CN109652528B

CN109652528B - Molecular marker for postmenopausal osteoporosis

Info

Publication number: CN109652528B
Application number: CN201811589992.0A
Authority: CN
Inventors: 杨承刚; 唐美兰; 向常娟
Original assignee: Gu'an Bojian Biotechnology Co ltd
Current assignee: Gu'an Bojian Biotechnology Co ltd
Priority date: 2018-12-25
Filing date: 2018-12-25
Publication date: 2020-12-11
Anticipated expiration: 2038-12-25
Also published as: CN109652528A

Abstract

The invention discloses a molecular marker for postmenopausal osteoporosis, which is miRNA-760 and miRNA-6734-5 p. Experiments prove that the miRNA-760 and the miRNA-6734-5p are up-regulated in the osteoporosis patients, and meanwhile, the expression level of the miRNA is changed to influence osteogenic differentiation, so that the miRNA-760 and the miRNA-6734-5p can be used as diagnosis and treatment targets of osteoporosis, and the individual diagnosis and treatment of the osteoporosis patients are realized.

Description

Molecular marker for postmenopausal osteoporosis

Technical Field

The invention belongs to the field of biological medicines, and relates to a molecular marker for postmenopausal osteoporosis.

Background

Osteoporosis is a metabolic bone disease characterized by low bone mass and microstructure destruction of bone tissue, resulting in increased bone fragility and easy fracture, and can be divided into primary and secondary types, the primary cause of secondary patients is clear, and endocrine metabolic diseases (such as hyperthyroidism, hypogonadism and the like) or systemic diseases (such as after organ transplantation, chronic renal failure, malnutrition and the like) often cause. The primary patients can be divided into type I and type II, wherein the type I is postmenopausal osteoporosis and occurs in postmenopausal women; type II is found in older adults over 60 years old, with women having a more than 2-fold higher incidence than men. Along with the development trend of the population aging all over the world, the population of osteoporosis patients will become more huge, and social and economic problems brought by osteoporosis complications such as bone pain, fracture and even loss of self-care ability of life are more obvious. Therefore, the method has important significance for researches on occurrence, development, treatment, prevention and the like of osteoporosis.

The osteoporosis diagnosis gold standard is a dual-energy X-ray absorption (DMA) method for measuring bone density (BMD). The DXA test is diagnosed by using a T value measured by comparing the bone density value of the subject with the average peak bone density and standard deviation of a normal reference population, and the national osteoporosis diagnosis and treatment guidelines recommend a standard deviation of 2.5 (-2.5SD) below the peak bone mass as a diagnosis standard. However, bone strength is determined by bone mass and BMD, BMD is only one aspect of bone strength, changes in bone density are a long process, and can be detected by DXA from half a year to two years, BMD cannot provide more clinical information for differential diagnosis of osteoporosis, and has great limitation in clinical use, so BMD is suitable for diagnosis and is not suitable for index of treatment observation. Biochemical markers of bone metabolism, which can be detected from blood and urine, are biochemical products of bone metabolism or related hormones, can be used to reflect the state of bone metabolic balance, and are important indicators for assisting diagnosis, identification, treatment and efficacy evaluation of metabolic bone diseases (linear S, Morin-papunnen L, Piltonen T, purunen J, Sundstrom-poromai, Stener-Victorin E, multi-center study. et al. bone markers in metabolic syndrome: a Clinical endocrinology 2017). The bone metabolism markers include three, that is, common biochemical markers such as blood phosphorus, blood calcium and the like; ② hormones related to bone metabolism regulation such as parathyroid hormone (PTH), vitamin D and the like; ③ bone transformation markers, including bone formation markers and bone resorption markers. Bone metabolism markers are more advantageous over BMD (Lee J, Vasikaran S. Current receptors for bone metabolism and use of bone tumor markers in management of bone tumors 2012; 32(2): 105-.

