CN111317816A - Preparation method of novel coronavirus pneumonia bivalent vaccine - Google Patents

Abstract

The invention discloses a preparation method of a novel coronavirus pneumonia bivalent vaccine, which comprises the steps of amplifying a 2019-nCoV targeted interference gene shRNA, digesting a PCR product, constructing an interference vector pSilencer-shRNA, converting DH5a, constructing a shuttle vector pDC312-shRNA, co-transfecting HEK293 with an adenovirus skeleton plasmid pBHGloxAEL to prepare Ad-shRNA, and further preparing Ad-nCoVdsRNA; the method also comprises the steps of amplification of 2019-nCoV antibody expression genes, enzyme digestion of PCR products, construction of shuttle plasmid pShuttle-nCoV, transformation of DH5a, PCR amplification, co-transfection of HEK293 with adenovirus skeleton plasmid pAd-nCoV to prepare recombinant adenovirus Ad-nCoV, and further preparation of Ad-nCoVDNA; then the expression vector is expressed by Ad-nCoVdsRNA: Ad-nCoVDNA: h₂0-1: 1: 19, preparing bivalent vaccine, and introducing nCoVdsRNA and nCoVDNA into cells by Ad after respiratory tract spray inoculation.

Description

Preparation method of novel coronavirus pneumonia bivalent vaccine

Technical Field

The invention relates to a preparation method of a novel coronavirus pneumonia bivalent vaccine used in the field of infectious disease prevention and treatment, and belongs to the technical field of novel vaccine preparation methods.

Background

Human coronaviruses (HcoV 229E and HcoV OC43) cause up to 30% of colds. Animal coronavirus such as porcine gastroenteritis coronavirus (TGEV), mouse hepatitis coronavirus (MHV), avian infectious tracheitis coronavirus (IBV), etc. can infect respiratory tract, gastrointestinal tract, nervous system and liver of a corresponding host, resulting in corresponding symptoms. The envelope of the coronavirus is a petaloid protuberance that makes the coronavirus look like a crown of royal crown (latin, corona) whose nucleocapsid is a variable long helix. The particle diameter of coronavirus is 60-140 nm, and the virus genome is single-stranded positive-sense RNA with 27-32 kb, and is the largest of all RNA virus genomes. One variant of the coronavirus in 2003 caused an outbreak of severe acute respiratory syndrome, SARS (SARS), with a SARS-CoV genome size of 27-3 lkb, 14 Open Reading Frames (ORFs) and 1 s2m motif (s2m motif).

It was reported that the entire genome of nCoV-2019, which was almost identical in the sequence of 79.5% among 5 patients, was identical to SARS-CoV, and that nCoV-2019 was found to belong to the enveloped RNA virus of SARSr-CoV by comparing the conserved 7 non-structural proteins. nCoV-2019 contains the 5 'untranslated region (UTR), the replicase complex (orf1ab), the S gene, the E gene, the M gene, the N gene, the 3' UTR and several unknown unstructured open reading frames. For gene diagnosis (PCR) of nCoV-2019, the Chinese disease prevention and control center currently recommends primer and probe sequences for the open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) gene regions of novel coronavirus nCoV-2019, wherein: target 1(ORF1 ab): forward primer (F): CCCTGTGGGTTTTACACTTAA, respectively; reverse primer (R): ACGATTGTGCATCAGCTGA; probe (P): 5'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ 1-3'. Target 2 (N): forward primer (F): GGGGAACTTCTCCTGCTAGAAT, respectively; reverse primer (R): CAGACATTTTGCTCTCAAGCTG, respectively; fluorescent probe (P): 5'-FAM-TTGCTGCTGCTTGACAGATT-BHQ 1-3'. The analysis of The entire genome sequence and function of nCoV-2019 (A NovelCoronavir from Patients with Pneumonia in China,2019.The New England journal of Medicine,2020, January 24) also lays a good foundation for The further research of nCoV-2019, but at present, more exact information about nCoV-2019 is lacked.

The international epidemic prevention and innovation alliance (CEPI) head office executive officer's Charcot-Hatchett (RichardHatchett) is shown in 23 days 1 month 2020, and the organization in which he is located invests 1500 ten thousand dollars for the first round to develop a novel coronavirus vaccine, and if the development is smooth, the clinical test is expected to start after 6 months. 26/1/2020, the chinese center for disease control shows that it has started the development of novel coronavirus vaccines, has successfully isolated viruses and is screening seed strains. 26 months in 2020, 3 strains of novel coronavirus are also isolated in the focus laboratory of Li-Lanjuan Hospital in the university of Zhejiang for infectious disease diagnosis and treatment, which lays a foundation for the next vaccine research. Vaccines can be classified into attenuated live vaccines, inactivated vaccines, subunit vaccines, DNA vaccines, recombinant vector vaccines, virus particle-like vaccines, polypeptide vaccines, and the like. Most of the traditional vaccines are dead vaccines, attenuated live vaccines or recombinant subunit vaccines, while the novel vaccines are viral nucleic acids encoding antigenic proteins or cellular vaccines capable of eliciting specific immune responses. The existing traditional vaccine mainly depends on antigen protein of pathogen to stimulate organism to generate protective antibody, and the existing novel vaccine can also stimulate specific cellular immune response. In view of the unclear biological properties and strong infectivity of 2019-nCoV, it should be noted that the live vaccine is not safe and difficult to prepare, and the inactivated vaccine may be recombined with the wild strain and recovered, and is only suitable for emergency storage. In contrast, modern biotechnology-based subunit, DNA and polypeptide vaccines are safer, more practical and more operational. In order to reduce the cost of vaccine transportation, storage, vaccination and ease of vaccination, several vaccines against different pathogens are often mixed together, known as multiple vaccines, such as the diphtheria, tetanus and pertussis are prevented simultaneously by one vaccination. In addition, to overcome the disadvantage of poor immunity due to strain polymorphism, vaccines against different serotypes of the same pathogen are often mixed together, called bivalent or multivalent vaccines, such as multivalent HPV vaccines. But can invent a multivalent vaccine against coronavirus pneumonia which is different from the existing vaccine and has no relation with antigen protein, antibody or cellular immunity?

The inventor plans to disclose a preparation method of a novel coronavirus bivalent vaccine based on RNA interference as early as possible. RNA interference (RNAi) refers to the ability of a small RNA to bind to a target gene pair, specifically knock out or turn off the expression of the bound gene. Namely, RNAi refers to highly efficient specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). The literature reports that in 1995, doctor Guo Shu from the university of double university injected antisense RNA into C.ele-gans (C. ele-gans) in the body of C.ele-gans in an attempt to block the expression of the par-1 gene. She also injected the sense RNA into the control group nematodes in order to observe the effect of the par-1 gene expression enhancement. However, the par-1 gene expression of the control group was not only not enhanced but blocked as in the experimental group. These results cannot be explained by the conventional antisense RNA technology, but they faithfully address the results of the study in the Cell journal and are published. This suspense brought the attention of Fire a doctor, washington, california research institute, who purified sense and antisense RNAs by gel electrophoresis, and intentionally mixed the purified sense and antisense RNAs together to make dsRNA hybrids, which were separately injected into nematodes. The result shows that the purified antisense RNA gene suppression effect is obviously weakened, and the dsRNA heterozygote can effectively and specifically block the expression of homologous mRNA, and the blocking effect of the dsRNA heterozygote is at least 100 times higher than that of antisense RNA. This result surprisingly demonstrates that dsRNA plays a major role in gene suppression. Hre A refers to this effect of dsRNA as RNA interference (RNAi). In 1998, Hre A published the research results in Nature journal, so that the hot tide of RNA interference research is rapidly raised in the world, and it is confirmed that RNA interference is caused by that after dsRNA is injected into eukaryotic cells, a defense response in the eukaryotic cells is triggered, a dsRNA-induced silencing complex is generated, mRNA having a homologous sequence with the dsRNA is degraded, and a gene is silenced at a post-transcriptional level, and the capability of expressing protein or polypeptide is lost. Further research shows that exogenous genes such as viral genes, artificial transfer genes, transposons and the like are randomly integrated into the host cell genome, and when the host cell is used for transcription, some dsRNA is often generated. The host cell reacts to the dsRNA rapidly, an endonuclease (Dicer) in cytoplasm cleaves the dsRNA into a plurality of small-fragment siRNAs (about 21-23 bp) with specific lengths and structures, the siRNAs are melted into a sense strand and an antisense strand under the action of intracellular RNA helicase, and the antisense siRNAs are combined with some enzymes (including endonuclease, exonuclease, helicase and the like) in vivo to form an RNA-induced silencing complex (RISC). RISC and exogenous gene expression mRNA homologous region to carry on the specific binding, RISC has nuclease function, in binding site cut mRNA, the cutting site is two ends that complementary binding with antisense strand in siRNA. The cleaved, cleaved mRNA fragments are then degraded, thereby inducing a host cell degradation response to the mRNA. The siRNA can not only guide RISC to cut homologous single-stranded mRNA, but also can be used as a primer to be combined with target RNA and synthesize more new dsRNA under the action of RNA polymerase (RdRP), and the newly synthesized dsRNA is cut by Dicer to generate a large amount of secondary siRNA, so that the action of RNAi is further amplified, and finally the target mRNA is completely degraded. RNAi is similar to gene knockout, but is far simpler and more practical than gene knockout, and has high safety, and because the RNAi is not really gene knockout, serious consequences caused by gene misknockout can be avoided. This provides a feasible mechanism for developing novel coronavirus dsRNA vaccines based on RNA interference.

