CN113564253B

CN113564253B - Application of circ_0000173 as ovarian cancer prognosis and treatment marker

Info

Publication number: CN113564253B
Application number: CN202110875383.7A
Authority: CN
Inventors: 夏大静; 汪舫; 吴一华
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2021-07-30
Filing date: 2021-07-30
Publication date: 2023-09-22
Anticipated expiration: 2041-07-30
Also published as: CN113564253A

Abstract

The expression of the circular RNA circRNA 0000173 in ovarian cancer tissue is up-regulated; the high expression of the recombinant expression can predict bad prognosis; inhibition of the expression of circRNA 0000173 inhibits ovarian cancer cell proliferation, migration, invasion and epithelial-mesenchymal transition, and circRNA 0000173 can target binding to PKM2 protein, exerting a promoting effect in tumorigenesis and metastasis. The circRNA 0000173 is suggested to be a novel diagnosis biomarker and a powerful ovarian cancer treatment target.

Description

Application of circ_0000173 as ovarian cancer prognosis and treatment marker

Technical Field

The invention relates to the technical field of molecular detection, in particular to a method for detecting and treating ovarian cancer by using circRNA.

Background

Ovarian cancer is one of three malignant tumors of female reproductive system, the incidence rate of the ovarian cancer tends to be stable in recent years, but the death rate is still in an ascending trend, and the ovarian cancer is the main cause of death of gynecological malignant tumors and is the fifth cause of death related to female tumors. Ovarian cancer is hidden from disease, usually has no obvious symptoms in the early stage, and lacks effective screening and early diagnosis measures, with 70% of patients already in the advanced stage when diagnosis is to be established. Worldwide, women have a risk ratio of developing ovarian cancer of 1.4 to 1.5% throughout life, and a mortality risk ratio of about 1%. Studies on ovarian cancer tissue heterogeneity and high throughput sequencing have shown that most of ovarian tumors are epithelial ovarian cancers (Epithelial Ovarian Cancer, EOC). Although chemotherapy based on platinum and paclitaxel is used as an auxiliary treatment for tumor cell reduction, and new treatments such as immunotherapy and intraperitoneal thermal perfusion chemotherapy are tried in recent years, the average clinical alleviation time is two years, and the five-year survival rate is only about 30%. The reasons for the high mortality rate of ovarian cancer mainly comprise few early screening indexes, difficult early diagnosis and high metastasis and recurrence, and in addition, the ovarian cancer is difficult to completely clear focus in the surgical treatment process, so that the postoperative recurrence rate is high and the prognosis is poor. Therefore, the exploration of new pathogenesis of ovarian cancer and the search of potential diagnosis and treatment targets and tumor markers are important points and difficulties to be solved in the basic and clinical research fields of ovarian cancer at present.

In recent years, research in the field of ovarian cancer in epigenetic science has progressed very rapidly. Epigenetic can regulate gene expression from chromatin, DNA, protein and RNA levels, including principally DNA methylation, histone modification, nucleosome reconstruction, and non-coding RNA regulation, among others ^[7] Wherein RNA plays a key role in epigenetic regulation, can be used as an information transmission intermediate from DNA to protein, and has various biological functions. Circular RNA (circRNA) is a novel non-coding RNA with a closed Circular structure that has been attracting attention in recent years, and has high expression level, stability and wide distribution. The circrnas are largely divided into 3 categories according to their composition and circulation mechanism: exon circRNA, intron circRNA, and exon-intron circRNA.

