CN101057975B - Cocktail vaccine for anti immune tolerance and immunodeficiency virus and its application - Google Patents

Abstract

The invention provides a cocktail vaccine that is anti-immune tolerance and anti-immunodeficiency virus and its application. Said cocktail vaccine at least comprises two or more elements and any viral antigen recombinant protein and medical shaping. Said element is recombinant DNA and/ or recombinant virus; it is chosen from (A) neutralizing antibody, receptor antagonist, membrane fusion blocking agent, cell factor coding sequence, and/ or DNA interference sequence; (B) immunoadjuvants coded sequence; (C) antigen gene, viral antigen and immunoadjuvants fusion gene, viral antigen epitope coded sequence, multi-epitope fusion gene and/or viral antigen epitope -MHC-I SCT gene; (D) two seven-peptide multiplexed sequence HR1 and HR2 of membrana capsular is virus fusion protein and/ or coded sequence of its polymer HR212. The expression carrier of all antiviral elements comprises recombinant DNA carrier, vaccinia virus carrier and/ or adenoviral carrier.

Description

The cocktail vaccine of a kind of anti immune tolerance and immunodeficiency virus and application thereof

Technical field

The invention belongs to field of immunology and vaccine development technology, be specifically related to the cocktail vaccine and the application thereof of anti immune tolerance and immunodeficiency virus.

Background technology

1. immunologic tolerance virus and amynologic basis thereof:Immunologic tolerance virus is meant the virus that can cause the body immune system respond low.Though each viral pathogenesis is not quite similar, they all cause with virus continue exist, ability drop or disappearance that B cell and T cell produce antibody and cellular immunization be the disease of characteristic.In the numerous viruses that start an inflammation of the liver, hepatitis B virus (HBV) and hepatitis C virus (HCV) are most important two immunologic tolerance viruses.

The immunologic tolerance virus immunity of organism of can effectively escaping causes immunologic tolerance, makes the immunologic mechanism of human body no longer resist former generation immunne response, makes virus long-term existence in vivo.HBV is most typical immunologic tolerance virus, and susceptible mother produces 90% neonate becomes the virus carrier, and the HBV patient that partly is grown up also can form the chronic infection of hepatitis B.The variation of the persistent infection of HBV and antigenic overexpression and virus often causes the Th1 class cell relevant with immunomodulating viral special in virus replication lasting in patient's body, the thymus to be cloned ctl response ability drop relevant with the infection cell cracking with virus sweep in rejecting, peripheral blood and the liver, disappear or clone rejecting.The persistent infection of HBV and relevant with it liver cirrhosis and hepatocarcinoma have caused great economy and social pressure to the patient to society.

The primary structure antigen of HBV comprises surface antigen S, and (comprising glycosylated big antigen S1S2S, middle antigen S2S and little antigen S) and core protein C also have polymerase P in addition and regulate albumen e and x.S and C antigen can cause the generation of neutralizing antibody.Core protein C is conservative relatively, and the special cytotoxic T lymphocyte (CTL) that it produces is significant to virus sweep.Concerning HBV, the antigenic great expression of e can make Th1 class cell be suppressed, and the great expression of surface antigen makes immune system exhausted (exhausted).

HCV immunologic tolerance mechanism is different with HBV, and mostly HCV is low-level infection, is difficult for producing active immunne response, and the HCV gene very easily produces variation in addition, causes immunologic escape, produces persistent infection and immunologic tolerance.

191 aminoacid of HCV polyprotein N-terminal are core protein, are the main components of virus nucleocapsid.The N-terminal of core protein is rich in basic amino acid and high conservative.Be the envelope protein E1 of virus behind the core protein, E2 is the I type transmembrane protein of high glycosylation.In all HCV albumen, the conservative of E2 a little less than, be immunoreactive main target.Most HCV non-structural protein (NS2-NS5B) for viral genome duplicate the institute essential.HCV is a kind of virus of height variation, and this variation makes HCV in the infected's body, form complicated and diversified HCV quasispecies crowd, might exert an influence to body disease-resistant poison immunne response.The formation of immune evasion strain then maybe be relevant with persistent viral infection.Two kinds of immune evasion maybe mechanism: the active antagonism that (1) HCV replys IFN, can block the phosphorylation and the activity of interferon regulatory factor 3 like HCV NS3/4 serine protease; E2 and NS5 albumen can suppress the function of RNA deopendent protein kinase, thereby influence the antiviral effect of IFN.(2) passive variation takes place in bone-marrow-derived lymphocyte or T lymphocyte antigen epi-position on the HCV albumen under immunity of organisms, thereby escapes the attack of adaptive immune response.

2. immunodeficiency virus and amynologic basis thereof: typical case's representative of immunodeficiency virus is human immunodeficiency virus (HIV).HIV causes CD4 through infecting cd4 t cell ⁺The T lymphocyte quantity constantly descends.In addition, HIV infects the cell toxicant function reduction also cause imbalance of B-cell function and NK cell, the quantity that makes BMDC (DC) with immunologic function in blood with tissue in distribution and quantity change.HIV infects organs such as also can causing central nervous system and gastrointestinal tract and produces pathological changes.Because immunologic function degression, the probability of concurrent various cancers of patient and infectious disease heightens, and finally causes AIDS (AIDS).

The structural gene of HIV comprises gag (P55, P17, P24), Pol and env.Pol gene code polymerase precursor protein (P34) forms protease, intergrase, reverse transcriptase, ribonuclease H through cutting, and it is essential to be virus multiplication institute.About 863 the amino acid whose precursor proteins of env gene code form gp160, gp120 and gp41 through glycosylation.During gp120 contains and antigenic determinant, proved among the HIV with epitope on gp120V3 ring, V3 ring district is the critical function district of envelope protein, in virus and cell fusion, plays an important role.Gp120 links to each other with non-covalent bond with transmembrane protein gp41.Gp41 participates in target cell and merges, and impels the virus infection cell.Experiment shows that gp41 also has than strong antigen property, can induce the generation antibody response.The controlling gene of HIV comprises Tat, Rev, Nef, Vif, Vpu, Vpr at least.The immunization therapy of HIV should be set up blocking virus and continued to infect CD4 ⁺The mechanism of T cell, that suppresses the inner HIV of infection cell continues to duplicate and produce neutralizing antibody and ctl response.

3. the progress of immunologic tolerance virus and immunodeficiency virus vaccine

(1) HBV vaccine research progress: the preventative SAV of HBV has obtained using and having reduced to a great extent widely the infection of HBV, but this kind vaccine can not be treated the chronic infection of HBV.The method that traditional treatment HBV infects comprises α-IFN and chemicals, and they have important effect aspect the duplicating of control virus, but but can not remove virus (Seeger and Mason 2000) effectively.Though the dna vaccination of pure strategy comes into one's own because bringing out cell and humoral immunization, the result of dna vaccination in the toy experiment but can not realize (Payette et al.2006 at large animal on one's body; Zhao et al.2006).Along with to HBV with and induce an illness research go deep into; There has been the clinical experiment of part to adopt chemicals and the bonded comprehensive therapy of protein vaccine; Though obtained certain achievement (Yang; But conventional medicament does not also have optimistic report in the ctl response ability to that overcomes immunologic escape that virus variation causes, reduces virus replication and recover body Lee et al.2006).So far still not having approved HBV therapeutic vaccine comes out.

(2) HCV vaccine research progress: the hepatitis C that HCV causes, the chronicity rate of its infection be up to 60-80%, and cause liver cirrhosis and hepatocarcinoma.HCV mainly infects through blood transfusion, the new incidence rate that infects of the close inspection may command HCV of blood, and according to above-mentioned situation, the vaccine research of HCV mainly is the research to therapeutic vaccine.Because HCV gene alterable height; Lack the suitable cell culture system small animal model of unifying again; Effectively the recombiant vaccine research and development are hindered. however; Gene vaccine, polypeptide and protein vaccine, based on researchs such as the vaccine of DC cell and viruslike particle vaccines all by extensive concern (Manns et al.2001).When the experimental vaccine of hepatitis C is started to walk,, promptly seek special antigenic component, come immune host in the hope of obtaining neutrality or protection antibody nothing more than traditional vaccine strategy.Under study for action, can induce the anti-memebrane protein of high titre (anti-envelope) antibody to produce but can only watch for animals with reorganization E1/E2 protein immunization orangutan and avoid virus infraction (Foms et al, 1998 at a low price; Zhou et al.2000; Lee et al 1998).Gene vaccine was at first reported in 1992; Recently development rapidly; This technology is expelled to host's muscle or Intradermal with the dna direct of coding for antigens; Can the inducing specific humoral immunization and broad-spectrum cellullar immunologic response more, the order-checking of HCV whole genome sequence makes the research progressively deeply (Jiao et al.2004) of HCV gene vaccine, but the application of recombinant DNA vaccine receives the restriction of carrier characteristic equally.The challenge that the HCV vaccine faces, the variation of high degeneration, especially envelope protein that remains virus protein is more main, and the LDL albumen relevant with HCV make that most of virion has can not neutrality, become the challenge of vaccine research.Because the height variability that the weak protection of HCV neutralizing antibody is active, viral and the destruction of body's immunity, the vaccine research thinking of pure strategy can not produce important therapeutical effect (Inchauspe et al.2003) in the immunization therapy of HCV.The present situation of HCV clinical research presses for people, and to establish a kind of be the comprehensive therapy strategy of characteristic according to virus infection process and human body immunoreation.

(3) HIV vaccine research progress: after early 1980s was found AIDS, people promptly began to attempt prevention and the therapeutic vaccine of HIV as far back as 1986.Main vaccine strategy comprises inactivated vaccine, the attenuated live vaccine of HIV; Though sustainable generation antibody of vaccine and CTL immunoreation that these obtain through the processing to virus; And but the adult Rhesus Macacus of protection test reduces the SIV infection; But these monkeys finally still develop into AIDS (Baba T W et al., 1999), so people hold conservative attitude to deactivation or the application of attenuated live vaccine in human body.Research to the HIV recombinant subunit vaccine does not obtain applicable achievement yet; Get into the HIV memebrane protein gp160 antigen vaccine of clinical experiment first like the U.S.; Though gp120 can be incorporated on the cd4 cell and blocks the invasion of HIV to a certain extent; But because HIV has other approach and combines with the virus receptor of cell surface; This kind subunit vaccine is used and can not be brought out CTL behind the human body and can not produce neutralizing antibody, the III phase clinical experiment of carrying out in the U.S. and Thailand end up in failure (Dennis R B et al., 2004).The HIV virus sample particle vaccines is a kind of vaccine that the virus protein of generation was assembled into the granular structure after applying portion HIV DNA infected.Owing to having very strong immunogenicity in primate, it comes into one's own.The Gag of development such as China Xiao Yao (Xiao Yao etc., 2000) and the virus-like particle of Gag V3 gene can be induced humoral immunization and cellular immunization to a certain degree on mouse model, but do not see the experimental result on primate.Recombinant DNA vaccine is to insert the viral vector of living to the HIV exogenous gene, through virus exogenous gene is expressed in host cell, produces wider host immune response thus.These carriers have increased vaccine safety and have not weakened its immunocompetence (Bruyn Get al., 2004).Be further to increase the safety of vaccine, development attenuated vaccinia virus carrier get along with (Qing F, et al., 2005).Dna vaccination is with the plasmid immune animal that contains the HIV gene, but the generation of inducing specific antibody, and the CTL that also observes T lymphocyte specific simultaneously replys.The DNA vaccine can be induced the SIV specific CTL Rhesus Macacus, and this vaccine-induced immunity can promote the generation that the second time, CTL replied, and can control the metainfective virus replication of pathogenic SIV (Egan M A, et al., 2000) subsequently.Adopt the DNA immunogen underway as the early stage experimentation of the human body of HIV candidate vaccine.But the HIV vaccine face huge challenge, global so far AIDS vaccine carried out clinical widely before experimentation, and AIDS vaccine I phase clinical experiment nearly 100 times, the minority vaccine has been accomplished or has been carried out II phase clinical experiment.In clinical experiment, do not show the vaccine that definite protective effect can be provided but still have at present, completed two AIDS vaccine III phase clinical experiments are all counted out.

According to above-mentioned result of study and both at home and abroad immunologic tolerance and immunodeficiency virus vaccine are not made a breakthrough as yet; And face the severe social need and the present situation of technical challenges; We in time propose a kind of new vaccine development strategy; That is: anti-immunologic tolerance of cocktail type and immunodeficiency virus the development New Policy, its main points are the characteristics of replying according to the characteristic of viral infection and body, with multiple antiviral combination of elements in a vaccine.The verified vaccine than single component of cocktail vaccine that makes up has bigger immunocompetence, and can on a plurality of aspects, suppress the infection of virus, the immunologic injury of duplicating and causing.Cocktail application method that kind in the treatment of erect image AIDS-treating medicine has obtained good curative effect.In the disclosed invention of this patent, we have designed the recombinant DNA, vaccinia virus and/or the adenovirus that infect comprising of stage of a plurality of antiviral elements to viral difference according to the process of virus infection cell and the characteristics of the organism immune response that causes.Cocktail vaccine by their various combination is constructed can be blocked in the phase I of poisoning intrusion; RNA interference sequence and sequence library to the characteristic Design of virus variation can effectively suppress the probability that viral nucleic acid duplicates and makes a variation; Use heat shock protein gp96 as immunological adjuvant ability enhance immunity active and the antiviral natural immunity of activation and adaptive immunity ability; Conserved sequence design from a plurality of series of variation of virus antigen has the recombiant vaccine of extensive cross-reactivity; Adopt the mode of recombinant DNA carrier immunity and viral vector immunity can the most effectively bring into play the antiviral immunity effect.This cocktail vaccine has the vaccine and the not available global advantage of modified model thereof of single composition, is a kind of strategy of brand-new preparation vaccine.

Summary of the invention

The invention is characterized in that Combined application comprises immunological adjuvant such as heat shock protein gp96 or its n terminal fragment, antigen-antibody neutralization reaction, cell immune response, antiviral cell factor, receptor blocking agent, film fusion inhibitor and suppresses the vaccine of the strategies such as RNA interfering of virus replication with development anti immune tolerance and immunodeficiency virus.Antigen is meant regulator gene, virus antigen epitope or its multi-epitope fusion gene, the epitope-MHC-I strand trimer (SCT) of viral structural gene or the structural gene that merges with adjuvant, virus etc.Comprise and suppress virus infection and duplicate relevant element, virus antigen and can activate the body natural immunity and element that adaptive immunity is relevant through Combined application, reach prophylaxis of viral infections, the control virus replication also recovers the purpose of body's immunity.

In one aspect of the invention; The invention provides the cocktail vaccine of anti-immunologic tolerance virus and/or togavirus; It comprises two or more element and optional virus antigen recombiant protein and optional pharmaceutically acceptable excipient; Said element exists with recombinant DNA and/or recombinant virus form, and said element is selected from: (A) neutralizing antibody, receptor blocking agent, membrane fusion inhibitor, cytokine coded sequence, and/or RNA interferes sequence; (B) immunological adjuvant coded sequence; (C) antigen gene, virus antigen and immunological adjuvant fusion gene, virus antigen epitope coded sequence, multi-epitope fusion gene and/or virus antigen epitope-MHC-I SCT gene; (D) coded sequence of two of the togavirus fusion rotein seven peptide repetitive sequence HR1 (SEQ ID NO:17), HR2 (SEQ ID NO:16) and/or its polymer HR212 (SEQ ID NO:18).

Particularly, said anti-immunologic tolerance virus can be selected from, but is not limited to HBV and HCV; Said anti-immunodeficiency virus can be selected from, but is not limited to HIV; Said virus antigen recombiant protein can be selected from, but is not limited to following sequence expressed proteins: the comparison conserved sequence of virus antigen, main epidemic strain sequence or its partial sequence, or the fusion gene sequence of virus antigen and adjuvant fusion; Said membrane fusion inhibitor can be selected from, but is not limited to seven peptide repetitive sequence HR1, HR2 or its polymer that the HIV film merges; Said cytokine can be selected from, but is not limited to, cytokine IFN α (1 and 2) or γ, TNF (tumor necrosis factor) α, IL-2; Said RNA interferes sequence to be selected from, but is not limited to encoding viral sequence or non-coding sequence; Said immunological adjuvant can be heat shock protein gp96 or its N terminal sequence; Said antigen gene can be selected from, but is not limited to the comparison conserved sequence of virus antigen, main epidemic strain sequence or its partial sequence, or the fusion gene sequence of virus antigen and adjuvant fusion; Said virus antigen epitope coded sequence can be selected from, but is not limited to viral structural gene or reconciles the gene epitope sequences; Said multi-epitope fusion gene can be selected from, but is not limited to, and viral Th (helper T lymphocyte) epi-position and MHC-I (major histocompatibility antigen I) restriction epi-position and adjuvant are or/and the ubiquitin fusion sequence; Said virus antigen epitope-MHC-I SCT gene can be selected from, but is not limited to the fusion sequence of HLA-A2, HLA-A11, HLA-A24, HLA-30 and virus antigen and β 2m.Said recombinant DNA can be a recombiant plasmid, and said heavy thin virus can be recombinant adenovirus or vaccinia virus recombinant; Said plasmid can be a carrier for expression of eukaryon.

In another aspect of the present invention, the present invention also provides the purposes that the cocktail vaccine of anti-immunologic tolerance virus of the present invention and/or togavirus is used for preparing the medicine that prevents and/or treats the disease that is caused by immunologic tolerance virus and immunodeficiency virus.

Of the present invention aspect another, the invention provides the method for the disease that causes by immunologic tolerance virus and immunodeficiency virus with said Drug therapy.

Be specific embodiments of the present invention below.

1.HBV therapeutic cocktail vaccine

Among the present invention disclosed HBV therapeutic cocktail vaccine be selected from following two or more combination of elements and the recombinant DNA, adenovirus and/or the vaccinia virus that make up and their compositions (1) effectively reduce RNA interfering (siRNA) that HBV-DNA duplicates and/or IFN (interferon) α ( Http:// www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? Val=NM_024013.1, serial number NM_024013; Http:// www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? Db=protein& Val=11067751, serial number NM_000605) or the γ coded sequence; (2) coded sequence of adjuvant molecule gp96 or its n terminal fragment; (3) fusion gene that merges of the structural antigens HBsAg of HBV, HBcAg or itself and adjuvant, epitope, multi-epitope fusion gene and epitope-MHC-I SCT gene of HBV.Dna vector, viral vector have alternative and good exogenous gene expression and the modification ability of insertion sequence flexibly, also have on the viral vector in addition and bring out autarcetic various active element.Immune step immune with dna vaccination and that viral vaccine is strengthened not only can effectively realize the expression of above-mentioned multiple element, and the CTL that immunity is produced also has the ability to the infection site migration.The cross immunity mode of this external vaccinia virus and adenovirus vector can be avoided the neutralization of body to the time being produced with the immunity once again of a kind of viral vector.

The therapeutic cocktail vaccine of HBV comprises among the present invention:

Vaccine combining form one: multichip carrier HBV therapeutic cocktail vaccine

By the multichip carrier cocktail vaccine (shown in Figure 1) that recombinant DNA, vaccinia virus and adenovirus are formed, wherein carrier one disturbs the recombinant adenovirus of element or comprises the recombinant adenovirus storehouse that a plurality of RNA disturb element for comprising the RNA that suppresses hbv replication.Carrier two is for comprising the fusion gene of HBV structural gene or HBV epitope or structural gene and epi-position and adjuvant and recombinant DNA or the recombinant DNA storehouse that comprises the SCT gene of epitope sequences.Carrier three is vaccinia virus recombinant or recombinant virus storehouse, comprise IFN gene, HBV structural gene or structural gene and adjuvant gp96 or its N fragment fusion gene, HBV epitope or multi-epitope recombinant and with the SCT gene of adjuvant gp96 or the segmental fusion gene of its N, HBV epitope.Multichip carrier HBV cocktail vaccine also comprises the combination separated from one another of recombinant DNA, vaccinia virus and adenovirus and HBV surface antigen protein.

Vaccine combining form two: single carrier HBV therapeutic cocktail vaccine

It is characterized by the vaccinia virus recombinant or recombinant adenovirus or vaccinia virus recombinant storehouse or recombinant adenovirus storehouse (as shown in Figure 7) that comprise following element: the structural gene of IFN gene, HBV or structural gene and adjuvant gp96 or its N fragment fusion gene, HBV epitope or multi-epitope recombinant and with the SCT gene of adjuvant gp96 or the segmental fusion gene of its N, HBV epitope, reconcile gene and the corresponding RNA interference sequence of non-encoding gene.Single carrier HBV therapeutic cocktail vaccine also comprises the combination separated from one another by recombinant virus or recombinant virus storehouse and HBV surface antigen.

2.HCV therapeutic cocktail vaccine

Disclosed HCV therapeutic cocktail vaccine is to be selected from following two or more combination of elements and recombinant DNA, vaccinia virus and the adenovirus and their compositions (1) that make up effectively reduce RNA interfering (siRNA) and/or IFN α or the γ that HCV duplicates among the present invention; (2) adjuvant molecule gp96 or its n terminal fragment; (3) the structural antigens capsid protein core (SEQ IDNO:58) of HCV, E1 (SEQ ID NO:69), E2 (SEQ ID NO:70) coded sequence ( Http:// hcv.lanl.gov/components/hcv- Db/combined_search/query_one.comp? Se_id=17434) or fusion gene, HCV epitope, multi-epitope fusion gene and epitope-MHC-I SCT gene of merging of itself and adjuvant.The combining form of HCV cocktail vaccine is similar with the HBV cocktail vaccine, is divided into multichip carrier HCV therapeutic cocktail vaccine and single carrier HCV therapeutic cocktail vaccine.

3.HIV-1 preventative cocktail vaccine

The preventative cocktail vaccine of disclosed HIV is to be selected from following two or more combination of elements and the recombinant DNA, vaccinia virus and the adenovirus that make up and their compositions among the present invention:

(1) coded sequence of seven peptide repetitive sequence HR212 of virus capable of blocking and cell fusion; (2) coded sequence of adjuvant molecule gp96 or its n terminal fragment; (3) fusion gene, HIV epitope, multi-epitope fusion gene and epitope-MHC-I SCT gene of merging of the structural antigens gene env of HIV (SEQ ID NO:61), gag (SEQ ID NO:59), pol (SEQ ID NO:60) coded sequence or itself and adjuvant.The combining form of the preventative cocktail vaccine of HIV has following several kinds:

Vaccine combining form one: contain the multichip carrier HIV prevention of the HR212 element of secreting, expressing The property cocktail vaccine

It is characterized by recombinant DNA, adenovirus and the poxvirus of the HR212 that comprises the secretion type expression characteristic.Wherein HR212's is characterized as by sequence and sequence library through the conservative seven peptide repetitive sequences of the HIV of comparison, the main epidemic strain of HIV system.

Vaccine combining form two: the preventative cocktail vaccine of multichip carrier HIV

By the multichip carrier cocktail vaccine that recombinant DNA, vaccinia virus and adenovirus are formed, it is characterized by structural antigens env, gag, pol or itself of the HR212 that comprises secreting, expressing and HIV and fusion gene, HIV epitope, multi-epitope fusion gene and epitope-MHC-I SCT gene that adjuvant merges.Wherein the HIV conservative seven peptide repetitive sequences or the main epidemic strain of HIV that are characterized as by the warp comparison of HR212 are HR212 sequence and sequence library thereof.

Vaccine combining form three: contain single vector HIV prevention of the HR212 element of secreting, expressing The property cocktail vaccine

It is characterized by recombinant DNA (storehouse) or recombinant adenovirus (storehouse) or the poxvirus (storehouse) of the HR212 that comprises the secretion type expression characteristic.Wherein HR212's is characterized as by HR212 sequence and sequence library through the main epidemic strain of HIV conservative seven peptide repetitive sequences, the HIV of comparison system.

Vaccine combining form four: the preventative cocktail vaccine of single vector HIV

By single carrier cocktail vaccine that recombinant DNA or adenovirus or vaccinia virus are formed, it is characterized by structural antigens env, gag, pol or itself of the HR212 that comprises secreting, expressing and HIV and antigen gene, HIV epitope, multi-epitope fusion gene and the epitope-MHC-I SCT gene of the fusion that adjuvant merges.Wherein HR212's is characterized as by sequence and sequence library through the main epidemic strain of HIV concordance seven peptide repetitive sequences, the HIV of comparison system.

4.HIV-1 therapeutic cocktail vaccine

Disclosed HIV therapeutic cocktail vaccine is to be selected from following two or more combination of elements and the recombinant DNA, vaccinia virus and the adenovirus that make up and their compositions among the present invention: seven peptide repetitive sequence polymer HR212 of (1) virus capable of blocking and cell fusion; (2) can effectively suppress RNA interfering (siRNA) and/or IFN α or γ (3) adjuvant molecule gp96 or its n terminal fragment that HIV duplicates; (4) fusion gene, HIV epitope, multi-epitope fusion gene and epitope-MHC-I SCT gene of merging of the structural antigens env of HIV, gag, pol or itself and adjuvant.The combining form of HIV cocktail vaccine has following several kinds.

Vaccine combining form one: multichip carrier HIV therapeutic cocktail vaccine

By the multichip carrier cocktail vaccine (shown in Figure 1) that recombinant DNA, vaccinia virus and adenovirus are formed, wherein carrier one is adenovirus or adenovirus storehouse, it is characterized by to comprise the HR212's that suppresses effective RNA interference element that HIV duplicates and/or secreting, expressing.Carrier two is the reorganization dna library, it is characterized by structural antigens env, gag, pol or itself of the HR212 that comprises secreting, expressing, HIV and fusion gene, HIV epitope, multi-epitope fusion gene and the epitope-MHC-I SCT gene of adjuvant fusion.Wherein HR212's is characterized as by sequence and sequence library through the main epidemic strain of HIV concordance seven peptide repetitive sequences, the HIV of comparison system.

Vaccine combining form two: single vector HIV therapeutic cocktail vaccine

By single carrier cocktail vaccine that recombinant DNA or adenovirus or vaccinia virus are formed, it is characterized by structural antigens env, gag, pol or itself of the HR212 that comprises secreting, expressing and HIV and antigen gene, HIV epitope, multi-epitope fusion gene and the epitope-MHC-I SCT gene of the fusion that adjuvant merges.Wherein HR212's is characterized as by HR212 sequence and sequence library through the main epidemic strain of HIV conservative seven peptide repetitive sequences, the HIV of comparison system.

The accompanying drawing summary

Fig. 1: the carrier of multichip carrier cocktail vaccine and construction strategy.

Wherein the adenovirus vector of carrier I carries single or a plurality of RNA interference elements; It also can be the adenovirus storehouse of carrying the different RNA interference element; Wherein A, B represent different RNA interference elements, a kind of component of carrier I in can independent or blended composition multichip carrier vaccine.The dna vector of carrier II carries the structural antigens gene of virus or the fusion gene that is merged by structural antigens and adjuvant or the multi-epitope gene that constructed by epi-position or by SCT or its mixture of single epi-position structure; A wherein represents above-mentioned any element, a kind of component of carrier II in can independent or blended composition multichip carrier vaccine.Carrier III comprises cytokine coded sequence and optional carrier II gene, and wherein A, B, C, D represent the different elements that carrier III is entrained respectively, a kind of component of carrier III in can independent or blended composition multichip carrier vaccine.Multichip carrier HBV therapeutic cocktail vaccine comprises two kinds or three kinds of carriers of optional independent packing.Wherein carrier I and carrier II can be separately and carrier III combination make up two carrier cocktail vaccines, carrier I and carrier II also can with carrier III combination structure three carrier cocktail vaccines.

Fig. 2: the recombinant adenoviral vector that carries the RAN interference element.

A: the dna profiling of the siRNA that is directed against HBV that forms in the cell goes out complementary sense and antisense oligos according to the sequential design of HBV, is annealed into two strands.Link to each other with SalI/XbaI digested vector pAVU6+27 for convenient; 5 ' end at DNA oligos has added SalI, and 3 ' end has added the XbaI enzyme cutting site, and Intermediate grey is partly for transcribing the ring structure that the back expection forms; For translation is effectively stopped, designed termination signal dT (5) endways.

The level that B:Northern hybridization detects HBV mRNA in the HepG2.2.15 cell is extracted the RNA of HepG2.2.15 cell, is that probe carries out Northern hybridization with HBV DNA, and with GAPDH as internal reference.Phosphorus screen analysis result shows, compare with contrast, transfection in 2215 cells of siHBV1 (P1) or siHBV2 (P2) recombinant adenovirus, the mRNA level of 3.5Kb and 2.4Kb/2.1Kb obviously reduces.In matched group; Transfection with the cell of irrelevant recombinant virus U6 (mock) of HBV gene or siEGFP (E) in; MRNA in its mRNA level and the non-transfected cells (C) is on close level, and shows that crt gene siEGFP can not influence the HBVmRNA level, has shown the specificity of siRNA effect.C represents 2215 cells of untransfected; Mock, E, P1, P2 have represented transfection respectively and have contained U6+27, U6+27-siEGFP, U6+27-siHBV1,2215 cells of U6+27-siHBV2 recombinant adenovirus.

The C:ELISA method detects the supernatant that the expression (percentage ratio of comparing with contrast) of HBsAg and HBeAg in 2215 cells is got 2215 cells, detects HBsAg, HBeAg level in the cell conditioned medium with the ELISA detection kit.The result shows and to compare with control cells (C), transfection in the cell of siHBV1 (P1) or siHBV2 (P2) recombinant adenovirus HBsAg, HBeAg protein level by obviously inhibition.Transfection the cell of siHBV1 recombinant virus, its HBsAg 90.6 ± 0.5% (P=0.00226) that descended, HBeAg 88.4 ± 0.9% (P=0.00011) that descended; Transfection the cell of siHBV2 recombiant plasmid, its HBsAg 92.9 ± 0.6% (P=0.00216) that descended, HBeAg 89.7 ± 1.0% (P=0.0001) that descended, the fall of data show HBsAg is slightly larger than HBeAg.Show that this EVAC is fine to the effect of HBV gene inhibition.C represents 2215 cells of untransfected; Mock, E, P1, P2 have represented transfection respectively and have contained U6+27, U6+27-siEGFP, U6+27-siHBV1,2215 cells of U6+27-siHBV2 recombinant adenovirus.

D:Real time PCR detects the supernatant that the HBV dna content is got 2215 cells, and wherein viral DNA is carried out real time pcr analysis.Be the quantitatively copy number of HBV DNA, the concentration known that increased simultaneously and through the topo-HBV plasmid of serial dilution, produce standard curve, establishing criteria curve and the Ct value of the HBV DNA that records calculate the copy number of HBV DNA.The result shows, contains the cell of the adenovirus infection of siHBV1 (P1) and siHBV2 (P2), HBV dna level in its supernatant and contrast (14.48 ± 2.15 * 10 ⁴Copys/mL) compare and descended 3.7 times (3.91 ± 0.72 * 10 respectively ⁴Copys/mL; P=0.00821) and 3.3 times (4.41 ± 0.85 * 10 ⁴Copys/mL; P=0.00780).

Fig. 3: the recombinant DNA carrier that carries structural antigens.

A. the construction and expression of fusion gene.(A) fusion gene makes up sketch map.Gene is under the CMV of pcDNA3 promoter.In fusion gene, introducing flexible connexon " GGSGG " guarantees the correct expression of each gene and keeps normal function.N355 ^w355 aminoacid of acute pyogenic infection of finger tip Mus or people's gp96N end.(B) western blot hybridization analysis.The clone who makes up is through calcium phosphate method transfection 293T cell, two days later, collecting cell, cell lysate detects behind immunoprecipitation.HBcAg (SEQ ID NO:4), HBsAg (SEQ ID NO:5), N355 (SEQ ID NO:2; 3), CN355 (fusion gene of HBV cAg and N355) (SEQ ID NO:7), SN355m (fusion gene of the surface antigen S of HBV and Mus gp96N end N355) (SEQ ID NO:8); SN355h (being the surface antigen S of HBV and the fusion gene of people gp96N end N355) (SEQ ID NO:9), S2S (SEQ ID NO:6), S2SN355 (fusion gene of the surface antigen S 2S of HBV and gp96N end N355) (SEQ ID NO:10) and N355S2S (fusion gene of the surface antigen S 2S of HBV and gp96N end N355) (SEQ ID NO:11); Molecular weight etc. gene outcome is respectively 17kDa, 24kDa, 45kDa; 62kDa, 69kDa, 69kDa; 31kDa, 76kDa and 76kDa.(a) the cAg monoclonal antibody of anti-mice detect truncate cAg and with the fusion product of N355.(b, c, d) the surface antigen monoclonal antibody of anti-mice detect the hepatitis B membrane antigen S and M albumen and with the fusion product of N355.The band of non-glycosylated (little band) and glycosylation (big band) can both detect.

B.DNA exempts from the detection of humoral immune reaction behind BALB/c Mus and the HLA/A2 transgenic mouse.Immunity is three times altogether, every group of 5 Mus, each intramuscular injection 100 μ g plasmids.For being total to immune group, before the injection each 50 μ g of two kinds of plasmids are mixed.Back 10 days eye sockets of last immunity are got blood, and ELISA serial dilution method is surveyed antibody titer.The result is with light absorption meansigma methods (A _490nm) ± SD representes.(A) surface antibody after 1/1000 dilution of BALB/c Mus serum; (B) surface antibody after 1/1000 dilution of Anti-HBs in HLA/A2 transgenic mouse serum; (C) and (D) be respectively the core antibody after BALB/c Mus and 1/10000 dilution of HLA/A2 transgenic mouse serum, (E) the back N355 antibody (IgG) of BALB/c Mus and 1/100 dilution of HLA/A2 transgenic mouse serum.All data are a representative value of three different experiments.

C.ELISPOT detects the reaction of HBV specific cell.Dna vaccination immunity BALB/c Mus and HLA/A2 transgenic mouse three times, every group of 5 Mus, each intramuscular injection 100 μ g plasmids.For being total to immune group, before the injection each 50 μ g of two kinds of plasmids are mixed.Last immunity was got the mouse spleen cell in back 10 days and is analyzed.IFN-γ and CD8 that HBV is special ⁺The speckle number that two positive cells form is with 5 * 10 ⁵Spleen cell calculates.Every group of speckle number (deduct and do not have polypeptide stimulated control speckle) representes that with the mean standard variance of three numbers all data are a representative value of three different experiments.(A) epi-position HBs362-371 and Ld28-39 analyze with the BALB/c Mus, and epi-position HBs348-357 is used for the analysis of HLA/A2 transgenic mouse.(B) epi-position HBc87-95 is used for the analysis of BALB/c Mus, and epi-position HBc18-27 is used for the analysis of HLA/A2 transgenic mouse.

Fig. 4: the SCT recombinant DNA carrier that carries epitope-MHC-I.

SCT is through with epitope, and β 2m is connected the fusion gene that makes up with the MHC-I quasi-molecule through 15 amino acid whose GS connexons, and its structure is shown in figure A.B, SCT can present epitope at cell surface effectively.C can produce special CTL with SCT reorganization DAN carrier immunity HLA-A2 transgenic mouse, and has the ability that suppresses hbv replication in the HepG2.2.15 cell.pcDNA-SCT-C18(SEQ?ID?NO：13)，pcDNA-SCT-C107(SEQID?NO：14)，pcDNA-SCT-HIV-gag(SEQ?ID?NO：15)

Fig. 5: the recombinant DNA carrier that carries former epi-position of multi-resistance and adjuvant molecule fusion gene.The ideograph of the fusion gene (SEQ ID NO:12) that makes up by the multi-epitope fusion

Fig. 6: the CTL that vaccinia virus recombinant and multichip carrier therapeutic HBV and HIV vaccine immunity produce.Can bring out the relevant CTL level of HBV cAg with the HBV cAg-SCT recombinant DNA among the embodiment one carrier 2B efficiently with the multichip carrier HBV therapeutic vaccine immunity HLA-A2 transgenic mouse that constitutes like the recombinant vaccinia of figure shown in the A.Gag epi-position with HIV has consistent experimental result.Fig. 6 A, one of structure form of vaccinia virus recombinant.Fig. 6 B, usefulness contains the reorganization DAN carrier of SCT and the CTL that vaccinia virus recombinant immunity HLA-A2 transgenic mouse can efficiently produce HBV cAg and HIVgag antigen-specific.In the present embodiment, the A on the carrier is γ-IFN, and B is S2SN355, and C is HLA-A2-SCT-C18.

Fig. 7 list carrier cocktail vaccine.

In single carrier cocktail vaccine of HBV, the ABC on the carrier is IFN α and β, S, S2S, S1S2S, C, SCT, gp96, the optional combination of Gp96N-S/C.D is that the special RNA of regulator gene and non-encoding gene interferes sequence.Single carrier cocktail vaccine also comprise contain different elements respectively by the mixing of the formed single carrier of same carrier of recombinant DNA, adenovirus or vaccinia virus recombinant.Single vehicle treatment property cocktail vaccine of HCV is meant the single vehicle treatment property cocktail vaccine among the embodiment 21.Single carrier cocktail vaccine of HIV is meant the preventative and therapeutic vaccine of single vector HIV of four kinds of embodiment three and embodiment.Wherein the ABC on the carrier is IFN α and γ, core, and E1, E2, Gp96, the optional combination of Gp96 or its N end-Core/E1/E2, D is that the special RNA of regulator gene and non-encoding gene interferes sequence.Single carrier cocktail vaccine of HIV is meant the preventative and therapeutic vaccine of single vector HIV of four kinds of embodiment three and embodiment; Wherein the ABC on the carrier is IFN α and γ, gag, pol; Env; Gp96, the optional combination of Gp96 or its N end-gag/pol/env, D is that the special RNA of regulator gene and non-encoding gene interferes sequence.

Fig. 8: the construction strategy of the Enveloped Virus-cell Membrane Fusion suppressor gene of eukaryotic expression system.

The construction strategy of the membrane fusion inhibitor of A band tPA signal peptide

The construction strategy of the membrane fusion inhibitor of B band IgG signal peptide

The RNA of Fig. 9: HBV interferes sequence.

A: the intervening rna sequence corresponding with HBV X antigen changes into is inserted into the sequence on the pAVU6+27 carrier.

B: the intervening rna sequence corresponding with HBV S antigen changes into is inserted into the sequence on the pAVU6+27 carrier.

C: the intervening rna sequence corresponding with HBV C antigen changes into is inserted into the sequence on the pAVU6+27 carrier.

D: the intervening rna sequence corresponding with HBV P antigen changes into is inserted into the sequence on the pAVU6+27 carrier.

Embodiment

Be some embodiments of the present invention below, but said embodiment only is an illustrative, and scope of the present invention is not played the qualification effect.

Embodiment one: the therapeutic cocktail vaccine of HBV

The characteristics of the immunologic tolerance that infection causes according to HBV, its therapeutic cocktail vaccine is single carrier bacterin or the multichip carrier combination-vaccine that comprises a plurality of elements.Cocktail vaccine has and is superior to the therapeutic purposes combination advantage that discrete component is realized.Present embodiment provides a kind of structure of multichip carrier cocktail vaccine and the building mode of compound mode and a kind of single carrier cocktail vaccine, but the content that this patent comprised is not limited to the compound mode of the disclosed cocktail vaccine of present embodiment.

1. multichip carrier HBV therapeutic cocktail vaccine (Fig. 1)

The composition and the application of multichip carrier HBV therapeutic cocktail vaccine

Carrier 1: the recombinant adenovirus that contains the RNA interference sequence

The virus replication that continues is a key character of immunologic tolerance virosis, and duplicating of virus not only replenished the storage capacity of virus in the host, produces a large amount of mutants, also caused immune exhaustion and functional defect.Therefore, an important behave of immunologic tolerance virosis treatment is titre and the levels of replication that at first suppresses virus.Perhaps have the virus of RNA intermediate for RNA, select virus genomic particular sequence, the RNA that carries through suitable carriers can duplicate and antigenic continuous expression in relating to element in very efficient special viral the continuing of inhibition.In the present embodiment, we are example with the levels of replication that the recombinant adenovirus that carries the HBV interference sequence reduces HBV, provide preparation and have the method that the RNA that suppresses the HBV virus replication interferes vaccine.But the content of the carrier one that this patent comprised is not limited only to this disclosed sequence and carrier.

A: the RNA to the single site of hepatitis B virus on the single adenovirus vector disturbs

To the antigenic mRNA sequence of hepatitis B virus (HBV) X; Utilize the software of the online design siRNA sequence of Dharmacon company; Designed a plurality of siRNA sequences, and converted them to complementary two DNA sequence (Fig. 2 A) separately, wherein linked to each other for U6+27 promoter convenient and that SalI/XbaI digested vector pAVU6+27 obtains; 5 ' end at DNAoligos has added SalI, and 3 ' end has added the XbaI enzyme cutting site.For translation is effectively stopped, also designed termination signal dT (5) endways.After Yu Boya company was synthetic, 100 ℃ were boiled 3 minutes, were cooled to room temperature automatically and carried out two strands annealing, were cloned among the carrier pAVU6+27 (available from Clontech), obtained expressing the expression cassette carrier pAVU6+27-siHBV to the siRNA of HBV.Transient cotransfection pUC19-HBV1.3 (MBI) plasmid and pAVU6+27-siHBV plasmid are in HepG2 (available from ATCC) cell in advance; Utilize ELISA to detect relevant S antigen of hepatitis B and the antigenic expression of e; Tentatively infer and effectively to suppress the sequence that HBV expresses; Preliminary screening obtains 2 sequences; Called after pAVU6+27-siHBV1 (SEQ ID NO:20) and pAVU6+27-siHBV2 (SEQ IDNO:21) (shown in Fig. 2 A) further will comprise in pAVU6+27-siHBV1 and the pAVU6+27-siHBV2 carrier of ordered sequence (seeing shown in Fig. 2 A) expression cassette and be cloned in pshuttle (available from the Stratagene) carrier of adenovirus.Method is: utilize HindIII to downcut the expression cassette of the siRNA among the carrier pAVU6+27-siHBV, parallel glue reclaims.The pshuttle carrier is utilized the HindIII enzyme action, and dephosphorylation, be connected with the expression cassette of the siRNA that reclaims, obtain purpose plasmid pshuttle-U6+27-siHBV1 and pshuttle-U6+27-siHBV2.This purpose plasmid is used the pmeI linearisation; Utilize ethanol precipitation to reclaim; Forward among the competent cell BJ5183 (available from Stratagene) with the common electricity of pAdEasy-1 (available from Stratagene) plasmid, carry out homologous recombination, obtain containing the recombinant of siRNA expression cassette.Further utilize pacI linearisation enzyme action to reclaim back transfection virus package cell line GP-293 (available from ATCC) recombinant, after 7-10 days, collect virus.

The GP-293 cell is paved into monolayer, adds the viral liquid of serial dilution according to gradient, cultivated 48 hours with 1% semisolid culturemedium then, counting forms has a liking for the speckle number, according to the viral dilution ratio with have a liking for the titre that the speckle number is confirmed recombinant adenovirus.Infection multiplicity according to 0.1MOI infects HepG2.2.15 cell (available from ATCC) (each antigen of stably express HBV; And ability Packing Intact virion); Detect HBV surface antigen S and the antigenic expression of e with the ELISA method after 72 hours; (C) compares with control cells, transfection in the cell of siHBV1 (P1) or siHBV2 (P2) recombinant virus S, the antigenic level of e obviously suppressed.Infected the cell of siHBV1 virus, descended 88.4 ± 0.9% (P=0.00011) of its S antigen 90.6 ± 0.5% (P=0.00226) that descended, e antigen; Infected the cell of siHBV2 adenovirus, its S antigen 92.9 ± 0.6% (P=0.00216) that descended, e antigen 89.7 ± 1.0% (P=0.0001) (Fig. 2 B) that descended.The Northern results of hybridization shows that in the cell of viral infection, the mRNA level of 3.5Kb and 2.4Kb/2.1Kb obviously reduces (Fig. 2 C).Fluorescence quantitative PCR detection result shows, infected cells, HBV dna level in its supernatant and contrast (14.48 ± 2.15 * 10 ⁴Copys/mL) compare and descended 3.7 times (3.91 ± 0.72 * 10 respectively ⁴Copys/mL; P=0.00821) and 3.3 times (4.41 ± 0.85 * 10 ⁴Copys/mL; P=0.00780) (Fig. 2 D).These results show that the RNAi method of the special target HBV gene that this is adenovirus mediated can effectively suppress HBV expression of gene in the HepG2.2.15 cell, and final effectively duplicating of inhibition HBV.

B: the RNA to a plurality of sites of hepatitis B virus on the single adenovirus vector disturbs

Utilize the method among the A, we have screened the antigenic siRNA sequence of S, X, C or polymerase P that is directed against HBV respectively, have obtained 6 pAVU6+27-siHBV recombiant plasmid that can effectively suppress hbv replication.Wherein:

The X interference sequence is 1.5 ' GAGGACTCTTGGACTCTCA-3 ' (SEQ IDNO:62); ' 2.5 CCGTGTGCACTTCGCTTCACCTCTG-3 ' (SEQ IDNO:63); It is inserted into structure among the pAVU6+27 shown in Fig. 9 A.

S interference sequence 1.5 ' CATCACATCAGGATTCCTA-3 ' (SEQ ID NO:64); ' 2.5 CTCAGTTTACTAGTGCCATTTGTTC-3 ' (SEQ ID NO:65); It is inserted into structure among the pAVU6+27 shown in Fig. 9 B.

C interference sequence 5 ' CATCACATCAGGATTCCTAAA-3 ' (SEQ IDNO:66); It is inserted into structure among the pAVU6+27 shown in Fig. 9 C.

P polymerase interference sequence, 5 ' AGAAGATCTCAATCTCGGGAATCTC-3 ' (SEQ ID NO:67).It is inserted into structure among the pAVU6+27 shown in Fig. 9 D.

Further respectively with in the carrier that builds to the expression cassette of the siRNA of S, X, C or P in twos combination clone in the pshuttle carrier; That is: utilize the expression cassette among the pAVU6+27-siHBV under the HindIII enzyme action earlier; Glue is linked in the pshuttle of same processing after reclaiming; Obtain purpose clone pshuttle-siHBV1; Further will downcut and reclaim with ECoRV and stuI to the expression cassette of another antigenic pAVU6+27-siHBV; Put down end with ECoRV enzyme action pshuttle-siHBV1 and dephosphorylation with the expression cassette of the siRNA that downcuts with ECoRV and stuI and be connected, obtained being connected with on the pshuttle carrier expression cassette of two siRNA like this.Same method makes up all expression cassettes to the siRNA of HBV that obtain in twos.The method of utilizing the adenovirus described in the A to set up has obtained X, S, the adenovirus particles that three profits of P and C make up in twos.After infecting HepG2.2.15, obtained and above similar result.Further with resulting adenovirus as a storehouse, infect the HepG2.2.15 cell after, the inhibition efficient of HBV is better than the infection with single adenovirus particles.

Carrier 2: the recombinant DNA carrier that contains HBV structural antigens, adjuvant, adjuvant and structural antigens fusion gene, epi-position and multi-epitope fusion gene, epi-position and adjuvant fusion gene and epi-position-MHC-SCT

A. the recombinant DNA carrier that contains HBV structural antigens, adjuvant, adjuvant and structural antigens fusion gene

Structural protein cAg HbcAg (C) coded sequence (SEQ ID NO:4) with HBV; N end 355 aminoacid (mature peptide does not contain signal peptide) coded sequence N355 of the gp96 of the small protein HBsAg (S) of membrane antigen (SEQ ID NO:5) and middle Protein S 2S (SEQ ID NO:6), people or mice ^h(SEQ ID NO:2) and N355 ^m(SEQ ID NO:1) and said structure albumen and gp96N end gene fusion construct.During gene fusion construct, introduce connexon " GGSGG ", its coded sequence is " GGT TCC TCT GGA GGT ".The amplification method of fusion gene is: earlier hold and antigen sequence the two ends fragment that purification obtains with both sides primer and the middle primer gp96N that increases respectively respectively; Mix two fragments then as template, with the primer amplification fusion gene of both sides.All amplimers are listed in the table 1, and wherein tilted letter is a restriction enzyme site, the connexon of bold-faced letter for introducing.The sketch map of the dna vaccination that makes up is shown in Fig. 3 A.

Table 1 makes up the primer sequence of HBV structural gene and fusion gene vaccine

Annotate: " N355 ^m" represent the N355 (SEQ ID NO:1) in Mus source, " N355 ^h" N355 (SEQ IDNO:2) in representative source.Wherein (a) is SEQ ID NO:24; (b) be SEQ ID NO:25; (c) be SEQ ID NO:26; (d) be SEQ ID NO:27; (e) be SEQ ID NO:28; (f) be SEQ ID NO:29; (g) be SEQ ID NO:30; (h) be SEQ ID NO:31; (i) be SEQ ID NO:32; (j) be SEQ ID NO:33; SEQ ID NO:34 is ggttcctctggaggtgacgatgaagttgatgt; (k) be SEQ ID NO:35; Acctccagaggaaccaataacacaagtctccg is SEQ ID NO:36; Acctccagaggaaccaatgtatacccaaag is SEQ ID NO:37; Ggttcctctggaggtgatgatgaagtcgac is SEQ ID NO:38; (l) be SEQ ID NO:39; (m) be SEQ ID NO:40; Acctccagaggaaccaatgtatacccaaag is SEQ ID NO:41; Ggttcctctggaggtgatgatgaagtcgac is SEQ ID NO:42.

With the mode immunity BALB/c and the HLA-A2 transgenic mouse (available from Jackson Lab) of intramuscular injection, immune three times, dosage is 100 μ g/ Mus to the dna vaccination that obtains, at interval two weeks respectively.The peripheral blood of getting Mus after two weeks of last immunity prepares serum, detects the antibody titer of related antigen among the HBV.Get the spleen cell of Mus, detect the level of the CTL generation of the HBV antigen-specific that produces in the spleen.Experimental result shows that the form of dna vaccination immunity can produce tangible antibody and CTL level, under the adjuvant effect of gp96N end, produces the neutralizing antibody of Th1 class, and the level of CTL improves 6-8 doubly.Fig. 3 B and Fig. 3 C have explained the level that antibody horizontal and CTL produce.

B. the recombinant DNA that makes up by epitope-MHC-I SCT

Be built into monomolecular SCT on MHC-I and the B2M and can effectively the corresponding epi-position of virus antigen be presented at cell surface through in advance epi-position being fused to, bring out the generation of the relevant CTL of virus antigen very efficiently.Provide the result of the CTL that method that two relevant epi-positions of HBV cAg of HLA-A2 restriction make up and immune mouse produced in the present embodiment.The content that this patent comprised is not limited to the epi-position of HLA-A2 and cAg, and the recombinant DNA carrier that is obtained can be the single carrier that comprises an epi-position, also can be the multi-epitope recombinant DNA mixture that comprises a plurality of epi-positions.

Fig. 4 A is depicted as the ideograph of SCT, wherein connects through 15 amino acid whose GS connexons between each gene.The N end of SCT is a signal peptide, and the epi-position that it comprised can be introduced through the mode of primer sudden change.The SCT dna vector that makes up can be presented the cAg epi-position at cell surface (Fig. 4 B) effectively.The special CTL of epi-position can be produced with SCT dna vector immunity HLA-A2 transgenic mouse, and the expression (Fig. 4 C) of HBV surface antigen and cAg in the HepG2.2.15 cell can be reduced.

Adopt the mode of PCR sudden change to change the entrained epitope of HLA-A2:

The SCT primer:

A2-SCT-up1：CAGCTGTGGAATGTGTGTCAGTTAG(SEQ?ID?NO：43)

A2-SCT-primer2：AATCAGCAAGCTTGGTACCGA(SEQ?ID?NO：44)

The HBcAg18-27 mutant primer:

A2SCT-HBcAg?18-27-1(match?1)：

AACAGAAGGAAAGAAGTCAGAAGGCAAAAAAGCCTCCAGGCCAG

AAAG(SEQ?ID?NO：45)

A2SCT-HBcAg18-27-2(match?2)：

TTTTTGCCTTCTGACTTCTTTCCTTCTGTTGGAGGTGGGGGAGGCGG

A(SEQ?ID?NO：46)

The mutant primer of HBcAg107-115

A2SCT-HBcAg107-115-1(match?1)：

AACAGTTTCTCTTCCAAAAGTAAGACAAGCCTCCAGGCCAGAAAG

(SEQ?ID?NO：47)

A2SCT-HBcAg107-115-2(match?2)：

TGTCTTACTTTTGGAAGAGAAACTGTTGGAGGTGGGGGAGGCGGA

(SEQ?ID?NO：48)

C. merge the multi-epitope recombinant DNA carrier that forms by former epi-position of multi-resistance and adjuvant

Ubiquitin can promote PD in cell, improves the working (machining) efficiency of epi-position, therefore can strengthen cellular immune function.Epi-position can be in body the generation of inducing specific CTL.We have synthesized the t cell epitope of five HBV; Be respectively the restrictive epi-position C18-27 of HLA-A2 (FLPSDFFPSV) (SEQ ID NO:72), E335-343 (WLSLLVPFV) (SEQ IDNO:73) and E183-191 (FLLTRILTI) (SEQ ID NO:74); The restrictive epi-position C88-96 of HLA-A11 (YVNVNMGLKL) (SEQ ID NO:75); The restrictive epi-position C117-125 of HLA-A24 (EYLVSFGVW) (SEQ ID NO:76), its polyphone is synthetic, and serial arrangement is as shown in Figure 5.Connect the tetanus toxoid general auxiliary epi-position of Th (QYIKANSKFIGITE) (SEQ ID NO:77) at multi-epitope sequence 5 ' end, and be connected in the reading frame, connect through connexon AAY between each epi-position with ubiquitin.The fusion gene sequence called after NHTU (SEQ ID NO:12) of design, serial arrangement is as shown in Figure 5.The synthetic DNA of expressing this serial sequence is connected in pcDNA3.1 (available from the Invitrogen) carrier for expression of eukaryon constitutes dna vaccination.With recombinant DNA immunity HLA-A2 transgenic mouse, through muscle immunity three times, can in body, effectively produce specific CTL, thereby body is produced immune protective effect.

Carrier 3: the vaccinia virus recombinant carrier that contains HBV structural antigens, adjuvant, adjuvant and structural antigens fusion gene, epi-position and multi-epitope recombinant and epi-position-MHC-I SCT, γ-IFN

The recombinant vaccinia carrier can carry multiple Expression element, and vaccinia virus can be brought out mucosal immunoreaction efficiently simultaneously, activates natural immune system.The vaccinia virus recombinant that comprises a plurality of elements can be used for independent immunity, also can be with adenovirus or/and recombinant DNA carrier immunity or immunity stage by stage.A kind of building mode that comprises the vaccinia virus recombinant of a plurality of elements is provided in the present embodiment, but element and combination of elements order that the content that this patent comprised is not limited in the disclosure to be comprised.

With the synthetic mode of full gene according to NCBI (National Center for BiotechnologyInformation; Http:// www.ncbi.nlm.nih.gov/) the 127-627 bit base in the full gene of the synthetic IFN-γ of the sequence shown in the disclosed IFN-γ (NM_000619); Wherein the front end of sequence adds 5 '-GCGAAGCTTG-3 ' sequence (SEQ ID NO:49), and the rear end of sequence adds 3 '-ACTCGAGCAT-5 ' sequence (SEQ ID NO:50).Synthetic gene inserts pMD 18T carrier (available from TAKARA), carries out sequencing.The correct gene that checks order carries out double digestion with HindIII/Xho I, inserts then in the pcDNA3.0 carrier (available from Invitrogen) of same enzyme action.Make up the carrier for expression of eukaryon of IFN-γ.PcDNA3.0-IFN-γ expression vector is inserted in the recombinant vaccinia carrier (available from Wuhan University) through double digestion and the flush endization of BglII and SmaI, makes up the vaccinia virus recombinant carrier that contains IFN-γ.

Element in present embodiment one carrier 2 is carried out enzyme action and flush endization, be connected to then on the recombinant vaccinia carrier, confirm direction of insertion through the mode of enzyme action and order-checking.The recombinant vaccinia carrier 1 μ g and the wild vaccinia virus Tiantan strain (available from Chinese CDC) that obtain (0.1MOI) are carried out homologous recombination in Vero cell (available from ATCC), pass through the expression of EGFP or the expression screening recombinant virus of genes of interest after 24 hours.Recombinant virus carries out purification through the six single speckle screenings taken turns, and the virus of purification increases in the Vero cell, and carries out purification with 36% sucrose pad.Fig. 6 A is an instance that comprises some vaccinia virus recombinant carriers of a plurality of elements, and Fig. 6 B utilizes the cocktail vaccine that contains carrier 2 and carrier 3, the recombiant plasmid pcDNA3.0-SCT-C18 intramuscular injection immune transgenic Mus of getting 100 μ g, and all backs are with 2 * 10 ^6-8The recombinant virus of PFU adopts the mode of intramuscular injection to carry out booster immunization, and the spleen cell of getting mice after the week detects the CTL that mice produced.

The comparative advantages of multichip carrier HBV therapeutic vaccine

With recombinant DNA, adenovirus and the vaccinia virus vector vaccine of above-mentioned structure, the flow process of immune HBV transgenic mouse is: first immunisation uses 2 * 10 ⁶MOI recombinant adenovirus or recombinant adenovirus storehouse RNAi interfere vaccine to reduce hbv replication; After one month with each 50 μ g (pcDNA3.0-SN and pcDNA3.0-CN) intramuscular injection immune transgenic Mus of recombinant DNA vaccine; The recombinant s protein subcutaneous injection immune transgenic Mus that is aided with gp96 and the 50 μ g of 20 μ g simultaneously, 2 of immunity all backs are with 2 * 10 for the second time ⁶The vaccinia virus recombinant of MOI carries out booster immunization.Experimental result shows: carry out just exempting from the interior HBV titre of back transgenic mouse body with recombinant adenovirus and recombinant adenovirus storehouse RNAi vaccine and reduce more than 90%; Begin to occur surface antigen and the special ctl response of cAg after the immune week for the second time; And the S antibody of generation protectiveness; The titre of HBV continues to reduce, and serum HBV DNA presents feminine gender after 2 weeks.After using vaccinia virus recombinant (containing γ-IFN, S antigen and C antigen gene) booster immunization for the third time, the antibody horizontal that surface antigen and cAg are corresponding in the serum significantly improves, and is accompanied by antigen-specific CD8 ⁺The generation of T cell and γ-IFN and to the liver internal migration, had slight ALT level improves in the serum.Treat after three months, serum HBV DNA is negative, and the ALT level is normal, and the core antigen-positive cell is negative in the liver, and cccDNA detects negative.The HBV transgenic mouse produces the comprehensive therapy effect that obviously is superior to the one pack system vaccine behind the cocktail vaccine Comprehensive Treatment.Because the application of adjuvant molecule, the antibody of generation and cellular immunization are Th1 property; Owing to the generation of γ-IFN and to the inner migration of liver, the HBV that has obtained the non-cracking performance of liver cell removes ability; Through the combined immunization of dna vaccination and vaccine vaccine, the significant polyclone CTL of generation replys in the body, and produces the memory t cell clone, thereby has further removed the infection cell of the inner trace of liver.Because the generation of protection antibody and multi-epitope CTL and immunological memory, the inner virion of HBV transgenic mouse has obtained effective removing.

2. single carrier HBV therapeutic cocktail vaccine (Fig. 7)

The HBV therapeutic cocktail vaccine that present patent application comprised also comprises the multichip carrier HBV therapeutic vaccine corresponding elements among the embodiment one is made up and the single carrier recombinant DNA, adenovirus or the vaccinia virus vector vaccine that make up.A concrete instance is a vaccinia virus recombinant as shown in Figure 7; Wherein comprise and reduce the needed RNA interference element of virus replication, γ-IFN, bring out the structural antigens gene of neutralizing antibody and polyclone CTL and the structural gene that merges with adjuvant, and the SCT etc. that brings out efficient CTL.

Single carrier HBV therapeutic vaccine that present patent application comprised also comprises the recombiant plasmid that comprises different elements that is made up of carrier of the same race or the combination of recombinant virus.

The described single carrier HBV therapeutic vaccine of present patent application has consistent inhibition virus replication and brings out immunoreactive function with multichip carrier HBV therapeutic vaccine.

Embodiment two: the therapeutic cocktail vaccine (Fig. 1) of HCV

1.HCV multichip carrier therapeutic cocktail vaccine

The multichip carrier therapeutic cocktail vaccine of the construction strategy of the multichip carrier therapeutic vaccine of HCV and method and HBV is similar, as shown in Figure 1, and wherein carrier 1 is for containing the recombinant adenovirus or the adenovirus storehouse of RNA interference element.ABC in the carrier 2 and 3 is meant IFN, the structural antigens capsid protein (core) of HCV, E1, E2, SCT and multi-epitope fusion gene that epi-position is relevant, gp96 coded sequence (SEQ ID NO:3), the optional combination of Gp96N-core/E1/E2 fusion gene.

The simple construction strategy of setting forth the recombinant relevant in the present embodiment with wherein part carrier.

Utilize with embodiment one carrier 1 same method and obtained suppressing the ordered sequence that HCV expresses: 5 ' CCCGCTCAATGCCTGGAG-3 ' (SEQ ID NO:68); Be converted into the sequence of inserting on the pAVU6+27 carrier; Acquisition has the ordered sequence (SEQ IDNO:22) that inhibition HCV duplicates; This sequence is to HCV 5 ' UTR zone, utilizes above-mentioned method packaging virus subsequent use.With Huh-mono cell (available from ATCC) is model (stably express I389/hyg-ubi/NS3-3 '/5.1HCV replicon), with this cell of packaged viral infection.The result shows: descended more than 60% by the levels of replication of HCV in the cell of viral infection, the expression of one of them important albumen HCV-NS5B has descended more than 70%.

The vaccinia virus recombinant immunity HLA-A2 transgenic mouse that will comprise the recombinant DNA vaccine of HCV structural gene and comprise γ-IFN, HCV structural gene and HCV epi-position SCT gene can produce the special polyclone ctl response of HCV efficiently.

2.HCV single vehicle treatment property cocktail vaccine (Fig. 7)

The HCV therapeutic cocktail vaccine that present patent application comprised also comprises the multichip carrier HCV therapeutic vaccine corresponding elements among the embodiment 21 is made up and the single carrier recombinant DNA, adenovirus or the vaccinia virus vector vaccine that make up.A concrete instance is a vaccinia virus recombinant as shown in Figure 7; Wherein comprise and reduce the needed RNA interference element of virus replication and γ-IFN or α-IFN; Bring out the structural antigens gene of neutralizing antibody and polyclone CTL and the structural gene that merges with adjuvant, and the SCT etc. that brings out efficient CTL.

Single carrier HCV therapeutic vaccine that this patent comprised also comprises the recombiant plasmid that comprises different elements that is made up of carrier of the same race or the combination of recombinant virus.

The described single carrier HCV therapeutic vaccine of present patent application has consistent inhibition virus replication and brings out immunoreactive function with multichip carrier HCV therapeutic vaccine.

Embodiment three: the preventative cocktail vaccine of HIV-I

The preventative cocktail vaccine of disclosed HIV is to be selected from following combination of elements and the DNA, adenovirus or the vaccinia virus vaccine that make up among the present invention: seven peptide repetitive sequence HR212 of (1) virus capable of blocking and cell fusion; (2) the adjuvant molecule of gp96 or its n terminal fragment; (3) the SCT gene that makes up of epitope, multi-epitope fusion gene and epitope-MHC-I of the fusion gene that merges of the structural antigens env of HIV, gag and pol or itself and adjuvant and/or HIV.Similar with embodiment two with embodiment one, the preventative cocktail vaccine of the disclosed HIV-1 of this patent comprises multichip carrier cocktail vaccine (Fig. 1) and single carrier cocktail vaccine (Fig. 7).The multichip carrier cocktail vaccine is meant the combination of carrier 2 and carrier 3 relevant with suppressing the HIV invasion among Fig. 1, and wherein ABC is meant IFN α or γ, gag, env, HR212, SCT, gp96, the optional combination of Gp96N-gag/env fusion gene.The preventative cocktail vaccine of single vector HIV-1 is meant the combination that element relevant in the above-mentioned multichip carrier is chosen wantonly and recombinant DNA, adenovirus or the vaccinia virus that makes up, and its main points are to comprise to suppress the relevant structural gene of HR212, neutralizing antibody and CTL that film merges and the fusion gene of structural gene and adjuvant.The preventative cocktail vaccine of single carrier wherein also comprises the combination that the identical carrier that comprises different elements is carried out.

The simple construction strategy of setting forth the recombinant relevant in the present embodiment with wherein part carrier.Utilize the method same with embodiment one; Screened the siRNA sequence (SEQ ID NO:23) that suppresses the tat gene of HIV; Changing into DNA sequence is: 5 ' AAGTGTTGCTTTCATTGCCAAGTTTGTT-3 ' (SEQ ID NO:71); Be cloned among the pshuttle, in the BJ5183 competent cell, obtain recombinant adenoviral vector, frozen subsequent use through the packaged adenovirus of GP-293 in cryogenic refrigerator.With the 293T cell is experimental model, utilizes HIVNL4.3 plasmid transfection 293T cell earlier, and the packaged adenovirus particles of transfection after 6 hours detects the effect that suppresses after 72 hours.Western blotting result shows that the proteic expression of P24 is suppressed 73%, and gag albumen is suppressed more than 60%, and Northern blotting shows that HIV-RNA is obviously suppressed.Explain that adenovirus vector-mediated RNA perturbation technique can effectively suppress important proteic expression among the HIV, and further influenced duplicating of virus.The relevant SCT recombinant DNA of HIV gag epi-position that utilizes same principle to make up also can bring out the relevant CTL effect of HIV epi-position (Fig. 4,6) efficiently with vaccinia virus vector.

The film of used HIV-1 fusion inhibition sequence is through making up recombinant DNA, adenovirus and the vaccinia virus (Fig. 8) that the eukaryotic expression system gene makes up in the present embodiment.In a concrete instance, we have selected carrier for expression of eukaryon pcDNA3.0 and pSecTag2B.

With pcDNA3.0 (Invitrogen), two carrier for expression of eukaryon of pSecTag2B (Invitrogen) make up the secretion expression carrier that contains tPA and IgG signal peptide sequence respectively.The structure of pcDNA3.0-tPA-HR212 adopts the mode of bridging PCR, and primer sequence is respectively:

Up-tPA-p1：GTCTTCGTTTCGCCCAGCTGGATGGAGTGGGACAG(SEQID?NO：51)

Up-tPA-p2：

GCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTTTCGCCCA(SEQID?NO：52)

Up-tPA-p3：GATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGC(SEQ?ID?NO：53)

Up-tPA-p4：CGCAGGATCCGCCACCATGGATGCAATGAAGAGAG(SEQID?NO：54)

Down-HR212-p1：CGCGCTCGAGCTACAATAATTCTTGTTCATTC(SEQID?NO：55)

Constructed gene structure is shown in Fig. 8 A.

The primer sequence of pSecTag2B-HR212 is following, and constructed gene structure is shown in Fig. 8 B.

Up-pSec-p1：CGCAGGATCCTGGATGGAGTGGGACAGAG(SEQ?IDNO：56)

Down-HR212-p1：CTCTGTCCCACTCCATCCAGGATCCTGCG(SEQ?IDNO：57)

Gene tPA-HR212 (SEQ ID NO:19) and pSec-HR212 that PCR obtained are carried out double digestion with BamHI/Xho I, be connected into then in the carrier for expression of eukaryon of same enzyme action, make up the eucaryon recombinant DNA of secreting, expressing.

With constructed eukaryotic expression system carrier transfection 293T cell (available from ATCC), cultivate and collect supernatant after 48-72 hour, and concentrate.The pseudovirus of packing HIV, concrete operation method are 24h before the transfection, and digestion 293T cell also reaches in the 10cm ware, and concentration is 4-5 * 10 ⁶/ ware.Behind the 24h, cell about 80% is paved with.With pNL43LucE-R (available from Invitrogen) and two plasmid co-transfection 293T of pMT3-HXB-2 (available from Invitrogen) cell, behind the transfection 48h, cell covers with and becomes circle with calcium phosphate method, and centrifugal (3000rpm * 10min) results contain HIV-1 pseudovirus supernatant.

Merge and suppress preceding 24 hours of experiment, digestion GHOST-CXCR4 (available from ATCC) cell also reaches in 24 orifice plates, and cell concentration is 8 * 10 ⁴/ hole.The supernatant of eukaryotic expression system vector expression is mixed according to 1: 1 with virus; Then mixture is inoculated in the GHOST-CXCR4 cell (available from ATCC), treat virus absorption onto cell 2h after, inhale and to abandon virus mixture; Adding fresh culture continues to cultivate; Each dilution factor is done 2 repetitions, results and cell lysis after 48-72 hour, the activity of Lampyridea luciferase in the mensuration cell conditioned medium.Experimental result is as shown in table 2.

Table 2:HR212 suppresses HIV and infects target cell

Negative	Positive	Contrast	pcDNA3.0-tPA- HR212	pSecTag2B- HR212
					72	26342	15674	6739	2384
82	16598	22252	2009	5243

Negative: GHOST-CXCR4 cell non-processor

Positive: as to insert pseudovirus in the GHOST-CXCR4 cell

Contrast: insert pseudovirus and 293 cell conditioned mediums in the GHOST-CXCR4 cell

Insert pseudovirus and transfection in the pcDNA3.0-tPA-HR212:GHOST-CXCR4 cell

293 cell conditioned mediums of pcDNA3.0-TPA-HR212

Insert pseudovirus and transfection in the pSecTag2B-HR212:GHOST-CXCR4 cell

293 cell conditioned mediums of pSecTag2B-HR212

Different with the micromolecule chemicals cocktail vaccine of the HIV that has existed, the disclosed content of present embodiment is the biological cocktail vaccine that designs according to the HIV infection characteristic.The HIV HR212 of the disclosed secreting, expressing of present embodiment can effectively suppress HIV pseudovirus the infecting target cell of packing; In addition; Because the eukaryotic vector vaccine can independently duplicate in vivo, express and correct processing purpose albumen, the characteristics of SM in the time of therefore can effectively reducing the HIV treatment.The same with the building mode of embodiment one 1B, C, the SCT DNA-vaccine vaccine that comprises HIV structural gene and comprise the HIV epitope of structure can efficiently bring out HIV in the HLA-A transgenic mouse multi-epitope CTL replys.

Embodiment four: HIV-I therapeutic cocktail vaccine

Similar with embodiment three, HIV-1 therapeutic cocktail vaccine also comprises multichip carrier therapeutic cocktail vaccine and single vehicle treatment property cocktail vaccine.Except that a plurality of elements that embodiment three is comprised, also comprise in the present embodiment and can suppress the effective RNA interference element that HIV-1 duplicates and recombinant DNA, adenovirus and the vaccinia virus of structure.

The simple construction strategy of setting forth the recombinant relevant in the present embodiment with wherein part carrier.Utilize the method same with embodiment one; Screened the siRNA sequence (SEQ ID NO:23) that suppresses the tat gene of HIV; Changing into DNA sequence is: 5 ' AAGTGTTGCTTTCATTGCCAAGTTTGTT-3 '; Be cloned among the pshuttle, in the BJ5183 competent cell, obtain recombinant adenoviral vector, frozen subsequent use through the packaged adenovirus of GP-293 in cryogenic refrigerator.With the 293T cell is experimental model, utilizes HIVNL4.3 plasmid transfection 293T cell earlier, and the packaged adenovirus particles of transfection after 6 hours detects the effect that suppresses after 72 hours.Western blotting result shows that the proteic expression of P24 is suppressed 73%, and gag albumen is suppressed more than 60%, and Northern blotting shows that HIV-RNA is obviously suppressed.Explain that adenovirus vector-mediated RNA perturbation technique can effectively suppress important proteic expression among the HIV, and further influenced duplicating of virus.The same with the preventative cocktail vaccine of HIV, the recombinant DNA-vaccine vaccine that comprises fusion gene, HIV multi-epitope adjuvant fusion gene and the HIV epi-position-SCT of HIV structural antigens, structural antigens and adjuvant can efficiently bring out multi-epitope CTL effect in the HLA-A2 transgenic mouse.

List of references

Payette，P.J.，X.Ma，et?al.(2006).″Testing?of?CpG-optimized?protein?and?DNAvaccines?against?the?hepatitis?B?virus?in?chimpanzees?for?immunogenicityand?protection?from?challenge.″Intervirology?49(3)：144-51.

Seeger，C.and?W.S.Mason(2000).″Hepatitis?B?virus?biology.″Microbiol?MolBiol?Rev?64(1)：51-68.

Yang，S.H.，C.G.Lee，et?al.(2006).″Correlation?of?antiviral?T-cell?responseswith?suppression?of?viral?rebound?in?chronic?hepatitis?B?carriers：aproof-of-concept?study.″Gene?Ther.

Zhao，Y.G.，B.Peng，et?al.(2006).″Anti-HBV?immune?responses?in?rhesusmacaquese?elicited?by?electroporation?mediated?DNA?vaccination.″Vaccine?24(7)：897-903.

Manns?MP，McHutchinson?JG，Gordon?SC，et?al.Peginterferon?alpha-2b?incombination?with?ribavirin?compared?with?interferon?alpha-2b?plusribavirin?for?initial?treatment?of?chronic?hepatitis?C：results?of?arandomized?trial.Lancet，2001，358：958-965.

Lee?SW，Cho?JH，Sung?YC.Optimal?induction?of?hepatitis?C?virus?envelope-specific?immunity.J?Virol，1998，72：8430-8436.

Foms?X，Emerson?SU，Tobin?GJ，et?al.DNA?immunization?of?mice?andmacaques?with?plasmids?encoding?hepatitis?C?virus?envelope?E2?proteinexpressed?intracellularly?and?on?the?cell?surface.Vaccine，1999，17：1992-2002.Zhou?YH，Shimizu?YK，Esumi?M.Monoclonal?antibodiesto?the?hypervariable?region?1?of?hepatitis?C?virus?capture?virus?and?inhibitvirus?adsorption?to?susceptible?cells?in?vitro.Virology，2000，269(2)：276-283

Jiao?X，Wang?RY，Feng?Z，et?al.DNA?immunization?encoding?the?secretednonstructural?protein?3(NS3)of?hepatitis?C?virus?and?enhancing?the?Th1type?immune?response.J?Viral?Hepat，2004，11(1)：18-26.

Inchauspe?G，Feinstone?S.Development?of?a?hepatitis?C?virus?vaccine.ClinLiver?Dis，2003，7：243-259

Baba，T.W.，Liska，V.，Khimani，A.H.，et?al.Live?attenuated，multiply?deletedsimian?immunodeficiency?virus?causes?AIDS?in?infant?and?adultmacaques.Nat.Med.，1999，5：194-203.

Bruyn，G.，Rossini，A.J.，Chiu，Y.L.，et?al.Safety?profile?of?recombinantcanarypox?HIV?vaccines.Vaccine，2004，22(5～6)：704～713.

Dennis，R.B.，Ronald，C.D.，Robert，W.D.，et?al.Enhanced：A?sound?rationaleneeded?for?phase?III?HIV-1?vaccine?trials.Science，2004，303：316.

Egan，M.A.，Charini，W.A.，Kuroda，M.J.，et?al.Simian?immunodeficiency?virus(SIV)gag?DNA?vaccinated?rhesus?monkeys?develop?secondary?cytotoxicT-lymphocyte?responses?and?control?viral?replication?after?pathogenicSIV?infection.J.Virol.，2000，74：7485-7495.

Qing?Fang，Lin?Yang，Weijun?Zhu，et?al.Host?range，growth?property，andvirulence?of?the?smallpox?vaccine：Vaccinia?virus?Tian?Tan?strain.

Virology，2005，335：242-251.

Xiao Yao, Fan Xiujuan. Chinese HIV-1B hypotype P55 and chimeric P55-V3 virus-like particle candidate vaccine Immunogenicity Study. viral journal, 2000,16 (4): 313～316.

Sequence table

< 110>Institute of Microorganism, Academia Sinica

< 120>cocktail vaccine of a kind of anti immune tolerance and immunodeficiency virus and application thereof

<130>IBO67386

<160>77

<170>PatentIn?version?3.1

<210>1

<211>1071

<212>DNA

< 213>mice

<220>

<221>CDS

<222>(1)..(1071)

<223>

<400>1

atggathatg?aagtcgacgt?ggatggcaca?gtggaagagg?acctgggtaa?aagccgagaa 60

ggctcaagga?cagatgatga?agttgtgcag?agagaggaag?aagctattca?gttggatggg 120

ttaaacgcat?cacagataag?agaacttaga?gaaaaatctg?aaaagttcgc?cttccaagct 180

gaagtgaaca?ggatgatgaa?acttatcatc?aattctttgt?ataaaaataa?agagattttc 240

ctgagagaac?tgatttcaaa?tgcttctgat?gctttagaca?agataaggct?catctcccta 300

actgatgaaa?atgcactcgc?tggaaatgag?gagttaacgg?tcaagattaa?gtgtgacaaa 360

gagaaaaacc?tgctgcatgt?cacagacacg?ggtgtaggaa?tgactagaga?ggagttggtt 420

aaaaatctcg?gcaccatagc?caaatctgga?acaagcgagt?ttttaaacaa?aatgacagaa 480

gctcaagaag?atggtcagtc?aacctctgaa?ctgattggcc?agtttggtgt?cggtttttat 540

tctgccttcc?ttgtagcaga?taaggtcatt?gtcacatcga?aacacaacaa?tgatacccag 600

cacatctggg?aatcagactc?caatgaattc?tctgtaattg?ctgacccaag?aggaaacaca 660

ctaggtcgtg?gaacaacaat?tactcttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 720

ttggacacaa?ttaaaaatct?cgtcaggaag?tactctcagt?tcatcaactt?tcccatctac 780

gtgtggagta?gcaagacaga?gactgttgag?gagcccttgg?aagaagatga?agcagcaaaa 840

gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aggaagaaga?agaaaagaaa 900

ccaaaaacta?agaaagttga?aaaaactgtg?tgggattggg?aacttatgaa?tgatatcaaa 960

ccaatatggc?agagaccatc?caaagaagta?gaagaagacg?aatacaaagc?tttctacaaa 1020

tcattttcaa?aggaaagtga?tgaccccatg?gcttatatcc?acttcactta?a 1071

<210>2

<211>1071

<212>DNA

< 213>people

<220>

<221>CDS

<222>(1)..(1071)

<223>

<400>2

atggacgatg?aagttgatgt?ggatggtaca?gtagaagagg?atctgggtaa?aagtagagaa 60

ggatcaagga?cggatgatga?agtagtacag?agagaggaag?aagctattca?gttggatgga 120

ttaaatgcat?cacaaataag?agaacttaga?gagaagtcgg?aaaagtttgc?cttccaagcc 180

gaagttaaca?gaatgatgaa?acttatcatc?aattcattgt?ataaaaataa?agagattttc 240

ctgagagaac?tgatttcaaa?tgcttctgat?gctttagata?agataaggct?aatatcactg 300

actgatgaaa?atgctctttc?tggaaatgag?gaactaacag?tcaaaattaa?gtgtgataag 360

gagaagaacc?tgctgcatgt?cacagacacc?ggtgtaggaa?tgaccagaga?agagttggtt 420

aaaaaccttg?gtaccatagc?caaatctggg?acaagcgagt?ttttaaacaa?aatgactgaa 480

gcacaggaag?atggccagtc?aacttctgaa?ttgattggcc?agtttggtgt?cggtttctat 540

tccgccttcc?ttgtagcaga?taaggttatt?gtcacttcaa?aacacaacaa?cgatacccag 600

cacatctggg?agtctgactc?caatgaattt?tctgtaattg?ctgacccaag?aggaaacact 660

ctaggacggg?gaacgacaat?tacccttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 720

ttggatacaa?ttaaaaatct?cgtcaaaaaa?tattcacagt?tcataaactt?tcctatttat 780

gtatggagca?gcaagactga?aactgttgag?gagcccatgg?aggaagaaga?agcagccaaa 840

gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aagaagaaga?agaaaagaaa 900

ccaaagacta?aaaaagttga?aaaaactgtc?tgggactggg?aacttatgaa?tgatatcaaa 960

ccaatatggc?agagaccatc?aaaagaagta?gaagaagatg?aatacaaagc?tttctacaaa 1020

tcattttcaa?aggaaagtga?tgaccccatg?gcttatattc?actttactta?a 1071

<210>3

<211>2352

<212>DNA

< 213>people

<220>

<221>CDS

<222>(1)..(2352)

<223>

<400>3

atggacgatg?aagttgatgt?ggatggtaca?gtagaagagg?atctgggtaa?aagtagagaa 60

ggatcaagga?cggatgatga?agtagtacag?agagaggaag?aagctattca?gttggatgga 120

ttaaatgcat?cacaaataag?agaacttaga?gagaagtcgg?aaaagtttgc?cttccaagcc 180

gaagttaaca?gaatgatgaa?acttatcatc?aattcattgt?ataaaaataa?agagattttc 240

ctgagagaac?tgatttcaaa?tgcttctgat?gctttagata?agataaggct?aatatcactg 300

actgatgaaa?atgctctttc?tggaaatgag?gaactaacag?tcaaaattaa?gtgtgataag 360

gagaagaacc?tgctgcatgt?cacagacacc?ggtgtaggaa?tgaccagaga?agagttggtt 420

aaaaaccttg?gtaccatagc?caaatctggg?acaagcgagt?ttttaaacaa?aatgactgaa 480

gcacaggaag?atggccagtc?aacttctgaa?ttgattggcc?agtttggtgt?cggtttctat 540

tccgccttcc?ttgtagcaga?taaggttatt?gtcacttcaa?aacacaacaa?cgatacccag 600

cacatctggg?agtctgactc?caatgaattt?tctgtaattg?ctgacccaag?aggaaacact 660

ctaggacggg?gaacgacaat?tacccttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 720

ttggatacaa?ttaaaaatct?cgtcaaaaaa?tattcacagt?tcataaactt?tcctatttat 780

gtatggagca?gcaagactga?aactgttgag?gagcccatgg?aggaagaaga?agcagccaaa 840

gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aagaagaaga?agaaaagaaa 900

ccaaagacta?aaaaagttga?aaaaactgtc?tgggactggg?aacttatgaa?tgatatcaaa 960

ccaatatggc?agagaccatc?aaaagaagta?gaagaagatg?aatacaaagc?tttctacaaa 1020

tcattttcaa?aggaaagtga?tgaccccatg?gcttatattc?actttactgc?tgaaggggaa 1080

gttaccttca?aatcaatttt?atttgtaccc?acatctgctc?cacgtggtct?gtttgacgaa 1140

tatggatcta?aaaagagcga?ttacattaag?ctctatgtgc?gccgtgtatt?catcacagac 1200

gacttccatg?atatgatgcc?taaatacctc?aattttgtca?agggtgtggt?ggactcagat 1260

gatctcccct?tgaatgtttc?ccgcgagact?cttcagcaac?ataaactgct?taaggtgatt 1320

aggaagaagc?ttgttcgtaa?aacgctggac?atgatcaaga?agattgctga?tgataaatac 1380

aatgatactt?tttggaaaga?atttggtacc?aacatcaagc?ttggtgtgat?tgaagaccac 1440

tcgaatcgaa?cacgtcttgc?taaacttctt?aggttccagt?cttctcatca?tccaactgac 1500

attactagcc?tagaccagta?tgtggaaaga?atgaaggaaa?aacaagacaa?aatctacttc 1560

atggctgggt?ccagcagaaa?agaggctgaa?tcttctccat?ttgttgagcg?acttctgaaa 1620

aagggctatg?aagttattta?cctcacagaa?cctgtggatg?aatactgtat?tcaggccctt 1680

cccgaatttg?atgggaagag?gttccagaat?gttgccaagg?aaggagtgaa?gttcgatgaa 1740

agtgagaaaa?ctaaggagag?tcgtgaagca?gttgagaaag?aatttgagcc?tctgctgaat 1800

tggatgaaag?ataaagccct?taaggacaag?attgaaaagg?ctgtggtgtc?tcagcgcctg 1860

acagaatctc?cgtgtgcttt?ggtggccagc?cagtacggat?ggtctggcaa?catggagaga 1920

atcatgaaag?cacaagcgta?ccaaacgggc?aaggacatct?ctacaaatta?ctatgcgagt 1980

cagaagaaaa?catttgaaat?taatcccaga?cacccgctga?tcagagacat?gcttcgacga 2040

attaaggaag?atgaagatga?taaaacagtt?ttggatcttg?ctgtggtttt?gtttgaaaca 2100

gcaacgcttc?ggtcagggta?tcttttacca?gacactaaag?catatggaga?tagaatagaa 2160

agaatgcttc?gcctcagttt?gaacattgac?cctgatgcaa?aggtggaaga?agagcccgaa 2220

gaagaacctg?aagagacagc?agaagacaca?acagaagaca?cagagcaaga?cgaagatgaa 2280

gaaatggatg?tgggaacaga?tgaagaagaa?gaaacagcaa?aggaatctac?agctgaaaaa 2340

gatgaattgt?aa 2352

<210>4

<211>450

<212>DNA

< 213>hepatitis B virus

<220>

<221>CDS

<222>(1)..(450)

<223>

<400>4

atgcaacttt?ttgaattctg?cctaatcatc?tcatgttcat?gtcctactgt?tcaagcctcc 60

aagctgtgcc?ttgggtggct?ttggggcatg?gacattgacc?cgtataaaga?atttggagct 120

tctgtggagt?tactctcttt?tttgccttct?gacttctttc?cttctgttcg?agagcttctc 180

gacaccgcct?ctgctctgta?tcgggaggcc?ttagagtctc?cggaacattg?ttcacctcat 240

catacggcac?tcaggcaagc?tattctgtgt?tgggttgagt?tgatgaatct?agccacctgg 300

gtgggaagta?atttggaaga?cccagcatcc?agggaattgg?tagtcagcca?tgtcaatgtt 360

aatatgggcc?taaaaatcag?acaactattg?tggtttcaca?tttcctgtct?tacttttgga 420

agagaaactg?ttcttgaata?tttggtgtaa 450

<210>5

<211>681

<212>DNA

< 213>hepatitis B virus

<220>

<221>CDS

<222>(1)..(681)

<223>

<400>5

atggagaaca?tcgcatcagg?actcctagga?cccctgctcg?tgttacaggc?ggggtttttc 60

tcgttgacaa?aaatcctcac?aataccacag?agtctagact?cgttgtggac?ttctctcaat 120

tttctagggg?aaacacccgt?gtgtcttggc?caaaattcgc?agtcccaaat?ctccagtcac 180

tcactaactt?gttgtcctcc?aatttgtcct?ggttatcgct?ggatgtgtct?gcggcgtttt 240

atcatcttcc?tctgcatcct?gctgctatgc?ctcatcttct?tgttggttct?tctggactat 300

caaggtatgt?tgcccgtttg?tcctctaatt?ccaggatcat?caaccaccag?caccggacca 360

tgcagaacct?gcacgactcc?tgctcaagga?acctctatgt?ttccctcatg?ttgctgtaca 420

aaacctacgg?acggaaactg?cacctgtatt?cccatcccat?catcttgggc?tttcgcaaaa 480

tacctatggg?agtgggcctc?agtccgtttc?tcttggctca?gtttactagt?gccatttgtt 540

cagtggttcg?tagggctttc?ccccactgtc?tggctttcag?ttatatggat?gatgtggtat 600

tgggggccaa?gtctgtacaa?catcttgagt?ccctttatgc?cgctgttacc?aattttcttt 660

tgtctttggg?tatacattta?a 681

<210>6

<211>846

<212>DNA

< 213>hepatitis B virus

<220>

<221>CDS

<222>(1)..(846)

<223>

<400>6

atgcagtgga?attccacaac?ctttcaccaa?actctgcaag?atcccagagt?gagaggcctg 60

tatttccctg?ctggtggctc?cagttcagga?gcagtaaacc?ctgttccgac?tactgcctct 120

cccttatcgt?caatcttctc?gaggattggg?gaccctgcgc?tgaacatgga?gaacatcaca 180

tcaggattcc?taggacccct?tctcgtgtta?caggcggggt?ttttcttgtt?gacaagaatc 240

ctcacaatac?cgcagagtct?agactcgtgg?tggacttctc?tcaattttct?agggggaact 300

accgtgtgtc?ttggccaaaa?ttcgcagtcc?ccaacctcca?atcactcacc?aacctcctgt 360

cctccaactt?gtcctggtta?tcgctggatg?tgtctgcggc?gttttatcat?cttcctcttc 420

atcctgctgc?tatgcctcat?cttcttgttg?gttcttctgg?actatcaagg?tatgttgccc 480

gtttgtcctc?taattccagg?atcctcaacc?accagcacgg?gaccatgccg?aacctgcatg 540

actactgctc?aaggaacctc?tatgtatccc?tcctgttgct?gtaccaaacc?ttcggacgga 600

aattgcacct?gtattcccat?cccatcatcc?tgggctttcg?gaaaattcct?atgggagtgg 660

gcctcagccc?gtttctcctg?gctcagttta?ctagtgccat?ttgttcagtg?gttcgtaggg 720

ctttccccca?ctgtttggct?ttcagttata?tggatgatgt?ggtattgggg?gccaagtctg 780

tacagcatct?tgagtccctt?tttaccgctg?ttaccaattt?tcttttgtct?ttgggtatac 840

atttaa 846

<210>7

<211>1530

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1530)

<223>

<400>7

atgcaacttt?ttgaattctg?cctaatcatc?tcatgttcat?gtcctactgt?tcaagcctcc 60

aagctgtgcc?ttgggtggct?ttggggcatg?gacattgacc?cgtataaaga?atttggagct 120

tctgtggagt?tactctcttt?tttgccttct?gacttctttc?cttctgttcg?agagcttctc 180

gacaccgcct?ctgctctgta?tcgggaggcc?ttagagtctc?cggaacattg?ttcacctcat 240

catacggcac?tcaggcaagc?tattctgtgt?tgggttgagt?tgatgaatct?agccacctgg 300

gtgggaagta?atttggaaga?cccagcatcc?agggaattgg?tagtcagcca?tgtcaatgtt 360

aatatgggcc?taaaaatcag?acaactattg?tggtttcaca?tttcctgtct?tacttttgga 420

agagaaactg?ttcttgaata?tttggtgggt?tcctctggag?gtgatgatga?agtcgacgtg 480

gatggcacag?tggaagagga?cctgggtaaa?agccgagaag?gctcaaggac?agatgatgaa 540

gttgtgcaga?gagaggaaga?agctattcag?ttggatgggt?taaacgcatc?acagataaga 600

gaacttagag?aaaaatctga?aaagttcgcc?ttccaagctg?aagtgaacag?gatgatgaaa 660

cttatcatca?attctttgta?taaaaataaa?gagattttcc?tgagagaact?gatttcaaat 720

gcttctgatg?ctttagacaa?gataaggctc?atctccctaa?ctgatgaaaa?tgcactcgct 780

ggaaatgagg?agttaacggt?caagattaag?tgtgacaaag?agaaaaacct?gctgcatgtc 840

acagacacgg?gtgtaggaat?gactagagag?gagttggtta?aaaatctcgg?caccatagcc 900

aaatctggaa?caagcgagtt?tttaaacaaa?atgacagaag?ctcaagaaga?tggtcagtca 960

acctctgaac?tgattggcca?gtttggtgtc?ggtttttatt?ctgccttcct?tgtagcagat 1020

aaggtcattg?tcacatcgaa?acacaacaat?gatacccagc?acatctggga?atcagactcc 1080

aatgaattct?ctgtaattgc?tgacccaaga?ggaaacacac?taggtcgtgg?aacaacaatt 1140

actcttgtct?taaaagaaga?agcatctgat?taccttgaat?tggacacaat?taaaaatctc 1200

gtcaggaagt?actctcagtt?catcaacttt?cccatctacg?tgtggagtag?caagacagag 1260

actgttgagg?agcccttgga?agaagatgaa?gcagcaaaag?aagagaaaga?agaatctgat 1320

gatgaagctg?cagtagagga?ggaagaagaa?gaaaagaaac?caaaaactaa?gaaagttgaa 1380

aaaactgtgt?gggattggga?acttatgaat?gatatcaaac?caatatggca?gagaccatcc 1440

aaagaagtag?aagaagacga?atacaaagct?ttctacaaat?cattttcaaa?ggaaagtgat 1500

gaccccatgg?cttatatcca?cttcacttaa 1530

<210>8

<211>1761

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1761)

<223>

<400>8

atggagaaca?tcgcatcagg?actcctagga?cccctgctcg?tgttacaggc?ggggtttttc 60

tcgttgacaa?aaatcctcac?aataccacag?agtctagact?cgttgtggac?ttctctcaat 120

tttctagggg?aaacacccgt?gtgtcttggc?caaaattcgc?agtcccaaat?ctccagtcac 180

tcactaactt?gttgtcctcc?aatttgtcct?ggttatcgct?ggatgtgtct?gcggcgtttt 240

atcatcttcc?tctgcatcct?gctgctatgc?ctcatcttct?tgttggttct?tctggactat 300

caaggtatgt?tgcccgtttg?tcctctaatt?ccaggatcat?caaccaccag?caccggacca 360

tgcagaacct?gcacgactcc?tgctcaagga?acctctatgt?ttccctcatg?ttgctgtaca 420

aaacctacgg?acggaaactg?cacctgtatt?cccatcccat?catcttgggc?tttcgcaaaa 480

tacctatggg?agtgggcctc?agtccgtttc?tcttggctca?gtttactagt?gccatttgtt 540

cagtggttcg?tagggctttc?ccccactgtc?tggctttcag?ttatatggat?gatgtggtat 600

tgggggccaa?gtctgtacaa?catcttgagt?ccctttatgc?cgctgttacc?aattttcttt 660

tgtctttggg?tatacattgg?ttcctctgga?ggtgatgatg?aagtcgacgt?ggatggcaca 720

gtggaagagg?acctgggtaa?aagccgagaa?ggctcaagga?cagatgatga?agttgtgcag 780

agagaggaag?aagctattca?gttggatggg?ttaaacgcat?cacagataag?agaacttaga 840

gaaaaatctg?aaaagttcgc?cttccaagct?gaagtgaaca?ggatgatgaa?acttatcatc 900

aattctttgt?ataaaaataa?agagattttc?ctgagagaac?tgatttcaaa?tgcttctgat 960

gctttagaca?agataaggct?catctcccta?actgatgaaa?atgcactcgc?tggaaatgag 1020

gagttaacgg?tcaagattaa?gtgtgacaaa?gagaaaaacc?tgctgcatgt?cacagacacg 1080

ggtgtaggaa?tgactagaga?ggagttggtt?aaaaatctcg?gcaccatagc?caaatctgga 1140

acaagcgagt?ttttaaacaa?aatgacagaa?gctcaagaag?atggtcagtc?aacctctgaa 1200

ctgattggcc?agtttggtgt?cggtttttat?tctgccttcc?ttgtagcaga?taaggtcatt 1260

gtcacatcga?aacacaacaa?tgatacccag?cacatctggg?aatcagactc?caatgaattc 1320

tctgtaattg?ctgacccaag?aggaaacaca?ctaggtcgtg?gaacaacaat?tactcttgtc 1380

ttaaaagaag?aagcatctga?ttaccttgaa?ttggacacaa?ttaaaaatct?cgtcaggaag 1440

tactctcagt?tcatcaactt?tcccatctac?gtgtggagta?gcaagacaga?gactgttgag 1500

gagcccttgg?aagaagatga?agcagcaaaa?gaagagaaag?aagaatctga?tgatgaagct 1560

gcagtagagg?aggaagaaga?agaaaagaaa?ccaaaaacta?agaaagttga?aaaaactgtg 1620

tgggattggg?aacttatgaa?tgatatcaaa?ccaatatggc?agagaccatc?caaagaagta 1680

gaagaagacg?aatacaaagc?tttctacaaa?tcattttcaa?aggaaagtga?tgaccccatg 1740

gcttatatcc?acttcactta?a 1761

<210>9

<211>1761

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1761)

<223>

<400>9

atggagaaca?tcgcatcagg?actcctagga?cccctgctcg?tgttacaggc?ggggtttttc 60

tcgttgacaa?aaatcctcac?aataccacag?agtctagact?cgttgtggac?ttctctcaat 120

tttctagggg?aaacacccgt?gtgtcttggc?caaaattcgc?agtcccaaat?ctccagtcac 180

tcactaactt?gttgtcctcc?aatttgtcct?ggttatcgct?ggatgtgtct?gcggcgtttt 240

atcatcttcc?tctgcatcct?gctgctatgc?ctcatcttct?tgttggttct?tctggactat 300

caaggtatgt?tgcccgtttg?tcctctaatt?ccaggatcat?caaccaccag?caccggacca 360

tgcagaacct?gcacgactcc?tgctcaagga?acctctatgt?ttccctcatg?ttgctgtaca 420

aaacctacgg?acggaaactg?cacctgtatt?cccatcccat?catcttgggc?tttcgcaaaa 480

tacctatggg?agtgggcctc?agtccgtttc?tcttggctca?gtttactagt?gccatttgtt 540

cagtggttcg?tagggctttc?ccccactgtc?tggctttcag?ttatatggat?gatgtggtat 600

tgggggccaa?gtctgtacaa?catcttgagt?ccctttatgc?cgctgttacc?aattttcttt 660

tgtctttggg?tatacattgg?ttcctctgga?ggtgacgatg?aagttgatgt?ggatggtaca 720

gtagaagagg?atctgggtaa?aagtagagaa?ggatcaagga?cggatgatga?agtagtacag 780

agagaggaag?aagctattca?gttggatgga?ttaaatgcat?cacaaataag?agaacttaga 840

gagaagtcgg?aaaagtttgc?cttccaagcc?gaagttaaca?gaatgatgaa?acttatcatc 900

aattcattgt?ataaaaataa?agagattttc?ctgagagaac?tgatttcaaa?tgcttctgat 960

gctttagata?agataaggct?aatatcactg?actgatgaaa?atgctctttc?tggaaatgag?1020

gaactaacag?tcaaaattaa?gtgtgataag?gagaagaacc?tgctgcatgt?cacagacacc?1080

ggtgtaggaa?tgaccagaga?agagttggtt?aaaaaccttg?gtaccatagc?caaatctggg?1140

acaagcgagt?ttttaaacaa?aatgactgaa?gcacaggaag?atggccagtc?aacttctgaa?1200

ttgattggcc?agtttggtgt?cggtttctat?tccgccttcc?ttgtagcaga?taaggttatt?1260

gtcacttcaa?aacacaacaa?cgatacccag?cacatctggg?agtctgactc?caatgaattt?1320

tctgtaattg?ctgacccaag?aggaaacact?ctaggacggg?gaacgacaat?tacccttgtc?1380

ttaaaagaag?aagcatctga?ttaccttgaa?ttggatacaa?ttaaaaatct?cgtcaaaaaa 1440

tattcacagt?tcataaactt?tcctatttat?gtatggagca?gcaagactga?aactgttgag 1500

gagcccatgg?aggaagaaga?agcagccaaa?gaagagaaag?aagaatctga?tgatgaagct 1560

gcagtagagg?aagaagaaga?agaaaagaaa?ccaaagacta?aaaaagttga?aaaaactgtc 1620

tgggactggg?aacttatgaa?tgatatcaaa?ccaatatggc?agagaccatc?aaaagaagta 1680

gaagaagatg?aatacaaagc?tttctacaaa?tcattttcaa?aggaaagtga?tgaccccatg 1740

gcttatatt?cactttactta?a 1761

<210>10

<211>1926

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1926)

<223>

<400>10

atgcagtgga?attccacaac?ctttcaccaa?actctgcaag?atcccagagt?gagaggcctg 60

tatttccctg?ctggtggctc?cagttcagga?gcagtaaacc?ctgttccgac?tactgcctct 120

cccttatcgt?caatcttctc?gaggattggg?gaccctgcgc?tgaacatgga?gaacatcaca 180

tcaggattcc?taggacccct?tctcgtgtta?caggcggggt?ttttcttgtt?gacaagaatc 240

ctcacaatac?cgcagagtct?agactcgtgg?tggacttctc?tcaattttct?agggggaact 300

accgtgtgtc?ttggccaaaa?ttcgcagtcc?ccaacctcca?atcactcacc?aacctcctgt 360

cctccaactt?gtcctggtta?tcgctggatg?tgtctgcggc?gttttatcat?cttcctcttc 420

atcctgctgc?tatgcctcat?cttcttgttg?gttcttctgg?actatcaagg?tatgttgccc 480

gtttgtcctc?taattccagg?atcctcaacc?accagcacgg?gaccatgccg?aacctgcatg 540

actactgctc?aaggaacctc?tatgtatccc?tcctgttgct?gtaccaaacc?ttcggacgga 600

aattgcacct?gtattcccat?cccatcatcc?tgggctttcg?gaaaattcct?atgggagtgg 660

gcctcagccc?gtttctcctg?gctcagttta?ctagtgccat?ttgttcagtg?gttcgtaggg 720

ctttccccca?ctgtttggct?ttcagttata?tggatgatgt?ggtattgggg?gccaagtctg 780

tacagcatct?tgagtccctt?tttaccgctg?ttaccaattt?tcttttgtct?ttgggtatac 840

attggttcct?ctggaggtga?tgatgaagtc?gacgtggatg?gcacagtgga?agaggacctg 900

ggtaaaagcc?gagaaggctc?aaggacagat?gatgaagttg?tgcagagaga?ggaagaagct 960

attcagttgg?atgggttaaa?cgcatcacag?ataagagaac?ttagagaaaa?atctgaaaag?1020

ttcgccttcc?aagctgaagt?gaacaggatg?atgaaactta?tcatcaattc?tttgtataaa?1080

aataaagaga?ttttcctgag?agaactgatt?tcaaatgctt?ctgatgcttt?agacaagata?1140

aggctcatct?ccctaactga?tgaaaatgca?ctcgctggaa?atgaggagtt?aacggtcaag?1200

attaagtgtg?acaaagagaa?aaacctgctg?catgtcacag?acacgggtgt?aggaatgact 1260

agagaggagt?tggttaaaaa?tctcggcacc?atagccaaat?ctggaacaag?cgagttttta 1320

aacaaaatga?cagaagctca?agaagatggt?cagtcaacct?ctgaactgat?tggccagttt 1380

ggtgtcggtt?tttattctgc?cttccttgta?gcagataagg?tcattgtcac?atcgaaacac 1440

aacaatgata?cccagcacat?ctgggaatca?gactccaatg?aattctctgt?aattgctgac 1500

ccaagaggaa?acacactagg?tcgtggaaca?acaattactc?ttgtcttaaa?agaagaagca 1560

tctgattacc?ttgaattgga?cacaattaaa?aatcttgtca?ggaagtactc?tcagttcatc 1620

aactttccca?tctacgtgtg?gagtagcaag?acagagactg?ttgaggagcc?cttggaagaa 1680

gatgaagcag?caaaagaaga?gaaagaagaa?tctgatgatg?aagctgcagt?agaggaggaa 1740

gaagaagaaa?agaaaccaaa?aactaagaaa?gttgaaaaaa?ctgtgtggga?ttgggaactt 1800

atgaatgata?tcaaaccaat?atggcagaga?ccatccaaag?aagtagaaga?agacgaatac 1860

aaagctttct?acaaatcatt?ttcaaaggaa?agtgatgacc?ccatggctta?tatccacttc 1920

actt?aa 1926

<210>11

<211>1926

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1926)

<223>

<400>11

atggatgatg?aagtcgacgt?ggatggcaca?gtggaagagg?acctgggtaa?aagccgagaa 60

ggctcaagga?cagatgatga?agttgtgcag?agagaggaag?aagctattca?gttggatggg 120

ttaaacgcat?cacagataag?agaacttaga?gaaaaatctg?aaaagttcgc?cttccaagct 180

gaagtgaaca?ggatgatgaa?acttatcatc?aattctttgt?ataaaaataa?agagattttc 240

ctgagagaac?tgatttcaaa?tgcttctgat?gctttagaca?agataaggct?catctcccta 300

actgatgaaa?atgcactcgc?tggaaatgag?gagttaacgg?tcaagattaa?gtgtgacaaa 360

gagaaaaacc?tgctgcatgt?cacagacacg?ggtgtaggaa?tgactagaga?ggagttggtt 420

aaaaatctcg?gcaccatagc?caaatctgga?acaagcgagt?ttttaaacaa?aatgacagaa 480

gctcaagaag?atggtcagtc?aacctctgaa?ctgattggcc?agtttggtgt?cggtttttat 540

tctgccttcc?ttgtagcaga?taaggtcatt?gtcacatcga?aacacaacaa?tgatacccag 600

cacatctggg?aatcagactc?caatgaattc?tctgtaattg?ctgacccaag?aggaaacaca 660

ctaggtcgtg?gaacaacaat?tactcttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 720

ttggacacaa?ttaaaaatct?tgtcaggaag?tactctcagt?tcatcaactt?tcccatctac 780

gtgtggagta?gcaagacaga?gactgttgag?gagcccttgg?aagaagatga?agcagcaaaa 840

gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aggaagaaga?agaaaagaaa 900

ccaaaaacta?agaaagttga?aaaaactgtg?tgggattggg?aacttatgaa?tgatatcaaa 960

ccaatatggc?agagaccatc?caaagaagta?gaagaagacg?aatacaaagc?tttctacaaa 1020

tcattttcaa?aggaaagtga?tgaccccatg?gcttatatcc?acttcactgg?ttcctctgga 1080

ggtcagtgga?attccacaac?ctttcaccaa?actctgcaag?atcccagagt?gagaggcctg 1140

tatttccctg?ctggtggctc?cagttcagga?gcagtaaacc?ctgttccgac?tactgcctct 1200

cccttatcgt?caatcttctc?gaggattggg?gaccctgcgc?tgaacatgga?gaacatcaca 1260

tcaggattcc?taggacccct?tctcgtgtta?caggcggggt?ttttcttgtt?gacaagaatc 1320

ctcacaatac?cgcagagtct?agactcgtgg?tggacttct?ctcaattttct?agggggaact 1380

accgtgtgtc?ttggccaaaa?ttcgcagtcc?ccaacctcca?atcactcacc?aacctcctgt 1440

cctccaactt?gtcctggtta?tcgctggatg?tgtctgcggc?gttttatcat?cttcctcttc 1500

atcctgctgc?tatgcctcat?cttcttgttg?gttcttctgg?actatcaagg?tatgttgccc 1560

gtttgtcctc?taattccagg?atcctcaacc?accagcacgg?gaccatgccg?aacctgcatg 1620

actactgctc?aaggaacctc?tatgtatccc?tcctgttgct?gtaccaaacc?ttcggacgga 1680

aattgcacct?gtattcccat?cccatcatcc?tgggctttcg?gaaaattcct?atgggagtgg 1740

gcctcagccc?gtttctcctg?gctcagttta?ctagtgccat?ttgttcagtg?gttcgtaggg 1800

ctttccccca?ctgtttggct?ttcagttata?tggatgatgt?ggtattgggg?gccaagtctg 1860

tacagcatct?tgagtccctt?tttaccgctg?ttaccaattt?tcttttgtct?ttgggtatac 1920

attt?aa 1926

<210>12

<211>1440

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1440)

<223>

<400>12

atggacgatg?aagttgatgt?ggatggtaca?gtagaagagg?atctgggtaa?aagtagagaa 60

ggatcaagga?cggatgatga?agtagtacag?agagaggaag?aagctattca?gttggatgga 120

ttaaatgcat?cacaaataag?agaacttaga?gagaagtcgg?aaaagtttgc?cttccaagcc 180

gaagttaaca?gaatgatgaa?acttatcatc?aattcattgt?ataaaaataa?agagattttc 240

ctgagagaac?tgatttcaaa?tgcttctgat?gctttagata?agataaggct?aatatcactg 300

actgatgaaa?atgctctttc?tggaaatgag?gaactaacag?tcaaaattaa?gtgtgataag 360

gagaagaacc?tgctgcatgt?cacagacacc?ggtgtaggaa?tgaccagaga?agagttggtt 420

aaaaaccttg?gtaccatagc?caaatcaggg?acaagcgagt?ttttaaacaa?aatgactgaa 480

gcacaggaag?atggccagtc?aacttctgaa?ttgattggcc?agtttggtgt?cggtttctat 540

tccgccttcc?ttgtagcaga?taaggttatt?gtcacttcaa?aacacaacaa?cgatacccag 600

cacatctggg?agtctgactc?caatgaattt?tctgtaattg?ctgacccaag?aggaaacact 660

ctaggacggg?gaacgacaat?tacccttgtc?ttaaaagaag?aagcatctga?ttaccttgaa 720

ttggatacaa?ttaaaaatct?cgtcaaaaaa?tattcacagt?tcataaactt?tcctatttat 780

gtatggagca?gcaagactga?aactgttgag?gagcccatgg?aggaagaaga?agcagccaaa 840

gaagagaaag?aagaatctga?tgatgaagct?gcagtagagg?aagaagaaga?agaaaagaaa 900

ccaaagacta?aaaaagttga?aaaaactgtc?tgggactggg?aacttatgaa?gcttgctgct 960

tactttttgc?catctgactt?ctttccatcc?gtagctgctt?actatgtcaa?tgttaatatg 1020

ggcctaaaat?tagctgctt?actggctcagt?ttactagtgc?catttgttgc?tgcttacgaa 1080

tatttggtgt?cttttggagt?gtgggctgct?tacttcttgt?tgacaagaat?cctcacaata 1140

gctgcttacg?atgctgctta?ccagtatata?aaagcaaatt?ctaaatttat?aggtataact 1200

gaatctagaa?tgcagatctt?cgtgaagact?ctgactggta?agaccatcac?cctcgaggtg 1260

gagcccagtg?acaccatcga?gaatgtcaag?gcaaagatcc?aagataagga?aggcattcca 1320

ccagatcagc?agaggttgat?ctttgccgga?aaacagctgg?aagatggtcg?taccctgtct 1380

gactacaaca?tccagaaaga?gtccaccttg?cacctggtac?tccgtctcag?aggtgggtaa 1440

<210>13

<211>1503

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1503)

<223>

<400>13

atgtctcgct?ccgtggcctt?agctgtgctc?gcgatactct?ctctttctgg?cctggaggct 60

tttttgcctt?ctgacttctt?tccttctgtt?ggaggtgggg?gaggcggatc?aggaggctca 120

ggtgggtcag?gaggcatcca?gcgtactcca?aagattcagg?tttactcacg?tcatccagca 180

gagaatggaa?agtcaaattt?cctgaattgc?tatgtgtctg?ggtttcatcc?atccgacatt 240

gaagttgact?tactgaagaa?tggagagaga?attgaaaaag?tggagcattc?agacttgtct 300

ttcagcaagg?actggtcttt?ctatctcttg?tactacactg?aattcacccc?cactgaaaaa 360

gatgagtatg?cctgccgtgt?gaaccatgtg?actttgtcac?agcccaagat?agttaagtgg 420

gatcgagaca?tgggaggtgg?cggttcgggc?ggaggcggct?cgggtggcgg?cggctctggc 480

tctcactcca?tgaggtattt?cttcacatcc?gtgtcccggc?ccggccgcgg?ggagccccgc 540

ttcatcgcag?tgggctacgt?ggacgacacg?cagttcgtgc?ggttcgacag?cgacgccgcg 600

agccagagga?tggagccgcg?ggcgccgtgg?atagagcagg?agggtccgga?gtattgggac 660

ggggagacac?ggaaagtgaa?ggcccactca?cagactcacc?gagtggacct?ggggaccctg 720

cgcggctact?acaaccagag?cgaggccggt?tctcacaccg?tccagaggat?gtatggctgc 780

gacgtggggt?cggactggcg?cttcctccgc?gggtaccacc?agtacgccta?cgacggcaag 840

gattacatcg?ccctgaaaga?ggacctgcgc?tcttggaccg?cggcggacat?ggcagctcag 900

accaccaagc?acaagtggga?ggcggcccat?gtggcggagc?agttgagagc?ctacctggag 960

ggcacgtgcg?tggagtggct?ccgcagatac?ctggagaacg?ggaaggagac?gctgcagcgc 1020

acggacgccc?ccaaaacgca?tatgactcac?cacgctgtct?ctgaccatga?agccaccctg 1080

aggtgctggg?ccctgagctt?ctaccctgcg?gagatcacac?tgacctggca?gcgggatggg 1140

gaggaccaga?cccaggacac?ggagctcgtg?gagaccaggc?ctgcagggga?tggaaccttc 1200

cagaagtggg?cggctgtggt?ggtgccttct?ggacaggagc?agagatacac?ctgccatgtg 1260

cagcatgagg?gtttgcccaa?gcccctcacc?ctgagatggg?agccgtcttc?ccagcccacc 1320

atccccatcg?tgggcatcat?tgctggcctg?gttctctttg?gagctgtgat?cactggagct 1380

gtggtcgctg?ctgtgatgtg?gaggaggaag?agctcagata?gaaaaggagg?gagctactct 1440

caggctgcaa?gcagtgacag?tgcccagggc?tctgatgtgt?ctctcacagc?ttgtaaagtg 1500

tga 1503

<210>14

<211>1500

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1500)

<223>

<400>14

atgtctcgct?ccgtggcctt?agctgtgctc?gcgatact?ctctctttctgg?cctggaggct 60

tgtcttactt?ttggaagaga?aactgttgga?ggtgggggag?gcggatcagg?aggctcaggt 120

gggtcaggag?gcatccagcg?tactccaaag?attcaggttt?actcacgtca?tccagcagag 180

aatggaaagt?caaatttcct?gaattgctat?gtgtctgggt?ttcatccatc?cgacattgaa 240

gttgacttac?tgaagaatgg?agagagaatt?gaaaaagtgg?agcattcaga?cttgtctttc 300

agcaaggact?ggtctttcta?tctcttgtac?tacactgaat?tcacccccac?tgaaaaagat 360

gagtatgcct?gccgtgtgaa?ccatgtgact?ttgtcacagc?ccaagatagt?taagtgggat 420

cgagacatgg?gaggtggcgg?ttcgggcgga?ggcggctcgg?gtggcggcgg?ctctggctct 480

cactccatga?ggtatttctt?cacatccgtg?tcccggcccg?gccgcgggga?gccccgcttc 540

atcgcagtgg?gctacgtgga?cgacacgcag?ttcgtgcggt?tcgacagcga?cgccgcgagc 600

cagaggatgg?agccgcgggc?gccgtggata?gagcaggagg?gtccggagta?ttgggacggg 660

gagacacgga?aagtgaaggc?ccactcacag?actcaccgag?tggacctggg?gaccctgcgc 720

ggctactaca?accagagcga?ggccggttct?cacaccgtcc?agaggatgta?tggctgcgac 780

gtggggtcgg?actggcgctt?cctccgcggg?taccaccagt?acgcctacga?cggcaaggat 840

tacatcgccc?tgaaagagga?cctgcgctct?tggaccgcgg?cggacatggc?agctcagacc 900

accaagcaca?agtgggaggc?ggcccatgtg?gcggagcagt?tgagagccta?cctggagggc 960

acgtgcgtgg?agtggctccg?cagatacctg?gagaacggga?aggagacgct?gcagcgcacg 1020

gacgccccca?aaacgcatat?gactcaccac?gctgtctctg?accatgaagc?caccctgagg 1080

tgctgggccc?tgagcttcta?ccctgcggag?atcacactga?cctggcagcg?ggatggggag 1140

gaccagaccc?aggacacgga?gctcgtggag?accaggcctg?caggggatgg?aaccttccag 1200

aagtgggcgg?ctgtggtggt?gccttctgga?caggagcaga?gatacacctg?ccatgtgcag 1260

catgagggtt?tgcccaagcc?cctcaccctg?agatgggagc?cgtcttccca?gcccaccatc 1320

cccatcgtgg?gcatcattgc?tggcctggtt?ctctttggag?ctgtgatcac?tggagctgtg 1380

gtcgctgctg?tgatgtggag?gaggaagagc?tcagatagaa?aaggagggag?ctactctcag 1440

gctgcaagca?gtgacagtgc?ccagggctct?gatgtgtctc?tcacagcttg?taaagtgtga 1500

<210>15

<211>1500

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(1500)

<223>

<400>15

atgtctcgct?ccgtggcctt?agctgtgctc?gcgatactct?ctctttctgg?cctggaggct 60

agcctgtaca?acaccgtcgc?gaccctagga?ggtgggggag?gcggatcagg?aggctcaggt 120

gggtcaggag?gcatccagcg?tactccaaag?attcaggttt?actcacgtca?tccagcagag 180

aatggaaagt?caaatttcct?gaattgctat?gtgtctgggt?ttcatccatc?cgacattgaa 240

gttgacttac?tgaagaatgg?agagagaatt?gaaaaagtgg?agcattcaga?cttgtctttc 300

agcaaggact?ggtctttcta?tctcttgtac?tacactgaat?tcacccccac?tgaaaaagat 360

gagtatgcct?gccgtgtgaa?ccatgtgact?ttgtcacagc?ccaagatagt?taagtgggat 420

cgagacatgg?gaggtggcgg?ttcgggcgga?ggcggctcgg?gtggcggcgg?ctctggctct 480

cactccatga?ggtatttctt?cacatccgtg?tcccggcccg?gccgcgggga?gccccgcttc 540

atcgcagtgg?gctacgtgga?cgacacgcag?ttcgtgcggt?tcgacagcga?cgccgcgagc 600

cagaggatgg?agccgcgggc?gccgtggata?gagcaggagg?gtccggagta?ttgggacggg 660

gagacacgga?aagtgaaggc?ccactcacag?actcaccgag?tggacctggg?gaccctgcgc 720

ggctactaca?accagagcga?ggccggttct?cacaccgtcc?agaggatgta?tggctgcgac 780

gtggggtcgg?actggcgctt?cctccgcggg?taccaccagt?acgcctacga?cggcaaggat 840

tacatcgccc?tgaaagagga?cctgcgctct?tggaccgcgg?cggacatggc?agctcagacc 900

accaagcaca?agtgggaggc?ggcccatgtg?gcggagcagt?tgagagccta?cctggagggc 960

acgtgcgtgg?agtggctccg?cagatacctg?gagaacggga?aggagacgct?gcagcgcacg 1020

gacgccccca?aaacgcatat?gactcaccac?gctgtctctg?accatgaagc?caccctgagg 1080

tgctgggccc?tgagcttcta?ccctgcggag?atcacactga?cctggcagcg?ggatggggag 1140

gaccagaccc?aggacacgga?gctcgtggag?accaggcctg?caggggatgg?aaccttccag 1200

aagtgggcgg?ctgtggtggt?gccttctgga?caggagcaga?gatacacctg?ccatgtgcag 1260

catgagggtt?tgcccaagcc?cctcaccctg?agatgggagc?cgtcttccca?gcccaccatc 1320

cccatcgtgg?gcatcattgc?tggcctggtt?ctctttggag?ctgtgatcac?tggagctgtg 1380

gtcgctgctg?tgatgtggag?gaggaagagc?tcagatagaa?aaggagggag?ctactctcag 1440

gctgcaagca?gtgacagtgc?ccagggctct?gatgtgtctc?tcacagcttg?taaagtgtga 1500

<210>16

<211>102

<212>DNA

< 213>human immunodeficiency virus

<220>

<221>CDS

<222>(1)..(102)

<223>

<400>16

atggagtggg?acagagaaat?taacaattac?acaagcttaa?tacactcctt?aattgaagaa 60

tcgcaaaacc?agcaagaaaa?gaatgaacaa?gaattattgtaa 102

<210>17

<211>108

<212>DNA

< 213>human immunodeficiency virus

<220>

<221>CDS

<222>(1)..(108)

<223>

<400>17

atgtctggta?tagtgcagca?gcagaacaat?ttgctgaggg?ctattgaggc?gcaacagcat 60

ctgttgcaac?tcacagtctg?gggcatcaag?cagctccagg?caagataa 108

<210>18

<211>336

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(336)

<223>

<400>18

atggagtggg?acagagaaat?taacaattac?acaagcttaa?tacactcctt?aattgaagaa 60

tcgcaaaacc?agcaagaaaa?gaatgaacaa?gaattattgg?gtggttctgg?tggatctggt 120

atagtgcagc?agcagaacaa?tttgctgagg?gctattgagg?cgcaacagca?tctgttgcaa 180

ctcacagtct?ggggcatcaa?gcagctccag?gcaagaggtt?cctctggagg?ttggatggag 240

tgggacagag?aaattaacaa?ttacacaagc?ttaatacact?ccttaattga?agaatcgcaa 300

aaccagcaag?aaaagaatga?acaagaatta?ttgtag 336

<210>19

<211>405

<212>DNA

< 213>artificial sequence

<220>

<221>CDS

<222>(1)..(405)

<223>

<400>19

atggatgcaa?tgaagagagg?gctctgctgt?gtgctgctgc?tgtgtggagc?agtcttcgtt 60

tcgcccagca?tggagtggga?cagagaaatt?aacaattaca?caagcttaat?acactcctta 120

attgaagaat?cgcaaaacca?gcaagaaaag?aatgaacaag?aattattggg?tggttctggt 180

ggatctggta?tagtgcagca?gcagaacaat?ttgctgaggg?ctattgaggc?gcaacagcat 240

ctgttgcaac?tcacagtctg?gggcatcaag?cagctccagg?caagaggttc?ctctggaggt 300

tggatggagt?gggacagaga?aattaacaat?tacacaagct?taatacactc?cttaattgaa 360

gaatcgcaaa?accagcaaga?aaagaatgaa?caagaattat?tgtag 405

<210>20

<211>56

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

<222>(1)..(56)

<223>

<400>20

tcgagaggac?tcttggactc?tcattcaaga?gatgagagtc?caagagtcct?cttttt 56

<210>21

<211>68

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

<222>(1)..(68)

<223>

<400>21

tcgaccgtgt?gcacttcgct?tcacctctgt?tcaagagaca?gaggtgaagc?gaagtgcaca 60

cggttttt 68

<210>22

<211>56

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

<222>(1)..(56)

<223>

<400>22

tcgacccgct?caatgcctgg?agattcaaga?gatctccagg?cattgagcgg?gttttt 56

<210>23

<211>74

<212>DNA

< 213>artificial sequence

<220>

<221>misc_feature

<222>(1)..(74)

<223>

<400>23

tcgaaagtgt?tgctttcatt?gccaagtttg?ttttcaagag?aaacaaactt?ggcaatgaaa 60

gcaacacttt?tttt 74

<210>24

<211>30

<212>DNA

< 213>artificial sequence

<400>24

gcggatccat?ggagaacatc?acatcaggat 30

<210>25

<211>29

<212>DNA

< 213>artificial sequence

<400>25

gcgctcgagt?taaatgtata?cccaaagac 29

<210>26

<211>30

<212>DNA

< 213>artificial sequence

<400>26

gcggatccat?ggacattgac?ccgtataaag 30

<210>27

<211>30

<212>DNA

< 213>artificial sequence

<400>27

gcgctcgagt?taaataacac?aagtctccgg 30

<210>28

<211>28

<212>DNA

< 213>artificial sequence

<400>28

gcggatccat?ggatgatgaa?gtcgacgt 28

<210>29

<211>33

<212>DNA

< 213>artificial sequence

<400>29

gcgctcgagt?taagtgaagt?ggatataagc?cat 33

<210>30

<211>30

<212>DNA

< 213>artificial sequence

<400>30

gcggtaccat?gcagtggaat?tccacaacct 30

<210>31

<211>30

<212>DNA

< 213>artificial sequence

<400>31

tagcggccgc?ttaaatgtat?acccaaagac 30

<210>32

<211>32

<212>DNA

< 213>artificial sequence

<400>32

acctccagag?gaaccaatgt?atacccaaag?ac 32

<210>33

<211>32

<212>DNA

< 213>artificial sequence

<400>33

ggttcctctg?gaggtgatga?tgaagtcgac?gt 32

<210>34

<211>32

<212>DNA

< 213>artificial sequence

<400>34

ggttcctctg?gaggtgacga?tgaagttgatgt 32

<210>35

<211>31

<212>DNA

< 213>artificial sequence

<400>35

gcgctcgagt?taagtaaagt?gaatataagc?c 31

<210>36

<211>32

<212>DNA

< 213>artificial sequence

<400>36

acctccagag?gaaccaataa?cacaagtctc?cg 32

<210>37

<211>30

<212>DNA

< 213>artificial sequence

<400>37

acctccagag?gaaccaatgt?atacccaaag 30

<210>38

<211>30

<212>DNA

< 213>artificial sequence

<400>38

ggttcctctg?gaggtgatga?tgaagtcgac 30

<210>39

<211>30

<212>DNA

< 213>artificial sequence

<400>39

tagcggccgc?ttaagtgaag?tggatataag 30

<210>40

<211>30

<212>DNA

< 213>artificial sequence

<400>40

taggtaccat?ggatgatgaa?gtcgacgtgg 30

<210>41

<211>30

<212>DNA

< 213>artificial sequence

<400>41

acctccagag?gaaccaatgt?atacccaaag 30

<210>42

<211>30

<212>DNA

< 213>artificial sequence

<400>12

ggttcctctg?gaggtgatga?tgaagtcgac 30

<210>43

<211>25

<212>DNA

< 213>artificial sequence

<400>43

cagctgtgga?atgtgtgtca?gttag 25

<210>44

<211>21

<212>DNA

< 213>artificial sequence

<400>44

aatcagcaag?cttggtaccg?a 21

<210>45

<211>48

<212>DNA

< 213>artificial sequence

<400>45

aacagaagga?aagaagtcag?aaggcaaaaa?agcctccagg?ccagaaag 48

<210>46

<211>8

<212>DNA

< 213>artificial sequence

<400>46

tttttgcctt?ctgacttctt?tccttctgtt?ggaggtgggg?gaggcgga 48

<210>47

<211>45

<212>DNA

< 213>artificial sequence

<400>47

aacagtttct?cttccaaaag?taagacaagc?ctccaggcca?gaaag 45

<210>48

<211>45

<212>DNA

< 213>artificial sequence

<400>48

tgtcttactt?ttggaagaga?aactgttgga?ggtgggggag?gcgga 45

<210>49

<211>10

<212>DNA

< 213>artificial sequence

<400>49

gcgaagctt?g 10

<210>50

<211>10

<212>DNA

< 213>artificial sequence

<400>50

actcgagcat 10

<210>51

<211>35

<212>DNA

< 213>artificial sequence

<400>51

gtcttcgttt?cgcccagctg?gatggagtgg?gacag 35

<210>52

<211>42

<212>DNA

< 213>artificial sequence

<400>52

gctgtgtgct?gctgctgtgt?ggagcagtct?tcgtttcgcc?ca 42

<210>53

<211>37

<212>DNA

< 213>artificial sequence

<400>53

gatgcaatga?agagagggct?ctgctgtgtg?ctgctgc 37

<210>54

<211>35

<212>DNA

< 213>artificial sequence

<400>54

cgcaggatcc?gccaccatgg?atgcaatgaa?gagag 35

<210>55

<211>32

<212>DNA

< 213>artificial sequence

<400>55

cgcgctcgag?ctacaataat?tcttgttcat?tc 32

<210>56

<211>29

<212>DNA

< 213>artificial sequence

<400>56

cgcaggatcc?tggatggagt?gggacagag 29

<210>57

<211>29

<212>DNA

< 213>artificial sequence

<400>57

ctctgtccca?ctccatccag?gatcctgcg 29

<210>58

<211>3027

<212>DNA

< 213>hepatitis C virus

<220>

<221>CDS

<222>(1)..(3027)

<223>

<400>58

atgagcacaa?atcctaaacc?tcaaagaaaa?accaaacgta?acaccaaccg?ccgcccacag 60

gacgtcaagt?tcccgggcgg?tggtcagatc?gttggtggag?tttacctgtt?gccgcgcagg 120

ggccccaggt?tgggtgtgcg?cgcgactagg?aagacttccg?agcggtcgca?acctcgtgga 180

aggcgacaac?ctatccccaa?ggctcgccgg?cccgagggca?gggcctgggc?tcagcccggg 240

tacccttggc?ccctctatgg?caatgagggc?ttggggtggg?caggatggct?cctgtcaccc 300

cgtggctctc?ggcctagttg?gggccccaca?gacccccggc?gtaggtcgcg?taatttgggt 360

aaggtcatcg?ataccctcac?atgcggcttc?gccgacctca?tggggtacat?tccgcttgtc 420

ggcgcccccc?tagggggcgc?tgccagggcc?ctggcgcatg?gcgtccgggt?tctggaggac 480

ggcgtgaact?atgcaacagg?gaatttgccc?ggttgctctt?tctctatctt?cctcttggct 540

ttgctgtctt?gtctgaccat?cccagcttcc?gcttatgaag?tgcgcaacgt?gtccggggtg 600

taccatgtca?cgaacgactg?ctccaactca?agtattgtgt?atgaggcagc?ggacatgatc 660

atgcacaccc?ccgggtgcgt?accctgcgtc?cgggaggcca?actcctcccg?ctgctgggta 720

gcgctcactc?ccacgctcgc?ggccaggaac?agcagcgtcc?ccactacgac?aatacgacgc 780

cacgtcgatt?tgctcgttgg?ggcagctgct?ctctgctccg?ccatgtacgt?gggagatctc 840

tgcggatctg?ttttcctcat?ctcccagctg?ttcaccttct?cacctcgcca?gtatgagacg 900

gtacaagact?gcaattgctc?actctatccc?ggccacgtat?caggtcaccg?catggcttgg 960

gatatgatga?tgaactggtc?acctacaaca?gccctggtgg?tatcgcagtt?gctccggatc?1020

ccacaagccg?tcgtggacat?ggtggcgggg?gcccactggg?gagtcctagc?gggccttgcc?1080

tactattcca?tggtggggaa?ctgggctaag?gttctgattg?tgatgctact?ctttgccggc?1140

gtcgacgggg?ctacctacac?gtcagggggg?acggtaggcc?ggaccaccag?aggccttacg?1200

tccttctttg?cacctggccc?gtctcagaag?atccaactta?tcaacaccaa?cggcagctgg?1260

cacatcaata?ggactgccct?gaattgcaat?gactccctcc?acaccgggtt?ccttgctgcg?1320

ctgttctaca?cgcacaagtt?caactcgtcc?ggatgctcgg?agcgtatggc?cagctgccgc?1380

cccattgaca?agttcgccca?ggggtggggt?cccatcactc?atggtgtgcc?tgacgacccg?1440

gaccagaggc?cctactgttg?gcactacgcg?cctcggccgt?gcggtatcgt?acccgcgtcg?1500

caggtgtgtg?gtccagtgta?ttgcttcacc?ccgagccctg?tcgtggtggg?gacgaccgat?1560

cgttccggcg?cccccacgta?cacctggggg?gagaatgaga?cggacgtgct?actccttaac?1620

aacacgcgac?cgccgcaagg?caactggttc?ggttgcacat?gggtgaacag?caccgggttc?1680

accaaaacgt?gcgggggccc?cccatgcaac?attggagggg?tcggcaacaa?caccttgacc?1740

tgccccacgg?actgcttccg?gaagcacccc?gaggccactt?acaccaaatg?cggctcgggg?1800

ccatggttga?cacccaggtg?catggttgac?tacccataca?gactctggca?ctacccttgc?1860

actgtcaatt?ttaccatctt?caaggtcagg?atgtatgtag?ggggtgtgga?gcacaggctc?1920

gacgccgcgt?gcaattggac?ccgaggagag?cgttgcaatg?tggaggacag?ggatagatca?1980

gagcttagcc?cactgctact?gtccacaaca?gagtggcagg?tactgccctg?ttctttcacc?2040

accctaccgg?ctctgtccac?tggtttgatc?cacctccacc?agaacatcgt?ggacgtgcaa?2100

tacctgtacg?gtgtggggtc?agtggttgtc?tccgttgtaa?tcagatggga?gtatgtcgtg?2160

ctgctcttcc?ttctcctggc?ggacgcacgc?gtctgcgcct?gcttgtggat?gatgctgctg?2220

gtagcccagg?ctgaggccgc?cttagagaac?ttggtggtcc?tcaatgcggc?atctgtagcc?2280

ggagcgcatg?gcattctctc?cttccttgtg?ttcttctgtg?ctgcctggta?catcaagggc?2340

aagctggtcc?ctggggcggc?atatgccttc?tatggcgtat?ggccgctgct?cctgctcctg 2400

ctggcgttac?caccacgagc?atacgccatg?gaccgggaga?tggctgcatc?atgcggaggc 2460

gcggttttcg?taggtctggc?actcttgacc?ttgtcaccac?actataaagt?gttcctcgcc 2520

aggctcatat?ggtggttgca?ataccttatc?accagggccg?aggcgctgct?gcaagtgtgg 2580

atcccccctc?tcaacgttcg?ggggggccgc?gatgccatca?tcctcctcac?gtgcgcggtc 2640

catccagagc?taatctttga?catcaccaaa?atcttgctcg?ccatatttgg?tccgctcatg 2700

gtgctccagg?ctggcttaac?cagagtgccg?tacttcgtgc?gcgctcaggg?gctcatccgt 2760

gtgtgcatgt?tggtgcggaa?ggtcgctggg?ggtcactacg?tccagatggc?tctcatgagg 2820

ctcgccgcac?tgacgggcac?gtacgtttac?gaccatctca?ctccgctgcg?gggctgggcc 2880

catgcgggcc?tgcgggacct?tgcggtggca?gttgagcccg?tcgtcttctc?tgacatggag 2940

accaagatca?tcacctgggg?ggcagacacc?gcggcgtgtg?gggacatcat?cctgggtcta 3000

cccgtctccg?cccgaagggg?gaggtaa 3027

<210>59

<211>1524

<212>DNA

< 213>human immunodeficiency virus

<220>

<221>CDS

<222>(1)..(1524)

<223>

<400>59

atgggtgcga?gagcgtcagt?attaagcggg?ggaaaattag?ataaatggga?aaaaattcgg 60

ttacggccag?gaggaaagaa?acaatataga?ttaaaacatt?tagtatgggc?aagcagggaa 120

ttagaacgat?tcgcagttaa?tcctggcctt?ttagagacag?cagaaggctg?taaacaaatt 180

ctggaacagc?tacaaccatc?ccttcagaca?ggatcagaag?aacttaggtc?attatttaat 240

acagtagcaa?ccctctattg?tgtccatcag?aggatagagg?taagagacac?caaggaagcc 300

ttagataagg?tagaggagga?gcaaaacaac?agtaagaaaa?aggcacagca?agcagcagct 360

ggcacaggaa?atagcagcca?ggccagccaa?aattacccta?tagtgcagaa?catgcagggg 420

caaatggtac?atcaggcaat?atcacccaga?actttaaatg?catgggtaaa?agtagtagaa 480

gaaaagggtt?ttagcccaga?agtaataccc?atgttttcag?cattatcaga?aggaggcacc 540

ccacaagatt?taaacaccat?gctaaacaca?atagggggac?atcaagcagc?catgcaaatg 600

ttaaaagaca?ccatcaatga?ggaagctgca?gaatgggaca?gattacatcc?agtgcatgca 660

ggacctatcc?caccaggcca?gatgagggaa?cctaggggaa?gtgatatagc?tggatccact 720

agtacccttc?aggaacaaat?acaatggatg?acaagcaacc?cacctgtccc?agtgggagaa 780

atctataaaa?gatggattat?cctaggatta?aataaaatag?taagaatgta?tagccctgtc 840

agcattttgg?acataaaaca?agggccaaag?gaacccttta?gagactacgt?agacaggttc 900

tttaaaaccc?taagagctga?gcaagctaca?caggaagtaa?agggttggat?gacagacacc 960

ttgttggtcc?aaaatgcgaa?cccagattgt?aagaccattt?taaaagcact?gggaccaggg 1020

gcttcactag?aagaaatgat?gacagcatgt?cagggagtag?gaggacccgg?ccataaagca 1080

agagttttgg?ctgaagcaat?gagccacatg?acaaattcag?ctgctataat?gatgcagaaa 1140

ggcaatttta?ggaatcaaag?aaaaactgtc?aagtgtttca?attgtggcaa?agaagggcac 1200

atagccagaa?attgcagggc?ccctagaaaa?aagggctgtt?ggaaatgtgg?aagagaagga 1260

caccaaatga?aagactgcac?tgaaagacag?gctaattttt?tagggagaat?gtggccttcc 1320

cacaagggga?ggccgggaaa?tttccttcag?aacaggccag?agccaacagc?cccaccagca 1380

gagagcttcg?ggttcggaga?ggagataacc?ccatctccga?aggtgacccc?ctctccgaag 1440

caggagcaga?agcaggagca?gaaggacgag?ggactgtacc?ctcccttagc?ttccctcaaa 1500

tcactctttg?gcaacgacca?ctag 1524

<210>60

<211>3045

<212>DNA

< 213>human immunodeficiency virus

<220>

<221>CDS

<222>(1)..(3045)

<223>

<400>60

atgtttttta?gggagaatgt?ggccttccca?caaggggagg?ccgggaaatt?tccttcagaa 60

caggccagag?ccaacagccc?caccagcaga?gagcttcggg?ttcggagagg?agataacccc 120

atctccgaag?gtgaccccct?ctccgaagca?ggagcagaag?caggagcaga?aggacgaggg 180

actgtaccct?cccttagctt?ccctcaaatc?actctttggc?aacgaccact?agttacaata 240

aaaatagagg?gacagctaat?ggaagctcta?ttagatacag?gagcagatga?tacagtatta 300

gaagatgtaa?atttgccagg?aaaatggaga?ccaaaaatga?tagggggaat?tggaggtttt 360

atcaaagtaa?aacagtatga?taacatactc?atagaaattt?gtggacataa?ggctataggt 420

acagtgttgg?taggacctac?gcctgtcaac?ataattggaa?gaaacatgat?gactcagatt 480

ggttgtactt?taaattttcc?aattagtcct?attaggactg?taccagtaaa?attgaagcca 540

ggaatggatg?gcccaaaggt?taaacaatgg?ccattgacag?aagaaaaaat?aaaagcatta 600

acagaaatat?gtttggaaat?ggaaaaagaa?ggaaaaattt?caaaaattgg?gcctgaaaat 660

ccatacaata?ctccagtatt?tgccataaag?aaaaaagaca?gtactaaatg?gagaaaatta 720

gtagatttca?gagaacttaa?taaaagaact?caagattttt?gggaaattca?attaggaata 780

ccacatcctg?cagggttaaa?aaagaaaaag?tcagtgacag?tactggatgt?gggagatgca 840

tatttttcaa?ttcccttaga?tgaggatttc?aggaagtaca?ctgcattcac?catacctagt 900

atcaacaatg?agacaccagg?aattaggtac?cagtacaatg?tgcttccaca?aggatggaaa 960

ggatcaccag?caatattcca?atgtagcatg?acaaaaatct?tagacccctt?tagaacaaaa 1020

aatccagaca?tagtgatctg?ccaatacatg?gatgatttgt?atgtagggtc?tgacttagaa 1080

atagggcaac?atagagcaaa?aatagaggag?ttaagagaac?atctattgaa?atggggactt 1140

actacaccag?acaaaaaata?tcaaaaggag?cctccattcc?actggatggg?gtatgaactc 1200

catcctgata?agtggacagt?gcagcctata?caattgccag?acaaggacag?ctggactgtc 1260

aatgatatac?agaagttagt?aggaaaacta?aattgggcaa?gtcagattta?tccagggatt 1320

aaagtaaagc?aattatgtaa?actccttagg?ggagccaagg?cattaacaga?aatagtgcca 1380

ctgactgcag?aagcagagtt?agaattagca?gagaataggg?aaattctaaa?agaaccagta 1440

catggggtat?attatgaccc?atcaaaagac?ttaatagcag?aaatacagaa?acaagggcaa 1500

gggcagtgga?catatcaaat?ttatcaagag?ccatttaaaa?atctaaaaac?aggaaagtat 1560

gcaaaaatga?ggtctgccca?cactaatgat?gtaaaacaat?taacagaagc?agtgcaaaag 1620

atagctctag?aaagcatagt?catatgggga?aagactccta?agtttagact?acccatatta 1680

aaagagacat?gggatacatg?gtggacagag?tattggcaag?ccacctggat?tcctgaatgg 1740

gagtttgtca?ataccccccc?tctagtaaaa?ctatggtatc?agctagaaac?agagcccata 1800

gcaggagcag?aaaccttcta?tgtagatggg?gcatctaata?gggagaccaa?aaaaggaaaa 1860

gcaggatatg?ttactgacag?aggaagacaa?aaagctgttt?ccctaactga?gaccacaaat 1920

cagaaagccg?agttacaggc?aattcagtta?gctttacagg?attcaggatc?aaaagtgaac 1980

atagtaacag?actcacagta?tgtgttagga?atcattcaag?cacaaccaga?taagagtgac 2040

tcagaattag?tcaatcaaat?aatagagcaa?ttaatagaaa?aggaaaaggt?ctacctgtca 2100

tgggtaccag?cacacaaagg?aattggagga?aatgaacaag?tagataaatt?agtcagtgct 2160

gggatcagga?aagtattatt?tttagatgga?atagataagg?cccaagagga?acatgaaaaa 2220

tatcacaata?attggagatc?aatggctagt?gattttaatc?tgccacctgt?agtagcaaaa 2280

gaaatagtgg?ccagttgtga?taaatgtcag?ctaaaaggag?aagccatgca?tggacaagta 2340

gactgtagtc?caggaatatg?gcagctagat?tgtacacact?tagaaggaaa?aattatcctg 2400

gtagcagttc?atgtagccag?tggatatata?gaagcagaag?ttattccagc?agaaacaggg 2460

caagaaacag?catacttcat?cttaaaatta?gcaggaagat?ggccagtaaa?aataatacat 2520

acagacaatg?gcagcaattt?caccagtact?acagttaagg?ccgcctgttg?gtgggcgggg 2580

atcaaacagg?aatttggcat?tccctacaat?ccccaaagtc?agggagtaat?agaatctatg 2640

aataaggagt?taaagaaaat?tataggacag?gtaagagatc?aggctgaaca?tcttaagaca 2700

gcagtacaaa?tggcagtatt?catccacaat?tttaaaagaa?aaggggggat?tggggggtac 2760

agtgcagggg?aaagaataat?agacataata?gcaacagaca?tacaaactaa?agaattacaa 2820

aaacaaatta?caaaaattca?aaatttccgg?gtttattaca?gggacagcag?agacccagtt 2880

tggaaaggac?cagcaaagct?actctggaaa?ggtgaagggg?cagtagtcat?acaagacaat 2940

agtgaaataa?aagtagtacc?aagaagaaaa?gcaaagatca?ttagggatta?tggaaaacag 3000

atggcaggtg?atgattgtgt?ggcaggtgga?caggatgagg?attaa 3045

<210>61

<211>2583

<212>DNA

< 213>human immunodeficiency virus

<220>

<221>CDS

<222>(1)..(2583)

<223>

<400>61

atgagagtga?gggggatgca?gaggaattgg?caggacttgg?ggaagtgggg?ccttttattc 60

ctgggaatat?taataatctg?taatgctgaa?caaaatttgt?gggtcacagt?ctattatggg 120

gtacctgtgt?ggaaagaagc?atccactactct?attctgtg?catcagatgc?taaatcatat 180

gaaagagaag?tgcataatgt?ctgggctaca?catgcctgtg?tacccacaga?tcccaatcca 240

caagaactag?ttctgggaaa?tgtaacagaa?aattttgata?tgtggaaaaa?tgatatggta 300

gaacaaatgc?atgaagatat?aattagctta?tgggatcaaa?gcctaaaacc?atgtgtgaag 360

ttaaccccac?tctgtgttac?tttaaactgt?actaatgcca?aggccattaa?ctcctctgac 420

aatgccacca?attctactcc?cttgcctata?accagccccc?tgaaggaaga?ggcaggggca 480

atacaaaact?gttctttcaa?tgtgaccaca?gagttaagag?ataagaagaa?gaaagaatat 540

gcaatttttt?ataaacttga?tatagtacca?atagaacaaa?tcagcaataa?aagttacaat 600

acatacaggc?taataaattg?taacacctca?accactacac?aggcttgtcc?aaaggtatct 660

tgggatccaa?ttcccataca?ttattgtgct?ccagctggtt?ttgcgattct?aaagtgtaat 720

aataaaacgt?tcaatgggac?agggccatgc?aagaatgtca?gtacagtaca?atgtacacat 780

ggaattaaac?cagtggtatc?aactcaattg?ttgttaaatg?gtagcctagc?agaagaagat 840

atagtaatca?gatttcaaaa?tatctcagat?aatgcaaaaa?ccataatagt?acactttaat 900

gaatctgtac?agattaattg?tacaagaccc?aacaacaata?caagaaaagg?tatacatatg 960

ggaccaggac?aagcatttta?tgcagcagga?gaaataatag?gagacatcag?aaaagcatat?1020

tgtactatta?atggaacaca?atggaatgac?actttagaac?aggtaaaggc?aaagttgcag?1080

gagcatttcc?ctaatagaac?aataatgttt?aactcatctg?caggagggga?cctagaaatt?1140

acaacacata?tttttaattg?tagaggagaa?tttttttact?gcaatacatc?agaactgttt?1200

aataacacaa?aaaacaatgg?caccatcatt?ctcccatgta?aaataaaaca?aattgtaaac?1260

atgtggcaga?gagtaggacg?agcaatgtat?gccaatccca?ttgcaggaaa?aattaactgt?1320

aactcaaata?ttacaggtct?attattgaca?agagatggtg?gtaatcaggc?taatgagact?1380

agtggtattc?agactaatgg?gactgagatc?ttcagacctg?gaggaggaaa?tatgagagac?1440

aattggagaa?gtgaattata?taaatataaa?gtagtacaaa?ttaaaccact?aggaatagca?1500

cccaccaggg?caaaaagacg?agtggtgcag?agagcaagaa?gagcagtggg?aataggagct?1560

cttttcattg?gattcttagg?agcagcagga?agcactatgg?gcgcggcgtc?aataacgctg?1620

acggtacagg?ccagacaatt?attgtctgga?atagtgcaac?agcaaaacaa?tttactgcag?1680

gctattgaag?cgcaacagca?tctgttgcag?ctcacagtct?ggggcattaa?acagctccag 1740

gcaagactcc?tggctgtgga?aagattccta?catgatcaac?agctcctagg?gctttggggc 1800

tgctctggaa?aactcatctg?caccactagt?gtgccctgga?actctagttg?gagcaataaa 1860

tcttatgaca?agatttggga?taacatgacc?tggatggagt?gggaaaaaga?gattagcaat 1920

tactcagatg?aaatatacag?gttaattgaa?aaatcgcaga?accagcagga?aataaatgaa 1980

caagaattat?tagcattgga?taaatgggca?agtctgtgga?attggtttga?cataacaagc 2040

tggctgtggt?atataaaaat?attcataatg?atagtaggag?gcttgatagg?cttaagaata 2100

gtttttactg?tgctttctat?agtaaataga?gttaggaagg?gatactcacc?tttgtcattt 2160

cagacccata?tcccaagctc?gagggaacaa?cccgacaggc?ccgaaggaat?cgaagaagga 2220

ggtggagagc?aagacaaaga?cagatccgtg?agattagtga?gcggattctt?agctcttgtc 2280

tggaacgacc?tgagggacct?gtgcctcttc?agctaccacc?tcttgagaga?cttcacatta 2340

cttgcagcga?ggattgtgga?cagagggctg?aggagggggt?gggaagccct?caaatatctg 2400

tggaatctcg?cgcagtattg?gagtcgggaa?ctaaagaata?gtgctattag?cttgtttaat 2460

accacagcaa?tagtagtagc?tgaagggaca?gatagagttc?tagaagcttt?gcaaagagct 2520

ggtagagctg?ttctccatat?ccctagaaga?ataagacagg?gctttgaaag?agctttgcta 2580

taa 2583

<210>62

<211>19

<212>DNA

< 213>artificial sequence

<400>62

gaggactctt?ggactctca 19

<210>63

<211>25

<212>DNA

< 213>artificial sequence

<400>63

ccgtgtgcac?ttcgcttcac?ctctg 25

<210>64

<211>19

<212>DNA

< 213>artificial sequence

<400>64

catcacatca?ggattccta 19

<210>65

<211>25

<212>DNA

< 213>artificial sequence

<400>65

ctcagtttac?tagtgccatt?tgttc 25

<210>66

<211>21

<212>DNA

< 213>artificial sequence

<400>66

catcacatca?ggattcctaa?a 21

<210>67

<211>25

<212>DNA

< 213>artificial sequence

<400>67

agaagatctc?aatctcggga?atctc 25

<210>68

<211>18

<212>DNA

< 213>artificial sequence

<400>68

cccgctcaat?gcctggag 18

<210>69

<211>111

<212>DNA

< 213>hepatitis C virus

<220>

<221>CDS

<222>(1)..(111)

<223>

<400>69

atggttttcg?gcggccattg?gggtgtggtg?tttggcttgg?cctatttttc?catgcaagga 60

gcgtgggcca?aagtcattgc?catcctcctc?cttgtcgcag?gagtggacgcg 111

<210>70

<211>1098

<212>DNA

< 213>hepatitis C virus

<220>

<221>CDS

<222>(1)..(1098)

<223>

<400>70

ggcacctata?ccaccggtgc?agtcacgggt?cgaaccacca?atgtgtttac?tagcctcttt 60

tcatctgggt?cccagcagaa?gctcagttta?atcaacacca?atggcagctg?gcacataaac 120

cggaccgccc?tcaattgcaa?tgacagcctg?cagacggggt?ttatcgcctc?cttgttttac 180

acgcacaggt?ttaacagctc?cggctgcccc?gagcgcttgt?cttcctgccg?caggctggaa 240

gatttccgca?tcgggtgggg?aaccttggaa?tacgagacta?atgtcaccaa?tgatgaggac 300

atgaggccgt?actgctggca?ttaccctcca?agaccctgcg?gtatcgtcca?ggctaagacg 360

gtttgcgggc?cggtctattg?tttcaccccc?agccctgtcg?tcgtgggtac?cactgacagg 420

cagggcgtgc?ccacttacag?ctggggggaa?aatgagaccg?atgttttctt?gttaaatagt 480

acaagacccc?cgcaaggagc?ctggttcggc?tgcacttgga?tgaatgggac?tgggttcact 540

aagacatgcg?gtgcaccacc?ttgccgcatt?aggagggact?acaacggaac?cctcgaccta 600

ttgtgcccca?cagactgttt?cagaaagcac?ccagatacta?cctaccttaa?gtgtggagcg 660

gggccttggt?tgacccccaa?atgcatggta?gactatccct?atagattgtg?gcattatccg 720

tgcactgtga?attttaccat?cttcaaggtg?cggatgtatg?tgggaggagt?ggagcatcgg 780

ttccatgcag?cgtgcaatta?cacgcgcggg?gaccgctgca?gtttggagga?cagggacagg 840

ggtcagcaga?gtccactact?gcattccacc?accgagtggg?cggtgttgcc?atgctctttc 900

tccgacctac?cggcactatc?cactggtcta?ctgcacctcc?accaaaacat?cgtggacgtg 960

cagtacctct?atggactctc?tccggctatc?acaaaataca?tcgtgaagtg?ggaatgggtg?1020

atccttcttt?tcctgttgct?ggcagacgcc?agggtctgtg?cttgcctctg?gatgctcatt?1080

atattgggcc?aggccgaa 1098

<210>71

<211>28

<212>DNA

< 213>artificial sequence

<400>71

aagtgttgct?ttcattgcca?agtttgtt 28

<210>72

<211>10

<212>PRT

< 213>artificial sequence

<400>72

Phe?Leu?Pro?Ser?Asp?Phe?Phe?Pro?Ser?Val

1 5 10

<210>73

<211>9

<212>PRT

< 213>artificial sequence

<400>73

Trp?Leu?Ser?Leu?Leu?Val?Pro?Phe?Val

1 5

<210>74

<211>9

<212>PRT

< 213>artificial sequence

<400>74

Phe?Leu?Leu?Thr?Arg?Ile?Leu?Thr?Ilc

1 5

<210>75

<211>10

<212>PRT

< 213>artificial sequence

<400>75

Tyr?Val?Asn?Val?Asn?Met?Gly?Leu?Lys?Leu

1 5 10

<210>76

<211>9

<212>PRT

< 213>artificial sequence

<400>76

Glu?Tyr?Leu?Val?Ser?Phe?Gly?Val?Trp

1 5

<210>77

<211>14

<212>PRT

< 213>artificial sequence

<400>77

Gln?Tyr?Ile?Lys?Ala?Asn?Ser?Lys?Phe?Ile?Gly?Ile?Thr?Glu

1 5 10

Claims (10)

1. the cocktail vaccine of an anti-immunologic tolerance virus, it comprises following elements, and said element exists with the form of recombinant DNA and/or recombinant virus, and said element is that (A) cytokine coded sequence or RNA interfere sequence; (B) immunological adjuvant coded sequence; (C) antigen gene, virus antigen epitope coded sequence or virus antigen epitope-MHC-I SCT gene, wherein said immunologic tolerance virus are hepatitis B virus (HBV) or hepatitis C virus (HCV); Said immunological adjuvant is heat shock protein gp96 or its N355 fragment, and described N355 fragment is made up of 22-376 terminal amino acid of gp96N end; Said cytokine is selected from cytokine IFN α 1, IFN α 2 or IFN γ, TNF α or IL-2; Said RNA interferes its target sequence of sequence to be selected from encoding viral sequence or non-coding sequence; Said antigen gene is selected from the comparison conserved sequence of virus antigen, main epidemic strain sequence, or the fusion gene sequence of virus antigen and adjuvant fusion; Said virus antigen epitope coded sequence is selected from viral structural gene or reconciles the gene epitope sequences; Said virus antigen epitope-MHC-I SCT gene is selected from the fusion sequence of HLA-A2, HLA-A11, HLA-A24, HLA-A30 and virus antigen and β 2m.

2. according to the cocktail vaccine of claim 1, wherein said recombinant DNA is a recombiant plasmid.

3. according to the cocktail vaccine of claim 2, wherein said plasmid is a carrier for expression of eukaryon.

4. according to the cocktail vaccine of claim 1, wherein said recombinant virus is recombinant adenovirus or vaccinia virus recombinant.

5. according to the cocktail vaccine of claim 1, it is the multichip carrier vaccine that comprises recombinant DNA, adenovirus and/or poxvirus through said elements combination is made up.

6. according to the cocktail vaccine of claim 1, it is through said element being covered the single carrier bacterin that makes up in same DNA or adenovirus or the poxvirus vector.

7. according to the cocktail vaccine of claim 1; Wherein said cocktail vaccine is a HBV therapeutic cocktail vaccine; Said element exists with the form of recombinant DNA and/or recombinant virus; Wherein said (A) element is selected from: effectively reduce the RNA interfering (siRNA) that HBV-DNA duplicates, said RNA interfering (siRNA) is shown in SEQ ID NO:62, SEQ ID NO:63, SEQ IDNO:64, SEQ ID NO:65, SEQ ID NO:66 or SEQ ID NO:67; Said (B) element is selected from adjuvant molecule gp96 or its N355 fragment coding sequence, and described N355 fragment is made up of 22-376 terminal amino acid of gp96N end; Said (C) element is selected from structural antigens HBsAg, the HBcAg of HBV, the epitope coded sequence of HBV or epitope-MHC-I SCT gene.

8. according to the cocktail vaccine of claim 1; Wherein said cocktail vaccine is a HCV therapeutic cocktail vaccine; Said element exists with the form of recombinant DNA and/or recombinant virus; Said (A) element is selected from: effectively reduce the RNA interfering (siRNA) that HCV duplicates, said RNA interfering (siRNA) is shown in SEQ ID NO:68; Said (B) element is selected from adjuvant molecule gp96 or its N355 fragment, and described N355 fragment is made up of 22-376 terminal amino acid of gp96N end; Said (C) element is selected from structural antigens Core, E1, the E2 coded sequence of HCV, the epitope coded sequence of HCV or epitope-MHC-I SCT gene.

9. prevent and/or treat the purposes in the medicine of the disease that is caused by immunologic tolerance virus according to each cocktail vaccine among the claim 1-8 in preparation, wherein said immunologic tolerance virus is hepatitis B virus (HBV) or hepatitis C virus (HCV).

10. method for preparing the described medicine of claim 9, said method comprise in claim 1-8 (A) described in each, (B) with (C) element in element be built into active carrier with recombinant DNA and/or recombinant virus respectively.

Images