The literature reports that in vitro experiments of RNAi antiviral replication are easy to succeed, but siRNA is easily degraded by RNase (RNase) in vivo serum, so that an ideal vector is needed for delivering shRNA to cells for expression. The adenovirus recombinant vector technology is applied to RNAi (Xia et a1.2004) for the first time in 2004, and a classical adenovirus packaging system comprises HEK293 cells, shuttle plasmids carrying exogenous genes and backbone plasmids containing adenovirus genomes. The shuttle vector generally has a eukaryotic promoter and a multiple cloning site located downstream thereof, and the multiple cloning site into which a foreign gene is inserted is called a foreign gene expression cassette. After the shuttle vector and the backbone plasmid transfect the HEK293 cell together, the HEK293 cell provides E1 protein necessary for virus replication, so that the exogenous gene in the shuttle vector is transferred to the backbone plasmid, and the recombinant adenovirus particles are packaged. The human adenovirus which is most clearly researched at present comprises type 2 (Ad2) and type 5 (Ad5), the adenovirus vector developed by Ad5 is a commercial product applied to the field of disease treatment and scientific research, has the characteristics of wide infection spectrum, non-integration, safety, easy operation, high in vitro proliferation titer, large non-essential fragment in genome and the like, is the most widely applied virus vector at present, and can be used as the immune effect of an immunologic adjuvant when the immunogenicity is enhanced after the E3 region is deleted. Most importantly, the respiratory epithelial cells contain abundant adenovirus receptors (CAR), and the natural host of Ad5 adenovirus is human respiratory epithelial cells, so that the replication-defective recombinant adenovirus vector can efficiently infect the respiratory epithelial cells, and the possibility of immunization (spray or nasal drop) through oral and upper respiratory tracts is provided. In addition, the immunogen expressed by the adenovirus vector basically keeps the natural conformation of the immunogen after host cell expression, processing, folding, modification and presentation, so that the immune response in a natural state is convenient to simulate, the novel coronavirus is mainly infected through a respiratory tract, the adenovirus vector vaccine can be conveniently prepared into an oral or upper respiratory tract spray, atomization inhalation inoculation is not only convenient, but also the use cost is greatly reduced, and the application prospect is wide if the adenovirus vector vaccine can be used for inducing effective mucosal immune response.

The aerosol inhalation inoculation is to put the medicine or the vaccine into a specific aerosol generator, atomize and inhale the medicine or the vaccine into the respiratory tract, stimulate the respiratory tract mucous membrane to generate mucosal immunity and further enter the alveoli to take effect. Because the lung has huge alveolar surface area, abundant capillary vessels and extremely small transport distance, the inoculated medicine or vaccine can quickly exert the medicine effect after being absorbed by the lung. Overseas research on aerosol inhalation therapy dates back to the fifties of the last century, and the first pressure metered dose inhaler, Medihaler-Epi, was developed and marketed by the Riker laboratory as early as 1956^TMContaining adrenaline, Medihaler-Iso^TMContains isoproterenol. Aerosol immunization, the direct vaccination of the respiratory mucosa, not only provides a physiological and immunological advantage, but also this route of vaccination offers potential logistical advantages as it does not require trained personnel. Therefore, the aerosol immunization method is an immunization method which is worthy of being popularized steadily. Inhalation aerosol therapy has received great attention in recent times and more aerosol immunisation drugs have been developed, aerosol vaccination of measles vaccine being the most studied and proven to have a definite therapeutic effect in human aerosol immunisation studies. With the science and technologyWith continued progress, nebulized vaccination will become more sophisticated and a routine approach to immunotherapy. The key point of aerosol inhalation inoculation or administration is that an atomizer is always kept away, and the compressed air atomizer needs an air compressor to drive atomization. The compressed high-speed airflow passes through the Venturi tube to generate a Venturi effect, so that a negative pressure environment is generated around the nozzle, the medicine in the liquid medicine cup is brought out by the high-speed airflow, and the high-speed airflow impacts the baffle plate through the special nozzle to be broken into fog drops with the diameter of 5 mu m. The prior compressed air atomizer has wider clinical application, and can carry out atomization inhalation treatment and inoculation on measles, influenza, BCG vaccine and other medicaments.

In general, although a method for preparing an antigenic vaccine based on an antigen of a pathogen and a method for preparing an existing vaccine for removing a pathogen by generating an immunological antibody based on antigenic vaccination have been widely used, there are no reports on a method for preparing a dsRNA vaccine based on a conserved genome of a pathogen and a method for preparing a dsRNA vaccine for degrading homologous mRNA of a pathogen by generating a gene silencing complex based on dsRNA vaccination.

Disclosure of Invention

The invention aims to overcome the defects that the prior art does not have a method for preparing a dsRNA vaccine based on a pathogen conserved genome and a literature report and an application of a dsRNA vaccine preparation method for degrading pathogen homologous mRNA (messenger ribonucleic acid) based on gene silencing compound generated by dsRNA vaccination, and provides a preparation method of a novel coronavirus pneumonia bivalent vaccine different from the traditional process.

The purpose of the invention is realized by the following technical scheme:

(1) the Ad-nCoVdsRNA vaccine preparation method comprises the steps of amplifying a target interfering gene shRNA sequence of nCoV2019, carrying out enzyme digestion on the amplified shRNA sequence and an empty interfering vector pSilencer4.1.CMV. neo through BamH I and Hind III to construct an interfering vector pSilencer-shRNA, amplifying the interfering vector through competent escherichia coli DH5a, identifying that the shRNA is inserted into the interfering vector without errors, carrying out enzyme digestion on the interfering vector and an empty shuttle vector pDC312 through Hind lII and EcoR I to construct a shuttle vector pDC312-shRNA, co-transfecting HEK293 cells with an adenovirus skeleton plasmid pBHGloxAIL, carrying out homologous recombination in the cells to obtain recombinant adenovirus Ad-shRNA, and carrying out multiple times of amplification through HEK293 to prepare the Ad-nCoV2019dsRNA vaccine of the recombinant adenovirus vector.

Further, the target interfering gene shRNA refers to a sequence with the length of 19nt, which is complementary to the siRNA sequence and currently comprises ORF1ab, 3' UTR, S, E, M and N gene sequences.

Furthermore, the target interfering gene shRNA is a DNA template for expressing a hairpin structure and is composed of two most of complementary single-stranded DNAs, and a DNA double strand with sticky ends of BamH I and Hind III enzyme cutting sites can be formed after annealing and complementation.

Further, the Ad-nCo2019VdsRNA vaccine refers to a recombinant adenovirus vector carrying shRNA which can synthesize dsRNA in cells after entering epithelial cells of respiratory tract or digestive tract, and the synthesized dsRNA can specifically degrade mRNA with homologous sequences to lose the capacity of expressing protein or polypeptide; the Ad refers to a replication-defective recombinant adenovirus vector; the nCoV2019 refers to a targeted interference sequence of a conserved gene or a functional gene of the novel coronavirus.

(2) The Ad-nCoVDNA vaccine preparation method comprises the steps of amplifying an antibody expression gene of nCoV2019, carrying out enzyme digestion on the amplified sequence and an adenovirus shuttle plasmid pShuttle by XbaI and KpnI to construct a recombinant adenovirus shuttle plasmid pShuttle-nCoV2019, amplifying the shuttle plasmid by competent Escherichia coli DH5a, carrying out enzyme digestion by XbaI and KpnI to identify that the insertion of nCoV is correct, then carrying out co-transfection on HEK293 cells with an adenovirus skeleton plasmid pAd-nCoV2019, carrying out homologous recombination in the HEK293 cells to obtain the recombinant adenovirus Ad-nCoV2019, and carrying out multiple amplification on the recombinant adenovirus vectors by the HEK293 cells to prepare the Ad-nCoV2019DNA vaccine of the recombinant adenovirus vector.

Furthermore, the antibody expression gene refers to a gene capable of expressing mRNA, mRNA expression protein and protein for stimulating the body to produce antibodies.

Further, nCoV2019 refers to a conserved gene and a functional gene sequence of the novel coronavirus; the conserved and functional genes are currently referred to as ORF1ab, 3' UTR, S, E, M, N gene sequences.

Further, the pShuttle-nCoV2019 refers to a recombinant adenovirus shuttle plasmid containing nCoV 2019; the pAd-nCoV2019 refers to an adenovirus backbone plasmid containing nCoV 2019; the Ad-nCoV2019 refers to a replication-defective recombinant adenovirus vector containing nCoV 2019; the Ad refers to a replication-defective recombinant adenovirus vector.

Furthermore, the Ad-nCoV2019DNA vaccine refers to that after a recombinant adenovirus vector carrying an antibody expression gene enters epithelial cells of a respiratory tract or a digestive tract, the antibody expression gene can express mRNA and mRNA expression protein, and the protein stimulates an organism to generate an antibody, so that the antibody neutralizes a novel coronavirus, and the pathogenicity of the coronavirus is lost.

(3) According to the dsRNA of Ad-nCoV 2019: Ad-nCoV2019 DNA: h₂0-volume ratio of 1: 1: 5-19 to prepare the novel coronavirus pneumonia bivalent vaccine.

