CN111875680A - Preparation method and application of novel coronavirus prevention microparticles - Google Patents

Abstract

The invention provides a preparation method and application of novel coronavirus prevention microparticles, and relates to the field of vaccines. Specifically, the preparation method comprises the following steps: 1) constructing a recombinant plasmid for over-expressing the spike (S) protein; 2) packaging the recombinant plasmid into lentivirus particles; 3) infecting fibroblasts with lentivirus particles to obtain tool cells expressing S protein; 4) carrying out X-ray irradiation on the obtained tool cells and culture solution, and collecting supernatant after radiotherapy to obtain a mixture of the needed microparticles and tool cell fragments subjected to apoptosis; 5) and centrifuging, concentrating and purifying the obtained mixture to obtain the vaccine. The invention uses the micro-particles released by radiotherapy-induced tool cells as a carrier, and can directly activate the antiviral immunity of an organism to generate a neutralizing antibody for resisting the novel coronavirus under the condition of over-expression of the novel coronavirus S protein. The invention can induce organism to generate high-level neutralizing antibody immunoreaction and has good biological safety.

Description

Preparation method and application of novel coronavirus prevention microparticles

[ technical field ] A method for producing a semiconductor device

The invention relates to the technical field of vaccines, in particular to a preparation method and application of novel coronavirus prevention microparticles.

[ background of the invention ]

The new coronavirus pneumonia epidemic situation is defined as an international sudden public health incident by the world health organization in 2019, the disease is an acute respiratory tract infectious disease caused by the infection of the new coronavirus (SARS-CoV-2), the main transmission routes of the disease are respiratory tract droplet transmission, aerosol transmission and contact transmission, common symptoms comprise fever, cough, breathlessness, dyspnea and the like, and serious infectors can have serious acute respiratory syndrome, renal failure and even death.

Coronaviruses are typically between 70-120nm in diameter and are enveloped positive-stranded single-stranded RNA viruses with single-stranded, non-segmented RNA genomes between 26-32kb in length. Coronaviruses are the family coronaviridae, the orthocoronaviridae subfamily, which includes 4 genera (α, β, γ and), usually only α, β, have a pathogenic effect on humans. The novel coronavirus is a beta genus coronavirus in which the spike (S) protein is a trimeric structure in which each monomer has a site for binding to a cellular receptor. Studies have shown that the receptor domain on the S protein can bind to the human receptor protein angiotensin converting enzyme 2(ACE2) to invade cells. The lack of immunological memory responses in convalescent patients infected with the novel coronavirus allows the neutralizing antibodies to be maintained for a short period of time, which may result in secondary infections in the cured patient. Therefore, the exploration of safe and effective vaccines to stimulate the body to generate immune response, the formation of anti-viral antibodies and immune memory response are one of the most important measures to overcome epidemic situations.

Currently, research on novel coronavirus vaccines is mainly focused in the following directions:

1. recombinant adenoviral vaccines based on the novel coronavirus spike protein (S);

2. s protein based messenger rna (mrna) vaccines;

3. recombinant protein vaccines based on the S protein.

The recombinant adenovirus vaccine is easy to be eliminated by an immune system, so that the expression efficiency of the recombinant adenovirus vaccine is influenced; the mRNA vaccine is easy to be coated by a special carrier to protect mRNA from being degraded due to poor stability of the mRNA; the recombinant protein vaccine needs complicated expression and purification processes, so the cost is high, and the recombinant protein vaccine can exert a strong effect only after an adjuvant is additionally added.

The extracellular microparticles are important carriers for transferring substance information among cells, and when the cells are stimulated internally and externally, a cell membrane generates a phospholipid double-layer membrane structure with the diameter of 100-1000nm in a budding mode. Extracellular microparticles can be loaded with a variety of bioinformatic molecules, including proteins, mRNA, and the like. Compared with the traditional radiotherapy which is one of the commonly used tumor treatment means, research shows that the radiotherapy can promote cells to release extracellular microparticles, and the microparticles released by the radiotherapy-induced cells have the function of strongly activating the immune response of the organism.

However, no precedent exists for the research of using radiotherapy induction means combined with S protein overexpression recombinant cell vector to promote the preparation of vaccine from extracellular microparticles. Therefore, there is a need for a method for preparing a novel coronavirus vaccine, which directly activates the antiviral immunity of the body by using the immune activation effect of microparticles released from radiotherapy-induced tool cells as a carrier under the condition of over-expression of the S protein of the novel coronavirus. And the performance of the vaccine microparticles containing the S protein and released by the radiotherapy-induced tool cells for generating the novel coronavirus antibody is verified, so that the purification process of in-vitro preparation of recombinant protein is avoided, and the research and industrial application of the novel coronavirus vaccine are promoted.

[ summary of the invention ]

The invention aims to solve the problem that complicated expression and purification steps are required in the preparation process of a recombinant protein vaccine, and provides a preparation method of novel coronavirus prevention microparticles and application of the novel coronavirus prevention microparticles as the vaccine.

In order to solve the technical problems, the invention provides a preparation method of novel coronavirus prevention microparticles, which comprises the following steps:

1. constructing a recombinant plasmid for over-expressing the S protein;

2. packaging the recombinant plasmid into lentivirus particles;

3. infecting the tool cells with lentivirus particles to obtain tool cells over-expressing S protein;

4. carrying out X-ray irradiation on the obtained tool cells and culture solution, collecting supernatant after radiotherapy, concentrating and purifying to obtain a mixture of the needed microparticles and apoptotic tool cell fragments;

5. the mixture was centrifuged and the resulting microparticles were collected.

Further, the step 1 is that an artificial gene is synthesized based on the novel coronavirus S protein coding region and inserted into a multiple cloning site of a plasmid vector to construct a core plasmid capable of over-expressing S protein;

further, in the step 2, the process of packaging the lentiviral particles uses the psPAX2 plasmid and the pmd2.g plasmid;

further, the tool cells in step 3 comprise one of a fibroblast cell line, a vascular endothelial cell line and a human embryonic kidney cell line;

further, the X-ray radiation dose in the step 4 is 2-20 Gy;

further, in the step 4, the X-ray radiation dose is 20Gy, the X-ray energy is 6MV, and the supernatant is collected on the 2 nd to 7 th days after continuous radiotherapy;

further, the centrifugation operation in the step 5 is: 1000g, centrifuging for 10min to obtain a first supernatant; centrifuging the obtained first supernatant at 14000g for 2min to obtain a second supernatant; centrifuging the obtained second supernatant at 14000g for 60min to obtain microparticle precipitate;

further, the microparticles are microvesicle structures carrying S protein, and the particle size of the microvesicle structures is 100-1000 nm.

It is another object of the present invention to provide a vaccine for preventing a novel coronavirus, which comprises the microparticles obtained by the above microparticle preparation method.

Further, the vaccine may be loaded with an adjuvant for immunization.

Compared with the prior art, the invention has the beneficial effects that:

1. the vaccine can generate antibodies against the novel coronavirus by activating B lymphocytes so as to achieve the purpose of preventing the novel coronavirus from being infected, and a large amount of specific antibodies aiming at the novel coronavirus can be generated without adding an immunologic adjuvant;

2. the invention prepares the radiotherapy micro-particles loaded with the S protein by preparing the tool cells over expressing the S protein and carrying out X-ray radiotherapy, thereby obtaining the novel coronavirus vaccine which can activate an organism to generate a large amount of novel coronavirus neutralizing antibodies, avoiding the enrichment and purification process of the S protein, improving the yield of the vaccine and reducing the production cost.

3. The novel coronavirus prevention microparticle provided by the invention is simple in preparation process, short in period and good in biological safety and biocompatibility.

[ description of the drawings ]

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is an electron micrograph of a novel coronavirus preventive microparticle according to the present invention;

FIG. 2 is a graph showing the particle size of the novel coronavirus preventive microparticles of the present invention;

FIG. 3 shows the result of detecting the S protein content of stably transformed fibroblasts;

FIG. 4 shows the results of protein quantification for different doses of radiotherapy to induce the generation of microparticles for radiotherapy by tool cells;

FIG. 5 shows the result of measuring the S protein content of the novel coronavirus microparticles of the present invention;

FIG. 6 shows the results of measuring the content of an anti-novel coronavirus antibody produced in a mouse by the novel coronavirus preventive microparticles of the present invention;

FIG. 7 shows the results of measuring the content of antibodies against the novel coronavirus produced in a mouse by a lysate of cells overexpressing the S protein and the vaccine microparticles of the present invention;

FIG. 8 is a statistical graph of the body weight of mice during administration of the prophylactic novel coronavirus microparticles of the present invention.

[ detailed description ] embodiments

The following examples are intended to illustrate the invention without limiting its scope. It is intended that all modifications or alterations to the methods, procedures or conditions of the present invention be made without departing from the spirit and substance of the invention.

In the present invention, after irradiation of genetically engineered fibroblasts with X-rays, the cells will secrete microparticles rich in the novel coronavirus S protein. The obtained microparticles can induce organism to produce anti-novel coronavirus antibody. In the present invention, the storage conditions for the preventive novel coronavirus microparticles are within 4 ℃ and 7 days. The structure of the novel coronavirus prevention microparticle is shown in figure 1, and the particle size is shown in figure 2.

The following are examples of the present invention:

1. constructing recombinant plasmid and packaging into slow virus particle infection tool cell

Determining the gene sequence of a novel coronavirus S protein coding region on a Pubmed website: atgtttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttgggtgtttattaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattaatttagtgcgtgatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggtgattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcacaagtcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattaccagatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacacttgcagatgctggcttcatcaaacaatatggtgattgccttggtgatattgctgctagagacctcatttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaaatgattgctcaatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgcattacaaataccatttgctatgcaaatggcttataggtttaatggtattggagttacacagaatgttctctatgagaaccaaaaattgattgccaaccaatttaatagtgctattggcaaaattcaagactcactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaagctttaaacacgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatcctttcacgtcttgacaaagttgaggctgaagtgcaaattgataggttgatcacaggcagacttcaaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgctaatcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaaagggctatcatcttatgtccttccctcagtcagcacctcatggtgtagtcttcttgcatgtgacttatgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgatggaaaagcacactttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaatttttatgaaccacaaatcattactacagacaacacatttgtgtctggtaactgtgatgttgtaataggaattgtcaacaacacagtttatgatcctttgcaacctgaattagactcattcaaggaggagttagataaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttcagttgtaaacattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctctcatcgatctccaagaacttggaaagtatgagcagtatataaaatggccatggtacatttggctaggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccagttgctgtagttgtctcaagggctgttgttcttgtggatcctgctgcaaatttgatgaagacgactctgagccagtgctcaaaggagtcaaattacattacacataa, synthesizing the gene sequence corresponding to S protein of virus in vitro, and inserting it into the multiple cloning site of plasmid vector to construct the core plasmid capable of over-expressing S protein. Human embryonic kidney 293T cells were cultured in 10% FBS (fetal bovine serum) medium in 10mm by 10mm dishes and 10 ml of fresh medium was replaced when the cell density in the dishes reached about 50%. 2 sterile and RNase-free EP tubes are taken, 1.5mL of Opti-MEM optimized culture medium is added into one of the sterile and RNase-free EP tubes, 30 mu L of PEI is added into the optimized culture medium, the transfection reagent is blown by a gun head gently and mixed evenly, and then the mixture is kept stand at room temperature for 5 min. Another EP tube was also filled with 1.5mL of Opti-MEM optimized medium, and 6. mu.g of the core plasmid, 4.5. mu.g of the psPAX2 plasmid, and 1.5. mu.g of the pMD2.G plasmid were added thereto, and gently mixed. The liquid in the EP tube with the transfection reagent is added into the EP tube with the plasmid, and the mixture is gently and evenly blown and kept stand for 20min at room temperature. And adding the mixed and standing liquid into 293T cells, shaking up gently, and putting into an incubator for culture. After 24h, 13mL of the medium was replaced, and after further culturing for 48h, the cell supernatant was filtered through 0.45 μm. After the cell density in the dish was about 50% by using L929 cells which are a culture medium containing 10% FBS (fetal bovine serum) in a 10mm X10 mm dish, 5mL of the filtered supernatant and 5mL of a fresh culture medium were replaced, and 10. mu.L of polybrene which is a gene transfection enhancer was added to the culture dish and the infection was continued for two days. The selection is carried out by using a culture medium (1: 1000) containing puromycin to obtain tool cells (the tool cells can be normal tissue cell lines such as a fibroblast cell line, a vascular endothelial cell line, a human embryonic kidney cell line and the like, and the consideration of avoiding the malignant transformation risk of the cell lines such as tumor cells and the like) for over-expressing the S protein.

2. Stable fibroblast cell validation of overexpressed S proteins

The quantitative stably transformed fibroblast lysate which over-expresses the S protein is mixed with 5 XSDSloading buffer of 1/4 lysate volume, and heated for 10min at 100 ℃. 12% separation gel and 5% concentration gel were prepared according to the recipe, protein samples were added to the loading wells, and equal volumes of 1 xSDS loading buffer were added to the marginal wells. During electrophoresis, the concentrated gel is at a constant voltage of 80V, and when the protein marker is separated, the voltage is adjusted to be at a constant voltage of 120V. And when the electrophoresis runs to the bottom of the separation gel, ending the electrophoresis. Pouring the film transferring liquid into an iron plate, and putting the iron plate into a film transferring clamp. Prying the glass plate, transversely cutting the required target protein by using a gel cutting plate according to the position of a marker, placing the gel cutting plate on black gel surface filter paper, covering the PVDF membrane soaked by methanol on gel, and clamping a clamp. And placing the clamp into a film transferring groove, pouring the film transferring liquid in the iron disc into the film transferring groove, placing the film transferring groove into a foam box filled with ice, and selecting a 200mA constant current to transfer the film. After 2h, the PVDF membrane was removed and blocked on a 5% skimmed milk block for 1h on a warm shaker. Washing with 1 × TBST for 3 times, each for 10min, diluting with primary antibody at a certain dilution ratio to obtain primary antibody solution, contacting the protein surface of the membrane with the antibody, and placing in a refrigerator at 4 deg.C overnight. The membrane was washed 3 times with 1 × TBST on a shaker for 10min each time and incubated with HRP-labeled secondary antibody (diluted 1:5000 with 5% skim milk) for 1h on a shaker at room temperature. The film was washed 3 times with 1 × TBST for 10min on a shaker, and an ECL developer (ECL a: ECL B ═ 1: 1) was dispensed, and the ECL developer was dropped on the film and exposed to light using an exposure apparatus. As shown in FIG. 3, S protein was contained in the stably transformed fibroblasts.