micrornas play an important role in life activities as an important member of small non-coding RNA populations. From the earliest disclosure of the existence of the microRNA to the present, with the continuous expansion and deepening of the scientific and technological field, people find that the microRNA plays more and intricate life regulation roles, and participates in a series of regulation mechanisms from embryonic development, growth and development, functional recovery, disease occurrence and evolution and individual aging and death in the life process. The miRNA is closely related to bone histiocytes, and mainly relates to four types of cells, namely osteoblasts, osteoclasts, osteocytes and chondrocytes, and when the cells are normally operated, the functional level between bone formation and bone resorption is maintained, so that the normal bone morphology and function are maintained. And various orthopedic diseases occur due to unbalance caused by various reasons. Therefore, the research on the relation between the miRNA and the bone tissue cells can provide a new thought for the research of bone diseases, and potential new diagnostic markers and drug targets, which also provide a new direction for the treatment of the bone diseases.

Disclosure of Invention

In order to remedy the deficiencies of the prior art, it is an object of the present invention to provide a miRNA marker useful for diagnosing postmenopausal osteoporosis. Compared with the traditional diagnosis method of postmenopausal osteoporosis, the miRNA marker is more convenient, rapid, safe and economical to diagnose the postmenopausal osteoporosis.

The invention also aims to provide a molecular target for postmenopausal osteoporosis, and provides a new means for personalized treatment of postmenopausal osteoporosis.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an application of a reagent for detecting miRNA in preparing a product for diagnosing postmenopausal osteoporosis, wherein the miRNA is miRNA-760.

Further, the miRNA also comprises miRNA-6734-5 p.

Further, the product includes reagents for detecting the level of miRNA by using quantitative or digital PCR, sequencing, microarray, Luminex nucleic acid assay, or other hybridization-based techniques.

Further, the miRNA is up-regulated in osteoporotic patients compared to healthy individuals.

The invention provides a product for diagnosing postmenopausal osteoporosis, which comprises a reagent for detecting the level of miRNA-760 and/or miRNA-6734-5 p.

Further, the product comprises a chip, an array or a kit.

The invention provides application of miRNA-760 and/or miRNA-6734-5p in preparation of a medicament for treating postmenopausal osteoporosis.

Further, the medicament comprises an inhibitor of miRNA-760 and/or miRNA-6734-5p, which inhibitor may reduce the level of the miRNA, and/or inhibit or down-regulate the expression of a sequence encoding the miRNA or degrade or cleave the miRNA.

Further, the inhibitor is an antisense oligonucleotide or antagonist to the miRNA.

The invention provides a medicament for treating postmenopausal osteoporosis, which comprises an inhibitor of miRNA-760 and/or miRNA-6734-5 p. The inhibitor may reduce the level of the miRNA, and/or inhibit or down-regulate expression of a sequence encoding the miRNA or degrade or cleave the miRNA.

The invention has the advantages and beneficial effects that:

the invention discovers that the expression levels of miRNA-760 and miRNA-6734-5p are related to the occurrence and development of postmenopausal osteoporosis for the first time, and whether the subject suffers from postmenopausal osteoporosis or not or whether the subject is at risk of suffering from postmenopausal osteoporosis can be judged by detecting the expression levels of miRNA-760 and miRNA-6734-5p of the subject.

The invention discovers that miRNA-760 and miRNA-6734-5p are related to osteogenic differentiation, and the differentiation of mesenchymal stem cells into osteogenic bone can be changed by changing the levels of miRNA-760 and miRNA-6734-5p, which suggests that miRNA-760 and miRNA-6734-5p can be used as molecular targets for the treatment of postmenopausal osteoporosis.

Drawings

FIG. 1 is a graph of the detection of miRNA-760 and miRNA-6734-5p expression in postmenopausal osteoporosis patients using QPCR; wherein panel A is miRNA-760 and panel B is miRNA-6734-5 p;

FIG. 2 is a graph for detecting the effect of miRNA-760 and miRNA-6734-5p on the osteogenic capacity of hMSCs.