The invention has the beneficial effects that: the bivalent vaccine has the advantages of quick response, good effect, safe use, convenient inoculation and the like. Firstly, the bivalent vaccine is prepared by mixing an Ad-nCoVdsRNA vaccine and an Ad-nCoV2019DNA vaccine, and is introduced into respiratory tract infected cells by a recombinant adenovirus vector after spray inoculation, wherein the Ad-nCoV2019dsRNA vaccine immediately generates dsRNA through shRNA thereof, activates nuclease activity, immediately degrades homologous virus mRNA, and quickly enables the virus to lose pathogenic effect; the Ad-nCoV2019DNA vaccine expresses protein, generates antibody and plays a role in neutralizing viruses later; because the immune action mechanisms and time points of all components are different, the multivalent vaccine is suitable for different disease courses, and can avoid serious consequences caused by the immune failure of a monovalent vaccine, so that the multivalent vaccine has advantages, plays a role in mutual complementation and synergism, and particularly has the prominent effect of emergency prevention caused by the fact that the immune mechanism of the nCoV2019dsRNA component is different from the antigen-antibody reaction in the prior art, and prompts that in the preparation of a novel coronavirus vaccine, 1 target gene of 1 strain is inserted into 1 expression vector, or a plurality of target genes of 1 strain are inserted into 1 expression vector, or a plurality of target genes of a plurality of strains are inserted into 1 expression vector, so that the expression vectors of the strains are prepared, and then the strains are combined into a bivalent or multivalent vaccine of 1-strain or a plurality of strains of Ad-nCoV2019dsRNA or/and Ad-nCoV2019DNA for application. Secondly, the vectors for delivering the bivalent vaccine of the invention are all replication-defective adenoviruses, have the advantages of safe use, stable expression, easy operation and the like, provide basis for immune spray inoculation through oral cavity and upper respiratory tract due to high-efficiency infection of respiratory tract epithelial cells, and are theoretically more suitable for preventing novel coronavirus pneumonia.

Detailed Description

The following describes in detail the specific embodiments of the present invention.

First, example 1

Screening target interfering gene shRNA sequences (ORF1ab, S, E, M, N), constructing an expression vector pSilencer-shRNA (pSilencer-ORF1ab/S/E/M/N), transferring an shRNA expression cassette in the expression vector to construct an adenovirus shuttle plasmid pDC312-shRNA, co-transfecting HEK293 cells with an adenovirus skeleton plasmid pBHGloxAel, obtaining recombinant adenovirus Ad-shRNA through homologous recombination, preparing an anti-neocoronary pneumonia dsRNA vaccine by using an immunopotentiator as a medium through multiple amplification and purification of the HEK293 cells, introducing the shRNA into respiratory epithelial cells through the recombinant adenovirus vector (Ad-shRNA) after spray inoculation, synthesizing dsRNA in the cells, and then specifically inducing gene silencing or RNA interference reaction of nCoV mRNA degradation.

The embodiment relates to a preparation method of an nCoV2019 vaccine, relates to but is not limited to nCoV2019ORF1ab, S, E, M, N genes and primers thereof, relates to but is not limited to the same experimental methods, shRNA expression vectors pSilencer, pDC312, pBHGloxAEEl, pAd, pEGFP, HEK293 and other experimental materials, and also relates to in vitro synthesis of nCoV2019-RNA interference treatment products.

1. Selection of novel coronavirus RNAi target site and construction of shRNA interference vector

(1) Selection of RNAi target sites and design of siRNA expression templates: according to sequenced gene sequences of novel coronavirus ORF1ab, 3' UTR, S, E, M and N, a plurality of siRNA alternative sequences with the length of 19nt are obtained by utilizing shRNA online design software (http:// www.ambion.com/techlib/misc/siRNAtools. html) of Ambion company, siRNA sequences are preferably selected according to the Tm value of RNA combination and the specific comparison result, a genome region complementary to the siRNA sequences is selected as an interference target site, and shRNA templates capable of expressing hairpin structures are designed by combining a polyclonal enzyme cutting site of a pSilencer4.1.CMV. neo interference vector, each template is composed of two mostly complementary 55bp single-stranded DNAs, and after annealing and complementation, a DNA double-strand with sticky ends of BamH I and Hind III cutting sites can be formed for connection with a linearized interference vector pSilencer4.1.CMV. neo.

(2) Construction of shRNA expression vectors: annealing and complementing the oligonucleotide chain, connecting the oligonucleotide chain with a linearized shRNA expression vector pSilencer4.1.CMV.neo, constructing a shRNA expression plasmid, and converting the shRNA expression plasmid into a competent cell DH5 a. The specific method of annealing complementation and vector ligation is as follows:

① annealing of oligo DNA synthetic oligonucleotides were annealed with ddH₂Dissolving 0 into 100 μ M, mixing 5 μ L of each two complementary single strands, placing the 6 kinds of oligoDNA mixed solution in a 98 ℃ water bath for heating for 5min, closing a switch of the water bath to naturally cool the mixture to room temperature to form double-strand DNA, wherein an annealing system is as follows: 5. mu.L of 100. mu.M plus strand oligonucleotide; 5. mu.L of 100. mu.M minus strand oligonucleotide; 2 μ L of 10xPCR buffer; ddH₂0:8 μ L; the total volume was 20. mu.L.

② vector ligation, the synthesized double-stranded DNA was further diluted to 10nM and ligated at 16 ℃ for 30min in an enzyme ligation system of pSilencer4.1.CMV. neo: 4. mu.L, 5Xligation buffer: 2. mu.L, ds oligo (10nM) 4. mu.L, T4DNA ligase (1U/. mu.L) 1. mu.L, ddH₂0:9 μ L; the total volume was 20. mu.L. pSilencer-ORF1ab, pSilencer-3' UTR and pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N vectors were constructed.

③ identification of vector, the ligation product is transformed into Escherichia coli competent cell DH5a, 6 clones are selected from each recombinant vector plate for sequencing identification, and after the correctness of the insert is determined, the insert is preserved for standby.

2. Effect identification of shRNA interference vector

The 293T cell is identified by constructing a fluorescent label vector and co-transfecting the vector with shRNA interference.

(1) Construction of fluorescent tag vector of ORF1ab, 3' UTR, S, E, M and N genes

① ORF1ab, 3' UTR, S, E, M and N gene primer design, wherein according to the genome sequence (the sequence numbers are GWHABKF00000000, GWHABKG00000000, GWHABKH00000000, GWHABKI0000 and GWHABKJ 0000) of a novel coronavirus (nCoV-2019) issued by the national genome science data center (NGDC), lower and lower primers required for designing a conserved region are selected, or required primers are designed according to the gene sequencing result of a novel coronavirus strain.

② ORF1ab, 3' UTR, S, E, M, N gene amplification, the gene amplification reaction system and reaction conditions are carried out according to the kit provided by Shanghai, and the gene amplification products are recovered and purified for later use.

③ linearization of pEGFP-N1 vector, recovering DH5a strain containing pEGFP-N1 plasmid, extracting plasmid according to kit or literature, determining concentration, and performing enzyme digestion, wherein the enzyme digestion system comprises 10xM Buffer (5 μ L), plasmid DNA (20 μ L), HindIII (2 μ L), and ddH₂0: 23 mu L of the solution; total volume: 50 μ L. And uniformly mixing the mixed solution, placing the mixed solution in a water bath kettle at 37 ℃ for enzyme digestion for 2 hours, carrying out 0.8% agarose gel electrophoresis identification, and recovering the linearized vector for later use.

④ pEGFP-ORF1ab, pEGFP-3' UTR, pEGFP-S, pEGFP-E, pEGFP-M, pEGFP-N vectors were constructed by ligation using a homologous recombination kit from Kinsley corporation under the system and conditions of 6. mu.L of linearized vector (100. mu.L) and 8. mu.L of purified PCR product, 2. mu.L of 10xCloneEZ buffer, 2. mu.L of CloneEZ Enzyme, 2. mu.L of ddH20 and 2. mu.L of total volume 20. mu.L, mixing the mixture gently, keeping the mixture at 25 ℃ for 30min, keeping the mixture on ice for 5min, and keeping the mixture at-20 ℃ for use or immediately transforming the mixture after ligation.

(2) The co-transfection method comprises the following steps: the interference vectors pSilencer-ORF1ab, pSilencer-3'UTR and pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N and the corresponding fluorescent tag vectors pEGFP-ORF1ab, pEGFP-3' UTR and pEGFP-S, pEGFP-E, pEGFP-M, pEGFP-N are co-transfected into 293T cells respectively. The mass ratio of the interference carrier to the label carrier is 1: and 2, setting irrelevant interference holes and non-interference holes as controls, observing the fusion expression condition of the GFP in the cells 48h after transfection, and evaluating the interference effect according to the fluorescence intensity.

(3) Flow cytometry assay after co-transfection: to quantify the interference effect of different interference vectors, the ratio of cells expressing fluorescent protein in the total cell number was analyzed using flow cytometry detected cells. The flow cytometry analysis method was as follows:

① cells to be tested were trypsinized from the cell plate and blown into single cells and transferred to a 1.5mL centrifuge tube.

② the cell suspension cells 40C 300Xg were centrifuged for 10min, the supernatant was discarded, and a pre-cooled PBS was added for washing.

③ the cells were suspended thoroughly after repeating the step (2)3 times and the cells were blown into single cells.

