LU101942B1

LU101942B1 - Method for preparing novel coronavirus pneumonia dsrna vaccine

Info

Publication number: LU101942B1
Application number: LU101942A
Authority: LU
Inventors: Weng Binghuan; Li Lanjuan; Yan Kai; Qian Xin; Wu Mengting
Original assignee: Yan Kai; Qian Xin
Priority date: 2020-02-05
Filing date: 2020-07-24
Publication date: 2021-03-05
Also published as: CN111321142A

Abstract

Disclosed is a method for preparing a novel coronavirus pneumonia dsRNA vaccine used in the medical field, amplifying a targeted interference gene shRNA sequence of nCoV2019, and the resulted product and an empty interference vector pSilencer are digested by BamH I and Hind III to construct an interference vector pSilencer-shRNA. After the interference vector is amplified by competent E. coli DH5a and the correctness of shRNA insertion was identified, pSilencer-shRNA and an empty shuttle vector pDC312 are digested by Hind II and EcoR I synchronously, in order to construct the a shuttle vector pDC312-shRNA, such that it was co-transfected with adenovirus backbone plasmid pBHGloxAEl into HEK293 cells, homologously recombined in the cell to obtain recombinant adenovirus Ad-shRNA, and then amplified and purified by HEK293 cells multiple times to prepare an nCoV dsRNA vaccine. By spray inoculation, recombinant adenovirus vector Ad introduces shRNA into respiratory epithelial cells and synthesizes dsRNA in the cells, and then specifically induces the degradation of homologous nCoV mRNA, resulting in anti-nCoV2019 post-transcriptional gene silencing or RNA interference.

Description

METHOD FOR PREPARING NOVEL CORONAVIRUS PNEUMONIA | 01942

DSRNA VACCINE TECHNICAL FIELD

[0001] The disclosure relates to a preparation method of a novel coronavirus pneumonia dsRNA vaccine used in the field of infectious disease prevention and control, and belongs to the technical field of vaccine preparation methods.

BACKGROUND

[0002] Human coronaviruses (HcoV 229E and HcoV OC43) can cause up to 30% of colds. Animal coronaviruses, such as porcine transmissible gastroenteritis coronavirus (TGEV), mouse hepatitis coronavirus (MHV), avian infectious bronchitis coronavirus (IBV) etc., can infect the respiratory tract, gastrointestinal tract, nervous system and liver of the corresponding host, leading to corresponding symptoms. The envelope of the coronavirus is a petal-shaped protrusion, making the coronavirus look like a crown (Latin, corona), and its nucleocapsid is a variable long spiral shape. Coronavirus has a virion particle diameter of 60 nm to 140 nm and a spherical shape. The viral genome is a single-stranded sense RNA of 27 kb to 32 kb, which is the largest of all RNA viral genomes. In 2003, a variant of coronavirus caused the outbreak of severe acute respiratory syndrome, ie. SARS, with a SARS-CoV genome size of 27 to 31 kb, 14 open reading frames (ORF) and 1 s2m motif.

[0003] On January 12, 2020, the World Health Organization named the coronavirus that caused the viral pneumonia outbreak in Wuhan, China as the novel coronavirus, or "nCoV-2019". Shi Zhengli et al. reported that they obtained a substantially identical nCoV-2019 genome from 5 patients. Among them, 79.5% of the sequences were consistent with SARS-CoV. By comparing their conserved 7 non-structural proteins, it was found that nCoV-2019 belongs to Envelope RNA virus of SARSr-CoV. nCoV-2019 contains 5 'untranslated region (UTR), replicase complex (orflab), S gene, E gene, M gene, N gene, 3' UTR and several unknown unstructured open reading frames. For the genetic diagnosis (PCR) of nCoV-2019, the Chinese Center for Disease Control and Prevention currently recommends primers and probe sequences for the open reading frame lab (ORF1lab), nucleoprotein (N) gene regions of Wuhan novel coronavirus nCoV-2019, in which: Target 1 (ORFlab): forward primer (F): CCCTGTGGGTTTTACACTTAA; reverse primer (R): ACGATTGTGCATCAGCTGA; probe (P): 5S'-FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3". Target 2 (N): forward primer (F): GGGGAACTTCTCCTGCTAGAAT; reverse primer (R): 1

CAGACATTTTGCTCTCAAGCTG; fluorescent probe (P): 5S'-FAM-TTGCTGCTGCTTGACAGATT-BHQ1-3'. nCoV-2019 genome-wide sequence and 01942 function analysis (A Novel Coronavirus from Patients with Pneumonia in China, 2019. The New England Journal of Medicine, 2020, January 24) also laid a good foundation for further research of nCoV-2019, but there is currently no more precise information about nCoV-2019.

[0004] With the outbreak and spread of novel coronavirus pneumonia in Wuhan, China, research on therapeutic medicine and biological products has become a top priority. The State-owned Assets Supervision and Administration Commission of the State Council issued an emergency notice on January 22, 2020, requiring central enterprises to actively develop novel coronavirus antisera and vaccines. Richard Hatchett, CEO of the International Epidemiological Prevention Innovation Alliance (CEPI), stated on January 23, 2020 that his institution has invested $ 15 million in the development of the novel coronavirus vaccine. If it goes well, it is expected to start clinical testing in 6 months. On January 26, 2020, Chinese Center for Disease Control stated that the center had begun the development of the novel coronavirus vaccine. At present, the virus has been successfully isolated and seed strains are being screened. On January 26, 2020, Academician Li Lanjuan, State Key Laboratory of Infectious Diseases, Zhejiang University, also stated that three novel coronaviruses have been isolated, which laid the foundation for the next step of vaccine research. Vaccines can be divided into live attenuated vaccines, inactivated vaccines, subunit vaccines, DNA vaccines, recombinant vector vaccines, viral particle-like vaccines and peptide vaccines. The traditional vaccines are mostly dead vaccines, live attenuated vaccines or recombinant subunit vaccines, while the new vaccines are viral nucleic acids encoding antigen proteins or cell vaccines that can elicit specific immune responses. Existing traditional vaccines mainly rely on pathogen antigen proteins to stimulate the body to produce protective antibodies. Existing new vaccines can also stimulate specific cellular immune responses. In view of the fact that the biological characteristics of 2019-nCoV are still unclear and highly infectious, it should be noted that live vaccines are not safe and difficult to prepare. Inactivated vaccines may be reconstituted with wild strains and recovered, and should only be used as an emergency reserve. In contrast, subunit vaccines, DNA vaccines, and peptide vaccines based on modern biotechnology are more safe, practical, and maneuverable. In order to reduce the cost of vaccine transportation, storage, and vaccination, and to facilitate vaccination, several vaccines of different pathogens are often mixed together, called a multi-vaccine, such as the DPT vaccine, a single vaccination can simultaneously prevent diphtheria, tetanus and pertussis. In addition, in order to overcome the shortcomings of poor immune effect caused by strain polymorphism, vaccines against different serotypes of the same pathogen are often mixed together and are called bivalent or multivalent vaccines, such as multivalent HPV vaccines. But 2 can we invent a multivalent vaccine against the novel coronavirus pneumonia that is not related to antigen proteins, antibodies or cellular immunity and is different from existing vaccines? HU101942

[0005] During the extraordinary period of Wuhan pneumonia outbreak, the inventor intends to disclose as soon as possible a method for preparing a novel coronavirus bivalent vaccine based on RNA interference. RNA interference (RNAi) refers to a type of small RNA that can be paired with the target gene to specifically eliminate or turn off the expression of the combined gene. That is, RNAI refers to the efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA). It is reported in the literature that Dr. Guo Shu from Fudan University injected antisense RNA into C. ele-gans at Cornell University in 1995 to try to block the expression of par-1 gene. At the same time, she injected sense RNA into the control nematode, in order to observe the enhanced effect of par-1 gene expression. However, the par-1 gene expression in the control group was not only not enhanced, but was blocked as in the experimental group. This kind of result cannot be explained by traditional antisense RNA technology, but they still sent the research results to Cell magazine faithfully and published them. This suspense caught the attention of Dr. Fire A of the Carnegie Institution of Washington. He used gel electrophoresis to purify sense RNA and antisense RNA, and intentionally mixed the purified sense and antisense RNA together to make dsRNA hybrids, and injected nematodes separately. As a result, it was found that the antisense RNA gene suppression effect after purification was significantly weakened, while dsRNA hybrids efficiently and specifically blocked the expression of homologous mRNA, and its blocking effect exceeded antisense RNA by at least 100 times. This result unexpectedly confirms that dsRNA plays a major role in gene suppression. Hre A refers to this role of dsRNA as RNA interference (RNAi). In 1998, Hre A published the research results in Nature magazine, which quickly set off a wave of research on RNA interference in the world, and confirmed that RNA interference is caused by dsRNA injected into eukaryotic cells, which stimulates the eukaryotic cell defense response and generates the silencing complex induced by dsRNA. mRNAs is degraded with homologous sequences to dsRNA, resulting in gene silencing at the post-transcription level and loss of the ability to express proteins or polypeptides. Further research shows that exogenous genes such as viral genes, artificially transferred genes, transposons, etc. are randomly integrated into the genome of the host cell, and when the host cell is used for transcription, some dsRNA is often produced. The host cell immediately responds to these dsRNA. The endoplasmic enzyme (Dicer) in its cytoplasm cuts the dsRNA into multiple small siRNAs (about 21 to 23 bp) with a specific length and structure. Under the action of RNA helicase in the cells, siRNA melts into a sense strand and an anti-sense strand. The anti-sense siRNA is combined with some enzymes in the body (including endonuclease, exonuclease, helicase, etc.) to form an RNA-induced silencing complex (RISC). RISC specifically binds to the 3 homologous region of the mRNA expressed by the exogenous gene. RISC has the function of nuclease, and cleaves the mRNA at the binding site. The cleavage site is the two ends that 1948 complementarily bind to the antisense strand in the siRNA. The cleaved mRNA is degraded immediately after being cleaved, thereby inducing the host cell to degrade the mRNA. siRNA can not only guide RISC to cleave homologous single-stranded mRNA, but also can be used as a primer to bind to target RNA and synthesize more new dsRNA under the action of RNA-dependent RNA polymerase (RdRP). The newly synthesized dsRNA is then used by Dicer Cleavage generates a large amount of secondary siRNA, which further amplifies the role of RNAI, and finally the target mRNA is completely degraded. RNAI is similar to gene knockout, but it is far simpler and easier to perform than gene knockout, and it is safer. Because it is not a real knockout, it can avoid the serious consequences of gene knockout. This provides a feasible mechanism for the development of the novel coronavirus dsRNA vaccine based on RNA interference.

[0006] It is reported in the literature that the in vitro test of RNAI antiviral replication is easier to succeed, but siRNA is easily degraded by RNase in the serum in vivo, which requires an ideal vector to deliver shRNA to the cell for expression. Adenovirus recombinant vector technology was first applied to RNAI in 2004 (Xia et al.2004). The classic adenovirus packaging system includes HEK293 cells, shuttle plasmids carrying foreign genes, and skeleton plasmids containing the adenovirus genome. The shuttle vector generally has a eukaryotic promoter and multiple cloning sites located downstream of it. The multiple cloning sites of the source gene inserted into the outer is called the foreign gene expression cassette. After the shuttle vector and the backbone plasmid were co-transfected into HEK293 cells, HEK293 cells provided the El protein necessary for virus replication, so that the foreign genes in the shuttle vector were transferred to the backbone plasmid, so that the recombinant adenovirus particles were packed. The most well-researched human adenoviruses include type 2 (Ad2) and type 5 (Ad5). Adenovirus vectors developed by Ad5 have commercialized products for disease treatment and scientific research. They have a broad infection spectrum, are not integrated, safe, easy to operate, high in vitro proliferation titers, large non-essential fragments in the genome, etc., and they are currently the most widely used viral vectors, and when the E3 region is deleted, the immunogenicity is enhanced and may also serve as an immune adjuvant. The most important thing is that the respiratory epithelial cells are rich in coxsackie-adenovirus receptors (CAR). The natural host of Ad5 adenovirus is human respiratory epithelial cells. Therefore, the replication-defective recombinant adenoviral vector can efficiently infect respiratory epithelial cells. Immunization (spray or nasal drops) of the upper respiratory tract provides the possibility. In addition, the immunogen expressed by the coxsackie-adenovirus vectors are basically 4 maintained in the natural conformation of the immunogen after being expressed, processed, folded, modified, and presented by the host cell, which is convenient for simulating the immune 01942 response in a natural state, and the novel coronavirus mainly infects through the respiratory tract. Coxsackie-adenovirus vector vaccine can be conveniently made into oral or upper respiratory tract spray. Inhalation inhalation is not only convenient, but also greatly reduces the cost of use. If an adenovirus vector vaccine can be used to induce an effective mucosal immune response, it will have broad application prospects.

[0007] Nebulized inhalation vaccination is to put the medicine or vaccine into a specific aerosol generator, inhale the medicine or vaccine into the respiratory tract, stimulate the mucosa of the respiratory tract to produce mucosal immunity and further enter the alveoli to have reaction. Because the lung has a huge alveolar surface area, abundant capillaries and a very small transport distance, the inoculated medicine or vaccines can quickly exert their effects after being absorbed by the lungs. Foreign research on nebulized inhalation therapy can be traced back to the 1950s. Riker laboratory developed and launched the first pressure metered dose inhaler in 1956, Medihaler-Epi™ containing epinephrine, and Medihaler-Iso™ containing isoproterenol. Aerosol immunization, which directly vaccinates the respiratory mucosa, not only provides a physiological and immunological advantage, but vaccination on this route also provides potential logistical advantages because it does not require trained personnel. Therefore, the aerosol immunization method is an immunization method worthy of steady promotion. In modern times, people have paid great attention to aerosol inhalation treatment, and more and more aerosol immune medicine have been developed. In terms of human aerosol immunity research, the aerosol vaccination of measles vaccine is the most studied and has been confirmed to have definite efficacy. With the continuous progress of science and technology, nebulization vaccination will become more and more perfect and become a routine immunotherapy approach. Nebulization inhalation inoculation or medicine delivery is always inseparable from the nebulizer, compressed air nebulizer requires an air compressor to drive the nebulizer. The compressed high-speed airflow passes through the Venturi tube, creating a Venturi effect, which creates a negative pressure environment around the nozzle, so that the medicine in the liquid cup is brought out by the high-speed airflow, and the special nozzle hits the baffle at high speed and breaks into droplets with Sum diameter. At present, compressed air nebulizers are widely used in clinics, and can be used for inhalation treatment and vaccination of medicine such as measles, influenza and BCG vaccines.

[0008] In sum, although methods for preparing antigenic vaccines based on pathogen antigens and existing vaccines based on antigenic vaccination to produce immune antibodies to clear pathogens have been widely used, there is no literature or application of the methods of dsRNA vaccines prepared based on conserved genomes and dsRNA vaccine prepared based on dsRNA 01942 vaccination to generate gene silencing complex to degrade pathogen homologous mRNA.

SUMMARY

[0009] The purpose of the present disclosure is to solve the shortcomings in the prior art that there is no literature report and application about the dsRNA vaccine preparation method based on the conservative genome of the pathogen and the dsRNA vaccine preparation method based on the dsRNA vaccination to generate the gene silencing complex so that the pathogen homologous mRNA is degraded. Provided is a method for preparing a novel coronavirus pneumonia dsRNA vaccine that is different from the traditional process.

[0010] The purpose of the present disclosure may be achieved by amplifying the shRNA sequence of the targeted interference gene of nCoV2019, and the amplified shRNA sequence is digested with the empty interference vector pSilencer4.1. CMV. neo by BamH I and Hind III to construct the interference vector pSilencer-shRNA, the interference vector may be amplified by competent E. coli DH5Sa and after the identified shRNA may be inserted without error, it may be digested with the empty shuttle vector pDC312 by Hind II and EcoR I to construct the shuttle vector pDC312-shRNA, the shuttle vector and the adenovirus backbone plasmid pBHGloxAEI may be co-transfected into HEK293 cells, and homologous recombination may be carried out in the cells to obtain recombinant adenovirus Ad-shRNA, which may be then amplified by HEK293 cells multiple times to prepare Ad-nCoVdsRNA vaccine of recombinant adenovirus vector.

[0011] Further, the targeted interference gene shRNA sequence refers to the relatively conserved nCoV2019 functional genome, and currently refers to the ORFlab, 3'UTR, S, E, M, and N gene sequences.

[0012] Further, the targeted interference gene shRNA refers to a siRNA sequence with a length of 19 nt obtained by using shRNA online software, and a conservative sequence complementary thereto is selected as a target site for interference.

[0013] Further, the targeted interference gene shRNA is a shRNA template expressing a hairpin structure, and each template is composed of two mostly complementary single-stranded DNAs, which can form a double-stranded DNA with cleavage site sticky ends of BamH I and Hind III after annealing and complementation.

[0014] Further, the Ad-nCoVdsRNA vaccine refers to that the shRNA recombinant 6 adenovirus vector enters the respiratory tract or digestive tract epithelial cells, the shRNA can synthesize dsRNA in the cells, and the synthesized dsRNA can specifically degrade mRNA with 01942 homologous sequences, so that it loses the ability to express proteins or polypeptides. The Ad refers to a replication-defective recombinant adenovirus vector; and the nCoV2019 refers to a targeted interference sequence of a conserved gene or a functional gene of a novel coronavirus.

[0015] The beneficial effects of the present disclosure are: the present disclosure has the advantages of quick effect, good effect, safe use, convenient inoculation and the like. First of all, the present disclosure innovates the mechanism and concept of vaccine preparation. Traditionally, vaccines may be antigens, or they can be converted into antigens even though they may be not direct antigens. For example, DNA vaccines produce protein antigens by encoding mRNA, so existing vaccines may be usually antigenic vaccines, they usually stimulate the body to produce antibodies by vaccination, which play an immune role in response to antigen and antibody. However, the present disclosure is to prepare dsRNA vaccines based on conserved genomes or functional genes of pathogens, which play an antiviral effect through RNA interference, and no antibody is involved in the whole process. More importantly, the present disclosure can quickly produce antiviral effects after inoculation. When the present disclosure is spray-inoculated, the recombinant adenoviral vector introduces the vaccine into the respiratory tract infection cells. The shRNA in the vaccine immediately generates dsRNA, which in turn activates the nuclease, instantly degrades homologous viral mRNA, to quickly makes the virus less pathogenic. The existing vaccines have to wait for antibodies to produce immunity, and the production of this viral antibody usually takes 2 to 3 weeks. Therefore, compared with the prior art, the present disclosure has a prominent effect of emergency prevention. In addition, the vector of the present disclosure is a replication-defective adenovirus, which has the advantages of safe use, stable expression, and easy operation. It can effectively infect respiratory epithelial cells and provides a basis for immune spray inoculation through the oral cavity and upper respiratory tract. It is suitable for the prevention of novel coronavirus pneumonia in theory.

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIG. 1 is a schematic diagram of the action of a novel coronavirus pneumonia dsRNA vaccine provided by the present disclosure.

[0017] In FIG. 1, recombinant adenovirus vectors Ad1, viral DNA2, shRNA3, dsRNA4, RISC 5, antisense siRNA and foreign gene expression mRNA conjugate 6, degraded foreign gene 7.

7

DESCRIPTION OF THE EMBODIMENTS LU101942

[0018] The specific implementation method of the present disclosure will be described in detail below by referring to FIG. 1.

[0019] 1. Selection of novel coronavirus RNAI target sites and construction of shRNA interference vector:

[0020] (1) Selecting RNAI target sites and designing siRNA expression template: According to the novel coronavirus ORFlab, 3'UTR, S, E, M, N gene sequences that have been sequenced, Ambion's shRNA online design software (http://www.ambion.com/techlib/misc/siRNAtools.html) can obtain multiple siRNA candidate sequences with a length of 19 nt. According to the Tm value of RNA binding and the result of specific alignment, the siRNA sequence is preferred, and its complementary genomic region may be selected as the target site of interference, combined with the polyclonal restriction site of the pSilencer4.1.CMV.neo interference vector, a shRNA template that can express the hairpin structure may be designed, each template consists of two single-stranded DNA with 55bp, which may be mostly complementary. After annealing and complementation, it can form a double-stranded DNA with sticky ends of BamH I and Hind III cleavage sites, which is used to connect with the linearized interference vector pSilencer4.1.CMV. neo.

[0021] (2) Constructing shRNA expression vector: The above oligonucleotide strand may be annealed and complemented, and connected with linearized shRNA expression vector pSilencer4.1.CMV.neo to construct shRNA expression plasmid, and transformed into competent cell DH5a. The specific methods of annealing complementation and vector connection may be as follows:

[0022] D Annealing oligo DNA: the synthesized oligonucleotide may be dissolved into 100 uM with ddH20, and then each of the complementary single strands may be taken by 5 uL and mixed, then the 6 oligoDNA mixtures may be placed in a 98 °C water bath and heated for 5 min, then the water bath switch is closed, to cool naturally to room temperature to form double-stranded DNA. The annealing system is as follows: 100 pM positive strand oligonucleotide with 5 uL; 100 uM negative strand oligonucleotide with 5 pL; 10xPCR buffer with 2 pL; ddH20 with 8 uL; total volume with 20 pL .

[0023] © ligating the vectors: The synthesized double-stranded DNA may be further diluted to 10 nM, and ligated at 16 °C for 30 min. The enzyme ligation system is as follows: pSilencer4.1.CMV.neo with 4 pL; Sxligation buffer with 2 pL; ds oligo (10 nM) with 4 pL; T4 DNA ligase (1U/uL) with 1 uL; ddH2O with 9 pL; total volume with 20 pL. pSilencer-ORF lab, 8 pSilencer-3'UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N vectors may be LU101942 constructed.

[0024] ©) Identifying the vectors: The ligation product can be transformed into E. coli competent cell DH5a, and 6 clones from each recombinant vector plate may be selected for sequencing and identifying. After confirming that the insert may be correct, it is saved for future use.

[0025] 2. The effect identification of shRNA interference vector

[0026] It may be identified by constructing a fluorescent tag vector and co-transfecting 293T cells with shRNA interference vector.

[0027] (1) Constructing ORF1lab, 3'UTR, S, E, M, N gene fluorescent tag vectors;

[0028] D Designing ORFlab, 3'UTR, S, E, M, N gene primers: according to the genome sequence of the novel coronavirus (nCoV-2019) released by China National Genomic Science Data Center (NGDC) (sequence numbers may be GWHABKF00000000, GWHABKG00000000, GWHABKH00000000, GWHABKI00000000, GWHABKJ00000000), the downstream and downstream primers required for the design of conservative regions may be selected, or the required primers may be designed based on the gene sequencing results of the new and emerging coronavirus strains. The present disclosure takes the nCoV-2019 ORFlab, 3J'UTR, S, E, M, N genes as an example, referring to the online primer design software, and according to different vectors, cleavage sites and identification needs, the biological company may be entrusted to design the required primers according to the requirements. The start code may be added at the 5' end of the upstream primer. To clone the amplified product into pEGFP-N1, a homology arm may be added for homologous recombination with the vector at the 5' end of the primer.

[0029] @ Amplifying ORFlab, 3'UTR, S, E, M, N genes: The gene amplification reaction system and reaction conditions may be carried out according to the kits provided by Shanghai Shengong Company. The gene amplification products may be recovered and purified for use.

[0030] © Linearizating pEGFP-N1 vector: The DHS5a strain containing pEGFP-N1 plasmid may be recovered, the plasmid may be extracted according to the kits or literature, and then enzyme digestion may be performed after measuring the concentration. The enzyme digestion system is as follows: 10xM Buffer with SuL; plasmid DNA with 20uL; Hind IIT with 2 pL; ddH20 with 23 pL; total volume with 50 pL. The mixed solution may be mixed and placed in a 37 °C water bath for 2 h, digested with 0.8% agarose gel electrophoresis, and the linearized 9 vector can be recovered for use. LU101942

[0031] @ Constructing pEGFP-ORFlab, pEGFP-3'UTR, pEGFP-S, pEGFP-E, pEGFP-M, pEGFP-N vectors: By using the homologous recombination kit of Kingsray Company, ligation may be made, the system and conditions may be as follows: linear Carrier (100-200ng/uL) with 6 uL; purified PCR product with 8 uL; 10xCloneEZ buffer with 2 uL; CloneEZ Enzyme with 2 uL; ddH20 with 2 pL; total volume with 20 uL. After the mixture is prepared, it may be gently mixed and kept at 25 °C for 30 minutes, and then kept on ice for 5 minutes. After the ligation is completed, it can be stored at -20 °C for later use or converted immediately.

[0032] (2) Co-transfection method: the interference vectors pSilencer-ORFlab, pSilencer-3'UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N and the corresponding fluorescent tag vectors pEGFP-ORFlab, pEGFP-3 "UTR, pEGFP-S, pEGFP-E, pEGFP-M, pEGFP-N may be co-transfected into 293T cells. The mass ratio of the interference vector to the tag vector may be 1: 2, and unrelated interference wells and non-interference wells may be established as controls. The fusion expression of GFP protein in the cells may be observed after 48h transfection, and the interference effect may be evaluated according to the fluorescence intensity.

[0033] (3) Flow cytometry after co-transfection: To quantitatively analyze the interference effects of different interference vectors, flow cytometry may be used to detect the test cells, and analyze the proportion of cells expressing fluorescent protein in the total number of cells. The operation steps of the flow cytometry method may be as follows:

[0034] © Digesting the test cells from the cell plate with trypsin and pipetting into single cells, transferring to a 1.5mL centrifuge tube.

[0035] © Centrifuging the cell suspension cells at 40C 300Xg for 10min, discarding the supernatant, and washing by adding cold PBS.

[0036] (3 After repeating step (2) 3 times, fully suspending the cells, and blowing the cells into a single.

[0037] @ Taking an appropriate number of cells for on-line detection. The detection method can adopt Guavaexpress Plus method, and the number of cells passed per second is kept below

800.

[0038] © After saving the test data, by using Flowjo flow analysis software, analyzing and counting the results.

[0039] (4) Westernbolt analysis of ORFlab, 3'UTR, S, E, M, N proteins: LU101942

[0040] © Cell collection and lysis: RIPA tissue lysate may be used to lyse cells, the specific steps may be as follows:

[0041] a. Washing the cells with PBS once for use; mixing the lysate with the ratio of 10 uL of PMSF and 1 mL of RIPA, and using it now;

[0042] b. Adding 150-250 uL of lysate to each well, and pipetting several times to make the lysate fully contact with the cells;

[0043] c. Centrifuging the lysed sample at 12000xg for 3.5 minutes, and taking the supernatant for use.

[0044] @ SDS-PAGE electrophoresis of protein samples:

[0045] The sample may be added to an equal volume of 2xSDS loading buffer, boiled in boiling water for 5min, then ice bathed for 2min, 12000xg, 10min. The preparation of SDS-PAGE gel may be as follows:

[0046] a. According to the use method of the vertical electrophoresis device, washing and drying the glass plate and starting assembly to ensure good sealing; preparing the separation gel first.

[0047] b. Preparing 10ml of 15% separation gel according to the following ingredients: 30% acrylamide mixed solution with 5.0 mL; 1.5M Tris (pH8.8) with 2.5 mL; 10% ammonium persulfate with 0.1 mL; 10% SDS with 0.1 mL; TEMED with 0.004 mL; ddH20 with 2.3 mL; finally, adding TEMED; after the separation gel is prepared, mixing it quickly, then using a pipette to inject the prepared gel solution into the gap at one end of the glass plate; when the glue surface is about 3 cm away from the edge of the glass plate, stopping adding liquid; adding ddH20 to the top of the gel; when the gel is completely coagulated, pouring off the water and carefully absorbing the residual liquid on the gel with filter paper.

[0048] c. Preparing the concentrated gel as 2ml of 5% concentrated according to the following ingredients: 30% acrylamide mixed solution with 0.33 mL; 1.0M Tris (pH6.8) with

0.25 mL; 10% ammonium persulfate with 0.02 mL ; 10% SDS with 0.02 mL; TEMED with

0.002 mL; H20 with 1.4 mL. After the concentrated gel is prepared, it is mixed quickly, and TEMED is added at the end, a pipette may be used to inject the prepared gel solution into the gap at one end of the glass plate, and after insertion, a comb may be gently insert to prevent air bubbles flowing out and excess gel may be removed.

[0049] d. Pulling out the comb after the concentrated gel sets.

11

[0050] e. Removing the gel from the plastic rack and installing it in the bath of electric 01942 swimwear; Adding 1xTris-Glycine electrophoresis solution out first, then inside, and finally taking samples with 20 per well.

[0051] f. Concentrating gel electrophoresis using a voltage of 80V. After the sample enters the separation gel, the voltage may be adjusted to 120V until the end of electrophoresis (bromophenol blue enters the electrophoresis solution).

[0052] g. Carefully removing the gel, and using Coomassie Brilliant Blue R-250 staining solution to perform staining on a horizontal shaker. After the decolorizing solution is replaced, it may be decolorized on the horizontal shaker overnight, during which the decolorizing solution is replaced until that a clear band appearing on the gel is observed.

[0053] © Western blot detection.

[0054] a. Transferring membrane: the unstained gel may be put in transfer membrane buffer, then the filter paper and PVDF membrane may be cut to the size, but slightly smaller, of the gel.

After immersing the PVDF membrane in anhydrous methanol for a short time and then putting it into the membrane buffer, the filter paper may be directly soaked in the membrane buffer. The film transfer device may be assembled (from bottom to top): filter paper (3 layers), PVDF membrane (1 layer), gel, filter paper (3 layers), after assembly, it may be put into the electrophoresis jig and placed in the transfer tank, with transferring for 120min under 150mA constant current.

[0055] b. Blocking: the membrane may be taken out, and put in 10mL of 2.5% PBST-diluted skim milk, then shaked on a shaker for 1h.

[0056] c. Primary antibody binding: the membrane may be put into 10mL of primary antibody (anti-GFP monoclonal antibody, anti-IB-actin monoclonal antibody) diluted in 2.5 skim milk, then shaked on a shaker for 1h.

[0057] d. Washing: it may be washed 3 times with PBST.

[0058] e. Secondary antibody binding: the PVDF membrane may be put into the secondary antibody diluted 1: 800 and shaked on a shaker for 1h.

[0059] f. Washing: it may be washed 3 times with PBST.

[0060] g. Color developing: the film may be developed using Tiangen HRP-DAB substrate color development kit.

[0061] h. Washing with deionized water to stop color developing and observing the result.

[0062] (5) Detection of relative expression levels of ORFlab, 3'UTR, S, E, M, N in 12 transfected cells. LU101942

[0063] a. Detecting the relative expression of ORFlab, 3'UTR, S, E, M, N genes in transfected cells, quantitatively evaluating the interference effect of different interference vectors, and using relative fluorescence quantitative RT-PCR detection method.

[0064] b. When performing relative quantitative detection on the target gene transcription of the sample, according to the standard curve equation respectively, the target gene and the copy number of the B-actin internal reference gene being converted from the CT value. The relative expression level of viral gene mRNA may be corrected by B-actin internal reference gene (target gene copy number / B-actin copy number).

[0065] 3. Construction of a recombinant adenovirus shuttle vector (pDC312-2019nCoV) that interferes with 2019nCoV replication

[0066] (1) Transfer of shRNA expression cassette in shRNA interference vector

[0067] shRNA interference vectors (pSilencer-ORFlab, pSilencer-3'UTR, pSilencer-S, pSilencer-E, pSilencer-M, pSilencer-N) and pDC312 or pShuttle adenovirus shuttle vectors may be conventionally extracted, while using the restriction enzyme Hind III to have a digestion with EcoR I, the shRNA expression cassette nay be cut in the shRNA interference vector, and the pDC312 vector may be linearized.

[0068] The digestion system is as follows: 10xM Buffer with Sul; Plasmid DNA with 20uL; Hind III with 2uL; EcoR I with 2uL; ddH20 with 2luL; total volume with 50uL.

[0069] The linearized vector and shRNA expression cassette may be recovered and ligated as follows: pDC312 / pShuttle with 2uL; shRNA expression cassette with 4uL; 5xligation buffer with 4uL; T4 DNA ligase (1U / uL) with luL; ddH20 with 9uL; total volume with 20 uL.

[0070] The ligation product may be transformed into E. coli competent cell DH5a. After overnight cultivation, 4 clones may be picked for sequencing and identification. After confirming that the insert is correct, the recombinant vector may be named pDC312-nCoV2019 (pDC312-ORF1ab, pDC312-3'UTR, pDC312 -S, pDC312-E, pDC312-M, pDC312-N), and they may be saved for future use.

[0071] (2) Design of primers for identification of recombinant adenovirus shuttle vector (pDC312-nCoV2019)

[0072] Based on the Ad5 sequence published by Genbank and the nCoV-2019 genome sequence published by China National Genomics Science Data Center, primers designed by Shanghai Biotech may be used to amplify 880bp fragments of ORFlab, 3'UTR, S, E, M, N regions (such as ORFIab: F: CCCTGTGGGTTTTACACTTAA; R: 13

ACGATTGTGCATCAGCTGA. N: F: GGGGAACTTCTCCTGCTAGAAT; R: CAGACATTTTGCTCTCAAGCTG), and used for identification of recombinant adenovirus 97942 (pDC312 / pShuttle).

[0073] (3) Packaging and amplification of recombinant adenovirus (Ad-2019nCoV)

[0074] In the title, Ad stands for recombinant adenovirus vector. Like 2019 nCoV or nCoV2019, it stands for conserved or functional gene loci of novel coronavirus that can be used for targeted interference in Ad, such as ORFlab, 3'UTR, S, E, M, N. The disclosure adopts Admax's dual plasmid transfection system for packaging of recombinant adenovirus, and conventionally transfects HEK293 cells. The transfection ratio of adenovirus backbone vector pBHGIoxAEI and adenovirus recombinant shuttle vector (pDC312-2019nCoV) is 1:3 by mass. The cytopathic condition may be observed every day after transfection, and after about 8 days when 80% of the cells appear CPE, they may be ready to be poisoned. The cell bottle / culture plate may be freezed and thawed to be poisoned 3 times to rupture and disintegrate the cells and fully release the virus in the cells. The freeze-thaw solution may be centrifuged and the virus-containing supernatant may be collected. After centrifugation at 3000 xg at 4 °C for 10 min, the supernatant may be taken and stored for later use. The harvested first-generation recombinant adenovirus (Ad-2019nCoV) may be repeatedly infected with HEK293 cells to proliferate the virus, and the third-generation virus may be extracted. DNA may be extracted using a DNA extraction kit for PCR identification.

[0075] (4) Ad-2019nCoV titer determination

[0076] The recombinant adenovirus titer may be determined using the rapid adenovirus infectious titer (TCIDso) detection kit. Through A series of diluted virus samples may be used to infect 293 cells, each dilution may be infected with 8 cell wells. After about 10 days of culture, the presence of virus-induced cell lesions in each cell well may be determined under the microscope. The number of holes in the spot may calculate the adenovirus titer.

[0077] 4. Verification of Ad-2019nCoV (dsRNA) interference with 2019nCoV replication

[0078] Din vitro verification: In order to study the interference effect of recombinant adenovirus Ad-2019nCoV on 2019nCoV replication, Ad-nCoV2019 may be inoculated into HEK293 cells cultured in 12-well plates with 10, 50, 100, 250, and 500 MOI, while using the control virus Ad-CMV only containing the CMV promoter without including the shRNA template sequence may be inoculated as a control virus. 24h after infection, the 2019nCoV strain (clinical isolation) may be inoculated, and the cells inoculated with only 2019nCoV may be used as positive control cells. The cells may be collected and tested after 2019nCoV infection 14 for 48 hours. The relative expression levels of 2019nCoV genes (ORFlab, 3'UTR, S, E, M, N) in each group of cells may be tested to evaluate the interference effect. HU101942

[0079] @Animal test:

[0080] A. Experimental animals: Wistar rats may be cultivated in SPF-level animal laboratories, they may be half male and female, 6-8 weeks old, and weighing 110 + 10g. Animal production certificate number may be recorded.

[0081] B. Ad-nCoV2019 (dsRNA) preparation: combining eukaryotic fermentation technology and adenovirus column chromatography purification technology, Ad-nCoV2019 (dsRNA) may be self-amplified, CsCl may be twice centrifuged and purified, and titer is 5x1010pfu / ml.

[0082] C. Formulate experimental methods

[0083] a. Ad-nCoV2019 (dsRNA) nasal drip control group (empty vector control group): it may be anesthetized with 3% pentobarbital intraperitoneal injection, and nasal dripped after 5 minutes, at 0.5ml / body and dose of 1 x 107pfu / dose / rat.

[0084] b. Ad-nCoV2019 (dsRNA) nasal drops group: it may be anesthetized as above, and nasal dropped 5 minutes later at dose of 1 x 107pfu / dose / rat.

[0085] c. Ad-nCoV2019 (dsRNA) injected into the tail vein control group (empty vector control group) at a dose of 1 x 107 pfu / dose / rat.

[0086] d. Ad-nCoV2019 (dsRNA) tail vein injection group: it is given by tail vein injection, the dose is 1 x 107pfu / dose / rat.

[0087] e. Blank control group: tail vein injection of PBS at 0.5m1 / mouse.

[0088] f. Feeding method: The rats in the above groups may be equally exposed to the secretions of the diagnosed nCoV2019 patients or the environment containing nCoV2019 strains.

[0089] Each of the above groups may have 10 animals.

[0090] g. Observation and sampling: the incidence of rats may be observed, and nCoV2019 of samples may be detected at weeks 0, 1, 2, 3, and 4.

[0091] h. nCoV2019 diagnosis: by referring to the current commercially available PCR kit, detection and diagnosis may be performed.

[0092] i. Judging the effect of Ad-nCoV2019 (dsRNA) interference with nCoV2019 replication based on the above experimental results.

[0093] j. Naming: If the above results prove that Ad-nCoV2019 (dsRNA) can effectively interfere with nCoV2019 replication, then it may name Ad-nCoV2019 (dsRNA) as "novel coronavirus dsRNA vaccine" or "nCoV2019-dsRNA vaccine". HU101942

[0094] 5. Batch preparation of nCoV2019-dsRNA vaccine

[0095] (1) Taking the recombinant adenovirus prepared above to package HEK293 cells, freeze and thaw the cells 3 times in a 37 °C water bath-liquid nitrogen. After each thawing, vortex oscillation may be beneficial to cell lysis (if the prepared nCoV2019-dsRNA vaccine is used for further batch preparation, the operation may start from step 7 below).

[0096] (2) Centrifuging to remove cell debris.

[0097] (3) Inoculating 293 cells in a 60mm culture plate (24-well plate) at 1 * 106 cells / 250ul / well, and culturing overnight with serum-free RPMI 1640 to 75% fusion.

[0098] (4) Adding cell lysis supernatant at 250ul / well.

[0099] (5) Cultivating at 37 °C and 5% CO2, then observing CPE (cytopathiceffect) daily, CPE may appear within one week.

[0100] (6) Harvesting the cells when more than 50% of the cells are isshed, .

[0101] (7) Referring to the above steps, repeatedly infecting 293 cells with the lysed supernatant of the diseased 293 cells, expanding the cells with a 150cm2 culture flask, and preparing recombinant adenovirus (nCoV2019-dsRNA vaccine):

[0102] A. Dissolving all viruses into the culture solution to make a storage solution to ensure that the total number of infected viruses per bottle is the same.

[0103] B. Culturing 293 cells by conventional methods. When they reached 90% to 100% confluence, 1 * 1010 virus particles may be inoculated according to the culture area of 150cm2, and 293 cells may be infected with adenovirus.

[0104] C. Incubating for about 36 hours at 37 °C. During this period, the expansion of adenovirus can be observed. With the development of cytopathy, the cells may become round and the refractive index can change, and they may begin to fall off the surface of the culture flask.

[0105] (8) Purification, concentration detection and storage of recombinant adenovirus (nCoV2019-dsRNA vaccine)

[0106] A. Pipetting 293 cells and transfering the cells to a centrifuge tube.

[0107] B. Centrifuging at 1500g for 20 minutes at 4 °C.

[0108] C. Collecting the supernatant (Supematant # 1) and storing in a centrifuge tube at 4 °C.

[0109] D. Using 2 Resuspend the cell pellet in 5 ml sterile 100 mM Tris-HCI (pH 7.4).

16

[0110] E. Repeatedly freezing and thawing the cells 3 times in a 37 °C water bath-liquid 04942 nitrogen. After each thawing, it may be vortexed to promote cell lysis.

[0111] F Centrifuging at 1500g for 20 minutes at 4 °C, and collecting the supernatant (Supematant # 2).

[0112] G Mixing Supematant # 1 and Supematant # 2.

[0113] H. Putting the Bottle-Top Filter Unit into the ultra-clean table, opening the cover, and putting the Pre-filter Disc on the 0.45 micron filter.

[0114] I. Connecting Bottle-TopFilterUnit to vacuum pump.

[0115] J. Setting the vacuum pump to vacuum off, adding 10 ml of 100 mM Tris-HCI (pH7.4) to the Pre-Filter, so that the Pre-Filter and the 0.45 micron filter may be in close contact.

[0116] K. Carefully pouring the cell lysate supernatant into the Bottle-Top Filter Unit.

[0117] H. Setting the vacuum pump to vacuum on. When the collection vessel is full, the vacuum pump may be disconnected and the filtered solution may be transferred to the disinfection bottle. If the Bottle-TopFilter Unit is blocked, it may change to another Bottle-Top FiRerUnit.

[0118] L. Adding Benzonase Nuclease (Novagen) with a final concentration of 10 units Benzonase / ml to the filtrate and incubate at 37 °C for 30 min.

[0119] M. Diluting 5 x Dilution buffers and 5 x Wash bufferS to 1 x concentration with sterile Milli-QH20.

[0120] N. Mixing equal volume of filtrate and 1 x Dilution Buffer.

[0121] O. Purifying adenovirus.

[0122] P. Preparing the following items: Tubing Assembly and BD Adeno-X Purification Filter: 1 x WashBuffer, 1 x Elution Butter; sterile PBS: 1 x Formulation Buffer; 5-ml, 20-ml, 60-ml BD Luer-LokTM Tip Syringe; sterile 15-ml, 50-ml centrifuge tubes.

[0123] Q. Connecting BD Adeno-X Purification Filter and Tubing Assembly.

[0124] R. Connecting the purification system to a vacuum pump, putting one end of Tubing Assembly A into sterile PBS, slowly turning on the vacuum pump, drawing 10-20 ml of sterile PBS to pass it through BD Adeno-X Purification Filter and Tubing Assembly, and closing the water stop clamp, turning off the vacuum pump to remove air bubbles in BD Adeno-x Purification Filter and Tubing Assembly.

[0125] S. Putting the Tubing Assembly tube into the virus solution.

[0126] T. Slowly turning on the vacuum pump, and using a water stopper to control the flow 17 rate to about 20ml / min. After filtration, the Tubing Assembly tube may be clamped to remove the vacuum pump tube. HU101942

[0127] U. Removing TubingAssembly from the receiving bottle and putting in 1 x WashBuffer.

[0128] V. Filtering the WashBuffer with BDAdeno-xPurificationFilter at a flow rate of 20ml / min.

[0129] W. Removing Tubing Assembly B. Tubing Assembly A may be reserved for elution in the next step.

[0130] X. Eluting adenovirus: A 20ml syringe may be connected to the inlet end of BD Adeno-X Purification Filter. At the same time, the Tubing Assembly may be connected to the outlet end, and then put into a centrifuge tube containing 20m1 1 x Elution Buffer. 1 x Elution Buffer may be extracted, the purified adenovirus may be in the syringe, and transferred to a 50ml centrifuge tube.

[0131] Y. Determining the adenovirus titer with BD Adeno-XTM Rapid Titer Kit.

[0132] Z. Storing the recombinant adenovirus (nCoV2019-Ad-dsRNA vaccine): It mahh be stored at -70 °C for future use. The produced recombinant adenovirus (Ad) may carry the shRNA sequence of the novel coronavirus (nCoV2019) targeting interfering genes (ORFlab, 3J'UTR, S, E, M, N), which is called Ad-nCoVdsRNA vaccine. DsRNA is produced by shRNA, which in turn produces RNA interference. The Ad-nCoVdsRNA and water may be formulated into sprays.

[0133] As shown in FIG. 1, when the vaccine of the present disclosure enters the cell with the adenovirus vector (1), the DNA (2) of the vaccine can synthesize shRNA (3), and the shRNA (3) may be removed from the hairpin structure by nuclease to generate dsRNA (4), and further cleave into small pieces of RNA (siRNA) to generate the silencing complex RISC (5), RISC (5) can cleave the mRNA 6 expressed by the pathogenic gene into the broken mRNA (7). mRNA (7) may be degraded.

18

Claims

Claims LU101942 WHAT IS CLAIMED IS:

1. A method for preparing novel coronavirus pneumonia dsRNA vaccine, wherein, amplifying a targeted interference gene shRNA sequence of nCoV2019; a resulted product being digested with an empty interference vector pSilencer by BamH I and Hind III to construct an interference vector pSilencer- shRNA; pSilencer-shRNA and an empty shuttle vector pDC312 being digested with Hind II and EcoR I to construct a shuttle vector pDC312-shRNA, after the interference vector pSilencer-shRNA is amplified by competent E. coli DHS5Sa and the correctness of the shRNA insertion is identified, such that a shuttle vector pDC312-shRNA is co-transfected with adenovirus backbone plasmid pBHGloxAFI into HEK293 cells, then homologously recombined in the cells to obtain recombinant adenovirus Ad-shRNA; preparing an Ad-nCoV dsRNA vaccine, after HEK293 cells are repeatedly amplified and purified.

2. The method for preparing novel coronavirus pneumonia dsRNA vaccine according to claim 1, wherein the target interference gene shRNA sequence refers to an RNA sequence with a length of 19 nt complementary to an siRNA sequence.

3. The method for preparing novel coronavirus pneumonia dsRNA vaccine according to claim 1, wherein the targeted interference gene shRNA sequence is a template for expressing a hairpin structure, and consists of two single-stranded DNA that are mostly complementary, and form a double-stranded DNA with sticky ends of BamH I and Hind III cleavage sites after annealing and complementation.

4. The method for preparing novel coronavirus pneumonia dsRNA vaccine according to claim 1, wherein after the Ad-nCoVdsRNA vaccine sprayed, the recombinant adenovirus vector Ad introduces shRNA into cells, and the shRNA synthesizes dsRNA in the cells, the synthesized dsRNA specifically degrade nCoV mRNA with homologous sequences.

5. The method for preparing novel coronavirus pneumonia dsRNA vaccine according to claim 4, wherein the Ad-nCoV dsRNA vaccine is inoculated by spraying, and the recombinant adenovirus vector Ad introduces shRNA into respiratory epithelial cells and synthesizes dsRNA within the cells, and then specifically induces the degradation of homologous nCoV mRNA, 19 resulting in anti-nCoV2019 post-transcriptional gene silencing or RNA interference. LU101942

6. The method for preparing novel coronavirus pneumonia dsRNA vaccine according to claim 1, wherein the nCoV2019 refers to a conserved gene sequence or a functional gene sequence of the novel coronavirus; the conserved gene sequence or the functional gene sequence comprises ORFlab, 3'UTR, S, E, M, N gene sequences.