoDrop1000 spectrophotometer, wherein the sample for RNA-seq sequencing requires: OD260/OD280 was 1.8-2.2.

And (2) carrying out agarose gel electrophoresis on the extracted RNA, detecting the quality of the RNA sample by an Agilent Technologies 2100 Bioanalyzer, observing and photographing on a gel imager, and storing an image, wherein the total RNA quality can be preliminarily judged to be better when the ratio of 28S to 18S is more than or equal to 2.

4. Construction of miRNA libraries

1) Enrichment of Small RNA

Using 5. mu.g-10. mu.g RNA samples, different fragment sizes of RNA were then separated on a polyacrylamide gel, and 18-30nt (14-30 ssRNA Ladder Marker, TAKARA) bands were selected for recovery.

2) Add the piecing

5' ligation linker reaction system: reaction conditions are as follows: at 20 ℃ for 6 h; separating RNA with different fragment sizes by polyacrylamide gel; the 40-60 nt bands were selected for recovery.

3' linker reaction system: reaction conditions are as follows: at 20 ℃ for 6 h; separating RNAs with different fragment sizes by using polyacrylamide gel; the 60-80 nt bands were selected for recovery.

3) Reverse transcription

Reaction conditions are as follows: 10min at 65 ℃; 48 ℃ for 3 min; 42 ℃ for 1 h; 70 ℃ for 15 min.

4) PCR amplification

Reaction conditions are as follows: 30s at 98 ℃; 12-15 cycles (98 ℃, 10s, 72 ℃, 15 s); 72 ℃ for 10 min; storing at 4 ℃.

5) Purification of PCR products

And (3) purifying by using polyacrylamide gel, separating bands EB with about 110bp, dissolving, and obtaining a final library as a gel recovery product.

6) Library quality inspection

Library quality was checked using an Agilent 2100 Bioanalyzer and QPCR.

5. Sequencing on machine

And (4) performing on-machine detection by using a HiSeq4000 sequencer, and performing specific operation according to the instruction.

6. High throughput transcriptome sequencing data analysis

1) Carrying out trim on 5 'and 3' sections of reads by using cutadapt, wherein bases with the mass of less than 20 are removed from trim, and more than 10% of reads with N are deleted;

2) the reads map was mapped to the genome using bowtie. Mature miRNA and miRNA precursor sequences are downloaded from miRBase, and a reference genome is GRCh 38;

3) quantifying the expression of known mirnas with miRDeep 2;

4) the expression difference of the two groups was compared with the DESeq2 package under R environment, and genes were considered significantly differentially expressed when p-value <0.05, | log2FC | > 1.

7. As a result:

33 differentially expressed mirnas were obtained by the above standard screening, of which 18 were up-regulated and 15 were down-regulated. By searching, the miR-629-5p and miR-1468-5p have no report on related menopausal osteoporosis, and follow-up verification experimental study is carried out.

In bioinformatics analysis, 6820 pairs of verified miRNA-mRNA targeting relations are obtained through a mirtarBase database, the miRNA-mRNA targeting relations of miR-629-5p and miR-1468-5p are analyzed, 17 miR-1468-5p target genes and 62 miR-629-5p target genes are analyzed, and a network diagram of the targeting relations of the miRNA-mRNA targeting relations is respectively drawn (specifically shown in a figure 1 and a figure 2).

Example 2 QPCR validation of differentially expressed miR-629-5p and miR-1468-5p

1. Large sample QPCR validation was performed on differentially expressed miR-629-5p and miR-1468-5 p.

2. RNA extraction

The RNA in serum was extracted using QIAGEN blood RNA extraction kit, the detailed procedure was according to the instruction manual.

3. Reverse transcription:

1) 10 pg-1. mu.g of total RNA template was mixed with 2. mu.l of 10 Xbuffer, 2. mu.l of dATP (10 mM), 0.5. mu.l of polyA polymerase, 0.5. mu.l of ribonuclease (RNase) inhibitor and ribonuclease free water (RNase free water) in a final volume of 20. mu.l and incubated at 37 ℃ for 1 h.

2) Mu.l of 0.5. mu.g/. mu.l Oligo (dT) -specific RT primer was added to the reaction tube and incubated at 70 ℃ for 5 min.

3) The RNA and primer secondary structures were disrupted by immediate incubation on ice for at least 2 min.