④ the detection method adopts Guavaaxpress Plus method, and the number of cells per second is kept below 800.

⑤ the analysis and statistics of the results are carried out by Flowjo flow analysis software after the detection data are stored.

(4) Westernbolt analysis of ORF1ab, 3' UTR, S, E, M, N proteins

① cell collection and lysis, in which RIPA tissue lysate is used to lyse cells, and the specific steps are as follows:

a. the cells were washed 1 time with PBS for use; the lysate was prepared at a ratio of 10. mu.L PMSF mixed with lmL RIPA.

b. 150-250. mu.L of lysate was added to each well and pipetted several times to bring the lysate into full contact with the cells.

c. The lysed sample was centrifuged at 12000Xg for 3.5min and the supernatant was removed for further use.

② SDS-PAGE electrophoresis of protein samples:

adding a sample into an equal volume of 2xSDS loading buffer solution, boiling for 5min in boiling water, carrying out ice bath for 2min, carrying out 12000xg, and carrying out 10min, wherein the SDS-PAGE gel is prepared as follows:

a. according to the using method of the vertical electrophoresis device, the glass plate is cleaned and aired, and then the glass plate is assembled, so that good sealing performance is guaranteed. Firstly, preparing separation gel.

b. 10ml of 15% separation gel was formulated with the following ingredients: 5.0mL of 30% acrylamide mixed solution; 1.5M Tris (pH8.8) 2.5 mL; O.1mL of 10% ammonium persulfate; 10% SDS: 0.1 mL; TEMED: 0.004 mL; ddH₂02.3 mL. And finally adding TEMED, quickly mixing the separated gel uniformly after the separated gel is prepared, injecting the prepared gel solution into the gap at one end of the glass plate by using a liquid transfer device, and stopping adding liquid when the gel surface is about 3cm away from the edge of the glass plate. And ddH20 was added to the top of the gel, the water was poured off when the gel was fully agglutinated, and the remaining liquid on the gel was carefully blotted with filter paper.

c. Preparation of the concentrated gel 2ml of a 5% concentrate was prepared with the following ingredients: O.33mL of 30 percent acrylamide mixed solution; 0.25mL of 1.0M Tris (pH6.8); O.02mL of 10% ammonium persulfate; 0.02mL of 10% SDS; TEMED 0.002 mL; h₂O1.4 mL. Mixing concentrated gel rapidly, adding TEMED, injecting the gel solution into the gap at one end of the glass plate by using a pipette, slightly inserting a comb after adding to prevent bubbles, and removing excessive gel flowing out.

d. And pulling out the comb after the concentrated gel is solidified.

e. And (3) disassembling the gel on a gel preparation frame, placing the gel in an electrophoresis tank, adding 1 xTris-glycine electrophoresis solution, and spotting, wherein 20 points are applied to each hole.

f. The voltage of the concentrated gel electrophoresis is 80V, and after the sample enters the separation gel, the voltage is adjusted to be 120V until the electrophoresis is finished (the bromophenol blue enters the electrophoresis solution).

g. Carefully taking off the gel, dyeing on a horizontal shaking table by using Coomassie brilliant blue R-250 dyeing liquid, changing the decoloring liquid, and then decoloring on the horizontal shaking table overnight, wherein the decoloring liquid is changed until clear bands appear on the observed gel.

③ Western blot detection.

a. Film transfer: unstained gel was placed in the transfer buffer and the filter paper and PVDF membrane were cut to a size similar to but slightly smaller than the gel. Soaking the PVDF membrane in absolute methanol for a short time, then putting the PVDF membrane into a membrane transferring buffer solution, and directly soaking the filter paper in the membrane transferring buffer solution. Combined transfer device (from bottom to top order): and (3) filter paper (3 layers), a PVDF film (1 layer), gel and filter paper (3 layers) are put into an electrophoresis fixture after being assembled, and then put into a transfer printing groove for 150mA constant current transfer printing for 120 min.

b. And (3) sealing: the membrane was removed and placed in 10mL skimmed milk diluted with 2.5% PBST and shaken on a shaker lh.

c. Primary antibody binding: the membrane was placed in a container containing 10mL of primary antibody (anti-GFP monoclonal antibody, anti-IB-actin monoclonal antibody) diluted in 2.5 skim milk and shaken on a shaker for 1 h.

d. Washing: wash 3 times with PBST.

e. And (3) binding of a secondary antibody: putting the PVDF membrane into a container for diluting 1: in 800 diluted secondary antibody, shake for 1 h.

f. Washing: wash 3 times with PBST.

g. Color development: the membrane was developed using a Tiangen HRP-DAB substrate development kit.

h. The color development was stopped by washing with deionized water and the results were observed.

(5) And detecting the relative expression quantity of ORF1ab, 3' UTR, S, E, M and N of the transfected cells.

a. Detecting relative expression quantity of ORF1ab, 3' UTR, S, E, M and N genes in transfected cells, quantitatively evaluating interference effect of different interference vectors, and adopting relative fluorescence quantitative RT-PCR detection method.

b. When the target gene transcription of the sample is relatively and quantitatively detected, the copy numbers of the target gene and the reference gene in B-actin are converted from CT values according to a standard curve equation. The relative expression quantity of virus gene mRNA (target gene copy number/B-actin copy number) is corrected by B-actin internal reference gene.

3. Construction of a recombinant adenovirus shuttle vector (pDC312-2019nCoV) that interferes with the replication of 2019nCoV

(1) Transfer of shRNA expression cassette in shRNA interference vector

The shRNA interference vector (pSilencer-ORF1ab, pSilencer-3' UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N) and the pDC312 or pShuttle adenovirus shuttle vector are extracted conventionally, and are cut by using restriction enzymes Hind lII and EcoR I at the same time, the shRNA expression cassette in the shRNA interference vector is cut off, and the pDC312 vector is linearized.

The enzyme digestion system is as follows: 10xM Buffer:5 uL; plasmid DNA: 20 uL; hind III: 2 uL; EcoR I: 2 uL; ddH₂0: 2 luL; total volume 50 uL.

Recovering the linearized vector and the shRNA expression cassette, and connecting according to the following system: pDC 312/pShuttle: 2 uL; shRNA expression cassette: 4 uL; 5 xligantion buffer:4 uL; t4DNA ligase (1U/uL) 1 uL; ddH₂0:9 uL; total volume 20 uL.

The ligation product was transformed into E.coli competent cell DH5a, 4 clones were picked up after overnight culture for sequencing and identification, and after confirming the correctness of the insert, the recombinant vector was named pDC312-nCoV2019(pDC312-ORF1ab, pDC312-3' UTR, pDC312-S, pDC312-E, pDC312-M, pDC312-N) and stored for future use.

(2) Design of identification primer of recombinant adenovirus shuttle vector (pDC312-nCoV2019)

According to the Ad5 sequence issued by Genbank and the nCoV-2019 genome sequence issued by the China national genome science data center, primers (such as ORF1 ab: F: CCCTGTGGGTTTTACACTTAA; R: ACGATTGTGCATCAGCTGA. N: F: GGGGAACTTCTCCTGCTAGAAT; R: CAGACATTTTGCTCTCAAGCTG) capable of amplifying 880bp fragments of ORF1ab, 3' UTR, S, E, M and N regions are designed by Shanghai chemical industry Co., Ltd and used for identifying recombinant adenovirus (pDC 312/pShuttle).

(3) Packaging and amplification of recombinant adenovirus (Ad-2019nCoV)

In the title Ad stands for recombinant adenovirus vector, 2019nCoV or nCoV2019, as well as conserved or functional gene sites in Ad that can be used to target interfering novel coronaviruses, such as ORF1ab, 3' UTR, S, E, M, N. The invention adopts Admax double plasmid transfection system to pack the recombinant adenovirus, and carries out HEK293 cell transfection conventionally. The transfection ratio of the adenovirus skeleton vector pBHGloxAIL to the adenovirus recombinant shuttle vector (pDC312-2019nCoV) is 1: 3. cytopathic conditions were observed daily after transfection, approximately 8 days later, and 80% of cells were ready for virus recovery when CPE appeared. Freezing and thawing the cell bottle/culture plate for 3 times to break and disintegrate the cells and release the virus in the cells. And centrifuging the freeze-thaw liquid, collecting the supernatant containing the virus, centrifuging lOmin at 3000xg and 4 ℃, and taking the supernatant for storage. And repeatedly infecting HEK293 cell proliferation virus with the harvested first generation recombinant adenovirus (Ad-2019nCoV), extracting third generation virus, extracting DNA by using a DNA extraction kit, and performing PCR identification.

(4) Ad-2019nCoV titre assay

The titer of the recombinant adenovirus is determined by using a rapid adenovirus infectivity titer (TCIDso) detection kit. The 293 cell is infected by a series of diluted virus samples, 8 cell wells are infected by each dilution, after about 10d of culture, whether the cytopathic effect caused by the virus exists in each cell well is judged under a microscope, and the titer of the adenovirus is calculated by the number of the wells with plaques.

