LU101943B1 - Method for preparing novel coronavirus pneumonia bivalent vaccine - Google Patents

Abstract

Disclosed is a method for preparing a novel coronavirus pneumonia bivalent vaccine, which includes amplifying 2019-nCoV targeted interference gene shRNA, digesting PCR product, constructing interference vector pSilencer-shRNA, transferring DH5a, constructing shuttle vector pDC312 -shRNA and co-transfection of HEK293 with adenovirus backbone plasmid pBHGloxAEl to obtain Ad-shRNA, and then to obtain Ad-nCoVdsRNA; also includes amplifying 2019-nCoV antibody expression gene, digesting PCR product, constructing shuttle plasmid pShuttle-nCoV and transferring with DH5a, after PCR amplification, PCR co-transfecting HEK293 with adenovirus backbone plasmid pAd-nCoV to prepare recombinant adenovirus Ad-nCoV, and then prepare Ad-nCoVDNA; preparing a bivalent vaccine with Ad-nCoVdsRNA: Ad-nCoVDNA: H2O = 1: 1: 19; after inoculation via respiratory spray, Ad introduces nCoVdsRNA and nCoVDNA into cells, where nCoVdsRNA immediately generates dsRNA through its shRNA, and degrades homologous viral mRNA immediately, and nCoVDNA expresses proteins by encoding mRNA, and then produces antibodies to neutralize the virus.

Description

METHOD FOR PREPARING NOVEL CORONAVIRUS PNEUMONIA LU101943

BIVALENT VACCINE TECHNICAL FIELD

[0001] The disclosure relates to a method for preparing a novel coronavirus pneumonia bivalent vaccine used in the field of prevention and treatment of infectious diseases, and belongs to the technical field of a new method of vaccine preparation.

BACKGROUND

[0002] Human coronaviruses (HcoV 229E and HcoV OC43) can cause up to 30% of colds. Animal coronaviruses, such as porcine transmissible gastroenteritis coronavirus (TGEV), mouse hepatitis coronavirus (MHV), avian infectious bronchitis coronavirus (IBV) etc., can infect the respiratory tract, gastrointestinal tract, nervous system and liver of the corresponding host, leading to corresponding symptoms. The envelope of the coronavirus is a petal-shaped protrusion, making the coronavirus look like a crown (Latin, corona), and its nucleocapsid is a variable long spiral shape. Coronavirus has a virion particle diameter of 60 nm to 140 nm and a spherical shape. The viral genome is a single-stranded sense RNA of 27 kb to 32 kb, which is the largest of all RNA viral genomes. In 2003, a variant of coronavirus caused the outbreak of severe acute respiratory syndrome, ie. SARS, with a SARS-CoV genome size of 27 to 31 kb, 14 open reading frames (ORF) and 1 s2m motif.

[0003] On January 12, 2020, the World Health Organization named the coronavirus that caused the viral pneumonia outbreak in Wuhan, China as the novel coronavirus, or "nCoV-2019". It is reported that they obtained a substantially identical nCoV-2019 genome from 5 patients. Among them, 79.5% of the sequences were consistent with SARS-CoV. By comparing their conserved 7 non-structural proteins, it was found that nCoV-2019 belongs to Envelope RNA virus of SARSr-CoV. nCoV-2019 contains 5 "untranslated region (UTR), replicase complex (orflab), S gene, E gene, M gene, N gene, 3' UTR and several unknown unstructured open reading frames. For the genetic diagnosis (PCR) of nCoV-2019, the Chinese Center for Disease Control and Prevention currently recommends primers and probe sequences for the open reading frame lab (ORF1ab), nucleoprotein (N) gene regions of Wuhan novel coronavirus nCoV-2019, in which: Target 1 (ORFlab): forward primer (F): CCCTGTGGGTTTTACACTTAA; reverse primer (R): ACGATTGTGCATCAGCTGA; probe (P): 5S'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3". Target 2 (N): forward primer (F): GGGGAACTTCTCCTGCTAGAAT; reverse primer (R): 1

CAGACATTTTGCTCTCAAGCTG; fluorescent probe (P): 5S'-FAM-TTGCTGCTGCTTGACAGATT-BHQ1-3'. nCoV-2019 genome-wide sequence and 01943 function analysis (A Novel Coronavirus from Patients with Pneumonia in China, 2019. The New England Journal of Medicine, 2020, January 24) also laid a good foundation for further research of nCoV-2019, but there is currently no more precise information about nCoV-2019.

[0004] With the outbreak and spread of novel coronavirus pneumonia in Wuhan, China, research on therapeutic medicine and biological products has become a top priority. The State-owned Assets Supervision and Administration Commission of the State Council issued an emergency notice on January 22, 2020, requiring central enterprises to actively develop novel coronavirus antisera and vaccines. Richard Hatchett, CEO of the International Epidemiological Prevention Innovation Alliance (CEPI), stated on January 23, 2020 that his institution has invested $ 15 million in the development of the novel coronavirus vaccine. If it goes well, it is expected to start clinical testing in 6 months. On January 26, 2020, Chinese Center for Disease Control stated that the center had begun the development of the novel coronavirus vaccine. At present, the virus has been successfully isolated and seed strains are being screened. On January 26, 2020, Academician Li Lanjuan, State Key Laboratory of Infectious Diseases, Zhejiang University, also stated that three novel coronaviruses have been isolated, which laid the foundation for the next step of vaccine research. Vaccines can be divided into live attenuated vaccines, inactivated vaccines, subunit vaccines, DNA vaccines, recombinant vector vaccines, viral particle-like vaccines and peptide vaccines. The traditional vaccines are mostly dead vaccines, live attenuated vaccines or recombinant subunit vaccines, while the new vaccines are viral nucleic acids encoding antigen proteins or cell vaccines that can elicit specific immune responses. Existing traditional vaccines mainly rely on pathogen antigen proteins to stimulate the body to produce protective antibodies. Existing new vaccines can also stimulate specific cellular immune responses. In view of the fact that the biological characteristics of 2019-nCoV are still unclear and highly infectious, it should be noted that live vaccines are not safe and difficult to prepare. Inactivated vaccines may be reconstituted with wild strains and recovered, and should only be used as an emergency reserve. In contrast, subunit vaccines, DNA vaccines, and peptide vaccines based on modern biotechnology are more safe, practical, and maneuverable. In order to reduce the cost of vaccine transportation, storage, and vaccination, and to facilitate vaccination, several vaccines of different pathogens are often mixed together, called a multi-vaccine, such as the DPT vaccine, a single vaccination can simultaneously prevent diphtheria, tetanus and pertussis. In addition, in order to overcome the shortcomings of poor immune effect caused by strain polymorphism, vaccines against different serotypes of the same pathogen are often mixed together and are called bivalent or multivalent vaccines, such as multivalent HPV vaccines. But 2 can we invent a multivalent vaccine against the novel coronavirus pneumonia that is not related to antigen proteins, antibodies or cellular immunity and is different from existing vaccines? HU101943

[0005] During the extraordinary period of Wuhan pneumonia outbreak, the inventor intends to disclose as soon as possible a method for preparing a novel coronavirus bivalent vaccine based on RNA interference. RNA interference (RNAi) refers to a type of small RNA that can be paired with the target gene to specifically eliminate or turn off the expression of the combined gene. That is, RNAI refers to the efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). It is reported in the literature that Dr. Guo Shu from Fudan University injected antisense RNA into C. ele-gans at Cornell University in 1995 to try to block the expression of par-1 gene. At the same time, she injected sense RNA into the control nematode, in order to observe the enhanced effect of par-1 gene expression. However, the par-1 gene expression in the control group was not only not enhanced, but was blocked as in the experimental group. This kind of result cannot be explained by traditional antisense RNA technology, but they still sent the research results to Cell magazine faithfully and published them. This suspense caught the attention of Dr. Fire A of the Carnegie Institution of Washington. He used gel electrophoresis to purify sense RNA and antisense RNA, and intentionally mixed the purified sense and antisense RNA together to make dsRNA hybrids, and injected nematodes separately. As a result, it was found that the antisense RNA gene suppression effect after purification was significantly weakened, while dsRNA hybrids efficiently and specifically blocked the expression of homologous mRNA, and its blocking effect exceeded antisense RNA by at least 100 times. This result unexpectedly confirms that dsRNA plays a major role in gene suppression. Hre A refers to this role of dsRNA as RNA interference (RNAi). In 1998, Hre A published the research results in Nature magazine, which quickly set off a wave of research on RNA interference in the world, and confirmed that RNA interference is caused by dsRNA injected into eukaryotic cells, which stimulates the eukaryotic cell defense response and generates the silencing complex induced by dsRNA. mRNAs is degraded with homologous sequences to dsRNA, resulting in gene silencing at the post-transcription level and loss of the ability to express proteins or polypeptides. Further research shows that exogenous genes such as viral genes, artificially transferred genes, transposons, etc. are randomly integrated into the genome of the host cell, and when the host cell is used for transcription, some dsRNA is often produced. The host cell immediately responds to these dsRNA. The endoplasmic enzyme (Dicer) in its cytoplasm cuts the dsRNA into multiple small siRNAs (about 21 to 23 bp) with a specific length and structure. Under the action of RNA helicase in the cells, siRNA melts into a sense strand and an anti-sense strand. The anti-sense siRNA is combined with some enzymes in the body (including endonuclease, exonuclease, helicase, etc.) to form an RNA-induced silencing complex (RISC). RISC specifically binds to the 3 homologous region of the mRNA expressed by the exogenous gene. RISC has the function of nuclease, and cleaves the mRNA at the binding site. The cleavage site is the two ends that 199 complementarily bind to the antisense strand in the siRNA. The cleaved mRNA is degraded immediately after being cleaved, thereby inducing the host cell to degrade the mRNA. siRNA can not only guide RISC to cleave homologous single-stranded mRNA, but also can be used as a primer to bind to target RNA and synthesize more new dsRNA under the action of RNA-dependent RNA polymerase (RdRP). The newly synthesized dsRNA is then used by Dicer Cleavage generates a large amount of secondary siRNA, which further amplifies the role of RNAI, and finally the target mRNA is completely degraded. RNAI is similar to gene knockout, but it is far simpler and easier to perform than gene knockout, and it is safer. Because it is not a real knockout, it can avoid the serious consequences of gene knockout. This provides a feasible mechanism for the development of the novel coronavirus dsRNA vaccine based on RNA interference.

