CN115820742A - Method for improving transduction efficiency of NK cell lentivirus - Google Patents
Method for improving transduction efficiency of NK cell lentivirus Download PDFInfo
- Publication number
- CN115820742A CN115820742A CN202210953546.3A CN202210953546A CN115820742A CN 115820742 A CN115820742 A CN 115820742A CN 202210953546 A CN202210953546 A CN 202210953546A CN 115820742 A CN115820742 A CN 115820742A
- Authority
- CN
- China
- Prior art keywords
- cells
- car
- lentivirus
- baev
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a method for improving NK cell lentivirus transduction efficiency, and belongs to the technical field of cell transduction. Aiming at the bottleneck problem of NK cell exogenous gene transduction, the invention replaces the envelope protein VSVG protein on the surface of lentivirus by a coding BaEV glycoprotein sequence, utilizes the specific binding of the BaEV cell membrane glycoprotein to ASCT2 on an N cell membrane, improves the NK cell lentivirus transduction efficiency, and simultaneously induces NK cells into memory-like NK cells to further improve the lentivirus transduction efficiency of primary NK cells.
Description
Technical Field
The invention belongs to the technical field of cell transduction, and particularly relates to a method for improving NK cell lentivirus transduction efficiency.
Background
Currently, tumor immunotherapy, represented by immune checkpoint inhibitors, brings significant survival benefit to a subset of tumor patients, yet most patients respond poorly or have primary resistance to it [1] . Therefore, the development of various new immunotherapeutic approaches is being accelerated worldwide. The Chimeric Antigen Receptor (CAR) immune cell as a genetically engineered immune cell therapy method can accurately, quickly and efficiently kill tumors, and becomes a novel promising tumor immunotherapy method [2] . Currently, CAR-modified T cells (CAR-T) have achieved surprising efficacy in hematologic malignancies, however, clinical application of CAR-based genetically engineered immune cells in the treatment of malignant solid tumors is limited by selection of tumor-specific antigen targets, limited intratumoral infiltration, intratumoral immunosuppressive microenvironment, tumor cell heterogeneity [3] . The CAR-NK cell has unique biological advantages of higher safety, multiple target cell killing approaches, easy preparation of universal cell products and the like, so that the CAR-NK cell has an immunotherapy means with wider prospect and great clinical value [4] . However, the current clinical transformation application of CAR-NK cells still faces the problem of great difficulty in gene modification [4] . Therefore, the development of a set of technologies capable of efficiently performing NK cell gene modification is the technical bottleneck for realizing effective clinical transformation application of CAR-NK cells at present.
Currently, there are several methods for introducing foreign genes, including lentivirus, retrovirus, adenovirus, transposon techniques, and various transient expression techniques. Current clinical research aimed at primary NK cells (including CAR-NK cell clinical research recently reported in the New England journal of medicine) [5] ) Almost all used are retroviruses or transient expression techniques [4] (ii) a However, retroviruses more readily cause insertional mutagenesis of host genes, and this risk greatly limits their clinical utility [6] . Lentivirus is an ideal gene transfer technology, and can integrate exogenous genes into host genomeHigh efficiency and stable expression, and low risk of host gene insertion mutation. The lentiviruses currently used for gene transduction generally use VSV-G as the envelope protein because VSV-G envelope proteins have a wide range of orientations for a variety of species and cell types. However, NK cells are natural immune cells, and have natural resistance and clearance mechanisms against lentiviruses, and the transduction efficiency of lentiviruses to NK cells is usually only about 3%, which is far from meeting clinical requirements.
Reference documents:
[1]Kim TK,Vandsemb EN,Herbst RS,Chen L.Adaptive immune resistance at the tumour site:mechanisms and therapeutic opportunities.NAT REV DRUG DISCOV 2022.
[2]Rafiq S,Hackett CS,Brentjens RJ.Engineering strategies to overcome the current roadblocks in CAR T cell therapy.NAT REV CLIN ONCOL 2020,17(3):147-167.
[3]Larson RC,Maus MV.Recent advances and discoveries in the mechanisms and functions of CAR T cells.NAT REV CANCER 2021,21(3):145-161.
[4]Xie G,Dong H,Liang Y,Ham JD,Rizwan R,Chen J.CAR-NK cells:A promising cellular immunotherapy for cancer.EBIOMEDICINE 2020,59:102975.
[5]Liu E,Marin D,Banerjee P,Macapinlac HA,Thompson P,Basar R,NassifKL,Overman B,Thall P,Kaplan M,Nandivada V,Kaur I,Nunez CA,Cao K,Daher M,Hosing C,Cohen EN,Kebriaei P,Mehta R,Neelapu S,Nieto Y,Wang M,Wierda W,Keating M,Champlin R,Shpall EJ,Rezvani K.Use of CAR-TransducedNatural Killer Cells in CD19-Positive Lymphoid Tumors.N Engl J Med 2020,382(6):545-553.