4. Verification that Ad-2019nCoV (dsRNA) interferes with 2019nCoV replication

① in vitro verification to study the interference effect of recombinant adenovirus Ad-2019nCoV on 2019nCoV replication, the Ad-nCoV2019 was inoculated into HEK293 cells cultured in 12-well plates at lO, 50, 100, 250 and 500 MOIs, and simultaneously a control virus Ad-CMV only containing a CMV promoter and not including shRNA template sequence was used as a control virus for inoculation, 2019nCoV strain (clinical separation) was inoculated after infection for 24h, cells inoculated with 2019nCoV only were used as positive control cells, cells were collected for detection after 2019nCoV infection for 48h, 2019nCoV gene (ORF1ab, 3' UTR, S, E, M and N) relative expression amount detection was carried out on each group of cells, and the interference effect was evaluated.

② animal test:

A. experimental animals: wistar rats are cultured in an SPF-level animal laboratory, are half male and half female, are 6-8 weeks old, have the weight of 110+10g, and record animal production qualification certificate numbers.

ad-nCoV2019(dsRNA) preparation: combining with eukaryotic fermentation technology and adenovirus column chromatography purification technology, self-amplification of Ad-nCoV2019(dsRNA), twice CsCl centrifugal purification,titer 5X10¹⁰pfu/ml。

C. Method for preparing experiment

ad-nCoV2019(dsRNA) nasal drip control group (empty vector control group), anesthesia was performed by intraperitoneal injection of 3% pentobarbital, nasal drip was performed after 5 minutes at o.5 ml/tube, dosage was 1 × 10⁷pfu/dose/rat。

Ad-nCoV2019(dsRNA) nasal drip group, anaesthetized as above, nasal drip 5 minutes later, dose 1 × 10⁷pfu/dose/rat。

Ad-nCoV2019(dsRNA) tail vein injection control group (empty vector control group), dose 1 × 10⁷pfu/dose/rat。

Ad-nCoV2019(dsRNA) group for tail vein injection, dose 1 × 10⁷pfu/dose/rat。

e. Blank control group, tail vein injection PBS, O.5ml/mouse.

f. The breeding method comprises the following steps: the rats in the above groups were equally exposed to the secretions of diagnosed nCoV2019 patients or to the environment containing the nCoV2019 strain.

Each of the above groups had 10 animals per group.

g. Observation and sampling: the rats were observed for morbidity and nCoV2019 was measured for samples at weeks 0, 1, 2, 3, and 4.

nCoV2019 diagnosis, referring to the current commercial PCR kit detection diagnosis.

i. The effect of Ad-nCoV2019(dsRNA) on interfering the replication of nCoV2019 is judged according to the experimental results.

j. Naming: if the results prove that the Ad-nCoV2019(dsRNA) can effectively interfere the replication of the nCoV2019, the Ad-nCoV2019(dsRNA) is named as a novel coronavirus dsRNA vaccine or an nCoV2019-dsRNA vaccine "

5. Batch preparation of nCoV2019-dsRNA vaccine

(1) The recombinant adenovirus prepared above was packaged into HEK293 cells, and the cells were frozen and thawed in water bath at 37 ℃ in liquid nitrogen for 3 times. Vortex after each thawing to facilitate cell lysis (as in the case of further batch preparation with the already prepared nCoV2019-dsRNA vaccine, the procedure is started from step 7 below).

(2) And centrifuging to remove cell debris.

(3) 293 cells, 1 × 10, were inoculated in 60mm plates (24 well plates)⁶Cells/250 ul/well, cultured overnight to 75% confluence with serum-free RPMI 1640.

(4) Cell lysis supernatant, 250 ul/well, was added.

(5) Culturing at 37 deg.C under 5% C02 condition, observing CPE (cytopathic effect) every day, and allowing CPE to appear in one week.

(6) When more than 50% of the cells are shed, the cells are harvested.

(7) Referring to the above procedure, 293 cells were repeatedly infected with lysed supernatant of diseased 293 cells, expanded with 150cm2 flasks, and recombinant adenovirus (nCoV2019-dsRNA vaccine) was prepared:

A. all viruses were dissolved in culture to make stock solutions to ensure the same total number of viruses infected per vial.

B. 293 cells are cultured by a conventional method, and virus particles l × 10 are inoculated according to a culture area of 150cm2 when the cells grow to 90-100 percent confluence¹⁰For each calculation, 293 cells were infected with adenovirus.

Culturing at 37 deg.C for about 36 hr, observing the amplification of adenovirus, and removing from the surface of culture flask as cytopathic effect progresses, cell rounding and refractive index change.

(8) Purification, concentration detection and storage of recombinant adenovirus (nCoV2019-dsRNA vaccine)

A. The 293 cells were blown and transferred to a centrifuge tube.

B.4 ℃ and centrifugation at 1500g for 20 minutes.

C. The supernatant (Suematant #1) was collected and stored in a centrifuge tube at 4 ℃.

D. The cell pellet was resuspended in 25ml of sterile 100mM Tris-HCI (pH 7.4).

E. The cells were freeze-thawed repeatedly in 37 ℃ water bath-liquid nitrogen for 3 times. Vortex oscillation is carried out after each melting, so that cell lysis is promoted.

F.4 ℃ and 1500g were centrifuged for 20 minutes, and the supernatant (Suematant #2) was collected.

G. Sutemat #1 and Sutemat #2 were mixed.

H. Putting the Bottle-Top Filter Unit into a clean bench, opening the cover, and putting the Pre-Filter Disc on the 0.45micron Filter.

I. The Bottle-TopFilterUnit was connected to a vacuum pump.

J. Vacuum pump was set to vacuum off gear, 100mM Tris-HCI (pH7.4) in the amount of Pre-Filter plus lO ml, and the Pre-Filter was attached to 0.45micron Filter.

K. The cell lysis supernatant was carefully poured into a Bottle-Top Filter Unit.

H. And (4) setting a vacuuln on gear in the vacuum pump, disconnecting the vacuum pump after the collectivessel is filled, and transferring the filtrate into a disinfection bottle. If the Bottle-TopFiller Unit is blocked, another Bottle-Top FiRerUnit is replaced.

L. Benzonase Nuclear (Novagen) was added to the filtrate at a final concentration of 10units Benzonase/ml and incubated at 37 ℃ for 30 min.

M. 5 × Dilution bufferS and 5 × Wash bufferS were diluted with sterile Milli-QH20 to a concentration of 1 ×.

N. equal volumes of filtrate were mixed with 1 × Dilution Buffer.

And O, purifying the adenovirus.

P ready for the article Tubin Assembly and BD Adeno-X Purification Filter 1 × WashBuffer 1 × Elution Buffer, sterile PBS 1 × Formulation Buffer, 5-ml, 20-ml, 60-ml BD Luer-Lok^TMA Tip injector; sterile 15-m1, 50-ml centrifuge tube.

Q. connecting BD Adeno-X Purification Filter and Tubin Assembly.

And R, connecting the Purification system with a vacuum pump, putting one end of the Tubing Assembly A into sterile PBS, slowly opening the vacuum pump, pumping 10-20 ml of sterile PBS to enable the sterile PBS to pass through the BD Adeno-X Purification Filter and the Tubing Assembly, closing the water stop clamp, and closing the vacuum pump to remove bubbles in the BD Adeno-X Purification Filter and the Tubing Assembly.

S. put TubingAssembly tube into virus liquid.

And T, slowly starting a vacuum pump, and controlling the flow rate to be about 20ml/min by using a water stop clamp. After filtration, the TubingAssembly tube was clamped and the vacuum pump tube was removed.

U. unloading tubing assembly from receiving vial and placing 1 × WashBuffer.

V. WashBuffer was filtered through a BDAdeno-xPiperitionFilter at a flow rate of 20 ml/min.

W. unloading Tubin Assembly B, Tubin Assembly A is left for the next elution.

And X. eluting adenovirus, namely connecting a 20ml syringe to the inlet end of a BD Adeno-X Purification Filter, connecting Tubings Assembly to the outlet end at the same time, then placing the outlet end into a centrifuge tube filled with 20m 11 × elute Buffer, extracting l × elute Buffer, wherein the purified adenovirus is in the syringe, and transferring the purified adenovirus into a 50ml centrifuge tube.

Using BD Adeno-X^TMRapid Titer Kit determines adenovirus Titer.

Recombinant adenovirus (nCoV2019-Ad-dsRNA vaccine) deposit: storing at-70 deg.C for use. The prepared recombinant adenovirus (Ad) carries a novel coronavirus (nCoV2019) targeted interference gene (ORF1ab, 3' UTR, S, E, M and N) shRNA sequence, which is called Ad-nCoVdsRNA vaccine, wherein the shRNA can generate dsRNA to generate RNA interference.

Second, example 2

Screening protein expression of novel coronavirus nCoV, namely an antibody generating gene, constructing adenovirus shuttle plasmid pShuttle-nCoV (pShuttle-ORF1ab/N) and recombinant adenovirus skeleton plasmid pAd-nCoV (pAd-ORF1ab/N), packaging into recombinant adenovirus Ad-nCoV (Ad-ORF1ab/N), preparing recombinant adenovirus Ad-nCoV (Ad-ORF1ab/N) which is nontoxic to human bodies, can easily enter epithelial cells of respiratory tracts and can express nCoV-mRNA in the cells in vitro, and further preparing respiratory tract spray inoculation DNA vaccine which can stimulate organisms to generate anti-nCoV antibodies so as to generate specific immunity and is used for emergency prevention of novel coronavirus pneumonia.

The embodiment relates to a preparation method of nCoV vaccine, relates to but is not limited to nCoV ORF1ab, S, E, M, N gene and primer thereof, relates to but is not limited to the same experimental method, cloning vector and other experimental materials, and relates to but is not limited to in vivo synthesis of nCoV protein antigen or antibody.

1. Amplification of ORF1ab or N Gene of nCoV2019

Designing a primer: at present, the chinese center for disease prevention and control recommends the use of primers for the open reading frame 1ab (ORF1ab) and nucleocapsid protein (N) gene regions of nCoV-2019, wherein: open reading frame ORF1 ab: r: CCCTGTGGGTTTTACACTTAA, respectively; f: ACGATTGTGCATCAGCTGA are provided. Nucleocapsid protein N: f: GGGGAACTTCTCCTGCTAGAAT, respectively; r: CAGACATTTTGCTCTCAAGCTG are provided. The company was entrusted with designing primers, introducing XbaI and KpnI cleavage sites at the 5 'and 3' ends, respectively, and performing the procedures of the PCR kit.

2. Construction of adenovirus shuttle plasmid (pShuttle-ORF1ab/N)

(1) Preparing a carrier: the pShuttle plasmid is transformed into DH5 II bacteria, positive clones are picked up, a small amount of LB solution containing ampicillin is used for amplification, the pShuttle plasmid is extracted by PLASMID MINIPREP KIT (QIAGEN), after the restriction enzyme identification is correct, a large amount of Xba I + Kpn I is used for restriction enzyme, a large fragment is separated by gel electrophoresis, and a vector fragment is recovered by GELEXTRACTION (QIAGEN) and dissolved in sterile double distilled water.

(2) Preparation of an insert: the Sw gene fragment amplified in the above step was recovered by PCR PURIFICATION KIT (QIAGEN), and the DNA was eluted with sterilized double distilled water.

(3) And (3) connection reaction: insertion fragment: 5u 1; carrier: 2 ul; solution I: 7 ul; total volume 14u 1. Ligation was performed overnight at 16 ℃ with a ratio of moles of vector fragment to moles of insert of about 1: 3.

(4) 10ul of ligation product was transformed into DH5a competent bacteria.

(5) Resistant clones were picked from the transformation plates and amplified in small amounts with LB solution containing ampicillin.

(6) The plasmid pShuttle-SN was extracted with PLASMIDMINIPREPKIT(QIAGEN).

(7) Xba I and Kpn I were digested to identify pShuttle-ORF1ab/N plasmid.

(8) Sequence analysis of the pShuttle-ORF1ab/N plasmid sequencing primers were used for sequence analysis by Shanghai Boya Biotechnology Ltd.

(9) The DH5a/pShuttle-ORF 1ab/N was amplified in large amounts, and the pShuttle-ORF1ab/N PLASMID was extracted with PLASMID MtDIREP KIT (QIAGEN) for future use.

3. Construction of recombinant adenovirus backbone plasmid (pAd-ORF1ab/N)

(1) The vector is prepared by cutting the DNA transcribed by nCoV2019 with I-Ceu I and PI-Sce I in a large amount, separating the large fragment by GEL electrophoresis, recovering the vector fragment by GEL EXTRACTION (QIAGEN), and dissolving in sterile double distilled water.

(2) Preparation of an insert:

① pShuttle-ORF1ab/N was double digested with I-Ceu I and PI-Sce I, sterile double distilled water 19.5ul, 10 × double diagnostic buffer 3.0ul, pShuttle-Stq DNA (500 ng/ul): 2.0ul, PI-Sce I (1unit/ul): 2.0ul, I-Ceu I (5 units/ul): O.5ul, 10 × BSA: 3.0ul, total volume 30 ul.

② the large fragments were separated by gel electrophoresis.

③ the vector fragment was recovered by GEL EXTRACTION (QIAGEN) and dissolved in double distilled water to obtain ORF1ab/N expression cassette.

(3) And (3) connection reaction:

① vector and insert were mixed with equal volume of ligation solution I and ligated in vitro at 16 ℃ overnight with a molar ratio of vector to insert of about 1: 3.

② the ligation product was cleaved with Swa I to remove the self-cyclized linker.

③ phenol chloroform extraction and ethanol precipitation of DNA.

(4) 10ul of purified DNA was used to transform DH5a competent bacteria.

(5) Resistant clones were picked from the transformation plates and amplified in small amounts with LB solution of ampicillin.

(6) The positive cloning plasmid was extracted with PLASMID MINIPREPKIT (QIAGEN).

(7) And (4) carrying out enzyme digestion to identify positive cloning plasmids.

(8) And (4) PCR identification of positive clone plasmids.

① primers were designed to amplify a fragment of 505 bp.

② reaction system 10 × PCRbuffer 5U1, primers 50pmol each, Taq enzyme (Gibco) 2.0U, and viral DNA 5ng were added to a total volume of 50ul with deionized water.

③ reaction conditions, amplification in PE9600 thermal cycler, pre-denaturation at 95 ℃ for 8 min, cycle parameters of 94 ℃ for 1 min, 55 ℃ for 1 min, 72 ℃ for 60 s, and 30 cycles.

④ analysis of results the results were analyzed by electrophoresis on a 1% agarose gel and observed under an ultraviolet lamp.

(9) DH5a/pAd-ORF1ab/N was amplified in large amounts, and pAd-ORF1ab/N plasmid was extracted with PLASMID MIDIPKEPKIT (QIAGEN) for use.

4. Packaging recombinant adenovirus (Ad-ORF1ab/N)

(1)pAd-S_NLinearization

① contains S_NPlasmid pAd-S of the expression framework_NLinearization with PacI enzyme: disinfecting double distilled water: 20 ul; pAd-S_NDNA (500ng/ul) 10 ul; 10 XPac I digest Buffer:4 ul; 10 XBSA: 4 ul; pac I (1unit/ul) 2ul, total volume 40 ul.

② 37 ℃ for 2 hours, 60ul of TE Buffer (pH8.0) and 100ul of phenol, chloroform, isoamyl alcohol (25: 24: I) were added and vortexed.

③ DNA was precipitated with 1/10 volumes of 3mol/L NaAc (pH5.2) and 2 volumes of absolute ethanol, 1ul glycogen (20mg/m 1).

④ DNA was dissolved in lOul sterile TE (pH8.O) TE.

(2) Transfection of 293 cells

Prepared by Lipofectamin^TM2000 (Inviougen) mediated by linearized pAd-S_N293 cells were transfected and observed for CPE (cytopathic) formation.

① 293 cells, 1 × 106 cells/well, were inoculated in 60mm plates (24 well plates) the day before transfection and cultured overnight to 75% confluence in serum-free RPMI 1640.

② preparation of DNA-Lipofectamin^TM2000 of the complex: a. o.8ug pAd-S diluted with 50ul serum-free RPMll640_NDNA, mix gently. b. Mix Lipofectamin gently before use^TM2000, 2ul Lipofectamin diluted in 50u1 serum-free RPMI1640^TM2000, mix gently and incubate for 5 minutes at room temperature. c. Mixing the diluted Lipofectamin^TM2000 and diluted pAd-S_NDNA, 100ul in total volume, was gently mixed and incubated at room temperature for 20 min.

③ DNA Lipofectamin prepared in the above step^TM2000 complexes were added to 24-well plates and the plates were gently shaken in the front and back directions to allow DNA-Lipofectamin^TM2000 complexes are distributed evenly within the culture wells.

④ was cultured in a C02 incubator at 37 ℃ and 5% C02 for 36 hours.

⑤ presence or absence of cytopathic effect (CPE).

(3) After one week CPE appeared, the cells were gently pipetted and collected into a 15ml centrifuge tube.

(4) Centrifuge at 1500g for 5 minutes at room temperature.

(5) The cells were resuspended in 500ul sterile PBS.

(6) The cells were frozen and thawed in a water bath-liquid nitrogen at 37 ℃ for 3 times. Vortex oscillation is carried out after each melting, which is beneficial to cell lysis.

(7) And centrifuging to remove cell debris.

(8) 293 cells, 1 × 106 cells/250 ul/well were inoculated in 60mm plates (24-well plates) and cultured overnight to 75% confluence in serum-free RPMI 1640.

(9) Cell lysis supernatant, 250 ul/well, was added.

(10) Cultures were incubated at 37 ℃ in 5% C02 conditions and CPE was observed daily and should appear within a week.

(11) When more than 50% of the cells are shed, the cells are harvested.

(12) Referring to the steps (6) to (11), 293 cells were repeatedly infected with the lysis supernatant of the diseased 293 cells, and the recombinant adenovirus was amplified in a 150cm2 culture flask:

① stock solutions were prepared by dissolving all the viruses required in the culture to ensure the same total number of viruses per bottle.

② culturing 293 cells by conventional method, inoculating virus particles l × 10 in culture area of 150cm2 when the cells grow to 90-100% confluence¹⁰For each calculation, 293 cells were infected with adenovirus.

③ 37 deg.C for about 36 hr, during which the amplification of adenovirus is observed, and the cells become round and change in refractive index and begin to fall off from the surface of culture flask as the cytopathic effect progresses.

5. Purification and concentration detection of recombinant adenovirus (Ad-ORF1ab/N)

(1) The 293 cells were blown and transferred to a centrifuge tube.

(2) Centrifuge at 1500g for 20min at 4 ℃.

(3) The supernatant (Suematant #1) was collected and stored in a centrifuge tube at 4 ℃.

(4) The cell pellet was resuspended in 25ml of sterile 100mM Tris-HCI (pH 7.4).

(5) The cells were freeze-thawed repeatedly in 37 ℃ water bath-liquid nitrogen for 3 times. Vortex oscillation is carried out after each melting, so that cell lysis is promoted.

(6) The supernatant (Suematant #2) was collected by centrifugation at 1500g for 20 minutes at 4 ℃.

(7) Sutemat #1 and Sutemat #2 were mixed.

(8) Putting the Bottle-Top Filter Unit into a clean bench, opening the cover, and putting the Pre-Filter Disc on the 0.45micron Filter.

(9) The Bottle-TopFilterUnit was connected to a vacuum pump.

(10) Vacuum pump was set to vacuum off gear, 100mM Tris-HCI (pH7.4) in the amount of Pre-Filter plus lO ml, and the Pre-Filter was attached to 0.45micron Filter.

(11) The cell lysis supernatant was carefully poured into a Bottle-Top Filter Unit.

(12) And (4) placing a vacuuln on gear in the vacuum pump, disconnecting the vacuum pump after the collectivessel is filled, and transferring the filtrate into a disinfection bottle. If the Bottle-TopFiller Unit is blocked, another Bottle-Top FiRerUnit is replaced.

(13) Benzonase nucleic acid (Novagen) was added to the filtrate at a final concentration of 10units Benzonase/ml and incubated at 37 ℃ for 30 min.

(14) 5 × Dilution bufferS and 5 × Wash bufferS were diluted to a concentration of 1 × with sterile Milli-QH 20.

(15) Equal volumes of the filtrate were mixed with 1 × Dilution Buffer.

(16) And (4) purifying the adenovirus.

(17) The preparation of the products, Tubin Assembly and BD Adeno-X Purification Filter, 1 × WashBuffer, 1 × Elution Butter, sterile PBS 1 × Formulation Buffer, 5-ml, 20-ml, 60-ml BD Luer-Lok^TMA Tip injector; sterile 15-m1, 50-ml centrifuge tube.

(18) BD Adeno-X Purification Filter and Tubin Assembly were connected.

(19) Connecting the Purification system with a vacuum pump, placing one end of the Tubing Assembly A into sterile PBS, slowly opening the vacuum pump, pumping 10-20 ml of sterile PBS to enable the sterile PBS to pass through the BD Adeno-X Purification Filter and the Tubing Assembly, closing the water stop clamp, and closing the vacuum pump to remove bubbles in the BD Adeno-X Purification Filter and the Tubing Assembly.

(20) The TubingAssembly tube was placed in the virus fluid.

(21) The vacuum pump is slowly started, and the flow rate is controlled to be about 20ml/min by a water stop clamp. After filtration, the TubingAssembly tube was clamped and the vacuum pump tube was removed.

(22) TubingAssembly was removed from the receiving flask and placed in 1 × WashBuffer.

(23) WashBuffer was filtered through a BDAdeno-xPiperitionFilter at a flow rate of 20 ml/min.

(24) Tubin Assembly B was unloaded and Tubin Assembly A was left for the next elution.

(25) And (3) adenovirus Elution, namely connecting a 20ml syringe to the inlet end of a BD Adeno-X Purification Filter, connecting a Tubings Assembly to the outlet end at the same time, then placing the BD Adeno-X Purification Filter into a centrifuge tube filled with 20m 11 × experiment Buffer, extracting l × experiment Buffer, wherein the purified adenovirus is in the syringe, and transferring the purified adenovirus into a 50ml centrifuge tube.

(26) With BD Adeno-X^TMRapid Titer Kit determines adenovirus Titer.

(27) The adenovirus is stored at-70 ℃.

6. Identification of recombinant adenovirus (Ad-ORF1ab/N) Gene

(1) Enzyme digestion identification

① purification of viral DNA

A.500pl virus solution was digested with 50ul 20mg/ml proteinase K for 60 minutes and extracted 2 times.

b. The DNA was precipitated with 2 volumes of absolute ethanol and 1/10 volumes of sodium acetate (pH 5.2).

c. The DNA was washed 2 times with 70% ethanol; DNA was dissolved in 50ul of sterile double distilled water.

d. 10ul of virus DNA was diluted 20 times, and the OD260, 0D280 and OD260/0D280 values were measured in a Beckmann UV640 UV spectrophotometer to calculate the DNA concentration.

② viral DNA restriction analysis was performed with l-Ceu I/PI-SeeI, HindIIl, XhoI, KpnI and KpnI/XbaI and the cleavage was analyzed by O.8% agarose gel electrophoresis.

(2) Titre determination

① infected cells

a. 293 cells in logarithmic growth phase were digested, resuspended in 10% FBS in RPMI1640, plated in 12-well plates, 1ml per well, containing 5 × 10⁵And (4) cells.

b. Serial IO-fold dilution of virus samples with PBS, dilution gradient 10^-2～10^-5。

c. The diluted virus samples were added to 12-well plates at 10 ul/well.

d.5% C02, at 37 ℃ for 48 hours.

e. The culture medium was aspirated and blown in a clean bench for 5 minutes.

② cell fixation and labeling of primary antibody

a. To each well was added l 00% methanol ice cold, incubated at-20 ℃ for 10 min.

b. The methanol was aspirated off and the plate was washed gently 3 times with lml 1% BSA in PBS.

c. The mouse anti-Hexon antibody was diluted with PBS containing 1% BSA to 1: 1000.

d. the wash was aspirated off, and 1: the mouse anti-Hexon antibody was incubated at 1000 dilution (0.5 ml/well) with shaking at 37 ℃ for 1 hour.

e. The mouse anti-Hexon antibody was aspirated and the plate was washed 3 times with lml 1% BSA in PBS.

f. HRP-labeled rat anti-mouse antibody was diluted with PBS containing 1% BSA to 1: 500.

g. the wash was aspirated off, and 1: rat anti-mouse antibody at 500 dilutions O.5ml/well was incubated at 37 ℃ for 1 hour with shaking.

h. 10 × DAB Substrate was diluted with 1 XStableFileBuffer to 1 × working solution and the solution was equilibrated to room temperature.

i. HRP-labeled rat anti-mouse antibody was aspirated and the plate was gently washed 3 times with lml PBS containing 1% BSA.

③ color development

a. PBS containing 1% BSA was aspirated, DAB working solution was added, 500u 1/well, and incubated at room temperature for 10 minutes.

b. DAB working solution was aspirated and Iml PBS was added to each well.

c. Positively stained cells (black/brown) were counted using a 20-fold objective lens, at least 3 fields were observed, and the average number of positive cells per well was calculated.

d. Infection unit ifu ═ number of positive cells per field × per field of wells ÷ volume of viral fluid (m1) ÷ dilution factor.

(3) Purity determination

① Instrument preparation

a. High performance liquid chromatography (model HPll00, Hewlett packard, USA).

b. The strong anion exchange pre-packed column is Q Sepharose XL (Amersham pharmacia, Sweden), the column matrix is cross-linked agarose, the diameter of a filler is 45-165 mu m, the volume of a column bed (CV >1ml, the column bed is stored in 20% ethanol, the charge is-N + (CH3), and the ion exchange capacity is 0.18-0.26 mmol C1-/ml glue.

② Experimental methods

a. The column was equilibrated with solution A (20mM Tris-HCI, pH7.5), and the OD260 was monitored at a sample rate of 150ul, a flow rate of 1ml/min, a pressure of 26bar, and a temperature of 26 ℃.

b. Rinsing with 4.5CV of solution A.

c. And (3) eluting with 25.5CV 0-70% gradient B solution (1M NaCl +20mM Tris-HCl, pH 7.5).

d. Then eluting with a second gradient of 3CV 70-100% B solution. All the samples and the mobile phase are filtered by a 0.45um filter membrane, and the samples are tested repeatedly.

7. Expression detection of recombinant adenovirus (Ad-ORF1ab/N) gene

(1) Cell culture

The Vcro-E6 cell line is an epithelial cell of the kidney of an African green monkey (ATCC CRL 1586) obtained from ATCC and cultured in 1640 medium containing 10% FBS, 2mM glutamine, 100U/ml penicillin and 10099/ml streptomycin at 37 ℃ under 5% C02 and saturated humidity.

(2) RT-PCR detection

① Vem-E6 cells were seeded in 6-well plates at 2X10⁵Individual cell/well。

② 16h later, Vero-E6 cells were infected with different doses of Ad-ORF1ab or Ad-N (20MOI) for 48 h.

③ collecting the infected cells.

④ Total cellular RNA was extracted with TRlZOL reagent (Invitrogen).

⑤ residual DNA was removed by RQl RNase-free DNase I (Promega).

⑥ mRNA was reverse transcribed into cDNA using AMV reverse transcription system (Invitrogen) 4ug of RNA, 10 × AMVBuffer 2ul, AMV reverse transcriptase (Promega) 20U, RNAsin 20U, dNTP 0.5ul, OligodT (Promega) 30pmol, and the total population was made up to 20ul with deionized water.

⑦ the reaction conditions are mixing, reacting at 37 deg.C for 60 min, and inactivating reverse transcriptase at 95 deg.C for 10 min.