Detailed Description

The invention is widely and deeply researched, the expression level of miRNA in blood of postmenopausal osteoporosis patients and normal persons is detected by a high-throughput sequencing method, the miRNA which shows significant differential expression is discovered by bioinformatics analysis, and the relation between the miRNA and the occurrence and development of osteoporosis is discussed, so that a better way and a better method are found for the early diagnosis and treatment of osteoporosis. Through screening, the invention discovers for the first time that the expression levels of miRNA-760 and miRNA-6734-5p in the blood of an osteoporosis patient are obviously higher than those of normal people, and further cell experiments prove that miRNA-760 and miRNA-6734-5p are related to osteogenic differentiation. The invention provides a new molecular target and a new therapeutic target for the research of postmenopausal osteoporosis and the early diagnosis and treatment of postmenopausal osteoporosis.

In the present invention, "control", "control sample" or "reference value" are terms that may be used interchangeably herein and are to be understood as a sample or standard for comparison with a test sample. A control may comprise a sample obtained from a healthy subject or subject that is not at risk of developing osteoporosis or has osteoporosis. Furthermore, the control may also be a standard reference value or range of values, i.e. such as a stably expressed miRNA in the sample, e.g. the endogenous control cel-miR-39.

As used herein, the term "microRNA" or "miRNA" or "miR" refers to a non-coding RNA molecule of about 17 to 25 nucleotides in length, specifically having a length of 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, that hybridizes to and modulates the expression of an encoding messenger RNA. The term "miRNA molecule" refers to any nucleic acid molecule representing a miRNA, including native miRNA molecules, i.e. mature miRNA, pre-miRNA, pri-miRNA.

"miR precursor," "pre-miRNA," or "pre-miR" refers to a non-coding RNA having a hairpin structure that contains a miRNA. pre-miRNA is the product of cleavage of the primary mi-RNA transcript or "pri-miR" by a double-stranded RNA-specific ribonuclease called Drosha. Precursors may be in the form of the corresponding polynucleotides as they occur during maturation of the corresponding polynucleotides.

As a preferred embodiment, the sequences of one representative miRNA are shown in SEQ ID NO.1(miRNA-760) and SEQ ID NO.2(miRNA-6734-5p), respectively.

The identical polynucleotides used herein in the context of polynucleotides to be detected or inhibited in the context of the present invention may have a nucleic acid sequence which is at least 90%, 95%, 97%, 98% or 99% identical to a polynucleotide comprising or consisting of the nucleotide sequence of any of SEQ ID No.1 or SEQ ID No. 2.

Micrornas circulating in cell-free blood such as serum or plasma are a source of minimal or non-invasive biomarkers, allowing minimally invasive detection, and thus have wide applicability in clinics and research libraries. This is particularly advantageous for diseases affecting tissues that are not readily accessible for biopsy.

In the present invention, suitable miRNA detection conditions can be selected by those skilled in the art.

In a preferred embodiment, the level of the target miRNA is determined by Polymerase Chain Reaction (PCR). PCR methods are well known in the art and widely used, and include real-time quantitative PCR, semi-quantitative PCR, multiplex PCR, digital PCR, or any combination thereof. In a particularly preferred embodiment, the level of miRNA is determined by quantitative real-time PCR (qRT-PCR). Methods for determining miRNA levels using qRT-PCR are known in the art and are typically performed prior to reverse transcription of the miRNA into cDNA.

In the PCR methods useful in the present invention, the primers are typically based on mature miRNA molecules, but may include chemical modifications to optimize hybridization behavior.