[6]Carlsten M,Childs RW.Genetic Manipulation ofNK Cells for Cancer Immunotherapy:Techniques and Clinical Implications.FRONT IMMUNOL 2015,6:266.
disclosure of Invention
In view of the above, the present invention provides a method for improving NK cell lentiviral transduction efficiency, which can achieve a transduction efficiency of 50% or more.
The invention provides a method for improving NK cell lentivirus transduction efficiency, which comprises the following steps:
1) Constructing a lentivirus packaging plasmid containing a coding BaEV glycoprotein sequence;
2) Constructing a lentivirus expression plasmid containing a CAR structural sequence;
3) Transfecting the BaEV glycoprotein-containing lentivirus packaging plasmid in the step 1), the CAR structure sequence-containing lentivirus expression plasmid in the step 2) and the pCMV-dR8.9 plasmid into cells under the action of a transfection reagent, and culturing to collect the BaEV glycoprotein and CAR-expressing lentivirus;
4) Transducing the NK cells with the lentiviruses expressing the BaEV glycoprotein and the CAR in the step 3) to obtain NK cells expressing the CAR;
there is no chronological restriction between step 1) and step 2).
Preferably, the NK cells of step 4) comprise primary NK cells and NK92 cell line.
Preferably, the primary NK cells comprise memory-like NK cells.
Preferably, the method for inducing memory-like NK cells comprises the steps of stimulating primary NK cells in NK amplification culture medium containing cytokines; the cytokines include 10ng/ml rhIL-12, 50ng/ml rhIL-15 and 50ng/ml rhIL-18.
Preferably, the method of transduction in step 4) is transduction with a viral titer of MOI =10 of 10 6 And (4) individual NK cells.
Preferably, in the method for constructing the lentivirus packaging plasmid containing the BaEV glycoprotein-encoding sequence in the step 1), the codon-optimized BaEV glycoprotein-encoding sequence is inserted into the pCMV plasmid through a homologous recombination technology, and the codon-optimized BaEV glycoprotein-encoding sequence is shown as a nucleotide sequence in SEQ ID NO. 1.
Preferably, the method for constructing a lentiviral expression plasmid containing a CAR structural sequence as described in step 2), the CAR structural sequence is inserted at the XbaI/ClaI site of the pHIV-EGFP plasmid.
Preferably, the CAR structural sequence sequentially comprises anti-CD-19scFv, a CD8 alpha hinge region, an NKG2D transmembrane region and a 2B4 cytoplasmic region;
the CAR structural sequence is shown as SEQ ID NO. 2.
Preferably, the mass ratio of the BaeV glycoprotein containing lentiviral packaging plasmid, CAR structural sequence containing lentiviral expression plasmid and pCMV-dr8.9 plasmid in step 2) is 3.
The invention provides application of the CAR-expressing NK cell prepared by the method in preparation of a tumor killing medicine.
The invention provides a method for improving NK cell lentivirus transduction efficiency, which is characterized in that lentivirus packaging plasmids containing coding BaEV glycoprotein sequences are constructed, so that the packaged lentivirus BaEV cell membrane glycoprotein can be specifically combined with ASCT2 on NK cell membranes, and the NK cell lentivirus transduction efficiency is improved. The results show that the transduction efficiency of the BaEV lentivirus on NK92 cell strains and NK cells derived from peripheral blood can reach more than 50%.
Furthermore, the invention specifically limits the NK cells to be memory-like NK cells. The expression quantity of ASCT2 protein on the memory-like NK cell is obviously up-regulated compared with that of the conventional NK cell, and the lentivirus transduction efficiency of the primary NK cell is further improved due to the fact that the packaged lentivirus BaEV cell membrane glycoprotein is specifically combined with the ASCT2 on the NK cell membrane. Experiments show that the transduction efficiency of the lentivirus to NK92 cells can reach more than 90%.