⑧ PCR amplifies the cDNA.

a. ORF1ab or N primer with an amplified fragment of 624bp was designed as described above.

b. The reaction system contained 20ul of the above-mentioned reverse product, 5ul of 10 × PCR Buffer, 30pmol each of primers, and 2.5U of pfuDNA polymerase (Gibco) in a total volume of 50ul with deionized water.

c. Amplification in a PE9600 thermocycler, pre-denaturation at 95 ℃ for 8 min, cycle parameters: 94 ℃ for 1 minute, 55 ℃ for 1 minute, 72 ℃ for 90 seconds, 35 cycles.

d. The gel was analyzed by electrophoresis on 1% agarose gel and observed under UV light.

(3) Western blot identification

① Vero-E6 cells were seeded in 6-well plates at 2X10¹⁵Individual cells/well.

② 16h later, Vero-E6 cells were infected with different doses of Ad-ORF1ab/N (20MOI) for 48 h.

③ the culture supernatant was collected to prepare a protein sample.

④ SDS-PAGE.

⑤ the electrophoresis results were transferred to nitrocellulose membranes at 4 ℃.

⑥ are closed.

⑦ adding primary antibody at a ratio of 1: 1000, fully acting, and washing.

⑧ HRP-conjugated anti-rabbit lgG (1: 1000) was added and washed.

⑨ processed by Lumiglo^TM(NEB) treatment, film sensitization, and observation of experimental results.

8. Immune function detection of recombinant adenovirus (Ad-ORF1ab/N)

(1) Experimental animals: wistar rats are cultured in an SPF-grade animal laboratory, are half male and female, are 6-8 weeks old and have the body weight of 110+10g, and the animal production qualification number is recorded.

(2) Ad-ORF1ab or Ad-N: combining with eukaryotic fermentation technology and adenovirus column chromatography purification technology, self-amplifying Ad-ORF1ab or Ad-N, and centrifuging and purifying CsCl twice to obtain the product with titer of 5x10¹⁰pfu/ml。

(3) nCoV-2019 antibody (IgG) detection System: commercially available from a company that is likely to be produced later, HRP-conjugated anti-rat IgG is available from Santa Cruiz corporation.

(4) Method for preparing experiment

①Ad-S_NThe control group (empty vehicle control group) for nasal drip is anesthetized by intraperitoneal injection of 3% pentobarbital, and then nasal drip is carried out after 5 minutes, wherein O.5ml is used per patient, and the dosage is 1 × 10⁷pfu/dose/rat。

② Ad-ORF1ab/N nose drops, anesthesia is performed as above, 5 minutes later, the nose drops, and the dosage is 1 × 10⁷pfu/dose/rat。

③Ad-S_NTail vein injection control group (empty vehicle control group), dose 1 × 10⁷pfu/dose/rat。

④ Ad-ORF1ab/N group for tail vein injection, the administration is carried out by tail vein injection, the dosage is 1 × 10⁷pfu/dose/rat。

⑤ blank control group, tail vein injection PBS, O.5ml/mouse.

Each of the above groups had 10 animals per group.

(5) Immunization procedure: rats were immunized three times at weeks 0, 1, and 2. Sera were collected at weeks 0, 1, 2, 3, 4.

(6) Detecting the index

① nCoV-2019 specific IgG antibody detection, HRP conjugated anti-rat IgG (using concentration 1: 5000) is used as a secondary antibody, the anti-nCoV-2019 IgG antibody level of rat serum is detected by a human nCoV-2019 antibody (IgG) detection system, each sample is provided with three wells, OD450 is measured by a microplate reader, the reference wavelength is 630, and the titration end point is defined as the natural logarithm of the highest dilution that OD450 is at least 0.16 higher than that of a negative control group.

② immune protection experiment, Vero-E6 was used as a model to determine the effect of animal serum in protecting cells from nCoV-2019, and this part of the experiment was carried out in a level 3 safety (3P) laboratory.

The neutralization titer was defined as the highest serum dilution that completely inhibited vero.e6 cells.

9. Batch preparation of recombinant adenovirus (Ad-nCoV2019)

The recombinant adenovirus Ad-nCoV2019 is prepared in batches according to the experimental method and stored at the temperature of 70 ℃ below zero for later use. Wherein Ad represents a recombinant adenovirus vector, nCoV2019 represents a functional gene capable of expressing a protein, such as ORF1ab or the N gene. Ad-nCoV2019 is also called Ad-nCoVDNA in the invention.

Preparation of bivalent vaccine

The Ad-nCoV2019dsRNA prepared in example 1 and the Ad-nCoV2019DNA prepared in example 2 were reacted with H₂0 as Ad-nCoV2019 dsRNA: Ad-nCoV2019 DNA: h₂Volume ratio of 0 ═ 1: 1: 5-19 to prepare the novel coronavirus pneumonia bivalent vaccine.

Claims (9)

1. A preparation method of a novel coronavirus pneumonia bivalent vaccine is characterized by being prepared from an Ad-nCoV2019dsRNA vaccine and an Ad-nCoV2019DNA vaccine in proportion, wherein the Ad-nCoV2019 dsRNA: Ad-nCoV2019 DNA: h₂Volume ratio of 0 ═ 1: 1: 19; the preparation method of the Ad-nCoV2019dsRNA vaccine comprises the following steps: amplifying a target interfering gene shRNA sequence of nCoV2019, digesting the obtained product and an empty interfering vector pSilencer by BamH I and Hind III to construct an interfering vector pSilencer-shRNA, amplifying the interfering vector pSilencer-shRNA by competent escherichia coli DH5a, identifying that the shRNA is inserted into the interfering vector without errors, digesting the interfering vector pSilencer-shRNA with an empty shuttle vector pDC312 by Hind lII and EcoR I to construct a shuttle vector pDC312-shRNA, co-transfecting HEK293 cells with the shuttle vector and an adenovirus skeleton plasmid pBHGloxA El, carrying out homologous recombination in the cells to obtain a recombinant adenovirus Ad-shRNA, and then digesting the HEK293 cells to obtain the recombinant adenovirus Ad-shRNAAfter multiple amplifications, preparing the dsRNA of Ad-nCoV 2019; the preparation method of the Ad-nCoV2019DNA comprises the following steps: amplifying an antibody expression gene of nCoV2019, carrying out enzyme digestion on the amplified antibody expression gene sequence and an adenovirus shuttle plasmid pShuttle by XbaI and KpnI to construct a recombinant adenovirus shuttle plasmid pShuttle-nCoV2019, amplifying the shuttle plasmid by competent Escherichia coli DH5a, carrying out enzyme digestion by XbaI and KpnI to identify that the nCoV2019 is inserted into an HEK293 cell, carrying out homologous recombination in the HEK293 cell to obtain the recombinant adenovirus Ad-nCoV2019, and carrying out multiple amplification on the recombinant adenovirus by the HEK293 cell to prepare Ad-nCoV2019 DNA.

2. The method for preparing the novel coronavirus pneumonia bivalent vaccine of claim 1, wherein the targeted interfering gene shRNA sequence refers to an RNA sequence with a length of 19nt which is complementary with the siRNA sequence.

3. The method for preparing the novel coronavirus pneumonia bivalent vaccine of claim 1, wherein the target interfering gene shRNA sequence is a template for expressing a hairpin structure, is composed of two most complementary single-stranded DNAs, and can form a DNA double strand with sticky ends of BamH I and Hind III enzyme cutting sites after annealing and complementation.

4. The method for preparing the bivalent vaccine for the novel coronavirus pneumonia according to claim 1, wherein the nCoV2019 refers to a conserved gene or a functional gene sequence of the novel coronavirus; the conserved gene or functional gene sequence comprises ORF1ab, 3' UTR, S, E, M and N gene sequences.

5. The method for preparing the novel bivalent coronavirus pneumonia vaccine as claimed in claim 1, wherein the pShuttle-nCoV2019 refers to a recombinant adenovirus shuttle plasmid containing nCoV 2019; the pAd-nCoV2019 refers to an adenovirus backbone plasmid containing nCoV 2019; the Ad-nCoV2019 refers to a replication-defective recombinant adenovirus vector containing nCoV 2019; the Ad refers to a replication-defective recombinant adenovirus vector.

6. The method for preparing the novel bivalent coronavirus pneumonia vaccine as claimed in claim 1, wherein the Ad-nCoV2019DNA is a recombinant adenovirus carrying an antibody expression gene.

7. The method for preparing the novel bivalent coronavirus pneumonia vaccine as claimed in claim 1, wherein after bivalent vaccination, Ad introduces nCoV2019dsRNA and nCoV2019DNA into cells, wherein the nCoV2019dsRNA immediately generates dsRNA through shRNA thereof, and degrades homologous virus mRNA, and the nCoVDNA expresses protein by encoding mRNA, and then generates antibody to neutralize virus.

8. The method for preparing the novel bivalent coronavirus pneumonia vaccine as claimed in claim 7, wherein the bivalent vaccine is used for neutralizing virus by spraying, Ad introduces nCoV2019dsRNA and nCoV2019DNA into airway epithelial cells, the nCoV2019dsRNA synthesizes dsRNA in the cells, then the homologous nCoV2019 mRNA is specifically induced to degrade, the anti-nCoV 2019 post-transcriptional gene silencing or RNA interference is generated, the nCoV2019DNA expresses protein by encoding mRNA, and then antibody is generated.

9.The method for preparing the novel coronavirus pneumonia bivalent vaccine as claimed in claim 1 or 6, wherein the antibody expression gene refers to a gene capable of expressing mRNA, mRNA expression protein and protein for stimulating the body to produce antibody.