3. Microparticles constructed and quantified by BCA and capable of preventing novel coronavirus infection and storage method

The stable fibroblasts were cultured in 10mm × 10mm culture dishes in 10% FBS (fetal bovine serum) medium until the cells in the dishes reached about 5 × 10⁶At one time, radiotherapy is carried out with the dose of 6MV and 20Gy, fluid is changed on the first day after radiotherapy, 20ml of culture medium containing 10% FBS is added, and microparticles are extracted from all the fluid in a culture dish by a gradient centrifugation method on the 3 rd day (the time for collecting the microparticles is generally selected from 2 to 7 days after radiotherapy, and can be selected according to the situation, the 3 rd day is selected in the embodiment). Centrifuging 1000g of cell culture medium after radiotherapy for 10min, taking supernatant, centrifuging 14000g of supernatant for 2min to remove fragments, discarding precipitate, centrifuging 14000g of supernatant at 4 ℃ for 60min, discarding supernatant, wherein the precipitate is microparticles, washing the precipitate twice with physiological saline, resuspending 1ml of PBS (phosphate buffer) solution, storing at 4 ℃, centrifuging 100 mu l of liquid, adding a proper amount of protein lysate, fully lysing on ice for 30min, centrifuging 12000g for 30min, taking supernatant, and adding BCA quantitative solution for protein quantification.

As shown in FIG. 4, in the case of the tool cells treated with different doses of radiotherapy, it can be seen that, from the start of the administration of 2Gy, the total protein content of vaccine microparticles released increases with the dose of radiotherapy, the release of microparticles reaches a peak at 20Gy, and the release of microparticles does not change much at 30Gy, so that 2-20Gy is a more desirable choice, and 20Gy is the most desirable choice.

4. Microparticle S protein content detection capable of preventing novel coronavirus infection

The quantified micro-particle lysate was mixed with 1/4 lysate volume of 5 xSDS loading buffer and heated at 100 ℃ for 10 min. 12% separation gel and 5% concentration gel were prepared according to the recipe, protein samples were added to the loading wells, and equal volumes of 1 xSDS loading buffer were added to the marginal wells. During electrophoresis, the concentrated gel is at a constant voltage of 80V, and when the protein marker is separated, the voltage is adjusted to be at a constant voltage of 120V. And when the electrophoresis runs to the bottom of the separation gel, ending the electrophoresis. Pouring the film transferring liquid into an iron plate, and putting the iron plate into a film transferring clamp. Prying the glass plate, transversely cutting the required target protein by using a gel cutting plate according to the position of a marker, placing the gel cutting plate on black gel surface filter paper, covering the PVDF membrane soaked by methanol on gel, and clamping a clamp. And placing the clamp into a film transferring groove, pouring the film transferring liquid in the iron disc into the film transferring groove, placing the film transferring groove into a foam box filled with ice, and selecting a 200mA constant current to transfer the film. After 2h, the PVDF membrane was removed and blocked on a 5% skimmed milk block for 1h on a warm shaker. Washing with 1 × TBST for 3 times, each for 10min, diluting with primary antibody at a certain dilution ratio to obtain primary antibody solution, contacting the protein surface of the membrane with the antibody, and placing in a refrigerator at 4 deg.C overnight. The membrane was washed 3 times with 1 × TBST on a shaker for 10min each time and incubated with HRP-labeled secondary antibody (diluted 1:5000 with 5% skim milk) for 1h on a shaker at room temperature. The film was washed 3 times with 1 × TBST for 10min on a shaker, and an ECL developer (ECL a: ECL B ═ 1: 1) was dispensed, and the ECL developer was dropped on the film and exposed to light using an exposure apparatus. As shown in FIG. 5, microparticles for preventing infection with the novel coronavirus contained S protein.

5. Subcutaneous prevention of novel coronavirus microparticle vaccination in mice

C57 mice were injected subcutaneously with 50. mu.L of PBS (blank), microparticles (5mg/kg) extracted on day 3 after 20Gy radiotherapy of ordinary fibroblasts (control group), and microparticles (5mg/kg) extracted on day 3 after 20Gy radiotherapy of S protein-overexpressing fibroblasts (vaccine group), respectively, at a frequency of 1 injection per week for 3 weeks. The serum anti-S protein antibody content of the mice was measured by ELISA 15 days after the first injection. As shown in fig. 6, anti-S protein antibodies were generated in the vaccine group mice compared to the blank group and the control group. As shown in fig. 7, the vaccine microparticle group mice produced more anti-S protein antibodies than the S protein-containing tool cell lysate. As shown in FIG. 8, the body weight of the mice in the vaccine group was not significantly different from those in the other two groups, indicating that the microparticles for preventing the novel coronavirus infection had no significant toxic side effects.

The virus-infected microparticles prepared by the above steps are produced by subjecting genetically engineered tool cells to radiation. The principle is that the radiation therapy can promote cell membranes to release microparticles with a phospholipid bilayer structure of which the diameter is 100-1000nm to the outside in a budding mode, and the microparticles have an immune activation function and can promote immune reaction due to the fact that the microparticles carry new coronavirus S protein and have a targeting function on immune cells.

The novel coronavirus infection microparticle has remarkable immunity activation effect, and can promote B lymphocyte of organism to generate anti-novel coronavirus antibody to prevent novel coronavirus infection. The condition of subcutaneous inoculation for preventing the novel coronavirus microparticles of the mice shows that the novel coronavirus microparticles have good biological safety and biocompatibility, can be independently used, and can also be loaded with an immunologic adjuvant to further activate the immune system of the organism to enhance the function of preventing the novel coronavirus from being infected.

The invention is not limited solely to that described in the specification and embodiments, and additional advantages and modifications will readily occur to those skilled in the art, so that the invention is not limited to the specific details, representative embodiments, and illustrative examples shown and described herein, without departing from the spirit and scope of the general concept as defined by the appended claims and their equivalents.

Claims (10)

1. A method for preparing microparticles for preventing novel coronavirus, which comprises the following steps:

s1, constructing a recombinant plasmid for over-expression of S protein;

s2, packaging the recombinant plasmid into a lentivirus particle;

s3, infecting the tool cells by using the lentivirus particles to obtain the tool cells over-expressing the S protein;

s4, carrying out X-ray irradiation on the obtained tool cells and culture solution, and collecting supernatant after radiotherapy to obtain a mixture of the needed microparticles and tool cell fragments subjected to apoptosis;

s5, centrifuging the mixture, and collecting precipitates to obtain the novel coronavirus prevention microparticles.

2. The method of claim 1, wherein the step S1 is to synthesize an artificial gene based on the coding region of the S protein of the novel coronavirus and insert the artificial gene into the multiple cloning site of the plasmid vector to construct a core plasmid capable of overexpressing the S protein.

3. The method of claim 2, wherein the step S2 of packaging the lentiviral vector particles comprises using a psPAX2 plasmid and a pMD2.G plasmid.

4. The method of claim 1, wherein the instrumental cells of step S3 include one of fibroblast cell line, vascular endothelial cell line and human embryonic kidney cell line.

5. The method according to claim 1, wherein the dose of X-ray radiation in step S4 is 2-20 Gy.

6. The method of claim 1, wherein the dose of X-ray radiation in step S4 is 20Gy, the energy of X-ray is 6MV, and the supernatant is collected from day 2 to day 7 after the radiotherapy.

7. The method for preparing microparticles for preventing novel coronavirus according to claim 1, wherein the centrifugation in step S5 is performed by: 1000g, centrifuging for 10min to obtain a first supernatant; centrifuging the obtained first supernatant at 14000g for 2min to obtain a second supernatant; the second supernatant was centrifuged at 14000g for 60min to obtain a pellet.

8. The method for preparing the microparticle for preventing the novel coronavirus according to claim 1, wherein the vaccine has a microvesicle structure, and the particle size of the microvesicle structure is 100-1000 nm.

9. A novel coronavirus vaccine comprising microparticles obtainable by the pre-preparation method of any one of claims 1 to 8.

10. The novel coronavirus vaccine of claim 9, wherein the vaccine is loaded with an adjuvant for immunization.

Images