Drawings
FIG. 1 is a schematic diagram showing the replacement of the lentiviral surface envelope protein VSVG protein with the BaEV glycoprotein;
FIG. 2 shows the results of virus titer detection before and after transduction of Jurkat cells with lentivirus by flow assay, wherein the abscissa is GFP fluorescence intensity and the ordinate is APC-labeled protein-L for detecting the expression of CAR on the surface of NK92 cells;
FIG. 3 shows the results of flow measurement of transduction efficiency of NK92 cells, the left panel shows untransduced cells, the right panel shows lentivirus-transduced NK92 cells expressing CD19-CAR and GFP, the abscissa shows GFP fluorescence intensity, and the ordinate shows APC-labeled protein-L for detecting expression of CAR on the surface of NK92 cells;
FIG. 4 is a result of flow assay of transduction efficiency of primary NK cells, wherein after CD19-CAR lentivirus is transduced by primary NK cells, the proportion of CAR-expressing positive NK cells is detected by flow cytometry, the left panel shows NK92 cells without transduced virus as negative control, and the right panel shows expression;
FIG. 5 shows the result of memory-like NK cell assay, wherein A is the result of detecting CD3, CD56 expression after NK cells are sorted; b is a Cytokine-induced memory-like (CIMNK) cell which is generated by carrying out short-term pre-stimulation on the primary NK cell for 12h to generate Cytokine induction; c is the expression of ASCT2 on 'memory-like' NK cells generated by cytokine stimulation through flow detection;
FIG. 6 shows the results of flow assay of transduction efficiency of primary memory-like NK cells, the left panels are primary NK cells cultured conventionally, the right panels are "memory-like" primary NK cells produced by cytokine stimulation, primary NK cells not transduced with CAR lentivirus are used as negative control, and CAR expression on primary NK cells expressing CAR-GFP is detected by APC-labeled protein-L (ordinate).
Detailed Description
The invention provides a method for improving NK cell lentivirus transduction efficiency, which comprises the following steps:
1) Constructing a lentivirus packaging plasmid containing a coding BaEV glycoprotein sequence;
2) Constructing a lentivirus expression plasmid containing a CAR structural sequence;
3) Transfecting the BaEV glycoprotein-containing lentivirus packaging plasmid in the step 1), the CAR structure sequence-containing lentivirus expression plasmid in the step 2) and the pCMV-dR8.9 plasmid into cells under the action of a transfection reagent, and culturing to collect the BaEV glycoprotein and CAR-expressing lentivirus;
4) Transducing the NK cells with the lentiviruses expressing the BaEV glycoprotein and the CAR in the step 3) to obtain NK cells expressing the CAR;
there is no chronological restriction between step 1) and step 2).
The invention constructs a lentiviral packaging plasmid containing a sequence encoding the BaEV glycoprotein.
In the present invention, the method for constructing a lentiviral packaging plasmid containing a sequence encoding a BaEV glycoprotein, preferably, the codon-optimized sequence encoding a BaEV glycoprotein is inserted into a pCMV plasmid by homologous recombination techniquesThe sequence of the coded BaEV glycoprotein is shown as SEQ ID NO. 1. The pCMV plasmid was purchased from Addgene. The homologous recombination utilizes Gibson
Homologous recombination kit (NEB). After construction, the constructed plasmid is also preferably verified by DNA sequencing.
The invention constructs a lentiviral expression plasmid containing a CAR structural sequence.
In the present invention, the method for constructing a lentiviral expression plasmid containing a CAR-structural sequence preferably inserts the CAR-structural sequence into the XbaI/ClaI site of the PHIV-EGFP plasmid. The CAR structural sequence preferably comprises an anti-CD-19scFv, a CD8 alpha hinge region, an NKG2D transmembrane region and a 2B4 cytoplasmic region in sequence. Wherein the nucleotide sequence of the anti-CD-19scFv is shown as SEQ ID NO. 3. The CD8 α hinge region is described in NCBI Reference Sequence: NM-001768. The NKG2D transmembrane domain is described in NCBI Reference Sequence: NM-007360.3. The 2B4 cytoplasmic domain is described in NCBI Reference Sequence: NM-001166663.1. The CAR structural sequence is shown as SEQ ID NO 2