The qRT-PCR method can determine the absolute expression level of mirnas. Alternatively, the qRT-PCR method can determine the relative amounts of mirnas. The relative amount of miRNA can be determined by normalizing (normaize) the level of miRNA to the level of one or more internal normalizing nucleic acid sequences. Typically, such internal standard nucleic acid sequences should have a constant level in the blood or serum sample being analyzed. For example, the internal standard nucleic acid sequence may be a constitutively transcribed RNA nucleic acid sequence, such as an mRNA, e.g., glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), β -Actin (ACTB), or a non-coding RNA, e.g., 5S and 18S ribosomal RNA, RNU48, RNU44, and RNU 6. In addition, mirnas such as miRNA-760 or miRNA-6734-5p with constant and high levels in serum or plasma can be used as references for relative quantification. Furthermore, synthetic RNA sequences added in equimolar amounts during RNA isolation or cDNA synthesis can be used as a reference for the relative quantification of a particular miRNA.

Since mirnas are relatively short molecules, they can be extended by adding adenosine monomers (a technique known as polyadenylation) to the forward strand of reverse transcription and amplification. Briefly, RNA can be extracted from a sample by appropriate reagents (e.g., Trizol reagent), polyadenylated in the presence of ATP and poly (a) polymerase, reverse transcribed into cDNA using a poly (T) linker and 5'RACE sequence, and amplified using forward and reverse RACE primers derived from the 3' end of miRNA.

The detection of miRNA is also possibleTo achieve this by other methods known in the art, e.g. by deep sequencing methods, microbead-based quantification, e.g. Illumina bead arrays, hydrogel particle-based quantification, e.g. Firefly^TMBy microarray technology, such as Ncode available from Invitrogen^TMHuman miRNA arrays, chip arrays available from Affymetrix, Agilent, or using LNA backbone capture probes (mircurY LNA), e.g., from Exiqon^TMArray).

Differences in miRNA levels can also be determined using multiplex chemiluminescence-based nucleic acid assays such as Panomics or reporter plasmid assays ("biosensors") containing reporter proteins with microRNA-complementary regulatory sites, or other hybridization-based techniques known in the art.

The invention provides a medicine for treating osteoporosis, which comprises miRNA-760 and miRNA-6734-5p inhibitors. In the present invention, whether mirnas themselves or their inhibitors/antagonists are incorporated as active ingredients in therapeutic compositions depends not only on whether these mirnas are up-or down-regulated in patients with osteoporosis, but also on their specific function in the activation of osteogenic differentiation or osteoclastogenesis.

miRNA therapeutics (i.e., inhibitors of mirnas) are typically based on the sequence of the target mature miRNA. Therapeutic agents for miRNA replacement therapy need to share most of the sequence of the substituted mature miRNA. Accurate sequence homology is required in the 5' seed region of mirnas. Therapeutic agents (anti-microRNA oligonucleotides, AMO) aimed at specifically inhibiting the function of mirnas need to be complementary to the target sequence in order to achieve stable hybridization of the mirnas and thus chelation (chelation) of the mirnas. AMO may contain chemical modifications that result in the formation of stable RNA duplexes, such as phosphorothioate backbones, or LNA and 2' OMe modifications of sugar residues, respectively.

Inhibitors of mirnas are well known in the art, and customized miRNA inhibitors are commercially available. For example, the inhibitor in the context of the present invention may be a nucleic acid molecule, such as an antagonistic miRNA or any other T-O-methyl-RNA oligonucleotide with phosphorothioate linkages and cholesterol tail, miRCURY LNATM microRNA inhibitor (Exiqon), in vivo LNATM miRNA inhibitor (Exiqon), micro LNA, miR-decoy or miR-sponge, etc. The inhibitor may also be or be derived from a miRNA degrading enzyme, such as Tedeschi, Drug Discov Today (2009), 14: 776-783, or an anti-glutamyltranspeptidase (anthrogomir) as described in Jadhav, Angew Chem Int Ed Engl (2009), 48 (14: 2557-2560). In the context of the present invention, the inhibitor includes (but is not limited to) an antagomir, a micurary LNATM microRNA inhibitor, an in vivo LNATM miR inhibitor, a mini-LNA, a miR decoy, or a miR sponge.