The circRNA is produced from pre-mRNA (pre-mRNA) and transcribed by RNA polymerase II, a structure that causes the circRNA to lack a 5' poly A tail, a feature that allows the mature circRNA to be structurally stable, sequence-conserved, highly abundant, and dynamically expressed within specific tissues under specific conditions. Therefore, the circRNA can resist the degradation of exonuclease, is rich in expression, is relatively conserved among various species, and has the specificity of tissue and development time sequence. The circRNA has the following molecular marker characteristics: high expression selectivity, often equivalent to that of linear RNA (hostgene), is high in cells and organs with slow proliferation; the compound is highly stable, and the closed ring structure can resist degradation of RNase; relatively conserved among different species; specific expression, the expression of the circRNA has the specificity of tissue and development time sequence; the detection is convenient, and not only the expression in tumor tissues, but also the detection by serum and urine can be realized. Current studies have demonstrated that functional circrnas can affect the development and progression of tumors in a variety of ways, such as endogenous competitive inhibition of micrornas, interactions with circRNA binding proteins, modulation of transcription or splicing. In the field of gynaecological malignancies, there are several diseases related to cireports of rcRNA targeting protein molecules or circRNA-miRNA-mRNA networks in female reproductive system tumorigenesis and development, such as circRNA 0049116 (circMUC 16) in ovarian cancer by binding ATG13 protein, up-regulating ATG13 expression in ovarian cancer cells, enhancing autophagy, and thereby promoting proliferation and metastasis of ovarian cancer cells ^[22] Whereas circRNA-0132980 (circSLC 26A 4) can up-regulate HOXA7 by competing for binding to miR-1287-5p, thereby promoting progression of cervical cancer. The above studies suggest great potential of circRNA in the study of female reproductive tumors. Nevertheless, the generation and biological function of circRNA is very limited, and the role and related mechanisms of circRNA in the development and progression of common malignant tumors in gynaecology, especially ovarian cancer with extremely high malignancy and mortality, are not well understood.

PKM2 is known to be both the rate-limiting enzyme that catalyzes glycolysis and a key enzyme that regulates tumor aerobic glycolysis. PKM2 with high expression and low catalytic activity of tumor cells endows the tumor cells with a specific glycometabolism phenotype, and provides a large amount of ATP, intermediates for synthesizing nucleic acid, amino acid and lipid for the tumor cells. In tumor cells, PKM2 replaces other pyruvate kinase normal phenotypes (PKMl, PKL and PKR), resulting in increased glucose uptake, accumulation of sugar metabolites and metabolic reprogramming (from aerobic oxidation of sugar to anaerobic oxidation of sugar to the main), providing favorable and necessary conditions for the growth and survival of cancer cells. Conditions of relative nutrient deficiency occur in the rapid proliferation and invasion of tumor cells, which acquire and utilize various nutrients in a special manner, besides the need for sugar and lipid, but also the ingestion and utilization of non-traditional metabolic raw materials such as lactic acid, ketone bodies, acetic acid, branched-chain amino acids and the like. In addition to promoting the metabolic pathway of aerobic glycolysis of tumor cells, PKM2 can exert a tumorigenic effect through a non-metabolic regulatory pathway, and its effect has recently been attracting attention from studies in the tumor field.

Up to now, no prior art has suggested that specific relationship between circRNA and PKM2 and whether the relationship between circRNA and PKM2 can be used for specific tumor diagnosis and prognosis related research, and the technical problem to be solved by the present invention is to find specific relationship between circRNA and PKM2 through research, and apply the relationship to diagnosis of specific tumor.

Disclosure of Invention

In the present invention, we found and identified a novel circular RNA circRNA 0000173, which was 1) up-regulated in ovarian cancer tissues compared to control normal tissues by NCBI-SRA database analysis; 2) Meanwhile, high expression of circrna_0000173 predicts poor prognosis; 3) Functionally analyzed, reduced expression of circRNA 0000173 inhibited ovarian cancer cell proliferation, migration, invasion and epithelial-mesenchymal transition; 4) Importantly, circRNA 0000173 can bind to PKM2 protein with targeting, and in cell experiments we demonstrate that circRNA 0000173 plays a promoting role in tumorigenesis and metastasis by binding to PKM2 protein. In summary, our invention can provide a novel diagnostic biomarker and a powerful therapeutic target for ovarian cancer.

In order to further verify the certainty of circ_0000173 as circular RNA, the invention confirms that the base sequence is reverse-loop by using Northern blot and cutting gel to carry out Sanger sequencing; in gel electrophoresis of the amplified RNA products, however, we found that mRNA was amplified with the circ 0000173 primer for the corresponding specific band, which was not found in genomic DNA. Fluorescence In Situ Hybridization (FISH) localization analysis showed that circ 0000173 was widely expressed in the cytoplasm and nucleus of ovarian cancer cells.