(5'-atggccctccctgtcaccgccctgctgcttccgctggctcttctgctccacgccgctcggcccgaaattgtgatgacccagtcacccgccactcttagcctttcacccggtgagcgcgcaaccctgtcttgcagagcctcccaagacatctcaaaataccttaattggtatcaacagaagcccggacaggctcctcgccttctgatctaccacaccagccggctccattctggaatccctgccaggttcagcggtagcggatctgggaccgactacaccctcactatcagctcactgcagccagaggacttcgctgtctatttctgtcagcaagggaacaccctgccctacacctttggacagggcaccaagctcgagattaaaggtggaggtggcagcggaggaggtgggtccggcggtggaggaagccaggtccaactccaagaaagcggaccgggtcttgtgaagccatcagaaactctttcactgacttgtactgtgagcggagtgtctctccccgattacggggtgtcttggatcagacagccaccggggaagggtctggaatggattggagtgatttggggctctgagactacttactactcttcatccctcaagtcacgcgtcaccatctcaaaggacaactctaagaatcaggtgtcactgaaactgtcatctgtgaccgcagccgacaccgccgtgtactattgcgctaagcattactattatggcgggagctacgcaatggattactggggacagggtactctggtcaccgtgtccagcaccactaccccagcaccgaggccacccaccccggctcctaccatcgcctcccagcctctgtccctgcgtccggaggcatgtagacccgcagctggtggggccgtgcatacccggggtcttgacttcgcctgcgattcaaacctattcgtagctagttggatagcagtaatgattattttccgtatcggaatggccgtagctatcttctgctgcttcttttttccaaggagaaagaggaaggagaagcagtcagagaccagtcccaaggaatttttgacaatttacgaagatgtcaaggatctgaaaaccaggagaaatcacgagcaggagcagacttttcctggaggggggagcaccatctactctatgatccagtcccagtcttctgctcccacgtcacaagaacctgcatatacattatattcattaattcagccttccaggaagtctggaagcaggaagaggaaccacagcccttccttcaatagcactatctatgaagtgattggaaagagtcaacctaaagcccagaaccctgctcgattgagccgcaaagagctggagaactttgatgtttattcccgcgtgaaattcagccgcagcgcagatgctccagcctacaagcaggggcagaaccagctctacaacgaactcaatcttggtcggagagaggagtacgacgtgctggacaagcggagaggacgggacccagaaatgggcgggaagccgcgcagaaagaatccccaagagggcctgtacaacgagctccaaaaggataagatggcagaagcctatagcgagattggtatgaaaggggaacgcagaagaggcaaaggccacgacggactgtaccagggactcagcaccgccaccaaggacacctatgacgctcttcacatgcaggccctgccgcctcgg-3'). The CAR structural sequences were committed to the synthesis by huada gene corporation. The PHIV-EGFP plasmid was purchased from Addgene. The nucleotide sequence of the anti-CD-19scFv is shown in SEQ ID NO:3 (5'-gaaattgtgatgacccagtcacccgccactcttagcctttcacccggtgagcgcgcaaccctgtcttgcagagcctcccaagacatctcaaaataccttaattggtatcaacagaagcccggacaggctcctcgccttctgatctaccacaccagccggctccattctggaatccctgccaggttcagcggtagcggatctgggaccgactacaccctcactatcagctcactgcagccagaggacttcgctgtctatttctgtcagcaagggaacaccctgccctacacctttggacagggcaccaagctcgagattaaaggtggaggtggcagcggaggaggtgggtccggcggtggaggaagccaggtccaactccaagaaagcggaccgggtcttgtgaagccatcagaaactctttcactgacttgtactgtgagcggagtgtctctccccgattacggggtgtcttggatcagacagccaccggggaagggtctggaatggattggagtgatttggggctctgagactacttactactcttcatccctcaagtcacgcgtcaccatctcaaaggacaactctaagaatcaggtgtcactgaaactgtcatctgtgaccgcagccgacaccgccgtgtactattgcgctaagcattactattatggcgggagctacgcaatggattactggggacagggtactctggtcaccgtgtccagc-3'). Preferably, the inserting method adopts XbaI/ClaI double enzyme digestion to respectively process the CAR structural sequence and the PHIV-EGFP plasmid, the obtained CAR structural fragment is connected with the linearized PHIV-EGFP plasmid, and the lentivirus expression plasmid containing the CAR structural sequence is obtained through identification. The XbaI/ClaI double-restriction reaction system is preferably performed according to XbaI/ClaI restriction enzyme reagent (NEB) instructions, and the XbaI/ClaI double-restriction reaction conditions are preferably performed according to the XbaI/ClaI restriction enzyme reagent (NEB) instructions. The ligation is preferably performed using T4 ligase. The reaction system for T4 ligase ligation is preferably performed according to the T4 ligase reagent (NEB) instructions. The reaction conditions for T4 ligase ligation are preferably performed according to the T4 ligase reagent (NEB) specification. The method of identification is preferably DNA sequencing (Huada Gene Co.).
After the construction of plasmids is completed, the invention transfects the cells of the lentiviral packaging plasmid containing the BaeV glycoprotein, the lentiviral expression plasmid containing the CAR structural sequence and the pCMV-dR8.9 plasmid under the action of a transfection reagent, and collects the lentiviruses expressing the BaeV glycoprotein and CAR by culture.