[0006] It is reported in the literature that the in vitro test of RNAI antiviral replication is easier to succeed, but siRNA is easily degraded by RNase in the serum in vivo, which requires an ideal vector to deliver shRNA to the cell for expression. Adenovirus recombinant vector technology was first applied to RNAI in 2004 (Xia et al.2004). The classic adenovirus packaging system includes HEK293 cells, shuttle plasmids carrying foreign genes, and backbone plasmids containing the adenovirus genome. The shuttle vector generally has a eukaryotic promoter and multiple cloning sites located downstream of it. The multiple cloning sites of the source gene inserted into the outer is called the foreign gene expression cassette. After the shuttle vector and the backbone plasmid were co-transfected into HEK293 cells, HEK293 cells provided the El protein necessary for virus replication, so that the foreign genes in the shuttle vector were transferred to the backbone plasmid, so that the recombinant adenovirus particles were packed. The most well-researched human adenoviruses include type 2 (Ad2) and type 5 (Ad5). Adenovirus vectors developed by Ad5 have commercialized products for disease treatment and scientific research. They have a broad infection spectrum, are not integrated, safe, easy to operate, high in vitro proliferation titers, large non-essential fragments in the genome, etc., and they are currently the most widely used viral vectors, and when the E3 region is deleted, the immunogenicity is enhanced and may also serve as an immune adjuvant. The most important thing is that the respiratory epithelial cells are rich in coxsackie-adenovirus receptors (CAR). The natural host of Ad5 adenovirus is human respiratory epithelial cells. Therefore, the replication-defective recombinant adenoviral vector can efficiently infect respiratory epithelial cells. Immunization (spray or nasal drops) of the upper respiratory tract provides the possibility. In addition, the immunogen expressed by the coxsackie-adenovirus vectors are basically 4 maintained in the natural conformation of the immunogen after being expressed, processed, folded, modified, and presented by the host cell, which is convenient for simulating the immune 01943 response in a natural state, and the novel coronavirus mainly infects through the respiratory tract. Coxsackie-adenovirus vector vaccine can be conveniently made into oral or upper respiratory tract spray. Inhalation inhalation is not only convenient, but also greatly reduces the cost of use. If an adenovirus vector vaccine can be used to induce an effective mucosal immune response, it will have broad application prospects.

[0007] Nebulized inhalation vaccination is to put the medicine or vaccine into a specific aerosol generator, inhale the medicine or vaccine into the respiratory tract, stimulate the mucosa of the respiratory tract to produce mucosal immunity and further enter the alveoli to have reaction. Because the lung has a huge alveolar surface area, abundant capillaries and a very small transport distance, the inoculated medicine or vaccines can quickly exert their effects after being absorbed by the lungs. Foreign research on nebulized inhalation therapy can be traced back to the 1950s. Riker laboratory developed and launched the first pressure metered dose inhaler in 1956, Medihaler-Epi™ containing epinephrine, and Medihaler-Iso™ containing isoproterenol. Aerosol immunization, which directly vaccinates the respiratory mucosa, not only provides a physiological and immunological advantage, but vaccination on this route also provides potential logistical advantages because it does not require trained personnel. Therefore, the aerosol immunization method is an immunization method worthy of steady promotion. In modern times, people have paid great attention to aerosol inhalation treatment, and more and more aerosol immune medicine have been developed. In terms of human aerosol immunity research, the aerosol vaccination of measles vaccine is the most studied and has been confirmed to have definite efficacy. With the continuous progress of science and technology, nebulization vaccination will become more and more perfect and become a routine immunotherapy approach. Nebulization inhalation inoculation or medicine delivery is always inseparable from the nebulizer, compressed air nebulizer requires an air compressor to drive the nebulizer. The compressed high-speed airflow passes through the Venturi tube, creating a Venturi effect, which creates a negative pressure environment around the nozzle, so that the medicine in the liquid cup is brought out by the high-speed airflow, and the special nozzle hits the baffle at high speed and breaks into droplets with Sum diameter. At present, compressed air nebulizers are widely used in clinics, and can be used for inhalation treatment and vaccination of medicine such as measles, influenza and BCG vaccines.

[0008] In sum, although methods for preparing antigenic vaccines based on pathogen antigens and existing vaccines based on antigenic vaccination to produce immune antibodies to clear pathogens have been widely used, there is no literature or application of the methods of dsRNA vaccines prepared based on conserved genomes and dsRNA vaccine prepared based on dsRNA 01943 vaccination to generate gene silencing complex to degrade pathogen homologous mRNA.

SUMMARY

[0009] The purpose of the present disclosure may be to solve the shortcomings in the prior art that there is no literature report and application method of the dsRNA vaccine preparation method based on the conservative genome of the pathogen or the dsRNA vaccine preparation method based on the dsRNA vaccination to generate the gene silencing complex so that the pathogen homologous mRNA may be degraded , Provided is a method for preparing a novel coronavirus pneumonia bivalent vaccine that is different from the traditional process.

[0010] The object of the present disclosure may be achieved by the following technical solutions:

[0011] (1) Method for preparing Ad-nCoV2019 dsRNA vaccine, amplifying the targeted interference gene shRNA sequence of nCoV2019, the amplified shRNA sequence and the empty interference vector pSilencer4.1.CMV.neo may be digested by BamH I and Hind III to construct interference vector pSilencer-shRNA, the interference vector may be amplified by competent E. coli DHS5a, and after the shRNA inserted is identified without error, it may be digested with empty shuttle vector pDC312 by Hind III and EcoR I to construct the shuttle vector pDC312-shRNA, the shuttle vector and adenovirus backbone plasmid pBHGloxAEI may be co-transfected into HEK293 cells, and homologous recombination may be carried out in the cells to obtain recombinant adenovirus Ad-shRNA, which may be then amplified by HEK293 multiple times to prepare the recombinant adenovirus vector Ad-nCoV2019dsRNA vaccine.

[0012] Further, the targeted interference gene shRNA refers to a sequence with a length of 19 nt that may be complementary to the siRNA sequence, and currently includes ORFlab, 3'UTR, S, E, M, and N gene sequences.

[0013] Further, the targeted interference gene shRNA may be a DNA template expressing a hairpin structure, which may be composed of two single-stranded DNAs that may be mostly complementary, and can form a double-stranded DNA with sticky end of BamH I and Hind HI cleavage sites after annealing and complementation.

[0014] Further, the Ad-nCoV2019VdsRNA vaccine refers to the recombinant adenovirus vector carrying shRNA that enters the respiratory tract or digestive tract epithelial cells, where the shRNA can synthesize dsRNA in the cell, and the synthesized dsRNA can specifically 6 degrade mRNA with homologous sequences so that it loses the ability to express proteins or polypeptides; the Ad refers to a replication-defective recombinant adenovirus vector; and theo 99 nCoV2019 refers to a targeted interference sequence of a conserved gene or a functional gene of a novel coronavirus.

[0015] (2) Method for preparing Ad-nCoV2019 DNA vaccine, amplifying the antibody expression gene of nCoV2019, the amplified sequence and adenovirus shuttle plasmid pShuttle may be digested with Xbal and Kpnl to construct the recombinant adenovirus shuttle plasmid pShuttle-nCoV2019, the shuttle plasmid may be amplified by competent E. coli DHSa and co-transfected with adenovirus backbone plasmid pAd-nCoV2019 into HEK293 cells after the shuttle plasmid is digested by Xbal and Kpnl to identify that nCoV2019 is correct, and homologous recombination may be performed in this cell to obtain recombinant adenovirus Ad-nCoV2019, the recombinant adenovirus may be amplified by HEK293 cells multiple times to prepare Ad-nCoV2019 DNA vaccine of recombinant adenovirus vector.

[0016] Further, the antibody expression gene refers to a gene capable of expressing mRNA, mRNA expressing protein, and protein stimulating the body to produce antibodies.

[0017] Further, the nCoV2019 refers to the conserved gene sequence and the functional gene sequence of the novel coronavirus; the conserved gene and the functional gene currently refers to the gene sequence of ORFlab, 3'UTR, S, E, M, and N.

[0018] Further, the pShuttle-nCoV2019 refers to a recombinant adenovirus shuttle plasmid containing nCoV2019; the pAd-nCoV2019 refers to an adenovirus backbone plasmid containing nCoV2019; the Ad-nCoV2019 refers to a replication-defective recombinant adenovirus vector containing nCoV2019; the Ad refers to a replication-defective recombinant adenovirus vector.

[0019] Further, the Ad-nCoV2019 DNA vaccine refers to a recombinant adenovirus vector carrying antibody expression genes entering epithelial cells of the respiratory tract or digestive tract, where the antibody expression genes can express mRNA, mRNA expresses proteins, and the protein stimulates the body to produce antibodies, and the antibodies may neutralize the novel coronavirus to makes it pathogenic.

[0020] (3) Preparing the novel coronavirus pneumonia bivalent vaccine of the disclosure according to Ad-nCoV2019 dsRNA: Ad-nCoV2019 DNA: H20 volume ratio = 1: 1: 5 ~ 19.

[0021] The beneficial effect of the present disclosure may be that the bivalent vaccine of the present disclosure can have the advantages of quick effect, good effect, safe use, convenient inoculation and the like. First of all, the bivalent vaccine of the present disclosure may be 7 prepared by mixing Ad-nCoVdsRNA vaccine and Ad-nCoV2019DNA vaccine. After spray inoculation, the recombinant adenovirus vector may be introduced into the respiratory tract Or infected cells. The Ad-nCoV2019dsRNA vaccine can immediately generate dsRNA through its shRNA, activate nuclease activity, and degrade the homologous virus mRNA instantly, and quickly make the virus lose its pathogenic effect; while the Ad-nCoV2019 DNA vaccine expresses protein and produces antibodies to neutralize the virus later. Due to the immune mechanism of each component, it may be different from the time point, so it may be suitable for different disease courses and can avoid the serious consequences caused by the failure of the immunization of the monovalent vaccine. Therefore, the multivalent vaccine of the present disclosure may have its advantages and plays a complementary and complementary synergistic role, especially that immune mechanism of the nCoV2019dsRNA component may be different from the antigen-antibody reaction in the prior art, which produces a prominent effect of emergency prevention. Suggesting that in the preparation of a novel coronavirus vaccine, one target gene of one strain should be inserted into an expression vector, or several target genes of one strain may be inserted into one expression vector, or several target genes of several strains may be inserted into one expression vector, to prepare the expression vector of each strain according to this, and then combine into one polytype or multiple strains multi-type Ad-nCoV2019dsRNA or/and Ad-nCoV2019DNA bivalent or multivalent vaccines for future used. Secondly, the vectors for delivering the bivalent vaccine of the present disclosure may be all replication-deficient adenoviruses, which have the advantages of safe use, stable expression and easy operation, etc., because they can efficiently infect respiratory epithelial cells and provide a basis for immunospray vaccination through the oral cavity and upper respiratory tract, which may be theoretically more suitable for the prevention of novel coronavirus pneumonia.

DESCRIPTION OF THE EMBODIMENTS

[0022] The specific implementation method of the present disclosure may be described in detail below.

[0023] Example 1

[0024] shRNA sequences of targeted interference genes (ORFlab, S, E, M, N) may be screened to construct expression vector pSilencer-shRNA (pSilencer-ORF1ab/S/E/M/N). The shRNA expression kit may be transferred to construct adenovirus shuttle plasmid pDC312-shRNA co-transfected with adenovirus backbone plasmid pBHGloxAEI into HEK293 cells, and homologous recombination may be used to obtain recombinant adenovirus Ad-shRNA, which may be amplified and purified multiple times by HEK293 cells to prepare 8 the anti-neoplastic pneumonia dsRNA vaccine with immunoenhancer as the media. After spray-inoculated, the recombinant adenoviral vector (Ad-shRNA) may introduce shRNA int 971943 respiratory epithelial cells and synthesize dsRNA in the cells, followed by specific induction of gene silencing or RNA interference reaction of nCoV mRNA degradation.

[0025] This embodiment relates to a method for preparing nCoV2019 vaccine, which involves but not limited to nCoV2019 ORFlab, S, E, M, N genes and their primers, involves but not limited to the same experimental method, shRNA expression vector pSilencer, pDC312, pBHGloxAEI, pAd , PEGFP, HEK293 and other experimental materials, the method may be also involved in vitro synthesis of nCoV2019-RNA interference therapy products.

[0026] 1. Selection of novel coronavirus RNAI target sites and Construction of shRNA interference vector

[0027] (1) The selection of RNAI target sites and the design of siRNA expression template: According to the novel coronavirus ORFlab, 3'UTR, S, E, M, N gene sequences that have been sequenced, by using Ambion's shRNA online design software (http://www.ambion.com/techlib/misc/siRNAtools.html), multiple siRNA candidate sequences with a length of 19nt can be obtained. According to the Tm value of RNA binding and the result of specific alignment, the siRNA sequence may be preferred, and its complementary genomic region may be selected as the target site for interference. shRNA template expressing the hairpin structure can be designed when combining the polyclonal cleavage sites of pSilencer4.1.CMV.neo interference vector. Each template may be composed of two 55bp single-stranded DNA which may be mostly complementary. After annealing and complementation, a double-stranded DNA with sticky ends of BamH I and Hind III cleavage sites can be formed, which may be used to ligate with the linearized interference vector pSilencer4.1.CMV.neo.

[0028] (2) Construction of shRNA expression vector: The above oligonucleotide chain may be annealed and complemented and ligated with linearized shRNA expression vector pSilencer4.1.CMV.neo to construct shRNA expression plasmid and transformed into competent cell DH5a. The specific methods of annealing complementation and vector ligation may be as follows:

[0029] © Annealing oligo DNA: the synthesized oligonucleotide may be dissolved into 100 uM with ddH20, 5 uL each of the complementary single strands may be mixed, then the 6 oligoDNA mixtures may be placed in a 98 °C water bath and heated for 5 min, then the water bath switch is closed allowing it to cool naturally to room temperature to form double-stranded 9

DNA. The annealing system may be as follows: 100 uM positive strand oligonucleotide: 5 pL; LU101943 100 uM negative strand oligonucleotide: 5 uL; 10xPCR buffer: 2 uL; ddH20: 8 uL; total volume: 20 pL .

[0030] @ Vector ligation: The synthesized double-stranded DNA may be further diluted to nM, and ligated at 16 °C for 30 min. The enzyme ligation system may be as follows: pSilencer4.1.CMV.neo: 4 uL; Sxligation buffer: 2 uL; ds oligo (10 nM): 4 uL; T4 DNA ligase (1U/uL): 1 uL; ddH20: 9 uL; total volume: 20 pL. pSilencer-ORF1lab, pSilencer-3'UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N vectors may be constructed.

[0031] ©) Identification of the vector: The ligation product may be transformed into E. coli competent cell DH5a, and 6 clones from each recombinant vector plate may be selected for sequencing and identification. After confirming that the insert is correct, ,it may be saved for future use.

[0032] 2. The effect identification of shRNA interference vector

[0033] It may be identified by constructing a fluorescent tag vector and co-transfecting 293T cells with shRNA interference vector.

[0034] (1) Construction of ORFlab, 3'UTR, S, E, M, N gene fluorescent tag vectors

[0035] © Design of ORFlab, 3'UTR, S, E, M, N gene primer: according to the genome sequence of the novel coronavirus (nCoV-2019) released by China National Genomic Science Data Center (NGDC) (sequence numbers are GWHABKF00000000, GWHABKG00000000, GWHABKHO00000000, GWHABKI00000000, GWHABKJ00000000), the downstream and downstream primers required for the design of conservative regions may be selected, or the required primers may be designed based on the gene sequencing results of the new and emerging coronavirus strains. The present disclosure takes nCoV2019's ORFlab, 3'UTR, S, E, M, and N genes as examples, and refers to online primer design software. According to different vectors, different cleavage sites, and different identification needs, the biological company may be commissioned to design for the required primers, add a start code at the 5' end of the upstream primer. To clone the amplified product into pEGFP-N1, add a homology arm may be added at the 5' end of the primer for homologous recombination with the vector.

[0036] @ Amplification of ORFlab, 3'UTR, S, E, M, N genes: The gene amplification reaction system and reaction conditions may be carried out according to the kit provided by Shanghai Biotech. The gene amplification products may be recovered and purified for use.

10

[0037] © Linearization of pEGFP-N1 vector: the DH5a strain containing pEGFP-NI | 101943 plasmid may be recovered, the plasmid according to the kit or literature may be extracted, and then enzyme digestion may be performed after the concentration measured. The enzyme digestion system may be as follows: 10xM Buffer: SuL; plasmid DNA: 20uL; Hind III: 2 pL; ddH20: 23 pL; total volume: 50 pL. The mixed solution may be mixed and placed in a 37 °C water bath for 2 h, digested with 0.8% agarose gel electrophoresis, and the linearized vector may be recovered for use.

[0038] @ Construction of pEGFP-ORFlab, pEGFP-3'UTR, pEGFP-S, pEGFP-E, pEGFP-M, pEGFP-N vectors: the homologous recombination kit of Kingsray Company may be used for ligation, the system and conditions may be as follows: linear vector (100-200ng/uL): 6 uL; purified PCR product: 8 pL; 10xCloneEZ buffer: 2 uL; CloneEZ Enzyme: 2 pL; ddH2O: 2 pL; total volume: 20 uL. After the mixture is prepared, it may be gently mixed and kept at 25 °C for minutes, and then kept on ice for 5 minutes. After the ligation is completed, it can be stored at -20 °C for later use or converted immediately.

[0039] (2) Co-transfection method: the interference vectors pSilencer-ORFlab, pSilencer-3'UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N and the corresponding fluorescent tag vectors pEGFP-ORFlab, pEGFP-3 "UTR, pEGFP-S, pEGFP-E, pEGFP-M, pEGFP-N may be co-transfected into 293T cells. The mass ratio of the interference vectors to the tag vectors may be 1: 2, and unrelated interference wells and non-interference wells may be established as controls. The fusion expression of GFP protein in the cells may be observed 48h after transfection, and the interference effect may be evaluated according to the fluorescence intensity.

[0040] (3) Flow cytometry after co-transfection: To quantify the interference effects of different interference vectors, flow cytometry may be used to detect the proportion of cells expressing fluorescent protein in the total number of cells. The flow cytometric analysis method may be as follows:

[0041] © Digesting the tested cells from the cell plate with trypsin and pipetting into single cells, transferring to a 1.5mL centrifuge tube.

[0042] © Centrifuging the cell suspension cells at 40C 300Xg for 10min, discarding the supernatant, and washing by adding cold PBS.

[0043] (3 After repeating step (2) 3 times, fully suspending the cells, and pipetting the cells into an individual.

11

[0044] 4 Taking an appropriate number of cells for on-line detection. The detection method, 101943 adopts Guavaexpress Plus method, and the number of cells passed per second may be kept below 800.

[0045] © After saving the test data, using Flowjo flow analysis software to analyze and count the results.

[0046] (4) Westernbolt analysis of ORFlab, 3'UTR, S, E, M, N proteins

[0047] © Cells collection and lysis: RIPA tissue lysate may be used to lyse cells, the specific steps may be as follows:

[0048] a. Washing the cells with PBS once for use; mixing the lysate with a ratio of 10 uL of PMSF mixed with 1 mL of RIPA.

[0049] b. Adding 150-250 uL of lysate to each well and pipetting several times to make the lysate fully contact with the cells.

[0050] c. Centrifuging the lysed sample at 12000xg for 3.5 minutes. The supernatant may be taken for use.

[0051] @ SDS-PAGE electrophoresis of protein samples:

[0052] The sample may be added to an equal volume of 2xSDS loading buffer, boiled in boiling water for 5min, then ice bathed for 2min, 12000xg, 10min. The preparation of SDS-PAGE gel may be as follows:

[0053] a. Washing and drying the glass plate and starting assembly according to the use method of the vertical electrophoresis device, to ensure good sealing; preparing the separation gel first.

[0054] b. Preparing 10ml of 15% separation gel according to the following ingredients: 30% acrylamide mixed solution: 5.0 mL; 1.5M Tris (pH8.8): 2.5 mL; 10% ammonium persulfate: 0.1 mL; 10% SDS: 0.1 mL; TEMED: 0.004 mL; ddH20 2.3 mL; adding TEMED at last. After the separation gel is prepared, it may be mixed quickly. Using a pipette, the prepared gel solution may be injected into the gap at one end of the glass plate. When the glue surface is about 3 cm away from the edge of the glass plate, adding liquid may be stopped. ddH20 may be added to the top of the gel. When the gel is completely coagulated, the water may be poured off and the residual liquid on the gel may be carefully absorbed with filter paper.

[0055] c. Preparing concentrated gel t, 2ml of 5% concentrated gel may be prepared according to the following ingredients: 30% acrylamide mixed solution: 0.33 mL; 1.0M Tris (pH6.8) 0.25 12 mL; 10% ammonium persulfate: 0.02 mL ; 10% SDS: 0.02 mL; TEMED: 0.002 mL; H20: 1.4 mL. After the concentrated gel is prepared, it may be mixed quickly, TEMED may be added a 01943 the end, a pipette may be used to inject the prepared gel solution into the gap at one end of the glass plate, and after insertion, a comb may be gently inserted to prevent air bubbles and excess gel that flows out may be removed.

[0056] d. Pulling out the comb after the concentrated gel sets.

[0057] e. Removing the gel from the plastic rack and installing it in the bath of electric swimwear. 1xTris-Glycine electrophoresis solution may be added, first out then inside, and finally samples may be taken with 20 per well.

[0058] f. Concentrating gel electrophoresis by using a voltage of 80V. After the sample enters the separation gel, the voltage may be adjusted to 120V until the end of electrophoresis (bromophenol blue enters the electrophoresis solution).

[0059] g. Carefully removing the gel, and using Coomassie Brilliant Blue R-250 staining solution to perform staining on a horizontal shaker. After replacing the decolorizing solution, it may be decolorized on the horizontal shaker overnight, during which the decolorizing solution may be replaced until a clear band appears on the observed gel.

[0060] © Western blot detection.

[0061] a. Transferring membrane: the unstained gel may be put in transfer membrane buffer, the filter paper and PVDF membrane may be cut to the size of the gel, but slightly smaller. After immersing the PVDF membrane in anhydrous methanol for a short time, then it may be put into the membrane buffer, the filter paper may be directly soaked in the membrane buffer. Combined film transfer device (from bottom to top): filter paper (3 layers), PVDF membrane (1 layer), gel, filter paper (3 layers), after assembly, it may be put into the electrophoresis jig and put in the transfer tank, transferred with 150mA constant current for 120min.

[0062] b. Blocking: the membrane may be taken out, put in 10mL of 2.5% PBST-diluted skim milk, and shaked on a shaker for 1h.

[0063] c. Primary antibody binding: the membrane may be put into 10mL of primary antibody (anti-GFP monoclonal antibody, anti-IB-actin monoclonal antibody) diluted in 2.5 skim milk, shaked on a shaker for 1h.

[0064] d. Washing: it may be washed 3 times with PBST.

[0065] e. Secondary antibody binding: the PVDF membrane may put into the secondary antibody diluted 1: 800 and shaked on a shaker for 1h.

13

[0066] f. Washing: it may be washed 3 times with PBST. LU101943

[0067] g. Color developing: The film may be developed using Tiangen HRP-DAB substrate color development kit.

[0068] h. Washing with deionized water to stop color development and observing the result.

[0069] (5) Detection of relative expression levels of ORFlab, 3'UTR, S, E, M, N in transfected cells.

[0070] a. Detecting the relative expression of ORFlab, 3'UTR, S, E, M, N genes in transfected cells, quantitatively evaluating the interference effect of different interference vectors, and using relative fluorescence quantitative RT-PCR detection method.

[0071] b. When performing relative quantitative detection on the target gene transcription of the sample, according to the standard curve equation, the target gene and the copy number of the B-actin internal reference gene being converted from the CT value. The relative expression level of viral gene mRNA may be corrected by B-actin internal reference gene (target gene copy number/B-actin copy number).

[0072] 3. Construction of a recombinant adenovirus shuttle vector (pDC312-2019nCoV) that interferes with 2019nCoV replication

[0073] (1) Transfer of shRNA expression cassette in shRNA interference vector

[0074] shRNA interference vectors (pSilencer-ORFlab, pSilencer-3'UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N) and pDC312 or pShuttle adenovirus shuttle vectors may be conventionally extracted, while using the restriction enzyme Hind III to have a digestion with EcoR I, the shRNA expression cassette nay be cut in the shRNA interference vector, and the pDC312 vector may be linearized.

[0075] The digestion system is as follows: 10xM Buffer with Sul; Plasmid DNA with 20uL; Hind III with 2uL; EcoR I with 2uL; ddH20 with 2luL; total volume with 50uL.

[0076] The linearized vector and shRNA expression cassette may be recovered and ligated as follows: pDC312/pShuttle with 2uL; shRNA expression cassette with 4uL; 5xligation buffer with 4uL; T4 DNA ligase (1U/uL) with luL; ddH20 with 9uL; total volume with 20 uL.

[0077] The ligation product may be transformed into E. coli competent cell DH5a. After overnight cultivation, 4 clones may be picked for sequencing and identification. After confirming that the insert is correct, the recombinant vector may be named pDC312-nCoV2019 (pDC312-ORF1ab, pDC312-3'UTR, pDC312 -S, pDC312-E, pDC312-M, pDC312-N), and they 14 may be saved for future use. LU101943

[0078] (2) Design of primers for identification of recombinant adenovirus shuttle vector (pDC312-nCoV2019)

[0079] Based on the Ad5 sequence published by Genbank and the nCoV-2019 genome sequence published by China National Genomics Science Data Center, primers designed by Shanghai Biotech may be used to amplify 880bp fragments of ORFlab, 3'UTR, S, E, M, N regions (such as ORFIab: F: CCCTGTGGGTTTTACACTTAA; R: ACGATTGTGCATCAGCTGA. N: F: GGGGAACTTCTCCTGCTAGAAT; R: CAGACATTTTGCTCTCAAGCTG), and used for identification of recombinant adenovirus (pDC312/pShuttle).

[0080] (3) Packaging and amplification of recombinant adenovirus (Ad-2019nCoV)

[0081] In the title, Ad stands for recombinant adenovirus vector. Like 2019 nCoV or nCoV2019, it stands for conserved or functional gene loci of novel coronavirus that can be used for targeted interference in Ad, such as ORFlab, 3'UTR, S, E, M, N. The disclosure adopts Admax's dual plasmid transfection system for packaging of recombinant adenovirus, and conventionally transfects HEK293 cells. The transfection ratio of adenovirus backbone vector pBHGIoxAEI and adenovirus recombinant shuttle vector (pDC312-2019nCoV) is 1:3 by mass. The cytopathic condition may be observed every day after transfection, and after about 8 days when 80% of the cells appear CPE, they may be ready to be poisoned. The cell bottle/culture plate may be freezed and thawed to be poisoned 3 times to rupture and disintegrate the cells and fully release the virus in the cells. The freeze-thaw solution may be centrifuged and the virus-containing supernatant may be collected. After centrifugation at 3000 xg at 4 °C for 10 min, the supernatant may be taken and stored for later use. The harvested first-generation recombinant adenovirus (Ad-2019nCoV) may be repeatedly infected with HEK293 cells to proliferate the virus, and the third-generation virus may be extracted. DNA may be extracted using a DNA extraction kit for PCR identification.

[0082] (4) Ad-2019nCoV titer determination

[0083] The recombinant adenovirus titer may be determined using the rapid adenovirus infectious titer (TCIDso) detection kit. Through A series of diluted virus samples may be used to infect 293 cells, each dilution may be infected with 8 cell wells. After about 10 days of culture, the presence of virus-induced cell lesions in each cell well may be determined under the microscope. The number of holes in the spot may calculate the adenovirus titer.

[0084] 4. Verification of Ad-2019nCoV (dsRNA) interference with 2019nCoV replication

[0085] DIn vitro verification: In order to study the interference effect of recombinant 04943 adenovirus Ad-2019nCoV on 2019nCoV replication, Ad-nCoV2019 may be inoculated into HEK293 cells cultured in 12-well plates with 10, 50, 100, 250, and 500 MOI, while using the control virus Ad-CMV only containing the CMV promoter without including the shRNA template sequence may be inoculated as a control virus. 24h after infection, the 2019nCoV strain (clinical isolation) may be inoculated, and the cells inoculated with only 2019nCoV may be used as positive control cells. The cells may be collected and tested after 2019nCoV infection for 48 hours. The relative expression levels of 2019nCoV genes (ORFlab, 3'UTR, S, E, M, N) in each group of cells may be tested to evaluate the interference effect.

[0086] @Animal test:

[0087] A. Experimental animals: Wistar rats may be cultivated in SPF-level animal laboratories, they may be half male and female, 6-8 weeks old, and weighing 110 + 10g. Animal production certificate number may be recorded.

[0088] B. Ad-nCoV2019 (dsRNA) preparation: combining eukaryotic fermentation technology and adenovirus column chromatography purification technology, Ad-nCoV2019 (dsRNA) may be self-amplified, CsCl may be twice centrifuged and purified, and titer is 5x1010pfu/ml.

[0089] C. Formulate experimental methods

[0090] a. Ad-nCoV2019 (dsRNA) nasal drip control group (empty vector control group): it may be anesthetized with 3% pentobarbital intraperitoneal injection, and nasal dripped after 5 minutes, at 0.5ml/body and dose of 1 x 107pfu/dose/rat.

[0091] b. Ad-nCoV2019 (dsRNA) nasal drops group: it may be anesthetized as above, and nasal dropped 5 minutes later at dose of 1 x 107pfu/dose/rat.

[0092] c. Ad-nCoV2019 (dsRNA) injected into the tail vein control group (empty vector control group) at a dose of 1 x 107 pfu/dose/rat.

[0093] d. Ad-nCoV2019 (dsRNA) tail vein injection group: it is given by tail vein injection, the dose is 1 x 107pfu/dose/rat.

[0094] e. Blank control group: tail vein injection of PBS at 0.5ml/mouse.

[0095] f. Feeding method: The rats in the above groups may be equally exposed to the secretions of the diagnosed nCoV2019 patients or the environment containing nCoV2019 strains.

[0096] Each of the above groups may have 10 animals.

16

[0097] g. Observation and sampling: the incidence of rats may be observed, and nCoV2019 of 101943 samples may be detected at weeks 0, 1, 2, 3, and 4.

[0098] h. nCoV2019 diagnosis: by referring to the current commercially available PCR kit, detection and diagnosis may be performed.

[0099] i. Judging the effect of Ad-nCoV2019 (dsRNA) interference with nCoV2019 replication based on the above experimental results.

[0100] j. Naming: If the above results prove that Ad-nCoV2019 (dsRNA) can effectively interfere with nCoV2019 replication, then it may name Ad-nCoV2019 (dsRNA) as "novel coronavirus dsRNA vaccine" or "nCoV2019-dsRNA vaccine".

[0101] 5. Batch preparation of nCoV2019-dsRNA vaccine

[0102] (1) Taking the recombinant adenovirus prepared above to package HEK293 cells, freeze and thaw the cells 3 times in a 37 °C water bath-liquid nitrogen. After each thawing, vortex oscillation may be beneficial to cell lysis (if the prepared nCoV2019-dsRNA vaccine is used for further batch preparation, the operation may start from step 7 below).

[0103] (2) Centrifuging to remove cell debris.

[0104] (3) Inoculating 293 cells in a 60mm culture plate (24-well plate) at 1 * 106 cells/250ul/well, and culturing overnight with serum-free RPMI 1640 to 75% fusion.

[0105] (4) Adding cell lysis supernatant at 250ul/well.

[0106] (5) Cultivating at 37 °C and 5% CO2, then observing CPE (cytopathiceffect) daily, CPE may appear within one week.

[0107] (6) Harvesting the cells when more than 50% of the cells are isshed, .

[0108] (7) Referring to the above steps, repeatedly infecting 293 cells with the lysed supernatant of the diseased 293 cells, expanding the cells with a 150cm2 culture flask, and preparing recombinant adenovirus (nCoV2019-dsRNA vaccine):

[0109] A. Dissolving all viruses into the culture solution to make a storage solution to ensure that the total number of infected viruses per bottle is the same.

[0110] B. Culturing 293 cells by conventional methods. When they reached 90% to 100% confluence, 1 * 1010 virus particles may be inoculated according to the culture area of 150cm2, and 293 cells may be infected with adenovirus.

[0111] C. Incubating for about 36 hours at 37 °C. During this period, the expansion of adenovirus can be observed. With the development of cytopathy, the cells may become round and the refractive index can change, and they may begin to fall off the surface of the culture 17 flask. LU101943

[0112] (8) Purification, concentration detection and storage of recombinant adenovirus (nCoV2019-dsRNA vaccine)

[0113] A. Pipetting 293 cells and transfering the cells to a centrifuge tube.

[0114] B. Centrifuging at 1500g for 20 minutes at 4 °C.

[0115] C. Collecting the supernatant (Supematant # 1) and storing in a centrifuge tube at 4 °C.

[0116] D. Using 2 Resuspend the cell pellet in 5 ml sterile 100 mM Tris-HCI (pH 7.4).

[0117] E. Repeatedly freezing and thawing the cells 3 times in a 37 °C water bath-liquid nitrogen. After each thawing, it may be vortexed to promote cell lysis.

[0118] F Centrifuging at 1500g for 20 minutes at 4 °C, and collecting the supernatant (Supematant # 2).

[0119] G Mixing Supematant # 1 and Supematant # 2.

[0120] H. Putting the Bottle-Top Filter Unit into the ultra-clean table, opening the cover, and putting the Pre-filter Disc on the 0.45 micron filter.

[0121] I Connecting Bottle-TopFilterUnit to vacuum pump.

[0122] J. Setting the vacuum pump to vacuum off, adding 10 ml of 100 mM Tris-HCI (pH7.4) to the Pre-Filter, so that the Pre-Filter and the 0.45 micron filter may be in close contact.

[0123] K. Carefully pouring the cell lysate supernatant into the Bottle-Top Filter Unit.

[0124] H. Setting the vacuum pump to vacuum on. When the collection vessel is full, the vacuum pump may be disconnected and the filtered solution may be transferred to the disinfection bottle. If the Bottle-TopFilter Unit is blocked, it may change to another Bottle-Top FiRerUnit.

[0125] L. Adding Benzonase Nuclease (Novagen) with a final concentration of 10 units Benzonase/ml to the filtrate and incubate at 37 °C for 30 min.

[0126] M. Diluting 5 x Dilution buffers and 5 x Wash bufferS to 1 x concentration with sterile Milli-QH20.

[0127] N. Mixing equal volume of filtrate and 1 x Dilution Buffer.

[0128] O. Purifying adenovirus.

[0129] P. Preparing the following items: Tubing Assembly and BD Adeno-X Purification Filter: 1 x WashBuffer, 1 x Elution Butter; sterile PBS: 1 x Formulation Buffer; 5-ml, 20-ml, 60-ml BD Luer-LokTM Tip Syringe; sterile 15-ml, 50-ml centrifuge tubes.

18

[0130] Q. Connecting BD Adeno-X Purification Filter and Tubing Assembly. LU101943

[0131] R. Connecting the purification system to a vacuum pump, putting one end of Tubing Assembly A into sterile PBS, slowly turning on the vacuum pump, drawing 10-20 ml of sterile PBS to pass it through BD Adeno-X Purification Filter and Tubing Assembly, and closing the water stop clamp, turning off the vacuum pump to remove air bubbles in BD Adeno-x Purification Filter and Tubing Assembly.

[0132] S. Putting the Tubing Assembly tube into the virus solution.

[0133] T. Slowly turning on the vacuum pump, and using a water stopper to control the flow rate to about 20ml/min. After filtration, the Tubing Assembly tube may be clamped to remove the vacuum pump tube.

[0134] U. Removing TubingAssembly from the receiving bottle and putting in 1 x WashBuffer.

[0135] V. Filtering the WashBuffer with BDAdeno-xPurificationFilter at a flow rate of 20ml/min.

[0136] W. Removing Tubing Assembly B. Tubing Assembly A may be reserved for elution in the next step.

[0137] X. Eluting adenovirus: A 20ml syringe may be connected to the inlet end of BD Adeno-X Purification Filter. At the same time, the Tubing Assembly may be connected to the outlet end, and then put into a centrifuge tube containing 20m1 1 x Elution Buffer. 1 x Elution Buffer may be extracted, the purified adenovirus may be in the syringe, and transferred to a 50ml centrifuge tube.

[0138] Y. Determining the adenovirus titer with BD Adeno-XTM Rapid Titer Kit.

[0139] Z. Storing the recombinant adenovirus (nCoV2019-Ad-dsRNA vaccine): It mahh be stored at -70 °C for future use. The produced recombinant adenovirus (Ad) may carry the shRNA sequence of the novel coronavirus (nCoV2019) targeting interfering genes (ORFlab, 3J'UTR, S, E, M, N), which is called Ad-nCoVdsRNA vaccine. DsRNA is produced by shRNA, which in turn produces RNA interference.

[0140]

[0141] Example 2

[0142] The protein expression of the novel coronavirus nCoV may be screened, that is, antibody-producing genes, to construct adenovirus shuttle plasmid pShuttle-nCoV (pShuttle-ORFlab/N) and recombinant adenovirus backbone plasmid pAd-nCoV 19

(pAd-ORF1ab/N), and then to package into recombinant adenovirus Ad-nCoV (Ad-ORF1ab/N). Recombinant adenovirus Ad-nCoV (Ad-ORF1ab/N) that are non-toxic to humans, easily enters 01943 respiratory epithelial cells and can express nCoV-mRNA in cells may be prepared in vitro, thereby to produce respiratory tract inoculation DNA vaccine that can stimulate the body to produce anti-nCoV antibodies to produce specific immune effects, which may be used for emergency prevention of novel coronavirus pneumonia.

[0143] This embodiment relates to a method for preparing nCoV vaccine, which involves but not limited to nCoV ORFlab, S, E, M, N genes and their primers, and involves but not limited to the same experimental methods, cloning vectors and other experimental materials, and involves but not limited to nCoV protein antigens or antibodies synthesized in vivo.

[0144] 1. Amplifying the ORFlab or N gene of nCoV2019

[0145] Primer design: At present, the Chinese Center for Disease Control and Prevention recommends primers for the open reading frame lab (ORFlab) and nucleoprotein (N) gene regions of nCoV-2019, among which: Open reading frame ORFlab: R: CCCTGTGGGTTTTACACTTAA; F: ACGATTGTGCATCAGCTGA. Nucleocapsid protein N: F: GGGGAACTTCTCCTGCTAGAAT; R: CAGACATTTTGCTCTCAAGCTG. The company may be entrusted to design primers, to introduce Xbal and Kpnl cleavage sites at the 5' end and 3' end respectively, and to follow the instructions of the PCR kit.

[0146] 2. Construction of adenovirus shuttle plasmid (pShuttle-ORF1ab/N)

[0147] (1) Preparing vectors: pShuttle plasmid may be transformed into DHSII bacteria, positive clones may be selected, and amplified in small amount with LB solution containing ampicillin. pShuttle plasmid may be extracted with PLASMID MINIPREP KIT (QIAGEN), and a large amount of Xba I & Kpn I may be used to digest after digestion identification, large fragments may be separated by gel electrophoresis. By using GELEXTRACTION (QIAGEN), the vector fragments may be recovered and dissolved in sterile double distilled water.

[0148] (2) Preparing insert fragments: PCR PURIFICATION KIT (QIAGEN)may be used to recover the Sw gene fragment amplified in the previous step, and the DNA may be eluted with sterile double distilled water.

[0149] (3) Ligation reacting: insert fragments: 5 ul; vector: 2ul; solution I: 7 ul; total volume: 14ul. It may be ligated at 16 °C overnight, the molar ratio of vector fragment and insert fragment may be about 1: 3.

[0150] (4) Transferring 10ul of the ligation reaction product into DH5a competent bacteria.

[0151] (5) Selecting resistant clones from the transformation plate and amplifying in small amounts with LB solution containing ampicillin. LU101943

[0152] (6) Extracting pShuttle-SN plasmid with PLASMIDMINIPREPKIT (QIAGEN).

[0153] (7) Digesting and identifying pShuttle-ORF1ab/N plasmid by using Xba I and Kpn I.

[0154] (8) Sequence analyzing pShuttle-ORF1ab/N plasmid by Shanghai Boya Biotechnology Co., Ltd. using sequencing primers.

[0155] (9) Amplifying DH5a/pShuttle-ORFlab/N in large quantities, using PLASMID MtDIPREP KIT (QIAGEN) to extract pShuttle-ORF1ab/N plasmid for use.

[0156] 3. Construction of recombinant adenovirus backbone plasmid (pAd-ORF1ab/N)

[0157] (1) Vector preparation I-Ceu I and PI-Sce I may be used to digest a large amount of nCoV2019 transcribed DNA. The large fragments may be separated by gel electrophoresis. The vector fragments may be recovered by GEL EXTRACTION (QIAGEN) and dissolved in sterile double distilled water.

[0158] (2) Insert the fragment preparation:

[0159] © Double digesting pShuttle-ORFlab/N with I-Ceu I and PI-Sce I: disinfected double distilled water: 19.5 ul; 10 x DoubleDigestionBuffer: 3.0 ul; pShuttle-Stq DNA (500 ng/ul): 2.0 ul; PI-Sce I ( 1 unit/ul): 2.0 ul; I-Ceu I (Sunits/ul): O.5 ul; 10 x BSA: 3.0 ul, total volume: 30 ul.

[0160] @ Separating large fragments by gel electrophoresis.

[0161] © Using GEL EXTRACTION (QIAGEN) to recover the vector fragment, and dissolving in double distilled water to obtain the ORF1ab/N expression framework.

[0162] (3) Connection reaction:

[0163] D Mixing the vector fragment and the insert fragment with equal volume of ligation solution I, performing ligation in vitro overnight at 16 °C, the molar ratio of the vector fragment and the insert fragment may be about 1: 3.

[0164] © Digesting the ligation reaction product with Swa I to remove the self-circulated linker.

[0165] © Extracting phenol chloroform and ethanol precipitation of DNA.

[0166] (4) Taking 10 ul of purified DNA to transform DH5a competent bacteria.

[0167] (5) Selecting resistant clones from the transformation plate and amplifying them in small amounts with the LB solution of Typicillin.

21

[0168] (6) Extracting positive clone plasmid with PLASMID MINIPREPKIT (QIAGEN). LU101943

[0169] (7) Digesting and identifying positive cloned plasmids.

[0170] (8) PCR identifying positive clone plasmids.

[0171] D Designing primers to amplify 505bp fragment.

[0172] @ Reaction system: 10 x PCRBuffer: 5 ul; Primers: 50pmol each; Taq enzyme (Gibco): 2.0U; Viral DNA: 5ng, a total volume may be made up to 50ul with deionized water.

[0173] © Reaction conditions: it may be amplified in PE9600 thermal cycler, pre-denaturated at 95 °C for 8 minutes, cycled parameters: 94 °C for 1 minute, 55 °C for 1 minute, 72 °C for 60 seconds, with 30 cycles.

[0174] Result analysis: 1% agarose gel electrophoresis may be used to analyze and observe the result under ultraviolet light.

[0175] (9) Amplifying DH5a/pAd-ORFlab/N in large quantities, and using pLASMID MIDIPKEPKIT (QIAGEN) to extract the pAd-ORF1ab/N plasmid for use.

[0176] 4. Packaging recombinant adenovirus (Ad-ORF1ab/N)

[0177] (1) pAd-SN linearization

[0178] D Plasmid pAd-SN containing SN expression framework may be linearized with Pacl digestion: disinfected double distilled water: 20 ul; pAd-SN DNA (500 ng/ul): 10 ul; 10X Pac I Digestion Buffer: 4 ul; 10XBSA: 4 ul; Pac I (1unit/ul): 2 ul, total volume: 40 ul.

[0179] @ Digesting at 37 °C for 2 hours, adding 60 ul TE Buffer (pH 8.0) and 100 ul phenol: chloroform: isoamyl alcohol (25: 24: I), and vortexing slightly.

[0180] ©) Precipitating DNA with 1/10 volume of 3mol/L NaAc (pH5.2) and 2 volumes of absolute ethanol, 1 ul glycogen (20 mg/m1).

[0181] @ Disinfecting DNA with 10 ul sterilized TE (pH8.0) TE.

[0182] (2) Transfection of 293 cells

[0183] Mediated by LipofectaminTM 2000 (Inviuogen), 293 cells may be transfected with linearized pAd-SN, and the formation of CPE (cytopathy) may be observed.

[0184] D One day before the transfection, 293 cells may be seeded in a 60 mm culture plate (24-well plate), 1 x 106 cells/well, and cultured overnight with serum-free RPMI 1640 to 75% fusion.

22

[0185] @ Preparing DNA-LipofectaminTM 2000 complex: a. Diluting 0.8 ug of, 101943 pAd-SNDNA with 50 ul serum-free RPMII640 and mixing gently. b. Mixing LipofectaminTM2000 gently before use, diluting 2 ul of LipofectaminTM2000 with 50 ul serum-free RPMI 1640, mixing gently, and incubating at room temperature for 5 minutes. c.

Mixing the diluted LipofectaminTM 2000 and the diluted pAd-SNDNA in a total volume of 100 ul, mixing gently, and incubating at room temperature for 20 minutes.

[0186] (3Adding the DNA LipofectaminTM2000 complex prepared in the previous step to the 24-well plate, and gently shaking the culture plate in the front-back direction to make the DNA-LipofectaminTM2000 complex evenly distributed in the culture wells.

[0187] @ Incubating in a CO2 incubator at 37 °C and 5% CO2 for 36 hours.

[0188] © Observing whether there is cytopathic effect (CPE).

[0189] (3) CPE appearing one week later, gently pipetting the cells, and collecting the cells into a 15ml centrifuge tube.

[0190] (4) Centrifuging at 1500 g for 5 minutes at room temperature.

[0191] (5) Resuspending cells in 500 ul of sterile PBS.

[0192] (6) freezing and thawing the cells at 37 °C water bath- liquid nitrogen 3 times. After each thawing, it may be vortexed, which facilitates cell lysis.

[0193] (7) Centrifuging to remove cell debris.

[0194] (8) Inoculating 293 cells in a 60mm culture plate (24-well plate), with 1 x 106 cells/250ul/well, and culturing overnight with serum-free RPMI 1640 to 75% fusion.

[0195] (9) Adding cell lysis supernatant, 250ul/well.

[0196] (10) Cultivating at 37 °C and 5% CO2, observing CPE daily, and CPE may appear within one week.

[0197] (11) Harvesting the cells when more than 50% of the cells are shed, .

[0198] (12) Referring to steps (6) to (11), repeatedly infecting 293 cells with the lysed supernatant of diseased 293 cells, and amplifying recombinant adenovirus with 150cm2 culture flask:

[0199] © Dissolving all the required viruses into the culture solution to make a storage solution to ensure that the total number of infected viruses per bottle may be the same.

[0200] @ Culturing and amplifying 293 cells using conventional methods. When the cells 23 grow to 90% to 100% confluence, 1*1010 virus particles may be inoculated according to the culture area of 150cm2. 293 cells may be infected with adenovirus. HU101943

[0201] © Incubating at 37 °C for about 36 hours. During this period, the amplification of adenovirus may be observed. With the development of cell disease, the cells may become round and the refractive index may change, and they may begin to fall off the surface of the culture flask.

[0202] 5. Purification and concentration detection of recombinant adenovirus (Ad-ORF1ab/N)

[0203] (1) Pipetting 293 cells and transferring the cells to a centrifuge tube.

[0204] (2) Centrifuging at 1500g for 20 minutes at 4 °C.

[0205] (3) Collecting the supernatant (Supematant # 1) and storing in a centrifuge tube at 4 °C,

[0206] (4) Resuspending the cell pellet with 25 ml sterile 100 mM Tris-HCI (pH 7.4).

[0207] (5) Repeatedly freezing and thawing the cells 3 times in a 37 °C water bath-liquid nitrogen. After each thawing, it may be vortexed to promote cell lysis.

[0208] (6) Centrifuging at 1500g for 20 minutes at 4 °C, and collecting the supernatant (Supematant # 2).

[0209] (7) Mixing Supematant # 1 and Supematant # 2.

[0210] (8) Putting the Bottle-Top Filter Unit into the ultra-clean table, opening the cover, and placing the Pre-filter Disc on the 0.45 micron filter.

[0211] (9) Connecting the Bottle-TopFilterUnit to the vacuum pump.

[0212] (10) Setting the vacuum pump to vacuum off, adding 10 ml of 100 mM Tris-HCI (pH7.4) to the Pre-Filter, so that the Pre-Filter and the 0.45 micron filter may be in close contact.

[0213] (11) Carefully pouring the cell lysate supernatant into the Bottle-Top Filter Unit.

[0214] (12) Setting the vacuum pump to vacuum on. When the collectionvessel is full, the vacuum pump may be disconnected, and the filtrate may be transferred to the disinfection bottle.

If the Bottle-TopFilter Unit is blocked, it may be changed to another Bottle-Top FiRerUnit.

[0215] (13) Adding Benzonase Nuclease (Novagen) with a final concentration of 10 units Benzonase/ml to the filtrate and incubate at 37 °C for 30 min.

[0216] (14) Diluting 5 x Dilution buffers and 5 x Wash bufferS to 1 x concentration with 24 sterile Milli-QH20. LU101943

[0217] (15) Mixing equal volume of filtrate and 1 x Dilution Buffer.

[0218] (16) Purifying adenovirus.

[0219] (17) Preparing the following items: Tubing Assembly and BD Adeno-X Purification Filter: 1 x WashBuffer, 1 x Elution Butter; sterile PBS: 1 x Formulation Buffer; 5-ml, 20-ml, 60-ml BD Luer- LokTM Tip syringe; sterile 15-ml, 50-ml centrifuge tubes.

[0220] (18) Connecting BD Adeno-X Purification Filter and Tubing Assembly.

[0221] (19) Connecting the purification system to the vacuum pump, one end of Tubing Assembly A may be put in sterile PBS, the vacuum pump may be slowly turned on, 10-20 ml of sterile PBS may be drawn to pass it through the BD Adeno-X Purification Filter and Tubing Assembly, and the water stop clamp and the vacuum pump may be turned off, to remove air bubbles in the BD Adeno-x Purification Filter and Tubing Assembly.

[0222] (20) Putting the Tubing Assembly tube into the virus solution.

[0223] (21) Slowly turning on the vacuum pump, and using a water stopper to control the flow rate at about 20ml/min. After filtering, the Tubing Assembly tube may be clamped and the vacuum pump tube may be removed.

[0224] (22) Removing TubingAssembly from the receiving bottle and putting in 1 x WashBuffer.

[0225] (23) Filtering the WashBuffer with BDAdeno-xPurificationFilter at a flow rate of 20ml/min.

[0226] (24) Removing Tubing Assembly B, Tubing Assembly A may be reserved for elution in the next step.

[0227] (25) Eluting adenovirus: a 20ml syringe may be connected to the inlet end of BD Adeno-X Purification Filter. At the same time, the Tubing Assembly may be connected to the outlet end, and then put into a centrifuge tube containing 20m1 1 x Elution Buffer. 1 x Elution Buffer may be extracted, the purified adenovirus is in the syringe, and may be transferred to a 50ml centrifuge tube.

[0228] (26) Measuring the adenovirus titer with BD Adeno-XTM Rapid Titer Kit.

[0229] (27) Storing adenovirus at -70 °C.

[0230] 6. Identification of recombinant adenovirus (Ad-ORF1ab/N) gene

[0231] (1) Digestion identification

[0232] © Purifying viral DNA

[0233] a. Digesting 500pl virus solution with 50ul of 20mg/ml proteinase K for 60 minutes 101943 and extracted twice.

[0234] b. Precipitating DNA with 2 volumes of absolute ethanol and 1/10 volume of sodium acetate (pH 5.2).

[0235] c. Washing the DNA twice with 70% ethanol; dissolving the DNA with 50ul of sterile double distilled water.

[0236] d. Taking 10ul of viral DNA and diluting it 20 times; measuring the OD260, 0D280 and OD260/0D280 values in a Beckman UV640 UV spectrophotometer to calculate the DNA concentration.

[0237] © Restriction analysis of viral DNA may be performed with 1-Ceu I/PI-Seel, HindIII, Xhol, KpnI and Kpnl/Xbal, and the enzyme digestion reaction may be analyzed with 0.8% agarose gel electrophoresis.

[0238] (2) Titer determination

[0239] © Infecting cells

[0240] a. Digesting 293 cells in logarithmic growth phase, resuspending 293 cells in RPMI 1640 containing 10% FBS, inoculating them into 12-well plate with 1ml per well containing 5 x 105 cells.

[0241] b. Diluting virus samples serially 10 times with PBS, and the dilution gradient may be 10-2 — 10-5.

[0242] c. Adding the diluted virus sample to a 12-well plate at10ul/well.

[0243] d. Incubating 5% CO2 at 37 °C for 48 hours.

[0244] e. Aspirating the culture medium and blowing for 5 minutes in the ultra clean bench.

[0245] © Cell fixation and tagging of primary antibody

[0246] a. Adding 1ml ice cold 100% methanol to each well and incubating at -20 °C for 10 minutes.

[0247] b. Aspirating the methanol, gently washing the plate 3 times with 1 ml of PBS containing 1% BSA.

[0248] c. Diluting the mouse anti-Hexon antibody to 1: 1000 with PBS containing 1% BSA.

[0249] d. Aspirating the washing solution, adding 1: 1000 diluted 0.5ml/well of mouse anti-Hexon antibody, and incubating at 37 °C for 1 hour with shaking.

26

[0250] e. Aspirating the mouse anti-Hexon antibody and gently washing the plate 3 times with 01943 1 ml of PBS containing 1% BSA.

[0251] f. Diluting the HRP-labeled rat anti-mouse antibody to 1: 500 in PBS containing 1% BSA.

[0252] g. Aspirating the washing solution, adding 1: 500 diluted rat anti-mouse antibody

0.5ml/well, and incubating at 37 °C for 1 hour with shaking.

[0253] h. Diluting 10 x DAB Substrate to 1 x working solution with 1xStablePeroxidaseBuffer, and equilibrating to room temperature.

[0254] i. Aspirating the HRP-labeled rat anti-mouse antibody, washing the plate gently with 1 ml of PBS containing 1% BSA 3 times.

[0255] (3 Color rendering

[0256] a. Aspirating PBS containing 1% BSA, adding DAB working solution at 500 ul/well, and incubating at room temperature for 10 minutes.

[0257] b. Aspirating DAB working solution, adding 1ml PBS to each well.

[0258] c. Counting the positive stained cells (black/brown) with a 20x objective lens, observing at least 3 fields, and calculating the average number of positive cells per well.

[0259] d. Infection unit: ifu = number of positive cells per field of view * number of fields per well / volume of virus solution (m1) / dilution factor.

[0260] (3) Purity identification

[0261] © Instrument preparation

[0262] a. High-performance liquid chromatograph (HPII00 type, American Hewlett-Packard company products).

[0263] b. The strong anion exchange pre-packed column may be Q Sepharose XL (Amersharn pharmacia, Sweden), the column matrix may be cross-linked agarose, the packing diameter may be 45 — 165um, the column bed volume (CV> 1ml, stored in 20% ethanol, the charge may be -N + (CH3), and the ion exchange capacity may be 0.18 ~ 0.26mmolC1-/ml gel.

[0264] @ Experimental method

[0265] a. Using A solution (20 mM Tris-HCI, pH7.5) column equilibration, the sample volume may be 150ul, the flow rate may be 1ml/min, the pressure may be 26 bar, the temperature may be 26 °C; monitoring OD260.

27

[0266] b. Rinsing with 4.5CV A solution. LU101943

[0267] c. Rinsing with 25.5CV 0 — 70% gradient of liquid B (IM NaCl + 20mMTris-HCI, pH7.5).

[0268] d. Eluting with a second gradient 3 CV 70-100% B solution. All the above samples and flow phases may be filtered with 0.45um filter membrane, and the samples may be repeatedly tested.

[0269] 7. Expression detection of recombinant adenovirus (Ad-ORF1ab/N) gene

[0270] (1) Cell culturing

[0271] The Vcro-E6 cell line may be an African green monkey kidney epithelial cell (ATCC CRL 1586), derived from ATCC, 1640 culture solution containing 10% FBS, 2 mM glutamine, 100 U/ml penicillin and 10099/ml streptomycin may be used to be cultured at 37 °C, 5% CO2 and saturated humidity.

[0272] (2) RT-PCR detection

[0273] DVem-E6 cells being seeded into 6-well plates at 2x105 cells/well.

[0274] @After 16h, Vero-E6 cells being infected with different doses of Ad-ORF1ab or Ad-N (20 MOI) for 48h.

[0275] © Collecting infected cells.

[0276] © Extracting (Invitrogen) total RNA of cells with TRIZOL reagent.

[0277] © Removing residual DNA with RQI RNase-free DNase I (Promega).

[0278] © Reversing transcribe mRNA with AMV reverse transcription system (Invitrogen) to cDNA: RNA: 4ug; 10 x AMVBuffer: 2ul; AMV reverse transcriptase (Promega): 20U; RNAsin: 20U; dNTP: 0.5ul; OligodT (Promega ): 30pmol; making up to 20ul with deionized water.

[0279] © Reaction conditions: it may be mixed well, reacted at 37 °C for 60 minutes.

Reverse transcriptase may be inactivated at 95 °C for 10 minutes.

[0280] PCR amplifying cDNA.

[0281] a. According to the aforementioned design, the amplified fragment may be 624 bp ORFlab or N primer.

[0282] b. Reaction system: the above reversal product: 20ul; 10 x PCR Buffer: Sul; primers: 28

30pmol each; pfuDNA polymerase (Gibco): 2.5U, it may be made up to a total volume of 50ul LU101943 with deionized water.

[0283] c. Amplifying on PE 9600 thermal cycler, pre-denaturating at 95 °C for 8 minutes, cycle parameters: 94 °C for 1 minute, 55 °C for 1 minute, 72 °C for 90 seconds, with 35 cycles.

[0284] d. Analyzing with 1% agarose gel electrophoresis and observing under ultraviolet light.

[0285] (3) Western blot identification

[0286] D Vero-E6 cells being seeded into 6-well plates at 2x1015 cells/well.

[0287] @After 16h, Vero-E6 cells being infected with Ad-ORFlab/N (20 MOI) at different doses for 48h.

[0288] (3 Collecting the culture supernatant to prepare protein samples.

[0289] © SDS-PAGE electrophoresis.

[0290] © Transferring the result of electrophoresis to nitrocellulose membrane at 4 °C.

[0291] ® Closing

[0292] © Adding 1: 1000 primary antibody to fully effect and wash.

[0293] Adding HRP-conjugated anti-rabbit 1gG (1: 1000) and washing.

[0294] © After LumiGLOTM (NEB) treatment and film sensitivity, observing the experimental results.

[0295] 8. Detection of immune function of recombinant adenovirus (Ad-ORF1ab/N)

[0296] (1) Experimental animals: According to literature reports, Wistar rats may be cultivated in SPF-level animal laboratories, half male and female, 6-8 weeks old, weighing 110 + 10g, and the animal production certificate number may be recorded.

[0297] (2) Ad-ORFlab or Ad-N: combining eukaryotic fermentation technology and adenovirus column chromatography purification technology, Ad-ORFlab or Ad-N may be self-amplified with CsCl twice centrifugal purification, titer may be 5x1010pfu/ml.

[0298] (3) nCoV-2019 antibody (IgG) detection system: it may be purchased from a company that may be produced in the future, HRP-conjugated anti-rat IgG can be purchased from Santa Cruiz.

[0299] (4) Formulate experimental methods 29

[0300] © Ad-SN nasal drip control group (empty vector control group), first anesthetizing 94943 with 3% pentobarbital intraperitoneal injection may be performed, nasal drip may be performed after 5 minutes at 0.5ml/body at the dose of 1 x 107pfu/dose/rat

[0301] @ Ad-ORFlab/N nasal drip group, it may be anesthetized as above, then nasal dripped after 5 minutes at the dose of 1 x 107pfu/dose/rat.

[0302] © Ad-SN tail vein injection control group (empty vector control group), the dose may be 1 x 107pfu/dose/rat.

[0303] @ Ad-ORFlab/N tail vein injection group, given by tail vein injection, the dose may be 1 x 107pfu/dose/rat.

[0304] © In the blank control group, PBS may be injected into the tail vein at 0.5ml/mouse.

[0305] Each of the above groups has 10 animals .

[0306] (5) Immunization program: Rats may be immunized the animals three times at week 0, 1, and 2. Serum may be collected at week 0, 1, 2, 3, and 4.

[0307] (6) Detection index

[0308] D Detection of nCoV-2019 specific IgG antibody: HRP-conjugated anti-rat IgG (concentration 1: 5000) may be used as secondary antibody, and human nCoV-2019 antibody (IgG) detection system may be used to detect rat serum anti-nCoV-2019 IgG antibody level, three replicate wells may be set for each sample. OD450 may be measured with a microplate reader, and the reference wavelength may be 630. The titration endpoint may be defined as the natural logarithm of the highest dilution of 0D450, which is at least 0.16 higher than the negative control group.

[0309] @ Immune protection experiment: Vero-E6 may be used as a model to determine the role of animal serum in protecting cells from nCoV-2019 infection. This part of the experiment may be completed in a Level 3 Safety (3P) laboratory.

[0310] Neutralization titer may be defined as the highest serum dilution that that could completely inhibit vero. E6 cells.

[0311] 9. Batch preparation of recombinant adenovirus (Ad-nCoV2019)

[0312] The recombinant adenovirus Ad-nCoV2019 may be prepared in batches according to the above experimental method of the present disclosure, and stored at -70 °C for later use.

Where Ad may stand for recombinant adenovirus vector and nCoV2019 may stand for functional genes that can express proteins, such as ORFlab or N gene. In the present disclosure, Ad-nCoV2019 may be also called Ad-nCoVDNA. HU101943

[0313] 3. Preparation of Bivalent Vaccine

[0314] The Ad-nCoV2019 dsRNA prepared in Example 1 and the Ad-nCoV2019 DNA prepared in Example 2 may be combine with H2O according to the volume ratio of Ad-nCoV2019 dsRNA: Ad-nCoV2019 DNA: H20 = 1: 1: 5 to 19 to prepare the novel coronavirus pneumonia bivalent vaccine of present disclosure.

31

Claims (9)

Claims LU101943 WHAT IS CLAIMED IS:

1. A method for preparing a novel coronavirus pneumonia bivalent vaccine, wherein comprising preparing an Ad-nCoVdsRNA vaccine and an Ad-nCoVDNA vaccine in proportion, wherein the volume ratio of Ad-nCoVdsRNA: Ad-nCoVDNA: H20 = 1:1:19; the preparing method of the Ad-nCoVdsRNA is amplifying a targeted interference gene shRNA sequence of nCoV2019; a resulted product and an empty interference vector pSilencer being digested by BamH I and Hind III to construct interference vector pSilencer-shRNA; the interference vector pSilencer-shRNA being amplified by competent E. coli DHSa and identified that the shRNA is inserted correctly, and then being digested with the empty shuttle vector pDC312 by Hind II and EcoR I to construct the shuttle vector pDC312-shRNA; co-transfecting thee shuttle vector into HEK293 cells with adenovirus backbone plasmid pBHGloxAF1, homologously recombining in the cells to obtain recombinant adenovirus Ad-shRNA, and then amplifying HEK293 cells multiple times to prepare Ad-nCoV2019dsRNA; the preparing method of the Ad-nCoV2019DNA is: amplifying nCoV2019 antibody expression gene, the amplified antibody expression gene sequence and adenovirus shuttle plasmid pShuttle being digested with Xbal and Kpnl to construct a recombinant adenovirus shuttle plasmid pShuttle-nCoV2019; amplifying the shuttle plasmid by competent E. coli DH5a, and co-transfecting with adenovirus backbone plasmid pAd-nCoV2019 into HEK293 cells after the shuttle plasmid is digested by Xbal and Kpnl to identify that nCoV2019 is correct; homologously recombining in HEK293 cells to obtain recombinant adenovirus Ad-nCoV2019; preparing Ad-nCoV2019DNA after the recombinant adenovirus is amplified multiple times through HEK293 cells.

2. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1, wherein the target interference gene shRNA sequence refers to an RNA sequence with a length of 19 nt complementary to the siRNA sequence.

3. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1, wherein the target interference gene shRNA sequence is a template for expressing a hairpin structure, which is composed of two single-stranded DNA that are most complementary to, and after annealing and complementation, it forms a double-stranded DNA with sticky ends of BamH I and Hind III cleavage sites.

4. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1, wherein the nCoV2019 refers to a conserved gene sequence or a functional gene 32 sequence of the novel coronavirus; the conserved gene sequence or the functional gene sequence comprises ORFlab, 3'UTR, S, E, M, N gene sequences. HUT01943

5. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1, wherein the pShuttle-nCoV2019 refers to a recombinant adenovirus shuttle plasmid containing nCoV2019; the pAd-nCoV2019 refers to a vaccine containing nCoV2019 adenovirus backbone plasmid; the Ad-nCoV2019 refers to a replication-defective recombinant adenovirus vector containing nCoV2019; the Ad refers to a replication-defective recombinant adenovirus vector.

6. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1, wherein the Ad-nCoV2019 DNA refers to a recombinant adenovirus carrying antibody expression genes.

7. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1, wherein after the bivalent vaccine is inoculated, the Ad introduces nCoV2019dsRNA and nCoV2019DNA into cells, wherein nCoV2019dsRNA immediately generates dsRNA through its shRNA, and immediately degrades homologous virus mRNA, nCoVDNA expresses proteins by encoding mRNA, and then produces antibodies to neutralize the virus.

8. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 7, wherein the bivalent vaccine is inoculated by spraying, the Ad introduces nCoV2019dsRNA and nCoV2019DNA into respiratory epithelial cells, and nCoV2019dsRNA synthesizes dsRNA in cells, then specifically induces degradation of homologous nCoV2019 mRNA, resulting in generating anti-nCoV2019 post-transcriptional gene silencing or RNA interference; nCoV2019DNA expresses proteins by encoding mRNA, and then produces antibodies to neutralize the virus.

9. The method for preparing a novel coronavirus pneumonia bivalent vaccine according to claim 1 or 6, wherein the antibody expression gene refers to a gene capable of expressing mRNA, mRNA expressing protein, and protein stimulating the body to produce antibodies.

33