4) Mu.l of the above reaction mixture was mixed with 4. mu.l of 5 Xbuffer, 1. mu.l of dNTP (10 mM), 0.5. mu. l M-MLV reverse transcriptase, 0.5. mu.l of ribonuclease (RNase) inhibitor, 10. mu.l of polyA reaction mixture and 4. mu.l of RNase free water, and incubated at 42 ℃ for 1 hour.

4. Q-PCR reaction:

1) primer design

Primer for amplifying miR-1468-5p

A forward primer: CTCCGTTTGCCTGTTTCGCTG (SEQ ID NO. 5)

Primer for amplifying miR-629-5p

Primer: TGGGTTTACGTTGGGAGAACT (SEQ ID NO. 6)

Primer for amplifying U6 snRNA

A forward primer: CTCGCTTCGGCAGCACA (SEQ ID NO. 7)

Reverse primer: AACGCTTCACGAATTTGCGT (SEQ ID NO. 8)

2) PCR reaction systems were prepared as in table 1:

among them, SYBR Green polymerase chain reaction system was purchased from Invitrogen corporation.

TABLE 1 PCR reaction System

3) And (3) PCR reaction conditions: 10min at 95 ℃ (15 s at 95 ℃, 60 ℃ for 60) x 45 cycles. SYBR Green as a fluorescent marker, performing PCR reaction on a Light Cycler fluorescent quantitative PCR instrument, using T6 snRNA as a reference gene, determining a target band by melting curve analysis and electrophoresis, and performing relative quantification by a Δ CT method.

5. Results

As shown in fig. 3, compared with healthy people, the expression level of miR-629-5p in peripheral blood of postmenopausal osteoporosis patients is remarkably increased, which is about 2.4 times of that of a control group, 22 of the 30 osteoporosis patients have remarkably high expression, 6 of the osteoporosis patients have no remarkable difference in expression, and 2 of the osteoporosis patients have low expression; the miR-1468-5p expression level is remarkably reduced and is about 0.37 time of that of a control group, in 30 osteoporosis patient groups, 24 patients have remarkably low expression, 5 patients have no remarkable difference in differential expression, and 1 patient has high expression, so that miR-629-5p and miR-1468-5p are suggested to be possibly used as detection targets for diagnosis of osteoporosis.

Example 3 Effect of miR-629-5p and miRNA-1468-5p on osteogenic differentiation

Culturing human mesenchymal stem cells (hMSCs), and culturing the inhibitor of miR-629-5p, has-miR-629-5 p mirVana^TMmiRNA inhibits (life technologies, USA), and mimic has-miR-629-5 p mirVana^TMmiRNA mix (life technologies, USA), inhibitor of miR-1468-5p has-miR-1468-5p mirVana^TMmiRNA inhibit (life technologies, USA), mimic has-miR-1468-5p mirVana^TMmiRNA mimics (life technologies, USA) transfects hMSCs by means of a vector lipofectamine RNAImax Reagent, and observes the influence of miR-629-5p and miR-1468-5p on the induced differentiation of hMSCs into osteoblasts.

1. Culture of cells

Human mesenchymal stem cells (hMSCs) were cultured in a medium containing 10% fetal bovine serum and 1% P/S in a special medium at 37 deg.C with 5% CO₂And culturing in an incubator with relative humidity of 90%. The solution was changed 1 time 2-3 days, passaged by conventional digestion with 0.25% trypsin containing EDTA, and cells in logarithmic growth phase were taken for experiment.

2. Cell transfection

The cell concentration was 3X 10⁵One well was inoculated into 6 well cell culture plates at 37 ℃ with 5% CO₂Culturing cells in an incubator for 24h, changing the culture medium when the cell density is 70%, performing transfection culture according to the transfection instruction, changing the medium once every 3 days, and performing ARS (alizarin red) staining after osteogenesis induction for 14 days.

The experiment of each miRNA (miR-629-5 p, miRNA-1468-5 p) is divided into three groups (a control group, a mimic group and an inhibitor group), each group is provided with three parallel experimental holes, and the specific grouping conditions are as follows:

A. control group (Con): a special culture medium containing 10% fetal calf serum and an osteogenesis inducer;

B. mimetic group 1 (M1): a special culture medium containing 10% fetal calf serum, an osteogenesis inducer, miR-629-5p imic;

C. mimetic group 2 (M2): a special culture medium containing 10% fetal calf serum, an osteogenesis inducer, miR-1468-5p imic;

D. inhibitor group 1 (I1): a special culture medium containing 10% fetal calf serum, an osteogenesis inducer and an inhibitor of miR-629-5 p;

E. inhibitor group 2 (I2): a special culture medium containing 10 percent of fetal calf serum, an osteogenesis inducer and an inhibitor of miR-1468-5 p.

3. ARS staining

The culture solution is discarded from the cells, 4% paraformaldehyde is fixed for 15-20 min, and PBS is washed for 3 times. Adding alizarin red staining solution, adding the alizarin red staining solution into the culture plate during staining, placing the culture plate in an incubator for 15 minutes, discarding the staining solution, washing the culture plate for 3 times by using PBS (phosphate buffer solution), draining, and taking a picture under a differential microscope. Cetyl chloride-containing adjacent precipitate solution (100 mmol/L) was added to the stained 6-well plate at 500. mu.L per well, and after dissolving it sufficiently, an equal amount of the solution was taken in a certain ratio, and each absorbance value was measured using a spectrophotometer for quantification.

4. Results

The result is shown in figure 4, the inhibitor group added with miR-629-5p and the miR-1468-5p mimic group can promote ARS positive markers, and the inhibitor group added with miR-629-5p mimic group and the miR-1468-5p inhibitor group can reduce the ARS positive markers, so that the miR-629-5p and miR-1468-5p can influence the osteogenesis capacity, and the miR-629-5p and miRNA-1468-5p can be applied to treatment of osteoporosis diseases.

While the invention has been described with reference to various preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof without departing from the essential scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from the essential scope thereof.

Therefore, the present invention is not intended to be limited to the particular embodiments disclosed herein for carrying out the present invention; but that the invention will include all embodiments falling within the scope of the appended claims.

Sequence listing

<110> Gu' an Bo Jian Biotechnology Ltd

<120> osteoporosis-specific miRNA, composition and diagnosis and treatment use thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cuccguuugc cuguuucgcu g 21

<210> 2

<211> 86

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gguggguggu uucuccguuu gccuguuucg cugaugugca uucaacucau ucucagcaaa 60

auaagcaaau ggaaaauucg uccauc 86

<210> 3

<211> 21

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

uggguuuacg uugggagaac u 21

<210> 4

<211> 86

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gguggguggu uucuccguuu gccuguuucg cugaugugca uucaacucau ucucagcaaa 60

auaagcaaau ggaaaauucg uccauc 86

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctccgtttgc ctgtttcgct g 21

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgggtttacg ttgggagaac t 21

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ctcgcttcgg cagcaca 17

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aacgcttcac gaatttgcgt 20

Claims

1. Application of reagent for detecting miR-1468-5p and/or miR-629-5p expression in peripheral blood in preparation of postmenopausal osteoporosis diagnosis tool.

2. The use according to claim 1, characterized in that the expression of miR-1468-5p and/or miR-629-5p in the sample is detected by a high throughput sequencing method and/or a quantitative PCR method and/or a probe hybridization method.

3. The use of claim 1, wherein the expression of miR-1468-5p and/or miR-629-5p in the sample is detected by northern hybridization, miRNA expression profiling, ribozyme protection analysis, RAKE, in situ hybridization, or microsphere-based flow cytometry.

4. The use according to claim 2, characterized in that the quantitative PCR comprises primers for the specific amplification of miR-1468-5p and/or miR-629-5 p; the probe hybridization comprises a probe hybridized with a nucleic acid sequence of miR-1468-5p and/or miR-629-5 p.

5. The use of claim 4, wherein the primer for amplifying miR-1468-5p is SEQ ID NO 5; the primer for amplifying miR-629-5p is a sequence SEQ ID NO 6.

6. Use of a pharmaceutical composition for the manufacture of a medicament for the treatment of postmenopausal osteoporosis, said pharmaceutical composition comprising: (a) the compound can regulate the transcription of miR-629-5p and/or inhibit the activity of miR-629-5p mature miRNA, and the compound is antisense oligonucleotide, antagomiRs, miRNA sponge, miRNA Erasers or Target Masking; (b) a carrier which can be accepted in pharmacy.

7. Use of a pharmaceutical composition for the manufacture of a medicament for the treatment of postmenopausal osteoporosis, said pharmaceutical composition comprising: (a) the compound is miR-1468-5p Mimics; (b) a carrier which can be accepted in pharmacy.