In the present invention, the mass ratio of the BaeV glycoprotein containing lentiviral packaging plasmid, the CAR structural sequence containing lentiviral expression plasmid and the pCMV-dr8.9 plasmid is preferably 3. The transfection reagent is preferably TrnasT (Mirus). The method of transfection is not particularly limited, and any transfection method known in the art may be used. The culture method comprises the steps of firstly culturing for 48-72 h, then collecting supernatant, carrying out ultracentrifugation, collecting virus, carrying out resuspension by serum-free DMEM, carrying out 12 culture, and collecting the virus again. The collected viruses were tested for expression of CAR structures. The rotational speed of the ultracentrifugation is preferably 25000rpm, and the time of the ultracentrifugation is preferably 2h. The temperature of the ultracentrifugation is preferably 4 ℃. The method for detecting the expression of the CAR structure is preferably to transduce 10. Mu.l of virus fluid 6 Jurkat cells (1000g, 1h centrifuged at RT) were cultured for 72h and CAR expression was detected by flow cytometry. The method for detecting the expression of CAR by flow cytometry preferably utilizes biotinylated Protein L as primary antibody (GenScript), APC-coupled streptavidin as secondary antibody (BD Biosciences) to label cells, detects the expression of CAR by flow cytometry, and calculates the lentiviral titer.
After obtaining the lentivirus expressing the BaEV glycoprotein and the CAR, the lentivirus expressing the BaEV glycoprotein and the CAR is transduced into NK cells to obtain the NK cells expressing the CAR.
In the present invention, the method of transduction is preferably treatment with a virus titer of MOI =10 of 10 6 Fine NKCells were centrifuged and cultured. The centrifugation condition is preferably centrifugation for 55-65 min at 30-34 ℃ and 1000 g/h. The temperature of the culture is preferably 37 ℃. The time for the culture is preferably 70 to 75 hours, more preferably 72 hours. The culture Medium is preferably an NK cell amplification Medium (NK MACS Medium, miltenyi Biotec).
In the present invention, the NK cells preferably include primary NK cells and NK92 cell lines. The primary NK cell separation method is preferably to separate primary NK Cells from peripheral blood of healthy people by using an NK cell sorting kit (Stem Cells). The sorting method is just as follows according to the instructions of the NK cell sorting kit. The NK cell sorting kit was purchased from Stem Cells, inc.
In the present invention, said primary NK cells preferably comprise memory-like NK cells. The induction method of memory-like NK cells preferably comprises stimulating primary NK cells in NK amplification medium containing cytokines; the cytokines include 10ng/ml rhIL-12, 50ng/ml rhIL-15 and 50ng/ml rhIL-18.
In the present invention, after the culture is completed, the expression of the CAR structure is detected by flow cytometry. The result shows that the NK cell expressing the CAR prepared by the method can stably express the CAR structure, and the transduction efficiency can reach more than 90%.
In view of the fact that the prepared NK cell can efficiently express a CAR structure and provide killing performance of the NK cell on tumors, the invention provides application of the CAR-expressing NK cell prepared by the method in preparation of tumor killing medicines.
The method for improving NK cell lentiviral transduction efficiency provided by the present invention is described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
Preparation method of BaEV lentivirus
1) The method for constructing the BaEV lentivirus packaging plasmid is shown in figure 1, and comprises the following specific steps:
codon-optimized BaEV DNA fragments were synthesized by huada gene corporation and integrated into the pCMV plasmid (from addge) by homologous recombination techniques, and the sequences of the BaEV DNA fragments were as follows:
5’-atgggtttcactacgaaaattatctttctgtataatctggtactcgtatatgcgggtttcgacgatcccaggaaagcgatcgaacttgtccagaagagatacgggaggccctgtgactgcagcggagggcaagtatcagaacccccctctgatcgggtcagccaagttacttgcagcggcaaaacagcttacctgatgccggatcagagatggaaatgcaaatccatacccaaggacaccagtccgagtggaccattgcaggaatgtccgtgtaatagttaccaatcaagcgtccattcaagttgctacacgtcataccagcaatgtcgctcaggaaataaaacctattatacggcgacactgcttaaaacccaaacgggtggcacctctgatgttcaggttctcggaagtacgaataagttgattcagagtccctgcaacggtatcaaaggccagtcaatttgttggtctacgacagcgcctatccatgtgagtgacggcggtgggccgttggatacaacacgaataaaaagtgtacagcggaaacttgaggagatacacaaagccctctaccccgagcttcagtaccatcccctggccatccctaaggtcagggacaatctcatggtagacgctcaaaccctcaacatcctcaatgccacctacaatctcttgttgatgtctaacacaagcttggtagatgactgctggctctgtcttaaattgggccctccgactcccctcgctatacccaacttccttctgtcatacgtaacgcgcagctccgacaacatatcatgtctgataatcccgccgttgcttgtgcagcccatgcagttctctaacagctcctgcttgttcagtccatcttataattcaacagaagaaattgatttgggccatgtagctttcagtaactgtacatcaataactaacgtcactggccccatctgcgccgtgaacggttctgtcttcctctgcggcaacaatatggcttatacatacttgccaactaactggaccggtctgtgtgtattggccacgctgttgcctgacatagatataatccctggcgacgaacccgtccctatcccagccatcgaccattttatttatcgccccaagcgcgcgattcagtttatccctctgctcgctgggttgggcattacggctgcttttactacgggggctaccggccttggagtgtccgttacccaatatacgaaactgtccaatcaattgatttcagacgtgcaaatcttgagctctactatccaggatctgcaggaccaggtagactctctggcggaagtcgtcttgcaaaatcggcgggggttggatctgctgaccgccgagcagggcggcatctgtcttgctcttcaagaaaaatgctgtttttacgtgaacaaatcaggtattgtaagagataaaataaaaactttgcaagaagagctcgaaaggaggcggaaagacctggcgtctaatcctctgtggactggcctgcaggggctcctcccctatttgctgccctttcttggtccgctcctgactttgttgctgctcctgactattgggccatgcatcttcaatcgactcaccgcgttcatcaatgataaactcaacataatccacgctatgtga-3’(SEQ ID NO:1)。
2) Construction method of CD19-CAR-NK-GFP recombinant expression plasmid
The CAR structure comprises anti-CD-19scFv, a CD8 alpha hinge region (NCBI accession number: NM-001768), a NKG2D transmembrane region (NCBI accession number: NM-007360.3), a 2B4 cytoplasmic region (NCBI accession number: NM-001166663.1, a CAR structure sequence is synthesized by Huada gene company, a framework plasmid PHIV-EGFP (from Addgene) and the synthesized CAR fragment are subjected to double digestion by XbaI (NEB) and ClaI (NEB) respectively, and the digested fragment and the linearized PHIV-EGFP plasmid are connected by T4 ligase (NEB) to obtain the CD19-CAR-NK-GFP recombinant plasmid.
3) Virus preparation and titer determination
Preparing 293T cells, inoculating the cells into a 15cm culture dish, and packaging the virus when the cells grow to about 100% density;
BaEV packaging plasmid (6. Mu.g) and pCMV-dR8.9 (10. Mu.g) (from Addgene) and expression plasmid (pHIV-CD 19-CAR-NK-GFP) (20. Mu.g) were added to a tube of 2.5ml opti-MEM medium and allowed to stand for 5min. The transfection-promoting reagent TrnasT (Mirus) was added to another tube containing 2.5ml of opti-MEM medium and left to stand for 5min. Then the two tubes of solution were mixed and left to stand for 30min. The mixture was added dropwise to a 15cm dish containing 293T cells. Supernatants were collected after 48h and 72h, ultracentrifuged (25000rpm, 4 ℃,2 h), and then virus pellet after centrifugation was resuspended in serum-free DMEM. After 12h, the resuspended viruses were collected to obtain BaEV lentiviruses.
Example 2
Mu.l of the BaEV virus solution prepared in example 1 was taken and transduced with 10 6 Jurkat cells (1000g, 1h centrifuged at RT) were obtained. After 72h, the expression of CAR was detected by flow assay, which was performed as follows: cells were labeled with biotinylated Protein L as primary antibody (GenScript) and APC-conjugated streptavidin as secondary antibody (BD Biosciences), and CAR expression was detected by flow cytometry to calculate lentiviral titers.
The results are shown in FIG. 2. FIG. 2 shows 1. Mu.l BaEV viral fluid transduction 10 6 11.9% of the Jurkat cells successfully expressed CAR and GFP after Jurkat cells, and the virus titer was calculated to be 1X 10 6 ×11.9％×10 3 ＝1.19×10 8 TU/ml。
Example 3
The BaEV virus liquid prepared in example 1 is taken to transduce 10 according to the lentivirus titer at a titer of MOI =10 6 NK92 cells were centrifuged (1000 g/h,32 ℃,60 min) and cultured in an incubator. After 3 days of cultureThe transduction efficiency, i.e., the proportion of GFP-positive cells, was determined by flow cytometry. NK92 cells not transduced with BaEV virus were also set as control.
The results are shown in FIG. 3. The transduction efficiency of the CD19-CAR lentivirus on NK92 cells can reach more than 60%.