In an alternative embodiment, the active ingredients of the pharmaceutical composition are selected according to the principle known as "personalized medicine", i.e. in relation to the results of the diagnostic method of the invention, in which case they are referred to as "companion" diagnosis. This means that the decision to administer a therapeutic miRNA in order to replace or inhibit a particular miRNA is closely related to the concomitant diagnostic process of analyzing the level of the particular miRNA in the individual.

Any of the miRNA therapeutics of the invention may be combined with one or more other agents such as teriparatide, denosumab, bruzozumab (blosozumab), romosozumab, bisphosphonates such as alendronate, zoledronate, or one or more bone growth factors or corresponding encoding nucleic acid molecules, e.g., BMP-2 and/or BMP-7, or RNAs such as RNA antagonism miR-760 or miRNA-6734-5 p.

The miRNA-760 and miRNA-6734-5p of the invention can be natural or artificial, or obtained by transfecting cells with a vector capable of expressing DNA fragments of miRNA-760 and miRNA-6734-5 p. Pharmaceutically acceptable carriers of the invention may include, but are not limited to: viruses, liposomes, nanoparticles, or polymers, and any combination thereof. Relevant delivery vehicles can include, but are not limited to: liposomes, biocompatible polymers (including natural and synthetic polymers), lipoproteins, polypeptides, polysaccharides, lipopolysaccharides, artificial viral envelopes, inorganic (including metal) particles, and bacterial or viral (e.g., baculovirus, adenovirus, and retrovirus), phage, cosmid, or plasmid vectors.

The viral vector may be any viral vector capable of accepting the coding sequence of the miRNA gene product; including but not limited to retroviral vectors, adenoviral vectors, adeno-associated viral vectors, herpes viral (e.g., herpes simplex, vaccinia and EB virus) vectors, alphaviral vectors. The tropism of the viral vector can be altered by pseudotyping the vector with envelope proteins or other surface antigens from other viruses or by replacing different viral capsid proteins, if appropriate.

The eukaryotic expression vector may be any suitable expression vector, including but not limited to a pCMV-Myc expression vector, a pcDNA3.0 expression vector, a pcDNA3.1 expression vector, a pEGFP expression vector, a pEF Bos expression vector, a pTet expression vector, a pTRE expression vector, or a vector modified based on known expression vectors, such as pBin438, pCAMBIA1301, and the like.

The DNA fragments capable of expressing miRNA-760 and miRNA-6734-5p can be obtained by the following steps: searching the position and specific sequence information of miRNA-760 and miRNA-6734-5p on the genome from a miRNA database (http:// microrna. sanger. ac. uk/sequences /), determining the positions of miRNA-760 and miRNA-6734-5p initial miRNAs according to the genome sequence, designing specific primers in the interval of 500 and 800bp upstream and downstream of the positions of miRNA-760 and miRNA-6734-5p initial miRNAs, and amplifying the sequences in the middle of the primers to obtain DNA fragments for expressing miRNA-760 and miRNA-6734-5 p.

In the present invention, the term "blood sample" refers to serum, plasma, whole blood and components thereof, blood-derived products or preparations.

In the present invention, the term "treatment" relates to any treatment that improves health, reduces or inhibits unwanted weight loss and/or extends and/or increases the longevity of an individual. The treatment can eliminate the disorder, arrest or slow the progression of the disease, inhibit or slow the progression of the disease, reduce the frequency or severity of symptoms in the subject, and/or reduce the recurrence in a subject who has or has had the disease. The terms "prophylactic treatment" or "prophylactic treatment" are used interchangeably and refer to any treatment intended to prevent the development of a disease in a subject.

As used herein, "prevention" of a disease, disorder or condition refers to a reduction in the occurrence of the disorder or condition in a treated subject relative to an untreated control subject, or a delay in the onset or lessening the severity of one or more symptoms of the disorder or condition relative to an untreated control subject. The terms "protect", "prevent", "prophylactic", "preventive" or "protected" relate to the prevention and/or treatment of the occurrence and/or spread of a disease.

The term "postmenopausal" woman refers to a woman who has not had a period of time for at least one year.

Examples

The present invention is further illustrated below with reference to specific examples, which are provided only for the purpose of illustration and are not meant to limit the scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 screening of MiRNAs associated with postmenopausal osteoporosis

1. Sample collection

Blood samples were collected from 30 healthy persons and postmenopausal osteoporotic patients each. Standing EDTA anticoagulation tube for 10min, centrifuging to separate serum, and storing at-20 deg.C. All the specimens were obtained with the consent of the tissue ethics committee. 5 samples are taken for detection and analysis of miRNA expression profiles, differential expression gene screening is carried out, and large sample verification experiments are carried out on all 30 samples.

Exclusion criteria: those who undergo premature menopause; patients with secondary osteoporosis caused by endocrinopathy, hematopathy, connective tissue disease, drug and nutritional diseases; metabolic bone diseases, chronic liver and kidney diseases, and other diseases interfering with bone metabolism; patients who have recently taken estrogen, calcium, diphosphate, vitamin D, etc.; patients with diabetes; patients with hypertension; combined with severe cardiovascular and cerebrovascular diseases.

2. Extraction of total RNA from samples

Total RNA was extracted using a blood RNA extraction kit from Invitrogen.

3. Quality analysis of RNA samples (NanoDrop1000 Spectrophotometer)

Detecting an RNA sample by a NanoDrop1000 spectrophotometer, wherein the sample for RNA-seq sequencing requires: OD260/OD280 was 1.8-2.2.

And (2) carrying out agarose gel electrophoresis on the extracted RNA, detecting the quality of the RNA sample by an Agilent Technologies 2100Bioanalyzer, observing and photographing on a gel imager, and storing an image, wherein the total RNA quality can be preliminarily judged to be better when the ratio of 28S to 18S is more than or equal to 2.

4. Construction of miRNA libraries

1) Enrichment of Small RNA

Using 5. mu.g-10. mu.g RNA samples, different fragment sizes of RNA were then separated on a polyacrylamide gel, and 18-30nt (14-30ssRNA Ladder Marker, TAKARA) bands were selected for recovery.

2) Add the piecing

5' ligation linker reaction system: reaction conditions are as follows: at 20 ℃ for 6 h; separating RNA with different fragment sizes by polyacrylamide gel; the 40-60nt bands were selected for recovery.

3' linker reaction system: reaction conditions are as follows: at 20 ℃ for 6 h; separating RNAs with different fragment sizes by using polyacrylamide gel; the 60-80nt bands were selected for recovery.

3) Reverse transcription

Reaction conditions are as follows: 10min at 65 ℃; 48 ℃ for 3 min; 42 ℃ for 1 h; 70 ℃ for 15 min.

4) PCR amplification

Reaction conditions are as follows: 30s at 98 ℃; 12-15 cycles (98 ℃, 10s, 72 ℃, 15 s); 72 ℃ for 10 min; storing at 4 ℃.

5) Purification of PCR products

And (3) purifying by using polyacrylamide gel, separating bands EB with about 110bp, dissolving, and obtaining a final library as a gel recovery product.

6) Library quality inspection

Library quality was checked using an Agilent 2100Bioanalyzer and QPCR.

5. Sequencing on machine

And (4) performing on-machine detection by using a HiSeq4000 sequencer, and performing specific operation according to the instruction.

6. High throughput transcriptome sequencing data analysis

1) Carrying out trim on 5 'and 3' sections of reads by using cutadapt, wherein bases with the mass of less than 20 are removed from trim, and more than 10% of reads with N are deleted;

2) the reads map was mapped to the genome using bowtie. Mature miRNA and miRNA precursor sequences are downloaded from miRBase, and a reference genome is GRCh 38;

3) quantifying the expression of known mirnas with miRDeep 2;

4) the expression difference of the two groups was compared with the DESeq2 package under R environment, and genes were considered significantly differentially expressed when p-value <0.05, | log2FC | > 1.

7. As a result:

sequencing results show that compared with healthy people, the expression levels of miRNA-760 and miRNA-6734-5p in postmenopausal osteoporosis patients are remarkably increased, and the miRNA-760 and miRNA-6734-5p are suggested to be possibly used as detection targets for osteoporosis diagnosis.

Example 2QPCR validation of differentially expressed miRNA-760 and miRNA-6734-5p

1. Large sample QPCR validation was performed on differentially expressed miRNA-760 and miRNA-6734-5 p.

2. RNA extraction

The RNA in serum was extracted using QIAGEN blood RNA extraction kit, the detailed procedure was according to the instruction manual.

3. Reverse transcription:

1) 10 pg-1. mu.g of total RNA template was mixed with 2. mu.l of 10 Xbuffer, 2. mu.l of dATP (10mM), 0.5. mu.l of polyA polymerase, 0.5. mu.l of ribonuclease (RNase) inhibitor and ribonuclease-free water (RNase freewater) in a final volume of 20. mu.l and incubated at 37 ℃ for 1 h.

2) Mu.l of 0.5. mu.g/. mu.l Oligo (dT) -specific RT primer was added to the reaction tube and incubated at 70 ℃ for 5 min.

3) The RNA and primer secondary structures were disrupted by immediate incubation on ice for at least 2 min.

4) Mu.l of the above reaction mixture was mixed with 4. mu.l of 5 Xbuffer, 1. mu.l of dNTP (10mM), 0.5. mu. l M-MLV reverse transcriptase, 0.5. mu.l of ribonuclease (RNase) inhibitor, 10. mu.l of polyA reaction mixture and 4. mu.l of RNase free water, and incubated at 42 ℃ for 1 hour.

4. QPCR reaction:

1) primer design

Primer for amplifying miRNA-760

A forward primer: CGGCTCTGGGTCTGTGGGGA (SEQ ID NO.3)

Reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO.4)

Primer for amplifying miRNA-6734-5p

A forward primer: TTGAGGGGAGAATGAGGTGGAGA (SEQ ID NO.5)

Reverse primer: GTGCAGGGTCCGAGGT (SEQ ID NO.6)

Primer for amplifying U6snRNA

A forward primer: CTCGCTTCGGCAGCACA (SEQ ID NO.7)

Reverse primer: AACGCTTCACGAATTTGCGT (SEQ ID NO.8)

2) PCR reaction systems were prepared as in table 1:

among them, SYBR Green polymerase chain reaction system was purchased from Invitrogen corporation.

TABLE 1PCR reaction System

	Volume of
		SYBR Green polymerase chain reaction system	12.5μl
Forward primer	1μl
		Reverse primer	1μl
cDNA template	2μl
		ddH₂O	8.5μl
Total volume	25μl

3) And (3) PCR reaction conditions: 10min at 95 ℃ (15 s at 95 ℃, 60 ℃ for 60) x 45 cycles. SYBR Green is used as a fluorescent marker, PCR reaction is carried out on a Light Cycler fluorescent quantitative PCR instrument, T6snRNA is used as a reference gene, a target band is determined by melting curve analysis and electrophoresis, and relative quantification is carried out by a delta CT method.

5. Results

As shown in figure 1, compared with a healthy human sample, the expression levels of miRNA-760 and miRNA-6734-5P in postmenopausal osteoporosis are remarkably increased, the difference has a statistical significance P <0.05, and the miRNA-760 and miRNA-6734-5P can be used as molecular markers for early diagnosis of osteoporosis.

Example 3 Effect of miRNA-760 and miRNA-6734-5p on osteogenic differentiation

Culturing human mesenchymal stem cells (hMSCs), and culturing the inhibitor of miRNA-760, has-miR-760mirVana^TMmiRNA inhibit (life technologies, USA), mimic has-miR-760mirVana^TMmiRNA mix (life technologies, USA), inhibitor of miRNA-6734-5p has-miR-6734-5p mirVana^TMmiRNA inhibits (life technologies, USA), and mimics has-miR-6734-5p mirVana^TMmiRNA mimics (Life technologies, USA) transfects hMSCs by means of a lipofectamine RNAImax Reagent, and observes the influence of miRNA-760 and miRNA-6734-5p on the induced differentiation of hMSCs into osteoblasts.

1. Culture of cells

Human mesenchymal stem cells (hMSCs) were cultured in a medium containing 10% fetal bovine serum and 1% P/S in a special medium at 37 deg.C with 5% CO₂And culturing in an incubator with relative humidity of 90%. The solution was changed 1 time 2-3 days, passaged by conventional digestion with 0.25% trypsin containing EDTA, and cells in logarithmic growth phase were taken for experiment.

2. Cell transfection

The cell concentration was 3X 10⁵One well was inoculated into 6 well cell culture plates at 37 ℃ with 5% CO₂Culturing cells in an incubator for 24h, changing the culture medium when the cell density is 70%, performing transfection culture according to the transfection instruction, changing the medium once every 3 days, and performing ARS (alizarin red) staining after osteogenesis induction for 14 days.

The experiment is divided into three groups, each group is provided with three parallel experimental holes, and the specific grouping conditions are as follows:

A. control group (Con): a special culture medium containing 10% fetal calf serum and an osteogenesis inducer;

B. mimetic group 1 (M1): a special culture medium containing 10% fetal calf serum, an osteogenesis inducer and miRNA-760 micic;

C. mimetic group 2 (M2): a special culture medium containing 10% fetal calf serum, an osteogenesis inducer, miRNA-6734-5p imic;

D. inhibitor group 1 (I1): a special culture medium containing 10% fetal calf serum, an osteogenesis inducer and an inhibitor of miRNA-760;

E. inhibitor group 2 (I2): a special culture medium containing 10 percent of fetal calf serum, an osteogenesis inducer and an inhibitor of miRNA-6734-5 p.

3. ARS staining

The culture solution is discarded from the cells, 4% paraformaldehyde is fixed for 15-20 min, and PBS is washed for 3 times. Adding alizarin red staining solution, adding the alizarin red staining solution into the culture plate during staining, placing the culture plate in an incubator for 15 minutes, discarding the staining solution, washing the culture plate for 3 times by using PBS (phosphate buffer solution), draining, and taking a picture under a differential microscope. Cetyl chloride-containing adjacent precipitate solution (100mmol/L) was added to the stained 6-well plate at 500. mu.L per well, and after dissolving it sufficiently, an equal amount of the solution was taken in a certain ratio, and each absorbance value was measured using a spectrophotometer for quantification.

4. Results

The result is shown in figure 2, the inhibitor group added with miRNA-760 or miRNA-6734-5p can promote ARS positive markers, and the inhibitor group added with miRNA-760 or miRNA-6734-5p reduces ARS positive markers, which indicates that miRNA-760 and miRNA-6734-5p can affect osteogenic capacity, and suggests that miRNA-760 and miRNA-6734-5p can be applied to the treatment of osteoporosis diseases.

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Claims

1. The application of the reagent for detecting miRNA in the preparation of products for diagnosing postmenopausal osteoporosis is characterized in that the miRNA is miRNA-760.

2. The use of claim 1, wherein the miRNA further comprises miRNA-6734-5 p.

3. The use according to claim 2, wherein the product comprises reagents for detecting the level of miRNA by using quantitative or digital PCR, sequencing, microarray, Luminex nucleic acid assay or other hybridization-based techniques.

4. The use of claim 1 or 2, wherein the level of the miRNA is upregulated in osteoporotic patients as compared to healthy individuals.

5. The use of claim 1, wherein the product comprises a chip, an array or a kit.

The application of the miRNA-760 inhibitor in preparing the medicine for treating postmenopausal osteoporosis.

7. The use of claim 6, wherein the inhibitor is an antisense oligonucleotide or antagonist to the miRNA.