In addition, the present invention explores the progression of ovarian cancer cells by circRNA 0000173. A circRNA-0000173 knock-down model is constructed by using an A2780 cell line with high expression of circRNA-0000173, and a circRNA-0000173 overexpression model is constructed by using a SKOV3 cell line with low expression of circRNA-0000173. We examined the proliferation level of ovarian cancer cells by the Edu cell proliferation method, and found that knocking down circRNA 0000173 inhibited cell proliferation, while upregulation of circRNA 0000173 promoted proliferation. Clone formation experiments showed that knockdown circRNA 0000173 inhibited cell colony formation, while upregulation of circRNA 0000173 promoted colony formation. Transwell experiments detect the migration and invasion capacity of ovarian cancer cells, knockdown the migration and invasion capacity of ovarian cancer cells of circRNA 0000173 is reduced, while upregulation of circRNA 0000173 promotes cell migration and invasion.

The invention further explores the biological mechanism of regulating the development of ovarian cancer cells by using circRNA-0000173, marks streptavidin magnetic beads after in vitro transcription of circ-0000173, incubates the marked circ-0000173 with protein lysate from A2780 cells, and then performs coomassie brilliant blue staining and WB detection of SDS-PAGE gel (FIG. 4A). Further studies found that nucleic acid binding to amino acids between circRNA-0000173 and PKM2 was scored by the CatRAPID software, and that in the sequence of circRNA-0000173, 76-142 bases were scored for high binding to PKM2 (FIG. 4B). Gene function predictive analysis of differential gene groupings after binding of circRNA 0000173 to PKM2 using GSEA software suggests that circRNA 0000173 significantly upregulates the epithelial-mesenchymal transition (EMT) pathway after binding to PKM 2.

According to the invention, the development research of the ovarian cancer by combining the circRNA-0000173 with the PKM2 is carried out, western blot and Transwell experiments detect the marker molecules of the tumor development after the circRNA-0000173 is combined with the PKM2 to up-regulate beta-catenin, and as a result, the fact that the epithelial marker E-cadherein related to EMT is down-regulated under the influence of the circRNA-0000173/PKM 2/beta-catenin, and the interstitial markers Vimentin and N-cadherein are up-regulated, so that the migration and invasion capacity of the ovarian cancer can be promoted after the circRNA-0000173/PKM 2/beta-catenin is acted. Survival analysis was performed using TCGA ovarian dataset, with PKM2 high-expression group patients with significantly worse prognosis than PKM2 low-expression group patients.

As a key class of non-protein-encoding RNAs, circRNAs are important for the development and progression of tumors. However, compared to lncRNAs and microRNAs, there is relatively little research into the circRNAs involved in the development of ovarian carcinogenesis. In the present invention, we have discovered and validated that a novel circRNA molecule, circRNA_0000173, up-regulates expression in ovarian cancer tissue, and that high expression of circRNA_0000173 can predict poor prognosis of ovarian cancer. In addition, inhibition of circRNA 0000173 can effectively inhibit proliferation, migration, invasion and epithelial mesenchymal transition of ovarian cancer cells. The circRNA 0000173 specifically binds to PKM2 protein, and affects tumor progression through PKM2 signaling. Our invention describes the role of circRNA 0000173 in ovarian cancer and finds that it may appear on stimulation to have a regulatory axis for PKM2 formation. As mentioned above, metabolic reprogramming clinics and basic studies directed to PKM2 and its effects in tumor therapy are also entering an important stage. Silencing against circRNA 0000173 therefore inhibits PKM2 protein and thus inhibits the development of ovarian cancer, potentially as a new treatment for future ovarian cancer.

The invention firstly provides an application of circular RNA circRNA 0000173 in preparing a reagent for diagnosing ovarian cancer. In a specific embodiment, the sequence of the circRNA 0000173 is shown in SEQ ID NO. 1.

In another aspect of the invention, there is provided the use of a reagent for specifically detecting circular RNA circRNA 0000173 in the preparation of a medicament for diagnosing ovarian cancer; in a specific embodiment, the specific detection reagent for circular RNA circRNA 0000173 is a nucleic acid amplification primer or an in situ hybridization probe; preferably, the specific detection reagent is a PCR amplification primer, and the sequence of the specific detection reagent is shown as SEQ ID NO. 2-3.

In a further aspect of the invention there is provided the use of the circular RNA circRNA 0000173, preferably wherein the sequence of circRNA 0000173 is as shown in SEQ ID NO. 1, for the preparation of a reagent for the prognosis of ovarian cancer.

In another aspect, the invention provides the use of a reagent for specifically detecting circular RNA circRNA 0000173 in the preparation of a reagent for diagnosing ovarian cancer; in a specific embodiment, the specific detection reagent for circular RNA circRNA 0000173 is a nucleic acid amplification primer or an in situ hybridization probe; preferably, the specific detection reagent is a PCR amplification primer, and the sequence of the specific detection reagent is shown as SEQ ID NO. 2-3.

In another aspect, the invention provides the use of an inhibitor of circular RNA circRNA 0000173 in the preparation of a reagent for the treatment of ovarian cancer. In a specific embodiment, the inhibition is a reduction in expression of circRNA 0000173 by interfering RNA or CRISPR/Cas9 system editing. In another specific embodiment, the interfering RNA has the sequence shown in SEQ ID NOS.5-6.

F:5’-GAAAGAUCCAUGGAGAGAAGA-3’(SEQ ID NO:5)

F:5’-UUCUCUCCAUGGAUCUUUCGG-3’(SEQ ID NO:6)

Drawings

Fig. 1A-B: differential expression analysis of circRNA 0000173 in ovarian cancer and control samples; 15 expression level of circRNA_0000173 in paired ovarian cancer and normal tissue; d: expression level of circRNA 0000173 in ovarian epithelial tumor cell lines. * P <0.05, < P <0.01, < P <0.001.

FIGS. 2A-B Northern blot analysis and Sanger sequencing of the circRNA 0000173 nucleic acid fragment; c: gel imaging analysis of circRNA_0000173 on mRNA and gDNA; d: the circRNA_0000173 expressed localization and level fluorescence in situ hybridization assay in A2780 cells. * P <0.05, P <0.01.

Fig. 3A-B: detecting proliferation capacity of ovarian cancer cells by a Edu method; C-D, detecting the colony forming capacity of ovarian cancer cells by a clone forming test; e, detecting migration condition of ovarian cancer cells through a Transwell experiment; f, detecting invasion capacity of ovarian cancer cells by a Transwell-Matrigel experiment. * P <0.05, P <0.01.

Fig. 4A: the circRNA_0000173 is subjected to in vitro transcription of RNA pulldown protein SDS-PAGE electrophoresis; b: catRAPID analyzes the binding capacity and region of circRNA_0000173 to PKM 2; c: GSEA analysis circRNA 0000173 combined with PKM2 was predictive of gene function for ovarian cancer metastasis EMT effects.

Fig. 5A-B: western blot detection of the effect of circRNA_0000173 and PKM2 on the expression level of EMT marker proteins; C-D, transwell detection of migration and invasion capacity affected by circRNA_0000173 and PKM 2. And E, survival analysis of PKM2 high-low expression groups of TCGA ovarian cancer patients. * P <0.05, P <0.01.

Detailed description of the preferred embodiments

Detailed Description

1) circRNA: the circRNA molecule is in a closed annular structure, is not influenced by RNA exonuclease, and has more stable expression and difficult degradation. Functionally, recent researches show that the circRNA molecule is rich in microRNA (miRNA) binding sites, plays a role of miRNA sponge (miRNA sponge) in cells, and increases the expression level of target genes; this mechanism of action is known as the competitive endogenous RNA (ceRNA) mechanism. Furthermore, studies have shown that the circRNA molecule can bind to proteins and participate in the expression of the proteins. Several studies have also shown that circRNA can be involved in encoding peptide chains for biological effects. The circRNA plays an important regulatory role in disease by interacting with miRNAs and/or proteins associated with the disease.

2) Knocking down: the knock-down, i.e., knock-down, refers to the prevention of gene expression by degrading mRNA of a target gene having a homologous sequence. The double-stranded small RNA is utilized to efficiently and specifically degrade homologous mRNA in cells, so that the expression of target genes in the body is blocked, and the cells have the phenotype of target gene deletion.

3) Overexpression: the expression cassette containing the target gene is transferred into the target cell by using the gene expression vector, the target gene of the expression cassette in the vector is expressed by using the related tool enzyme of the gene expression of the cell, and the result is that the obtained cell expresses the target gene higher than the starting cell. Common over-expression vectors include vectors such as viruses and plasmids, and pages include cloning a target gene into the genome of a cell by means of gene editing; wherein the viral vectors include but are not limited to adenovirus, each serotype of adeno-associated virus, and the therapeutic vectors include but are not limited to pCDNA series, pLCDH-ciR series, pBK series, and the like.

In a specific embodiment of the invention, the general method is as follows:

example 1 differential expression of circRNA and validation thereof

1. Bioinformatics analysis

To determine the differently expressed circRNA in ovarian cancer, the present invention performs circular RNA expression differential analysis based on the find_circ software of python-sam and the R language DEseq package on full transcriptome raw data of ovarian cancer versus paracancerous and tubal epithelium in a public database.

Full transcriptome sequencing samples of ovarian cancer tissue and control tissue were collected in NCBI, and the original sequenced SRA file was downloaded and converted to fastq sequence file. Sequence alignment was performed using hisat2, bowtie2 software with reference to the human reference genome hg 19. The comparison result is analyzed into a circular RNA fragment based on the find_circle software of python-sam, and the analyzed circular RNA is marked according to the chromosome position and the Alias corresponding to the circular RNA. The R language DEseq package was subjected to differential analysis of circular RNA expression. By analysis, we found that the circular RNAs hsa_circ_0000173 were significantly highly expressed in ovarian cancer (fold change=2.541, p value=0.0132) (fig. 1a, b). The nucleic acid base sequence of hsa_circ_0000173 is:

GTGAGAAATTCTTTGATATTGATAGTGGGAGGAAGGCACCTCTACATTCACCACCCAGCCAGCACTATACCATTGTTTTTAACACCTTCGTGCTGATGCAGCTCTTCAATGAAATCAACTCCCGAAAGATCCATGGAGAGAAGAACGTCTTTTCAGGCATCTACCGCAACATTATCTTCTGCTCTGTAGTCTTGGGCACATTCATCTGCCAG(SEQ ID NO:1)。

2. tissue sample validation

Fresh samples of ovarian cancer surgically excised tissue were obtained, 15 pairs of ovarian cancer and control tissue were taken, the expression level of circ 0000173 was detected, tissue RNA was extracted, and total RNA was reverse transcribed into cDNA using PrimeScript II reverse transcription kit (TaKaRa). Quantitative RT-PCR (qRT-PCR) reactions were performed on a Bio-rad CFX96 real-time fluorescent quantitative PCR system using SYBR-Master mix (CWBIO, china). Normalization of relative Gene expression levels to beta-actin protein and use of 2 ^-ΔΔCt The method carries out expression quantity calculation and statistical analysis. The primers for the circRNA_0000173 were designed as follows:

F:5’-CCCGAAAGATCCATGGAGAGA-3’(SEQ ID NO:2)；

R:5’-GGCTGGGTGGTGAATGTAGA-3’(SEQ ID NO:3)。

as a result, ovarian cancer tissue was found to be significantly higher than matched normal tissue (fig. 1C).

3. Ovarian cancer cell culture

The present invention detects the expression level of circ 0000173 in ovarian cancer epithelial cell lines, ovarian cancer cell lines SKOV3, OVCAR3 and ES-2, from ATCC, cultured cells according to ATCC recommended instructions. A2780 cell line was purchased from the basic medical cell center of university of Cooperation and medical science and cultured according to the recommended conditions of the specification. The markers were characterized using Short Tandem Repeats (STRs) and the cell lines were tested for the absence of mycoplasma.

Total RNA was reverse transcribed into cDNA using PrimeScript II reverse transcription kit (TaKaRa). Using SYBR-Master Mix kit (CWBIO, china) in Bio-rad CFX96Quantitative RT-PCR (qRT-PCR) reactions were performed on a fluorescent quantitative PCR system. Normalization of relative Gene expression levels to beta-actin protein and use of 2 ^ΔΔCt The method carries out expression quantity calculation and statistical analysis. As a result, circ_0000173 was found to be highly expressed in A2780 and lowly expressed in SKOV3 (FIG. 1D), so in the subsequent experiments we used A2780 cells as the knock-down cell model and SKOV3 cells as the over-expression cell model.

4.Northern blot

The circRNA 0000173 sequence was designed to be specific for probes synthesized by Feng Hui organisms (fenghbio). The purification and enrichment of the circRNA was performed by RNase R treatment followed by polyaddition and poly (A) + RNA removal, followed by crosslinking with 5% formaldehyde solution and electrophoresis in 1% agarose gel, followed by transfer to charged nitrocellulose membrane (Merck), UV crosslinking and development. Analysis of circRNA-0000173 the analysis of the circRNA-0000173 nucleic acid molecule was performed with reference to DNA maker (Industry) (FIG. 2A).

PCR amplification and agarose gel electrophoresis

Experiments prove that the base sequence is reverse loop formation; RNA and genomic DNA (gDNA) of the ovarian cancer cell line SKOV3 were extracted, electrophoresed on a 2% agarose gel containing gel-red nucleic acid dye, and washed with TBE. cDNA and gDNA PCR products were studied. DNA was isolated by electrophoresis at 100V for 50 minutes. We found that mRNA amplified the corresponding specific band by the circ 0000173 primer, whereas this band was not found in genomic DNA. And the amplified sequence was checked for bases using Sanger sequencing (FIGS. 2B, 2C).

RNA fluorescence in situ hybridization

Subcellular distribution of circRNA-0000173 in A2780 cells was examined using RNA-FISH. Cells were fixed in 4% paraformaldehyde for 30min at room temperature and dehydrated in ethanol gradient (70%, 80%,95%, 100%). The samples were then incubated overnight at 37℃with digoxin-labeled RNA-FISH probes, and incubated for 2h with chromogenic binding to FITC. Antisense RNA probes served as negative controls. The results were examined using a confocal microscope. The sequence of the RNA-FISH probe is TTCATCTGCCAGGTGAGAAATTCT (SEQ ID NO: 4) (circRNA_ 0000173). Fluorescence In Situ Hybridization (FISH) localization analysis showed that circ 0000173 was widely expressed in the cytoplasm and nucleus of ovarian cancer cells (fig. 2D).

Example 2 influence of circ_0000173 on ovarian cancer cell lines

1. Construction of high and Low expressing cell lines

The circRNA 0000173 sequence was synthesized by the Ji Kai gene and cloned into eukaryotic expression vector pcDNA3.1 and lentiviral expression vector pLCDH-ciR. siRNA for circRNA 0000173 was purchased from Ji Kai gene. F5'-GAAAGAUCCAUGGAGAGAAGA-3' (SEQ ID NO: 5) F5'-UUCUCUCCAUGGAUCUUUCGG-3' (SEQ ID NO: 6). Verified shRNA sequence of circRNA_0000173, cloning and cloning into pLCDH-ciR shRNA and expression lentiviral vector.

A circRNA-0000173 knock-down model is constructed by using a circRNA-0000173 constitutive high-expression A2780 cell line, and a circRNA-0000173 overexpression model is constructed by using a circRNA-0000173 constitutive low-expression SKOV3 cell line.

2. Cell proliferation assay

We examined the proliferation level of ovarian cancer cells by the Edu cell proliferation method. Cell proliferation was measured using the EdU-594 in vitro kit (Biyun). Edu detection reagent was added to the complete medium of the ovarian cancer cell line at a concentration of 20. Mu.M. Cells were fixed with 4% paraformaldehyde, and the kit was developed and stained with Azide594 and Hoechst 33342.

It was found that knocking down circRNA 0000173 inhibited ovarian cancer cell proliferation, while upregulation of circRNA 0000173 promoted proliferation (FIGS. 3A, 3B).

3. Cloning formation experiments

For the clonogenic assay, 1000 ovarian cancer cells were seeded into each well of a 6-well plate and maintained in a medium containing 10% fbs for 10 days. Plate clones were then fixed with 4% Paraformaldehyde (PFA), stained with 1% crystal violet solution for 10min, washed and dried, photographed under an inverted microscope and colonies of more than 50 cells were counted.

Clone formation experiments showed that knockdown circRNA 0000173 inhibited cell colony formation, while upregulation of circRNA 0000173 promoted colony formation (FIGS. 3C, 3D).

5. Transwell migration and invasion analysis

Transwell experiments examine the migration and invasive capacity of ovarian cancer cells. For intrusion detection, 1×10 is levitated ⁵ Individual cells were grown in a 24 well Transwell upper chamber (8 um; corning) in 250. Mu.l of serum-free medium. For migration tests, 2×10 suspensions were made ⁵ Cells were in a 24-well plate upper chamber without pretreatment. Fresh medium containing 10% fbs was added to the lower chamber of both methods. After 24h, the invaded or migrated cells were stained with 4% crystal violet, 3 biological replicates were set per treated sample and 3 photographs were taken per replicate.

The results showed that ovarian cancer cells knockdown with circRNA 0000173 had reduced migration and invasion capacity, while upregulation of circRNA 0000173 promoted migration and invasion of cells (fig. 3e,3 f).

Example 3 biological mechanisms of circrna_0000173 to regulate ovarian cancer cell progression

1. RNA in vitro transcription and RNA-pulldown experiments

RNA-pulldown kit (RiboBio) using magnetic bead-bound RNA pulldown protein. The circRNA 0000173 sequence was labeled with biotin RNA according to the manufacturer's instructions, and the sequence was mixed and transcribed in vitro using T7 RNA polymerase (RiboBio) according to the manufacturer's instructions. Biotinylated circRNA 0000173 was incubated with streptavidin-linked magnetic beads (Invitrogen) and then with whole cell protein lysate overnight at 4 ℃. Washing with eluent and centrifuging to obtain protein precipitate, and diluting in protein lysis buffer. The obtained proteins were subjected to Coomassie blue staining and Western blot analysis on SDS-PAGE gels.

2. Protein expression Western blot detection

Proteins were separated on 6% -12% SDS-PAGE gels and then transferred to nitrocellulose membranes (Merck). After blocking with 5% skim milk, membranes were incubated with mouse anti-PKM 2 McAb (1:1000, sigma-Aldrich), mouse anti-beta-actin McAb (1:10000, PTG). Protein bands were visualized using ECL super-sensitized luminescence imaging system (4A Biotech).

The results indicate that the circRNA 0000173 nucleic acid was able to bind to the protein PKM2 (60 KDa) in the drop-down, WB shows that circRNA 0000173 is significantly expressed in PKM2 in the bound protein compared to the antisense strand (fig. 4A).

3. Predictive analysis of binding and effects of circRNA 0000173 and PKM2

RNA and protein binding prediction tool CatRAPID analyzes the binding capacity and region of circRNA_0000173 to PKM 2. The functional prediction of genes for metastatic EMT effects on ovarian cancer following binding of circRNA 0000173 to PKM2 was also analyzed using the gene set functional enrichment analysis tool GSEA (Gene Set Enrichment Analysis) (fig. 4B).

The results show that circrna_0000173 is able to bind to PKM2 protein, and that expression of the bound PKM2 in ovarian cancer cell lines is able to participate in the signal pathway upregulation of epithelial-mesenchymal transition (EMT) of tumor cells (see fig. 4C).

Example 4 targeting inhibition of nest cancer cell progression by interfering circRNA 0000173 and PKM2

1. Treatment of PKM2 expression by the stable expression cell line of circRNA 0000173

Plasmids for PKM2 and siRNA were purchased from Ji Kai gene, qPCR, WB validated the effectiveness of PKM2 plasmids with PKM 2-siRNA in model cell line HEK-293. The constructed circRNA 0000173 stable high expression and low expression cell lines are used for respectively carrying out siRNA and plasmid up-regulation expression transfection treatment of PKM 2.

2. Protein expression Western blot detection

Proteins were separated on 6% -12% SDS-PAGE gels and then transferred to nitrocellulose membranes (Merck). After blocking with 5% skim milk, the membranes were incubated with mouse anti-PKM 2 McAb (1:1000, sigma-Aldrich), E-cadherin (1:1000, CST), vimentin (1:1000, CST), N-cadherin (1:1000, CST), mouse anti-beta-actin McAb (1:10000, PTG). Protein bands were visualized using ECL super-sensitized luminescence imaging system (4A Biotech).

The results suggest that epithelial-to-mesenchymal transition (EMT) of ovarian cancer cells knocked down circRNA 0000173 is significantly reduced, whereas EMT effector markers are reverted after PKM2 overexpression. At the same time, upregulation of circRNA 0000173 promotes cell EMT-effect marker protein expression, while silencing PKM2 inhibits EMT-effect marker protein expression (FIGS. 5A, 5B).

3. Transwell migration and invasion analysis

Transwell experiments examine the migration and invasive capacity of ovarian cancer cells. For intrusion detection, 1×10 is levitated ⁵ Individual cells were grown in a 24 well Transwell upper chamber (8 um Corning) in 250 μl of serum-free medium. For migration tests, 2×10 suspensions were made ⁵ Cells were in a 24-well plate upper chamber without pretreatment. Fresh medium containing 10% fbs was added to the lower chamber of both methods. After 24h, the invaded or migrated cells were stained with 4% crystal violet, 3 biological replicates were set per treated sample and 3 photographs were taken per replicate.

The results show that: ovarian cancer cells knocked down with circRNA 0000173 had reduced migration and invasion capacity, while upregulation of circRNA 0000173 promoted migration and invasion of cells (fig. 5c,5 d).

4. Survival assay for PKM2

clinical significance of the acting protein PKM2 of circRNA 0000173 in ovarian cancer was assessed by RNA sequencing data expression levels of the TCGA database. The data of TCGA ovarian cancer patients are related to the expression level of PKM2, the expression level of PKM2 is defined by a median, and survival data is statistically analyzed by a Kaplan-Meier survival curve and a p-rank curve.

The results showed that among all ovarian cancer patients with TCGA, patients with high PKM2 expression survived significantly worse than those with low PKM2 expression, p=0.022 (fig. 5E).

While the invention has been described in terms of preferred embodiments, it is not intended to limit the invention, but it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope thereof, and it is intended to cover the invention in any form or detail in light of the above teachings.

Sequence listing

<110> university of Zhejiang

<120> application of circ_0000173 as ovarian cancer prognosis and treatment marker

<160> 6

<170> SIPOSequenceListing 1.0

<210> 2

<211> 212

<212> DNA

<213> Homo sapiens (Homo sapiens)

<400> 2

gtgagaaatt ctttgatatt gatagtggga ggaaggcacc tctacattca ccacccagcc 60

agcactatac cattgttttt aacaccttcg tgctgatgca gctcttcaat gaaatcaact 120

cccgaaagat ccatggagag aagaacgtct tttcaggcat ctaccgcaac attatcttct 180

gctctgtagt cttgggcaca ttcatctgcc ag 212

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

cccgaaagat ccatggagag a 21

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggctgggtgg tgaatgtaga 20

<210> 4

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

ttcatctgcc aggtgagaaa ttct 24

<210> 5

<211> 21

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

gaaagaucca uggagagaag a 21

<210> 6

<211> 21

<212> RNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

uucucuccau ggaucuuucg g 21

Claims

1. The application of the primer for specifically detecting the expression level of the circular RNA circRNA 0000173 in preparing the reagent for diagnosing the ovarian cancer is characterized in that the nucleotide sequence of the circular RNA circRNA 0000173 is shown as SEQ ID NO. 1.

2. The use according to claim 1, wherein the primer for specifically detecting the expression level of circular RNA circRNA 0000173 has the nucleotide sequence shown in SEQ ID No. 2-3.

3. The application of the inhibitor for reducing the expression level of the circular RNA circRNA 0000173 in preparing the medicines for treating the ovarian cancer is characterized in that the nucleotide sequence of the circular RNA circRNA 0000173 is shown as SEQ ID NO. 1, and the inhibitor for reducing the expression level of the circular RNA circRNA 0000173 is interfering RNA.

4. The use according to claim 3, wherein the interfering RNA has the nucleotide sequence shown in SEQ ID No. 5 or SEQ ID No. 6.