Example 4
Method for transducing primary NK cells by BaEV lentivirus
1. Separating peripheral blood of healthy volunteers, and sorting out primary NK Cells by using an NK cell sorting kit (Stem Cells);
2. the BaEV virus liquid prepared in example 1 was taken and transduced 10 at a titer of MOI =10 according to lentivirus titer 6 The primary NK cells are centrifuged (1000 g/h,32 ℃,60 min) and cultured in an incubator. After 3 days of culture, the transduction efficiency, i.e., the proportion of GFP-positive cells, was measured by flow cytometry. Primary NK cells not transduced with BaEV virus were also set as control.
As shown in fig. 4, the transduction efficiency of BaEV lentivirus to primary NK cells, i.e., the proportion of GFP-positive cells was 27%.
Example 5
Preparation method of memory-like primary NK (natural killer) cells
After NK Cells are selected from human PBMCs, primary NK Cells are selected by using a NK cell selection kit (Stem Cells), expression of CD3CD56 is detected by adopting flow cytometry, and Cells with double positive expression are selected as NK Cells (see A in figure 5); pre-stimulating primary NK cells for 12h in an NK amplification medium (Meitian and whirly company) by using cytokines rhIL-12 (10 ng/ml) (Peprotech), rhIL-15 (50 ng/ml) and rhIL-18 (50 ng/ml) to obtain 'memory-like' (CIML) NK cells through induction (the flow chart is shown as B in a figure 5). Expression of ASCT2 was detected using a rabbit anti-human ASCT2 monoclonal antibody (clone D7C12, cell Signaling Technology) as a primary antibody and a FITC-labeled goat anti-rabbit secondary antibody (ab 97199, abcam).
The results are shown in fig. 5C, suggesting that the expression of ASCT2 on "memory-like" NK cells induced following cytokine stimulation is significantly increased.
Example 6
Method for transduction of memory-like primary NK cells by BaEV (baculovirus)
The BaEV virus solution prepared in example 1 was used to transduce "memory-like" NK cells according to lentivirus titer at MOI =10, as described in example 5. Transduction efficiency was measured after 3 days by flow assay. Meanwhile, setting the conventional primary NK cells before and after the transduction by the BaEV lentivirus as a control.
The results are shown in FIG. 6. The transduction efficiency of the conventional primary NK cells after transduction by the BaEV lentivirus is 22.9%; while the transduction efficiency of the 'memory-like' primary NK cells transduced with the BaEV lentivirus reaches 58%. Therefore, cytokine stimulation of the generated "memory-like" primary NK cells can significantly improve the lentiviral transduction efficiency.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Claims (10)
1. A method of increasing the lentiviral transduction efficiency of NK cells, comprising the steps of:
1) Constructing a lentivirus packaging plasmid containing a coding BaEV glycoprotein sequence;
2) Constructing a lentivirus expression plasmid containing a CAR structural sequence;
3) Transfecting the BaEV glycoprotein-containing lentivirus packaging plasmid in the step 1), the CAR structure sequence-containing lentivirus expression plasmid in the step 2) and the pCMV-dR8.9 plasmid into cells under the action of a transfection reagent, and culturing to collect the BaEV glycoprotein and CAR-expressing lentivirus;
4) Transducing the NK cells with the lentiviruses expressing the BaeV glycoproteins and the CAR in the step 3) to obtain CAR-expressing NK cells;
there is no chronological restriction between step 1) and step 2).
2. The method according to claim 1, wherein said NK cells of step 4) comprise primary NK cells and NK92 cell line.
3. The method of claim 2, wherein said primary NK cells comprise memory-like NK cells.
4. The method according to claim 3, wherein the method for inducing memory-like NK cells comprises stimulating primary NK cells in cytokine-containing NK expansion medium; the cytokines include 10ng/ml rhIL-12, 50ng/ml rhIL-15 and 50ng/ml rhIL-18.
5. The method of claim 1, wherein the transduction in step 4) is performed by transducing 10 with a viral titer of MOI =10 6 And (4) individual NK cells.
6. The method of claim 1, wherein the method for constructing the lentiviral packaging plasmid containing the BaEV glycoprotein-encoding sequence in step 1) inserts the codon-optimized BaEV glycoprotein-encoding sequence into the pCMV plasmid by homologous recombination, and the codon-optimized BaEV glycoprotein-encoding sequence has a nucleotide sequence shown as SEQ ID NO. 1.
7. The method of claim 1, wherein in step 2) the method for constructing a lentiviral expression plasmid comprising a CAR structural sequence inserts the CAR structural sequence into the XbaI/ClaI site of the pHIV-EGFP plasmid.
8. The method according to claim 1 or 7, wherein the CAR structural sequence comprises, in order, anti-CD-19scfv, cd8 α hinge region, NKG2D transmembrane region, 2B4 cytoplasmic region;
the CAR structural sequence is shown as SEQ ID NO. 2.
9. The method according to claim 1, wherein the mass ratio of the BaEV glycoprotein-containing lentiviral packaging plasmid, the CAR structural sequence-containing lentiviral expression plasmid, and the pCMV-dr8.9 plasmid in step 2) is 3.
10. Use of CAR-expressing NK cells prepared according to any of claims 1 to 9 for the preparation of a medicament for killing tumors.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210953546.3A CN115820742A (en) | 2022-08-10 | 2022-08-10 | Method for improving transduction efficiency of NK cell lentivirus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210953546.3A CN115820742A (en) | 2022-08-10 | 2022-08-10 | Method for improving transduction efficiency of NK cell lentivirus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN115820742A true CN115820742A (en) | 2023-03-21 |
Family
ID=85523029
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210953546.3A Pending CN115820742A (en) | 2022-08-10 | 2022-08-10 | Method for improving transduction efficiency of NK cell lentivirus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN115820742A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116554353A (en) * | 2023-04-28 | 2023-08-08 | 北京奇迈永华生物科技有限公司 | Method for efficiently infecting human NK cells and other immune cells by pseudoviruses |
-
2022
- 2022-08-10 CN CN202210953546.3A patent/CN115820742A/en active Pending
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116554353A (en) * | 2023-04-28 | 2023-08-08 | 北京奇迈永华生物科技有限公司 | Method for efficiently infecting human NK cells and other immune cells by pseudoviruses |
| CN116554353B (en) * | 2023-04-28 | 2024-05-03 | 北京奇迈永华生物科技有限公司 | Method for efficiently infecting human NK cells and other immune cells by pseudoviruses |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021189571A1 (en) | Vaccine vector capable of efficiently inducing body humoral immune response as well as preparation method therefor and application thereof | |
| CN110464841B (en) | Immunity-enhancing pharmaceutical composition and application thereof | |
| US11932872B2 (en) | Dual chimeric antigen receptor-t cell which can be regulated, construction method therefor and use thereof | |
| CN103820393A (en) | Engineered CD20 targeting NKT cell and its preparation method and application | |
| CN105949316B (en) | Anti- EGFRvIII Chimeric antigen receptor, encoding gene, recombinant expression carrier and its construction method and application | |
| CN105950664B (en) | A kind of replication defective recombinant slow virus CAR-T transgene carrier targeting CD123 and its construction method and application | |
| CN104910278A (en) | Lentivirus used for preparing CART cells and having characteristics of efficient transfection capacity and biological activity | |
| CN105950663B (en) | A kind of replication defective recombinant slow virus CAR-T transgene carrier targeting CD30 and its construction method and application | |
| CN112391414A (en) | HER 2-targeted CAR-T expression vector and construction and application thereof | |
| CN115212299A (en) | Application of CAR-T and CAR-M combination in preparation of antitumor drugs | |
| CN115820742A (en) | Method for improving transduction efficiency of NK cell lentivirus | |
| CN107286246B (en) | Chimeric antigen receptor modified dendritic cell for treating brain glioma and preparation method thereof | |
| WO2020164166A1 (en) | General-purpose car-t cell, and preparation method therefor and use thereof | |
| CN105969805B (en) | A kind of replication defective recombinant slow virus CAR-T transgene carrier targeting Mesothelin and its construction method and application | |
| CN114957483A (en) | CD 155-targeted CAR (CAR-based protein) structural design and application thereof | |
| CN109796536B (en) | Preparation method of CTL (cytotoxic T lymphocyte) targeting multiple epitopes of glioblastoma | |
| CN110157674A (en) | A kind of targeting T lymphocyte and its preparation method and application | |
| WO2021036245A1 (en) | Chimeric antigen receptor t cell carrying safety switch and targeting egfrvⅲ, and preparation method therefor and use thereof | |
| US11718827B2 (en) | LRFFT2 cell | |
| CN107502596A (en) | Express T cell and its application of the specificity TCRs of NY ESO 1 | |
| WO2020164167A1 (en) | Recombinant adeno-associated viral vector for use in preparation of general-purpose car-t, and construction method therefor and use thereof | |
| CN111620955B (en) | Multi-target-site composite antigen and application thereof | |
| CN110172480B (en) | Double-antigen epitope fusion gene recombinant lentiviral vector, antigen presenting cell and CTL cell as well as construction method and application thereof | |
| CN110484507A (en) | A kind of technology of preparing of the Novel chimeric antigen receptor T cell of target tumor Her2 | |
| WO2018032619A1 (en) | Applications of soluble protein baff in b cell in-vitro culture and proliferation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |