CN110464841B - Immunity-enhancing pharmaceutical composition and application thereof - Google Patents

Abstract

The invention discloses an immunopotentiating pharmaceutical composition and application thereof. The immunopotentiating pharmaceutical composition of the present invention comprises a vaccine and a modulator, wherein the vaccine comprises at least one nucleic acid comprising at least one open reading frame encoding at least one antigen and/or at least one polypeptide comprising at least one antigenic epitope. The modulator comprises at least one selected from Bcl2, CD40L, IL-15 and IL-15Ra or coding nucleic acid thereof and a transforming growth factor signal path inhibitor. The immunopotentiating pharmaceutical compositions of the present invention can provide protective immunity from pathogen infection and can be used for the prevention and/or treatment of various tumors.

Description

Immunity-enhancing pharmaceutical composition and application thereof

Technical Field

The invention relates to a pharmaceutical product, in particular to an immunopotentiating pharmaceutical composition and a method for increasing the proportion of specific T lymphocytes of anti-tumor antigens in lymphocytes. The specific T lymphocyte of the antitumor antigen has the characteristic of expressing TNF-a or/and IFN-r.

Background

The immune response of the body is first to capture antigen by Antigen Presenting Cells (APC), processed and processed to present antigen information to lymphocytes, and then to initiate a series of specific immune responses. Dendritic Cells (DCs) are the most powerful APC currently considered to be able to stimulate naive T cells

T cells) is a central link in initiating, regulating and maintaining specific immune responses. In the anti-tumor immunity of the body, the cellular immunity mediated by T cells plays an important role.

Research finds that the tumor patients have the characteristics of reduced DC number and function defects, the number and the function of tumor tissues and DC infiltration around the tumor tissues are closely related to the occurrence, development, metastasis and prognosis of tumors, the tumors with dense DC infiltration have high differentiation degree and better prognosis, while tumors with mild DC infiltration are often accompanied with low differentiation degree and malignant progression, tumor cells have high-level Fas expression, can induce apoptosis of lymphocytes expressed by FasL, and can secrete immunosuppressive cytokines such as TGF- β and IL-10, so that the antigen presenting capability is reduced, and immune attack is avoided.

In recent years, it has become clear that the immune system does recognize tumor antigens, but despite the presence of tumor antigens, T cells are assured to remain quiescent. Based on this phenomenon, there is a hypothesis that: antigen presenting cells in the patient, which fail to correctly recognize the tumor antigen, present it to T lymphocytes, causing a tumor-specific immune response. In recent years, increasing the number of antigen presenting cells, and improving the ability of antigen presenting cells, especially DC cells, to take up, transport, present antigen, and stimulate T cells, are a major focus in the current tumor immunization research.

Numerous studies have shown that CD40-CD 40L-mediated signaling can induce activation of APC. The latter plays an important role in the activation of tumor-specific immune killer T cells: provides an antigen stimulating signal and a second signal, and the two signals act synergistically to start immune cascade reaction and exert the tumor immune function. Meanwhile, the research finds that the CD40L can also maintain the activation and survival of DC cells and the expansion of CD8+ T cells, and can antagonize the inhibitory effect of the cytokine IL-10 on the differentiation, maturation and function of the DC cells.

The CD40L molecule can interact with DC surface CD40 to activate DC, promote APC co-stimulatory molecule expression and cytokine secretion. Activated DCs are a bridge between tumor cells and tumor-specific immune killer T cells, and can present tumor antigens to and activate T cells, producing tumor-specific killer T cells. Thus, activation of DCs via the CD40-CD40L signaling molecule pathway can enhance the presentation of poorly immunogenic tumor cell antigens, inducing tumor-specific immunity.

IL-15 is a cytokine structurally similar to IL-2 and is widely expressed in various cells and tissues such as monocytes, macrophages, DC cells, fibroblasts, etc. IL-15 activates downstream JAK1, JAK3 by binding to IL-15 receptor α, leading to phosphorylation of downstream STAT3 and STAT5 and activation of signaling pathways, inducing phosphorylation of BCL2, MAP kinase pathway, Lck and syk, leading to proliferation and maturation of cells.

IL-15 is capable of regulating T cell and NK cell activation and proliferation, and maintaining memory T cell survival in the absence of antigen stimulation. It has been demonstrated that IL-15 inhibits apoptosis in rodent lymphocytes by inducing BCL2L1/BCL-x (L). Similarly, IL-15 has also been found to inhibit apoptosis of T lymphocytes in humans by inducing BCL2 and/or Bcl-xL.

Recently, there have been researchers using Newcastle Disease Virus (NDV) as a vector to construct a DNA tumor vaccine expressing recombinant IL-15 protein. Preclinical results show that this tumor vaccine has shown potential to control melanoma growth in a mouse model. Likewise, recombinant vaccinia viruses expressing influenza a protein and IL-15 are able to promote cross protection of CD4+ T cells. Another recombinant brucella DNA vaccine containing the IL-15 gene showed the ability to enhance CD8+ T cell immune responses in mice.

TGF- β (TGF- β) is a multifunctional cytokine that can affect cell growth, differentiation, apoptosis, etc. in addition, TGF- β has important immunomodulatory effects TGF- β can effectively inhibit T cell function and antigen presenting ability of DC cells recent studies have demonstrated a direct role for TGF- β in upregulating plasma-like DC (pDC) expression of the immunomodulatory enzyme indoleamine 2, 3-dioxygenase (IDO) and lead to long-term T cell tolerance.

TGFBR1/2 belongs to the transmembrane type receptor serine/threonine kinase family, which contains a serine/threonine kinase domain intracellularly, after binding to TGFBR1/2 heterodimers, transforming growth factor- β activates downstream signaling molecules and further activates signaling, the intracellular segment of TGFBR3 does not contain a kinase active region and does not directly participate in signaling, primarily regulates the binding of TGF- β to signal receptors, also known as co-receptors.

TGFBR3 is a typical co-receptor of the TGF- β signaling pathway and is involved in mediating SMAD-dependent and SMAD-independent downstream signaling pathways it has been found that in the early stages of many tumors, such as breast cancer, the expression level of TGFBR3 is significantly down-regulated compared to patient paracancerous normal tissue.

In recent years, there have been a number of reports of tumor treatment using antigen-loaded DC vaccines, and from the data reported so far, DC vaccines appear to represent a new and very promising approach for improved tumor immunotherapy. However, the use of DC vaccines alone often does not result in the desired improvement in immunotherapeutic effects and does not result in satisfactory clinical results.

Disclosure of Invention

In order to solve at least part of the technical problems of the prior art, the present inventors have found, after intensive research, that the immunity of a vaccine can be synergistically enhanced or improved by using different modulators in combination. The present invention has been accomplished, at least in part, based on this. Specifically, the present invention includes the following.

In a first aspect of the invention, there is provided an immunopotentiating pharmaceutical composition comprising:

(1) a vaccine comprising at least one nucleic acid comprising at least one open reading frame encoding at least one antigen and/or at least one polypeptide comprising at least one antigenic epitope;

(2) a modulator comprising at least one selected from the group consisting of Bcl2, CD40L, IL-15, and IL-15Ra, or a nucleic acid encoding same, and a transforming growth factor signaling pathway inhibitor.

In certain embodiments, the transforming growth factor signaling pathway inhibitor is selected from inhibitors against at least one of TGF- β, TGFBR1, TGFBR2, and TGFBR 3.

In certain embodiments, the transforming growth factor signaling pathway inhibitor is selected from the group consisting of an antagonistic antibody or a nucleic acid encoding an antagonistic antibody, an siRNA, an antisense RNA, a protein comprising or a nucleic acid encoding an amino acid sequence capable of binding TGF- β and capable of blocking the transforming growth factor signaling pathway, a soluble protein or a nucleic acid encoding the soluble protein that competes with TGF- β for binding to its receptor TGFBR1, TGFBR2, or TGFBR3, and a small molecule inhibitor.

In certain embodiments, the transforming growth factor signaling pathway inhibitor is an antibody or a nucleic acid encoding an antibody directed against TGF- β or a receptor thereof.

In certain embodiments, the protein comprising an amino acid sequence capable of binding TGF- β and blocking the transforming growth factor signaling pathway is selected from fragments of TGFBR1, TGFBR2, or TGFBR 3.

In certain embodiments, the fragment is a fusion protein comprising the extracellular domain of TGFBR1, TGFBR2, or TGFBR 3.

In certain embodiments, the fusion protein is a fusion protein of the extracellular domain of TGFBR1, TGFBR2, or TGFBR3 with the Fc portion of an immunoglobulin.

In a second aspect of the invention, there is provided a method of increasing the level of TNF-a and/or IFN-r in lymphocytes, comprising the step of subjecting said pharmaceutical composition to lymphocytes.

In a third aspect of the invention, there is provided a method of increasing the proportion of TNF-a + and/or IFN-r + cells in a population of lymphocytes, comprising the step of applying a pharmaceutical composition according to any one of claims 1 to 7 to said population of lymphocytes.

Another method of the invention for increasing the proportion of TNF-a + and/or IFN-r + cells in a population of lymphocytes comprises the steps of:

1) introducing a reagent into the expression cells to obtain transfected cells; and

2) a step of co-culturing the transfected cells with the lymphocyte population or contacting at least a partial secretion of the transfected cells with the lymphocyte population;

wherein the agent comprises as a modulator a nucleic acid encoding at least one member selected from the group consisting of Bcl2, CD40L, IL-15 and IL-15Ra and a nucleic acid encoding a soluble protein that competes with TGF- β for binding to its receptor TGFBR1, FBR2 or TGFBR3, or

The agents comprise (a) at least one nucleic acid encoding at least one antigenic open reading frame and/or at least one polypeptide comprising at least one antigenic epitope as a vaccine and (b) as a modulator a nucleic acid encoding at least one selected from Bcl2, CD40L, IL-15 and IL-15Ra and a nucleic acid encoding a soluble protein that competes with TGF- β for binding to its receptor TGFBR1, TGFBR2 or TGFBR 3.

The immunopotentiating pharmaceutical composition of the present invention can greatly enhance the immunity of vaccines, can provide protective immunity against pathogen infection, and particularly can be used for enhancing the effect of preventing and/or treating various tumors.

Drawings

FIG. 1 is a graph showing the survival curves of DC cells transfected with nucleic acid molecules encoding proteins of the compositions of the present invention, which are significantly higher in survival rate than those of control groups.

FIG. 2 is a graph showing the phenotype of DC cells transfected with nucleic acid molecules encoding proteins of the compositions of the present invention, wherein the CD80, CD86, and CD83 on the surface of mature DC cells (mDC-survivin vs. mDC-survivin/regulator nucleic acid set) are significantly upregulated, as compared to Immature Dendritic Cells (iDC), indicating significant mature DC cell characteristics; the phenotype of the survivin/modulator nucleic acid transfected DC cells compared to survivin antigen transfected DC cells alone is consistent with survivin antigen transfected DC cells alone. In FIG. 2, the left side of each column is a mDC control and the right side is a mDC cell transfected with a composition of the invention.

FIG. 3 is a graph of the effect of a combination of immunomodulators on T cell response. DC cells transfected with survivin/modulator nucleic acid molecules are capable of eliciting a stronger T cell response than the survivin antigen group alone, with the T cells stimulated with DC cells having a higher proportion of TNF-a and IFN-r expression. In the bar chart of FIG. 3, the bars on the left side of each group are IFN-r and the bars on the right side of each group are TNF-a.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that the upper and lower limits of the range, and each intervening value therebetween, is specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control. Unless otherwise indicated, "%" is percent by weight.

In the present invention, the term "antigen" refers to a substance that can be recognized by the immune system and is capable of eliciting an antigen-specific immune response by forming antibodies or/and antigen-specific T cells. In general, an antigen can be a protein or polypeptide that comprises at least one antigenic epitope and can be presented by the Major Histocompatibility Complex (MHC) to the surface of a T cell. In the present invention, the antigen may be a product of translation of mRNA or a product of transcription and translation of DNA.

In the present invention, the term "nucleic acid" includes deoxyribonucleic acid (i.e., DNA) and ribonucleic acid (i.e., RNA). In the case of RNA, various optimizations of the nucleic acid molecule can be performed based on the known multiple natural degradation pathways of RNA in order to prevent instability of RNA and degradation of multiple pathways. For example, the terminal structure is crucial for the stability of mRNA. For example, at the 5 ' end of a naturally occurring mRNA, there is a modified guanosine nucleotide known as a 5 ' cap structure, and at the 3 ' end there is an adenosine nucleotide (i.e., poly-A tail) structure of about 200-300 bases in length, and at the 5 ' and 3 ' ends UTR sequences such as those of human beta-globin.

[ Immunopotentiating pharmaceutical composition ]

In a first aspect of the invention, there is provided an immunopotentiating pharmaceutical composition comprising at least:

(1) a vaccine comprising at least one nucleic acid comprising at least one open reading frame encoding at least one antigen and/or at least one polypeptide comprising at least one antigenic epitope; and

(2) a modulator comprising at least one selected from the group consisting of Bcl2, CD40L, IL-15, and IL-15Ra, or a nucleic acid encoding same, and a transforming growth factor signaling pathway inhibitor.

Vaccine

A vaccine of the invention is generally understood to be a substance that provides one or more antigens, preferably immunogens, for prophylaxis or therapy. For example, a vaccine may comprise an antigen, or a nucleic acid encoding the antigen. The nucleic acid may be DNA or RNA. The vaccine may also comprise cells expressing the antigen, such as DC cells or PBMC cells. The antigen or immunogen may be derived from any material suitable for vaccination.

The vaccine of the present invention may be any type of vaccine, examples of which include, but are not limited to, tumor vaccines, infectious disease vaccines. The present invention preferably uses a tumor vaccine as a vaccine.

In certain embodiments, the vaccines of the present invention comprise nucleic acids. The nucleic acid of the present invention may be one or more. Each nucleic acid can encode at least one antigenic open reading frame. The nucleic acid in this case may also be referred to as an antigenic nucleic acid or an antigenic nucleic acid molecule.

In one embodiment, the antigenic nucleic acid molecule encodes an immunogenic peptide fragment of a bacterial, viral, fungal, or other pathogen. Wherein the pathogens include, but are not limited to, human hepatitis viruses including HAV, HBV, HCV, cytomegalovirus CMV, human immunodeficiency virus HIV, EB virus, dengue virus, Human Papilloma Virus (HPV), respiratory syncytial virus, rhinovirus, human T-lymphotropic virus type I (HTLV-1), influenza, Bovine Leukemia Virus (BLV), pertussis, polio, measles, mumps, rubella, smallpox, shingles, anthrax, tetanus, rotavirus, rabies, fowl pox, meningococcus, anthrax, encephalitis, pneumococcus, streptococcus, staphylococcus, Neisseria, Escherichia coli, Shigella, leishmania, respiratory syncytial virus, parainfluenza, adenovirus, varicella, flavivirus, Mycobacterium tuberculosis, malaria, and the like.

In one embodiment, the antigenic nucleic acid molecule encodes a tumor antigen. In this case, the tumor antigen may be expressed on the surface, cytoplasm, or nucleus of the tumor cell. The tumor antigen may also be selected from proteins that are overexpressed in tumor cells compared to normal cells. Tumor antigens can be further divided into tumor-associated antigens (TAAs) and tumor-specific antigens (TSAs). TAA is a class of antigenic molecules that are present in both tumor and normal cells, examples of which include: embryonic proteins, glycoprotein antigens, squamous cell antigens, and the like. TAA is not specific to tumor cells, but can be synthesized in trace amounts by normal cells, and is highly expressed when tumor cells proliferate. TSA refers to a novel antigen that is expressed only on the surface of tumor cells and not on normal cells. Such antigens may be present in tumors of the same tissue type in different individuals, e.g., melanoma specific antigens encoded by human malignant melanoma genes, may be present in melanoma cells in different individuals, but not expressed by normal melanocytes. TSA can also be common to tumors of different histological types, for example, mutated Ras gene products can be commonly found in lung cancer, digestive tract tumors, etc., but because its amino acid sequence is inconsistent with the expression product of normal proto-oncogene Ras, it can be recognized by the immune system of the body to stimulate the immune response of the body. In general, such antigens resulting from mutations are referred to as neoantigens (neoantigens). These antigens are all recognized by cytotoxic T lymphocytes and cells presenting the antigen can be killed by T lymphocytes.

In certain embodiments, the vaccine of the invention comprises at least one polypeptide. The polypeptides herein comprise at least one antigenic epitope. Thus, a polypeptide herein is understood to be an antigen.

The antigen of the present invention is preferably a tumor antigen, which may be selected from at least one of the group consisting of: TDO, MAGEC, HMOX, WT, LY6, AIM, IDO, CHI3L, IL13RA, LCK, GFAP, KIF20, CNTN, MUC, PEG, TNC, SOX, IGF2BP, S100A, AKAP, TTK, CHI3L, PTHHLH, CDC, PMEL, TOP2, PTTG, NRCAM, HMMR, MUC, LY6, SOX, FOSL, PRAME, FOLR, BIRC, KIF2, ITGAV, ART, PROM, CT, S100A, PPIB, S100A, STAT, EPBP, MLANA, KAAG, KLK, NT5, PTPRZ, SPAG, MET, RGS, CSPG, D1LG, MUC, CD274, PSCA, FABP, PLIN, KR, GCCR, TPCC, ACAGS, SARG, NLGN4X, SART3, PRKDC, FOXP3, HBEGF, PIK3R1, SLC1A3, PCNA, KIF1C, BSG, ATP2A3, SPAG9, RPSA, NFYC, LRRC8A, IQGAP1, LY6E, TRIOBP, ART1, BAGE, BIRC7, CA9, CCDC54, DCT, IDO2, MAGED4, SOX2, SYCP1, TYR, T4, BAGE2, BORIS, CALR3, CSAG 3, CTAG 13, CTAGE 3, FMR 3, GAGE3, GAIRGESSGEN 3, XA3, GASSGES 3, GCAST 3, GCE 3, GCAST 3, GCE 3, GCAST 3, GCE 3636363636363672, GCE 3636363672, GCE 363636363672, GCE 3636363636363636363672, GCE 363636363672, GCE 3, GCE 36363636363636363672, GCE 363636363672, GCE 3636363636363636363672, GCE 3, GCE 363672, GCE 36363672, GCE 3636363672, GCE 3, GCE 36363672, GCE 36363636363636363636363672, GCE 3, GCE 363636363636363636363636363672, GCE 3, GCE 36363636363636363636363672, GCE 3, GCE 3636363636363636363672, GCE 3636363636363636363636363636.

Furthermore, tumor antigens may also include individual tumor-specific neoantigens which are produced by genetic mutations in tumor cells. The mutated gene may be any gene in a cell, and the expression product thereof may be expressed on the cell surface or inside the cell.

Conditioning agents

The modulators of the present invention comprise (a) at least one member selected from the group consisting of Bcl2, CD40L, IL-15 and IL-15Ra or a nucleic acid encoding the same, and (b) a transforming growth factor signaling pathway inhibitor.

In certain embodiments, component (a) of the present invention is a protein comprising at least one of BCL2 protein, CD40L protein, IL-15Ra protein. Preferably, the BCL2 protein has the amino acid sequence of SEQ ID NO: 1. Preferably, the CD40L protein has the amino acid sequence of SEQ ID NO: 2. Preferably, the IL-15 protein has the amino acid sequence of SEQ ID NO: 3. The IL-15Ra protein has the amino acid sequence shown in SEQ ID NO: 4. The component (a) of the present invention may be one of the above proteins, or may be a combination of two or more thereof. In the case of a combination of two or more, two or more components may be present as a mixture, two or more components may be present individually, or two or more components may be present in a form in which two or more components are bonded to each other by a chemical bond. In certain embodiments, component (a) is a fusion protein of two proteins of BcL2, CD40L, IL-15, and IL-15 Ra. For example, a fusion protein of IL-15 and IL-15 Ra.

In certain embodiments, component (a) of the present invention is a nucleic acid comprising at least one of a nucleic acid encoding Bcl2, a nucleic acid encoding CD40L, a nucleic acid encoding IL-15, and a nucleic acid encoding IL-15 Ra. Preferably, the nucleic acid encoding CD40L has the amino acid sequence of SEQ ID NO: 5. Preferably, the nucleic acid encoding BCL2 protein has the amino acid sequence of SEQ ID NO: 6. Preferably, the nucleic acid encoding IL-15 has the sequence shown in SEQ ID NO 12. Preferably, the nucleic acid encoding IL-15Ra has the sequence shown in SEQ ID NO 13. The nucleic acid (a) of the present invention may be one of the above-mentioned nucleic acids, or may be a combination of two or more of them. Also preferably, the nucleic acid of the present invention is a nucleic acid encoding two or more proteins simultaneously. As used herein, "simultaneously encode" means that the same nucleic acid molecule can encode more than two proteins. In this case two or more proteins may be present in a fused form, but more preferably the same nucleic acid molecule encodes for the production of two or more proteins which are present separately. In the case where two or more proteins are produced simultaneously from the same nucleic acid molecule, the production can be achieved by linking two adjacent genes to each other, for example, by a ribosome entry site (IRES). The sequence of the ribosome entry site can be as shown in SEQ ID NO: shown at 7. Alternatively, this can also be achieved by linking nucleic acid sequences encoding self-cleaving polypeptide sequences between two adjacent genes. As an illustrative example, the nucleic acid of the invention may be a nucleic acid encoding both IL-15 and IL-15 Ra. Examples of such nucleic acids include, but are not limited to, SEQ ID NOs: 8, which can encode for the production of separate IL-15 protein and IL-15Ra protein simultaneously.

In certain embodiments, component (a) of the present invention may also be a combination of the above proteins or nucleic acids. The combination ratio of the protein and the nucleic acid is not particularly limited and can be easily determined by those skilled in the art as needed.

In certain embodiments, the transforming growth factor signaling pathway inhibitor of (b) the invention is selected from an inhibitor against at least one of TGF- β, TGFBR1, TGFBR2, and TGFBR 3. preferably, an inhibitor against TGFBR 3. more preferably, a soluble protein or nucleic acid encoding the soluble protein that competes with TGF- β for binding to its receptor TGFBR1, FBR2, or TGFBR3, or a small molecule inhibitor. further preferably, the transforming growth factor signaling pathway inhibitor is selected from a fragment of TGFBR1, TGFBR2, or TGFBR3 or a nucleic acid encoding the same.

The amount ratio of the component (a) to the component (b) in the regulator of the present invention is not particularly limited. In general, the molar ratio of (a) to (b) is 0.1 to 10:1, preferably 0.2 to 5:1, and more preferably 0.2 to 1: 1.

Combinations of vaccines and modulators

The pharmaceutical composition of the invention comprises at least a combination of both a vaccine and a modulator. The form of the combination of both is not particularly limited. The combination of both the protein as a vaccine and the protein as a regulator may be used, the combination of both the protein as a vaccine and the nucleic acid as a regulator may be used, the combination of both the nucleic acid as a vaccine and the protein as a regulator may be used, or the combination of both the nucleic acid as a vaccine and the nucleic acid as a regulator may be used.

In the present invention, the vaccine and the modulator may be present in a single form or in a mixture. The combination ratio of the vaccine and the modifier is not particularly limited, and may be, for example, 1:1 to 0.3: 1. . Those skilled in the art can readily determine the dosage form of the pharmaceutical composition, the type of vaccine and modulator, and the like.

The pharmaceutical compositions of the present invention may be administered by methods known in the art. Preferably, delivery to the host cell is by in vivo delivery. In one embodiment, the nucleic acid molecule is introduced into a subject in need thereof by a viral vector such as adenovirus (AdV), adeno-associated virus (AAV), retrovirus, lentivirus, herpes simplex virus, and the like, into a pharmaceutical composition of the invention. In addition, the pharmaceutical compositions of the present invention may also be introduced into a subject by transfection of liposomal nanoparticles into a host cell. In one embodiment, the pharmaceutical composition of the present invention can be introduced into the subject's own DC cells by electroporation, and the DC cells are used as vectors to be introduced into the subject. In one embodiment, the pharmaceutical composition of the present invention can be introduced into autologous PBMC cells or allogeneic PBMC cells of a subject by electroporation, and the autologous PBMC cells or allogeneic PBMC cells are used as vectors for introduction into the subject.

[ method for increasing TNF-a and/or IFN-r content in lymphocytes ]

In a second aspect of the invention, there is provided a method of increasing the TNF-a and/or IFN-r content of lymphocytes, comprising the step of allowing a pharmaceutical composition of the invention to act on the lymphocytes.

The lymphocytes of the invention are the target cells for the action of the pharmaceutical composition, which includes cells cultured in vitro or cells in vivo in a subject. The action of the pharmaceutical composition with lymphocytes can be performed in a variety of ways. Where the pharmaceutical composition comprises a protein, the lymphocyte can be acted upon by directly contacting the pharmaceutical composition with the lymphocyte. In the case where the pharmaceutical composition comprises a nucleic acid, the nucleic acid in the pharmaceutical composition may be expressed as the corresponding protein, and the resulting protein may then be contacted with lymphocytes. For example, the nucleic acid in the pharmaceutical composition is first expressed in the expression cell, and then the expression cell is contacted with a lymphocyte as a target cell. The expression cells herein include PBMC cells and/or DC cells.

[ method of increasing the proportion of TNF-a + and/or IFN-r + cells in a lymphocyte population ]

In a third aspect of the invention, there is provided a method of increasing the proportion of TNF-a + and/or IFN-r + cells in a population of lymphocytes, comprising the step of applying a pharmaceutical composition to the population of lymphocytes. The pharmaceutical composition and the lymphocyte population may act in the same manner as described above to increase the TNF-a and/or IFN-r content of the lymphocytes. And will not be described in detail herein.

In certain embodiments, the method of increasing the proportion of TNF-a + and/or IFN-r + cells in a population of lymphocytes comprises the steps of:

1) introducing an agent into an expression cell such as a DC cell or a PBMC cell to obtain a transfected cell; and

2) a step of co-culturing the transfected cells with the lymphocyte population or contacting at least a partial secretion of the transfected cells with the lymphocyte population;

wherein the agent comprises as a modulator a nucleic acid encoding at least one member selected from the group consisting of Bcl2, CD40L, IL-15 and IL-15Ra and a nucleic acid encoding a soluble protein that competes with TGF- β for binding to its receptor TGFBR1, FBR2 or TGFBR3, or

The agents comprise (a) at least one nucleic acid encoding at least one antigenic open reading frame and/or at least one polypeptide comprising at least one antigenic epitope as a vaccine and (b) nucleic acids encoding at least one selected from Bcl2, CD40L, IL-15 and IL-15Ra and nucleic acids encoding soluble proteins that compete with TGF- β for binding to its receptor TGFBR1, FBR2 or TGFBR3 as modulators.

Example 1

This example is the preparation of DNA and mRNA encoding antigens and immunodetection Point inhibitors

1. Preparation of DNA and mRNA constructs

The constructs were prepared by introducing high GC sequences by codon optimization to stabilize the synthesized mRNA, followed by the 3' UTR sequence of human-derived β -globin, followed by a segment of polyadenylation, these nucleic acid sequences and their encoded amino acid sequences are shown in Table 1 below.

TABLE-1

Name (R)	Protein sequence number	Nucleic acid sequence number
			BCL2	SEQ ID NO：1	SEQ ID NO：6
CD40L	SEQ ID NO：2	SEQ ID NO：5
			IL-15	SEQ ID NO：3	-
IL-15Ra	SEQ ID NO：4	-
			IL-15-IRES-IL-15Ra	-	SEQ ID NO：8
TGF-beta-Fc	SEQ ID NO:11	SEQ ID NO:10

2. In vitro transcription

The corresponding DNA plasmid prepared in step 1 is firstly linearized by using a speI endonuclease, and mRNA is prepared by in vitro transcription by using T7RNA polymerase by using the linearized plasmid as a template. The prepared mRNA was then purified by lithium chloride precipitation.

Example 2

This example is used to verify the effect of mRNA combination as a pharmaceutical composition on dendritic cell phenotype and survival.

In vitro induction culture of DC cells

Aseptically extracting healthy human venous blood 50ml, and carrying out shower in a super-clean workbenchSeparating peripheral blood mononuclear cells from the basocytes, adding the mononuclear cells to AIM-V medium, and adding 5% CO at 37 deg.C₂Incubation in an incubator allows monocytes to adhere. After 2h, nonadherent cells were removed, adherent cells were added to iDC medium (GM-CSF at a final concentration of 800U/mL and IL-4 at a final concentration of 500U/mL in AIM-V medium), and the mixture was placed at 37 ℃ with 5% CO₂Transferring half of the cell culture medium into a centrifuge tube, centrifuging at 500g to collect cells, removing supernatant, and adding an equal volume of fresh mDC culture medium, wherein the fresh mDC culture medium is prepared from 1600U/mLGM-CSF and 1000U/mLIL-4, TNF-a (5ng/ml), IL-1 β (5ng/ml), IL-6(150ng/ml) and prostaglandinE2(PGE2) (1ug/ml), after resuspending the cells, adding the cells into a culture flask, culturing for 8-18 hours, and inducing the maturation of the DC cells.

2. Transfection of DC cells with pharmaceutical compositions

On the day of transfection, DC cells were digested into cell suspensions using non-enzymatic cell digestion reagents, centrifuged, washed twice with PBS, resuspended in PBS, and adjusted to a cell density of 25-30X 10⁶DCs/ml. According to each 10⁶Transfection of DC cells into 4ug mRNA ratio, mixing DC cells with the nucleic acid molecules of the invention (BCL2, CD40L and IL-15-IRES-IL-15Ra) mRNA, adding the cell-mRNA mixture to an electric rotor, and transfecting the antigen mRNA into the DC cells using an ECM630 electric rotor. The cells after the electroporation were resuspended in cytokine-free AIM-V medium and the cell density was adjusted to 1X 10⁶DCs/ml, 200ul per well, into 96 well cell culture plates, placed at 37 ℃ in 5% CO₂And continuing culturing in the cell culture box. GFP mRNA was transfected into DC cells under the same conditions as the control group. The number of DC cells in the plates was recorded daily for 5 consecutive days.

3. Determination of transfection efficiency

24 hours after transfection, the proportion of DC cells expressing green fluorescent protein to all DC cells was analyzed by flow cytometry.

Identification of DC cell phenotype

Using direct immunofluorescence labeling, transfected DC cells were centrifuged and the cells were resuspended in FACS buffer (2% FBS in PBS) at cell concentrationIs 1 × 10⁶cells/ml, 100ul of transfected DC cell suspension was added to the flow cell tube, and 5ul of the corresponding antibodies CD80, CD83, CD86, and the corresponding isotype control were added, respectively. Staining at 4 ℃ for 30min in the dark. 3ml of FACS Buffer was added to each tube to wash the cells, the supernatant was discarded, 500ul of FACS Buffer was added, and expression of CD80, CD83, and CD86 was detected by flow analysis.

As shown in FIG. 1, DC cells transfected with the immunomodulator composition exhibited better cell viability than the untransfected DC cell control.

As shown in fig. 2, there was no significant difference in the stable expression of the cell surface molecules CD80, CD83, CD86 in DC cells transfected with the immunomodulator composition compared to the untransfected DC cell control.

Example 3

This example is to demonstrate the effect of the compositions of the invention on T cell responses

1. In vitro induction culture of DC cells

Aseptically extracting healthy human venous blood 50ml, separating peripheral blood mononuclear cells with lymphocyte separation medium in ultraclean bench, adding mononuclear cells into AIM-V culture medium, placing at 37 deg.C and 5% CO₂Incubation in an incubator allows monocytes to adhere. After 2h, nonadherent cells were removed, adherent cells were added to iDC medium (GM-CSF at a final concentration of 800U/mL and IL-4 at a final concentration of 500U/mL in AIM-V medium), and the mixture was placed at 37 ℃ with 5% CO₂Transferring half of the cell culture medium into a centrifuge tube, centrifuging by 500g to collect cells, removing supernatant, and adding an equal volume of fresh mDC culture medium, wherein the fresh mDC culture medium is prepared from 1600U/mL GM-CSF and 1000U/mLIL-4, TNF-a (5ng/mL), IL-1 β (5ng/mL), IL-6(150ng/mL) and prostaglandinE2(PGE2) (1ug/mL), after resuspension of the cells, adding the cells into a culture flask, culturing for 8-18 hours, and inducing the maturation of the DC cells.

2. Transfection of DC cells with pharmaceutical compositions

On the day of transfection, DC cells were digested into cell suspensions using non-enzymatic cell digestion reagents, centrifuged, washed twice with PBS, resuspended in PBS, and adjusted to a cell density of 25-30X 10⁶DCs/ml. According to each 10⁶Transfection of DC cells with 4ug mRNA, mixing DC cells with antigen mRNA and the composition of the invention (Bcl2, CD40L and IL-15-IRES-IL-15Ra) mRNA combination, adding the cell-mRNA mixture to an electric rotor, and transfecting antigen mRNA into DC cells using an ECM630 electric rotor. The cells after the electroporation were resuspended in a cytokine-free 1640 medium, and the cell density was adjusted to 2X 10⁵DCs/ml, placed at 37 ℃ in 5% CO₂The cultivation was continued in the cell incubator for 6 hours.

3. Recovering the MNC cells at 2X 10⁶The cells were seeded in 96-well plates at a concentration of/ml for T lymphocyte activation. The test grouping case is: a MNC blank control group, a MNC + antigen mRNA-DC vaccine group, a MNC + antigen + regulator mRNA (including Bcl2, CD40L, IL-15/IL-15Ra and a TGF-beta inhibitor TGFBR3) -DC vaccine group, and a MNC + PMA/Ionomycin positive control group. According to grouping conditions, adding DC cells loaded with corresponding mRNA into different holes, wherein the ratio of MNC to DC is 10: 1; the concentration of Anti-CD3/Anti-CD28 in the positive control is 1 mu g/ml or the concentration of PMA/Ionomycin is 50ng/ml and 1 ug/ml; culturing at 37 ℃ for 10-12 days.

4. Adding 2 mu M monensin or 3 mu g/ml Brefeldin A into the cell culture solution 5-8h before collecting cells, and fully and uniformly mixing; (Monensin and Brefeldin A should not exceed 12h in cytosol as blockers of protein transport).

5. The cells were transferred to a flow tube, stained with fluorescently labeled antibodies to CD3, CD4, and CD8, fixed and permeabilized, and stained intracellularly with fluorescently labeled antibodies to TNF-a and IFN-r.

6. The ratio of TNF-a + and IFN-r + cells in lymphocytes was measured by flow cytometry.

As shown in FIG. 3, the use of either antigen mRNA alone or antigen/immunomodulator composition mRNA can elicit an anti-tumor specific immune response in T lymphocytes. In the control group transfected with mRNA for survivin antigen alone, the proportion of IFN-r positive T lymphocytes was 0.35%, whereas in the group transfected with mRNA for the antigen/immunomodulator composition, the proportion of IFN-r positive T lymphocytes was 1.96% which was 5.60 times that of the control group; in the control group transfected with mRNA for survivin antigen alone, the proportion of T lymphocytes positive for TNF-a was 1.86%, whereas in the group transfected with mRNA for the antigen/immunomodulator composition, the proportion of T lymphocytes positive for TNF-a was 3.26%, which was 1.75 times that of the control group. The experimental result shows that the composition can obviously enhance the antigen presentation of DC cells and the capability of activating the T lymphocytes, better stimulate the T lymphocytes and generate stronger anti-tumor specific immune response.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The specification and examples are exemplary only.

Sequence listing

<110> Qichensheng Biotechnology (Zhuhai) Co., Ltd

<120> immunopotentiating pharmaceutical composition and use thereof

<130>BH1900066-1

<141>2019-08-19

<160>13

<170>SIPOSequenceListing 1.0

<210>1

<211>239

<212>PRT

<213>Homo sapiens

<400>1

Met Ala His Ala Gly Arg Thr Gly Tyr Asp Asn Arg Glu Ile Val Met

1 5 10 15

Lys Tyr Ile His Tyr Lys Leu Ser Gln Arg Gly Tyr Glu Trp Asp Ala

20 25 30

Gly Asp Val Gly Ala Ala Pro Pro Gly Ala Ala Pro Ala Pro Gly Ile

35 40 45

Phe Ser Ser Gln Pro Gly His Thr Pro His Pro Ala Ala Ser Arg Asp

50 55 60

Pro Val Ala Arg Thr Ser Pro Leu Gln Thr Pro Ala Ala Pro Gly Ala

65 70 75 80

Ala Ala Gly Pro Ala Leu Ser Pro Val Pro Pro Val Val His Leu Thr

85 90 95

Leu Arg Gln Ala Gly Asp Asp Phe Ser Arg Arg Tyr Arg Arg Asp Phe

100 105 110

Ala Glu Met Ser Ser Gln Leu His Leu Thr Pro Phe Thr Ala Arg Gly

115 120 125

Arg Phe Ala Thr Val Val Glu Glu Leu Phe Arg Asp Gly Val Asn Trp

130 135 140

Gly Arg Ile Val Ala Phe Phe Glu Phe Gly Gly Val Met Cys Val Glu

145 150 155 160

Ser Val Asn Arg Glu Met Ser Pro Leu Val Asp Asn Ile Ala Leu Trp

165 170 175

Met Thr Glu Tyr Leu Asn Arg His Leu His Thr Trp Ile Gln Asp Asn

180 185 190

Gly Gly Trp Asp Ala Phe Val Glu Leu Tyr Gly Pro Ser Met Arg Pro

195 200 205

Leu Phe Asp Phe Ser Trp Leu Ser Leu Lys Thr Leu Leu Ser Leu Ala

210 215 220

Leu Val Gly Ala Cys Ile Thr Leu Gly Ala Tyr Leu Gly His Lys

225 230 235

<210>2

<211>261

<212>PRT

<213>Homo sapiens

<400>2

Met Ile Glu Thr Tyr Asn Gln Thr Ser Pro Arg Ser Ala Ala Thr Gly

1 5 10 15

Leu Pro Ile Ser Met Lys Ile Phe Met Tyr Leu Leu Thr Val Phe Leu

20 25 30

Ile Thr Gln Met Ile Gly Ser Ala Leu Phe Ala Val Tyr Leu His Arg

35 40 45

Arg Leu Asp Lys Ile Glu Asp Glu Arg Asn Leu His Glu Asp Phe Val

50 55 60

Phe Met Lys Thr Ile Gln Arg Cys Asn Thr Gly Glu Arg Ser Leu Ser

65 70 75 80

Leu Leu Asn Cys Glu Glu Ile Lys Ser Gln Phe Glu Gly Phe Val Lys

85 90 95

Asp Ile Met Leu Asn Lys Glu Glu Thr Lys Lys Glu Asn Ser Phe Glu

100 105 110

Met Gln Lys Gly Asp Gln Asn Pro Gln Ile Ala Ala His Val Ile Ser

115 120 125

Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu Lys Gly

130 135 140

Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln

145 150 155 160

Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr

165 170 175

Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser

180 185 190

Leu Cys Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala

195 200 205

Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser Ile His

210 215 220

Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe Val Asn

225 230 235 240

Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr Ser Phe

245 250 255

Gly Leu Leu Lys Leu

260

<210>3

<211>162

<212>PRT

<213>Homo sapiens

<400>3

Met Arg Ile Ser Lys Pro His Leu Arg Ser Ile Ser Ile Gln Cys Tyr

1 5 10 15

Leu Cys Leu Leu Leu Asn Ser His Phe Leu Thr Glu Ala Gly Ile His

20 25 30

Val Phe Ile Leu Gly Cys Phe Ser Ala Gly Leu Pro Lys Thr Glu Ala

35 40 45

Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile

50 55 60

Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His

65 70 75 80

Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln

85 90 95

Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu

100 105 110

Asn Leu Ile Ile Leu Ala Asn Asn Ser Leu Ser Ser Asn Gly Asn Val

115 120 125

Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile

130 135 140

Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn

145 150 155 160

Thr Ser

<210>4

<211>267

<212>PRT

<213>Homo sapiens

<400>4

Met Ala Pro Arg Arg Ala Arg Gly Cys Arg Thr Leu Gly Leu Pro Ala

1 5 10 15

Leu Leu Leu Leu Leu Leu Leu Arg Pro Pro Ala Thr Arg Gly Ile Thr

20 25 30

Cys Pro Pro Pro Met Ser Val Glu His Ala Asp Ile Trp Val Lys Ser

35 40 45

Tyr Ser Leu Tyr Ser Arg Glu Arg Tyr Ile Cys Asn Ser Gly Phe Lys

50 55 60

Arg Lys Ala Gly Thr Ser Ser Leu Thr Glu Cys Val Leu Asn Lys Ala

65 70 75 80

Thr Asn Val Ala His Trp Thr Thr Pro Ser Leu Lys Cys Ile Arg Asp

85 90 95

Pro Ala Leu Val His Gln Arg Pro Ala Pro Pro Ser Thr Val Thr Thr

100 105 110

Ala Gly Val Thr Pro Gln Pro Glu Ser Leu Ser Pro Ser Gly Lys Glu

115 120 125

Pro Ala Ala Ser Ser Pro Ser Ser Asn Asn Thr Ala Ala Thr Thr Ala

130 135 140

Ala Ile Val Pro Gly Ser Gln Leu Met Pro Ser Lys Ser Pro Ser Thr

145 150 155 160

Gly Thr Thr Glu Ile Ser Ser His Glu Ser Ser His Gly Thr Pro Ser

165 170 175

Gln Thr Thr Ala Lys Asn Trp Glu Leu Thr Ala Ser Ala Ser His Gln

180 185 190

Pro Pro Gly Val Tyr Pro Gln Gly His Ser Asp Thr Thr Val Ala Ile

195 200 205

Ser Thr Ser Thr Val Leu Leu Cys Gly Leu Ser Ala Val Ser Leu Leu

210 215 220

Ala Cys Tyr Leu Lys Ser Arg Gln Thr Pro Pro Leu Ala Ser Val Glu

225 230 235 240

Met Glu Ala Met Glu Ala Leu Pro Val Thr Trp Gly Thr Ser Ser Arg

245 250 255

Asp Glu Asp Leu Glu Asn Cys Ser His His Leu

260 265

<210>5

<211>946

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gagacaagcu ugcaugccug caggucgacu cuagaggauc caccggucgc caccaugauc 60

gaaacauaca accaaacuuc uccccgaucu gcggccacug gacugcccau cagcaugaaa 120

auuuuuaugu auuuacuuac uguuuuucuu aucacccaga ugauuggguc agcacuuuuu 180

gcuguguauc uucauagaag guuggacaag auagaagaug aaaggaaucu ucaugaagau 240

uuuguauuca ugaaaacgau acagagaugc aacacaggag aaagauccuu auccuuacug 300

aacugugagg agauuaaaag ccaguuugaa ggcuuuguga aggauauaau guuaaacaaa 360

gaggagacga agaaagaaaa cagcuuugaa augcaaaaag gugaucagaa uccucaaauu 420

gcggcacaug ucauaaguga ggccagcagu aaaacaacau cuguguuaca gugggcugaa 480

aaaggauacu acaccaugag caacaacuug guaacccugg aaaaugggaa acagcugacc 540

guuaaaagac aaggacucua uuauaucuau gcccaaguca ccuucuguuc caaucgggaa 600

gcuucgaguc aagcuccauu uauagccagc cucugccuaa agucccccgg uagauucgag 660

agaaucuuac ucagagcugc aaauacccac aguuccgcca aaccuugcgg gcaacaaucc 720

auucacuugg gaggaguauu ugaauugcaa ccaggugcuu cgguguuugu caaugugacu 780

gauccaagcc aagugagcca uggcacuggc uucacguccu uuggcuuacu caaacucuga 840

agcggccgcg gauccccggg uaccgagcuc gaauucuuaa uuaaaaaaaa aaaaaaaaaa 900

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 946

<210>6

<211>842

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

gagaccggcc ucgagcagcu gaagcuuccu gcaggucgac ucuagagcca ccauggcgca 60

cgcugggaga acaggguacg auaaccggga gauagugaug aaguacaucc auuauaagcu 120

gucgcagagg ggcuacgagu gggaugcggg agaugugggc gccgcgcccc cgggggccgc 180

ccccgcaccg ggcaucuucu ccucccagcc cgggcacacg ccccauccag ccgcaucccg 240

ggacccgguc gccaggaccu cgccgcugca gaccccggcu gcccccggcg ccgccgcggg 300

gccugcgcuc agcccggugc caccuguggu ccaccugacc cuccgccagg ccggcgacga 360

cuucucccgc cgcuaccgcc gcgacuucgc cgagaugucc agccagcugc accugacgcc 420

cuucaccgcg cggggacgcu uugccacggu gguggaggag cucuucaggg acggggugaa 480

cugggggagg auuguggccu ucuuugaguu cggugggguc augugugugg agagcgucaa 540

ccgggagaug ucgccccugg uggacaacau cgcccugugg augacugagu accugaaccg 600

gcaccugcac accuggaucc aggauaacgg aggcugggau gccuuugugg aacuguacgg 660

ccccagcaug cggccucugu uugauuucuc cuggcugucu cugaagacuc ugcucaguuu 720

ggcccuggug ggagcuugca ucacccuggg ugccuaucug ggccacaagu gauuaauuaa 780

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 840

aa 842

<210>7

<211>552

<212>RNA

<213>Encephalomyocarditis virus

<400>7

acguuacugg ccgaagccgc uuggaauaag gccggugugc guuugucuau auguuauuuu 60

ccaccauauu gccgucuuuu ggcaauguga gggcccggaa accuggcccu gucuucuuga 120

cgagcauucc uaggggucuu uccccucucg ccaaaggaau gcaaggucug uugaaugucg 180

ugaaggaagc aguuccucug gaagcuucuu gaagacaaac aacgucugua gcgacccuuu 240

gcaggcagcg gaacccccca ccuggcgaca ggugccucug cggccaaaag ccacguguau 300

aagauacacc ugcaaaggcg gcacaacccc agugccacgu ugugaguugg auaguugugg 360

aaagagucaa auggcucucc ucaagcguau ucaacaaggg gcugaaggau gcccagaagg 420

uaccccauug uaugggaucu gaucuggggc cucggugcac augcuuuaca uguguuuagu 480

cgagguuaaa aaacgucuag gccccccgaa ccacggggac gugguuuucc uuugaaaaac 540

acgaugauaa ua 552

<210>8

<211>2316

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

agaccggccu cgagcagcug aagcuugcau gccugcaggu cgacucuaga ggauccgcca 60

ccaugagaau uucgaaacca cauuugagaa guauuuccau ccagugcuac uuguguuuac 120

uucuaaacag ucauuuucua acugaagcug gcauucaugu cuucauuuug ggcuguuuca 180

gugcagggcu uccuaaaaca gaagccaacu gggugaaugu aauaagugau uugaaaaaaa 240

uugaagaucu uauucaaucu augcauauug augcuacuuu auauacggaa agugauguuc 300

accccaguug caaaguaaca gcaaugaagu gcuuucucuu ggaguuacaa guuauuucac 360

uugaguccgg agaugcaagu auucaugaua caguagaaaa ucugaucauc cuagcaaaca 420

acaguuuguc uucuaauggg aauguaacag aaucuggaug caaagaaugu gaggaacugg 480

aggaaaaaaa uauuaaagaa uuuuugcaga guuuuguaca uauuguccaa auguucauca 540

acacuucuug agcggccgcc gcccgcccca cgacccgcag cgcccgaccg aaaggagcgc 600

acgaccccau cauccaauuc cgcccccccc cccuaacguu acuggccgaa gccgcuugga 660

auaaggccgg ugugcguuug ucuauauguu auuuuccacc auauugccgu cuuuuggcaa 720

ugugagggcc cggaaaccug gcccugucuucuugacgagc auuccuaggg gucuuucccc 780

ucucgccaaa ggaaugcaag gucuguugaa ugucgugaag gaagcaguuc cucuggaagc 840

uucuugaaga caaacaacgu cuguagcgac ccuuugcagg cagcggaacc ccccaccugg 900

cgacaggugc cucugcggcc aaaagccacg uguauaagau acaccugcaa aggcggcaca 960

accccagugc cacguuguga guuggauagu uguggaaaga gucaaauggc ucuccucaag 1020

cguauucaac aaggggcuga aggaugccca gaagguaccc cauuguaugg gaucugaucu 1080

ggggccucgg ugcacaugcu uuacaugugu uuagucgagg uuaaaaaacg ucuaggcccc 1140

ccgaaccacg gggacguggu uuuccuuuga aaaacacgau gauaauaugg ccacaacguc 1200

gacgccacca uggcuccuag gagagccaga ggguguagga cacugggacu gccagcucug 1260

cugcugcugc ugcugcugag accuccagcu acaaggggaa ucaccugccc uccuccuaug 1320

agcguggagc acgccgacau uugggugaag agcuacagcc uguacagccg ggagcgcuac 1380

auuugcaaca gcggcuucaa gaggaaggcc ggaacaagcu cucucaccga gugcgugcug 1440

aacaaggcca ccaacguggc ccauuggaca accccuagcc ugaagugcau cagggaccca 1500

gcacuggugc accagagacc agcuccuccu agcacaguga ccacagccgg agugacaccu 1560

cagccagaaa gccugagccc uagcggaaaa gaaccagccg ccucuagccc cagcagcaau 1620

aauaccgccg ccacaacagc cgcuauugug ccaggaagcc agcugaugcc uagcaagagc 1680

ccuagcaccg gcacaacaga gaucagcagc cacgagagca gccacggaac accuagccag 1740

accacagcca agaauuggga gcugaccgcc agcgccagcc accagccucc aggaguguac 1800

ccucagggac acagcgauac caccguggcc aucucuacca gcacagugcu gcugugcgga 1860

cugucagcug ugucccugcu ggcuugcuac cugaagagca gacagacccc uccucuggcc 1920

agcguggaaa uggaggcuau ggaggcccug ccagugacuu ggggaaccuc uagcagagac 1980

gaggaccugg agaauugcag ccaccaccug uaggaauucg cuggagccuc gguagccguu 2040

ccuccugccc gcugggccuc ccaacgggcc cuccuccccu ccuugcaccg gcccuuccug 2100

gucuuuggcu ggagccucgg uagccguucc uccugcccgc ugggccuccc aacgggcccu 2160

ccuccccucc uugcaccggc ccuuccuggu cuuugaaaaa aaaaaaaaaa aaaaaaaaaa 2220

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2280

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaa 2316

<210>9

<211>646

<212>PRT

<213>Homo sapiens

<400>9

Met Thr Ser His Tyr Val Ile Ala Ile Phe Ala Leu Met Ser Ser Cys

1 5 10 15

Leu Ala Thr Ala Gly Pro Glu Pro Gly Ala Leu Cys Glu Leu Ser Pro

20 25 30

Val Ser Ala Ser His Pro Val Gln Ala Leu Met Glu Ser Phe Thr Val

35 40 45

Leu Ser Gly Cys Ala Ser Arg Gly Thr Thr Gly Leu Pro Gln Glu Val

50 55 60

His ValLeu Asn Leu Arg Thr Ala Gly Gln Gly Pro Gly Gln Leu Gln

65 70 75 80

Arg Glu Val Thr Leu His Leu Asn Pro Ile Ser Ser Val His Ile His

85 90 95

His Lys Ser Val Val Phe Leu Leu Asn Ser Pro His Pro Leu Val Trp

100 105 110

His Leu Lys Thr Glu Arg Leu Ala Thr Gly Val Ser Arg Leu Phe Leu

115 120 125

Val Ser Glu Gly Ser Val Val Gln Phe Ser Ser Ala Asn Phe Ser Leu

130 135 140

Thr Ala Glu Thr Glu Glu Arg Asn Phe Pro His Gly Asn Glu His Leu

145 150 155 160

Leu Asn Trp Ala Arg Lys Glu Tyr Gly Ala Val Thr Ser Phe Thr Glu

165 170 175

Leu Lys Ile Ala Arg Asn Ile Tyr Ile Lys Val Gly Glu Asp Gln Val

180 185 190

Phe Pro Pro Lys Cys Asn Ile Gly Lys Asn Phe Leu Ser Leu Asn Tyr

195 200 205

Leu Ala Glu Tyr Leu Gln Pro Lys Ala Ala Glu Gly Cys Val Met Ser

210 215 220

Ser Gln Pro Gln Asn Glu Glu Val His Ile Ile Glu Leu Ile Thr Pro

225 230 235 240

Asn Ser Asn Pro Tyr Ser Ala Phe Gln Val Asp Ile Thr Ile Asp Ile

245 250 255

Arg Pro Ser Gln Glu Asp Leu Glu Val Val Lys Asn Leu Ile Leu Ile

260 265 270

Leu Lys Cys Lys Lys Ser Val Asn Trp Val Ile Lys Ser Phe Asp Val

275 280 285

Lys Gly Ser Leu Lys Ile Ile Ala Pro Asn Ser Ile Gly Phe Gly Lys

290 295 300

Glu Ser Glu Arg Ser Met Thr Met Thr Lys Ser Ile Arg Asp Asp Ile

305 310 315 320

Pro Ser Thr Gln Gly Asn Leu Val Lys Trp Ala Leu Asp Asn Gly Tyr

325 330 335

Ser Pro Ile Thr Ser Tyr Thr Met Ala Pro Val Ala Asn Arg Phe His

340 345 350

Leu Arg Leu Glu Asn Asn Ala Glu Glu Met Gly Asp Glu Glu Val His

355 360 365

Thr Ile Pro Pro Glu Leu Arg Ile Leu Leu Asp Pro Gly Ala Leu Pro

370 375 380

Ala Leu Gln Asn Pro Pro Ile Arg Gly Gly Glu Gly Gln Asn Gly Gly

385 390 395 400

Leu Pro Phe Pro Phe Pro Asp Ile Ser Arg Arg Val Trp Asn Glu Glu

405 410 415

Gly Glu Asp Gly Leu Pro Arg Pro Lys Asp Pro Val Ile Pro Ser Ile

420 425 430

Gln Leu Phe Pro Gly Leu Arg Glu Pro Glu Glu Val Gln Gly Ser Val

435 440 445

Asp Ile Ala Leu Ser Val Lys Cys Asp Asn Glu Lys Met Ile Val Ala

450 455 460

Val Glu Lys Asp Ser Phe Gln Ala Ser Gly Tyr Ser Gly Met Asp Val

465 470 475 480

Thr Leu Leu Asp Pro Thr Cys Lys Ala Lys Met Asn Gly Thr His Phe

485 490 495

Val Leu Glu Ser Pro Leu Asn Gly Cys Gly Thr Arg Pro Arg Trp Ser

500 505 510

Ala Leu Asp Gly Val Val Tyr Tyr Asn Ser Ile Val Ile Gln Val Pro

515 520 525

Ala Leu Gly Asp Ser Ser Gly Trp Pro Asp Gly Tyr Glu Asp Leu Glu

530 535 540

Ser Gly Asp Asn Gly Phe Pro Gly Asp Met Asp Glu Gly Asp Ala Ser

545 550 555 560

Leu Phe Thr Arg Pro Glu Ile Val Val Phe Asn Cys Ser Leu Gln Gln

565 570 575

Val Arg Asn Pro Ser Ser Phe Gln Glu Gln Pro His Gly Asn Ile Thr

580 585 590

Phe Asn Met Glu Leu Tyr Asn Thr Asp Leu Phe Leu Val Pro Ser Gln

595 600 605

Gly Val Phe Ser Val Pro Glu Asn Gly His Val Tyr Val Glu Val Ser

610 615 620

Val Thr Lys Ala Glu Gln Glu Leu Gly Phe Ala Ile Gln Thr Cys Phe

625 630 635 640

Ile Ser Pro Tyr Ser Asn

645

<210>10

<211>2765

<212>RNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

gagaccggcc ucgagcagcu gaagcuuccu gcaggucgac ucuagagcca ccaugaccag 60

ccacuacgug aucgccaucu ucgcccugau gagcagcugu cuggccacag caggaccaga 120

gccaggcgcc cugugugaac ucagcccagu guccgcuucu cauccagugc aggcccugau 180

ggagagcuuc acagugcuga gcggcugcgc cagcagaggc acaacaggac ugccucagga 240

ggugcacgug cugaaccuga gaaccgcagg acagggacca ggacagcugc agagggaagu 300

gacccugcac cugaacccca ucagcagcgu gcacauccac cacaagagcg ugguguuccu 360

gcugaacagc ccucacccac uggucuggca ccugaagacc gagagacugg cuacaggcgu 420

guccagacug uuccuggugu ccgaaggcag cguggugcag uuuagcagcg cuaacuucag 480

ccugaccgcc gaaaccgagg agagaaacuu cccccacggc aacgagcacc ugcugaauug 540

ggccaggaag gaguacggag ccgugaccag cuucaccgag cugaagaucg cccggaacau 600

cuacaucaag gucggcgagg accagguguu cccacccaag ugcaacaucg gcaagaacuu 660

ccugagccug aacuaccugg ccgaguaucu gcagccuaaa gccgcagagg gcugcgugau 720

gucuagccag ccccagaacg aggaggugca caucaucgag cugaucaccc ccaacagcaa 780

ccccuacagc gccuuccagg uggacaucac caucgacauc cggccuagcc aggaggaucu 840

ggaggucgug aagaaccuga uccugauccu caagugcaag aagagcguga auugggucau 900

caagagcuuc gacgugaagg gcagccugaa gaucaucgcc cccaacagca ucggcuuugg 960

caaagagagc gagcggagca ugaccaugac caagagcauc cgggacgaca uccccucuac 1020

acagggcaac cucgucaagu gggcacugga uaacggcuac agcccuauca ccagcuacac 1080

cauggcccca guggccaaca gauuccaccu gcggcuggag aacaacgccg aagagauggg 1140

cgacgaggaa gugcacacca ucccucccga gcugagaauc cugcuggacc ccggcgcccu 1200

gccagcucug cagaauccuc cuauuagagg cggcgaggga cagaacggag gacugccuuu 1260

cccuuucccc gacaucagca ggagagugug gaacgaggag ggcgaagacg gacugccuag 1320

accuaaggac cccgugaucc cuagcaucca gcuguuccca ggccugagag agccagagga 1380

agugcaggga agcguggaca ucgcucugag cgucaagugc gacaacgaga agaugaucgu 1440

ggccguggag aaggacagcu uccaggcuag cggauacagc ggaauggacg ugacccugcu 1500

ggacccuacu ugcaaggcca agaugaacgg cacccacuuc gugcuggagu ccccccugaa 1560

cgguugcggc acaagaccua gguggagcgc ucuggacgga gugguguacu acaacuccau 1620

cgugauccag gugcccgcuc ugggagauuc uagcgguugg ccagacggcu acgaggaucu 1680

ggagagcgga gacaacggcu ucccaggcga uauggacgag ggagacgcuu cucuguucac 1740

caggcccgag aucguggugu ucaauugcag ccugcagcag guccgcaacc cuucuagcuu 1800

ccaggagcag ccucacggca acaucaccuu caacauggag cuguacaaca ccgaccuguu 1860

ccuggugcca ucacagggag uguucagcgu gcccgagaac ggacacgugu acguggaggu 1920

guccgugacc aaggcagaac aggagcuggg cuucgccauc cagacuugcu ucaucagccc 1980

cuacagcaac gagcccaaau cuugugacaa aacucacaca ugcccaccgu gcccagcacc 2040

ugaacuccug gggggaccgu cagucuuccu cuucccccca aaacccaagg acacccucau 2100

gaucucccgg accccugagg ucacaugcgu ggugguggac gugagccacg aagacccuga 2160

ggucaaguuc aacugguacg uggacggcgu ggaggugcau aaugccaaga caaagccgcg 2220

ggaggagcag uacaacagca cguaccgugu ggucagcguc cucaccgucc ugcaccagga 2280

cuggcugaau ggcaaggagu acaagugcaa ggucuccaac aaagcccucc cagcccccau 2340

cgagaaaacc aucuccaaag ccaaagggca gccccgagaa ccacaggugu acacccugcc 2400

cccaucccgg gaugagcuga ccaagaacca ggucagccug accugccugg ucaaaggcuu 2460

cuaucccagc gacaucgccg uggaguggga gagcaauggg cagccggaga acaacuacaa 2520

gaccacgccu cccgugcugg acuccgacgg cuccuucuuc cucuacagca agcucaccgu 2580

ggacaagagc agguggcagc aggggaacgu cuucucaugc uccgugaugc augaggcucu 2640

gcacaaccac uacacgcaga agagccucuc ccugucuccg gguaaaugag aauucuuaau 2700

uaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 2760

aaaaa 2765

<210>11

<211>878

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>11

Met Thr Ser His Tyr Val Ile Ala Ile Phe Ala Leu Met Ser Ser Cys

1 5 10 15

Leu Ala Thr Ala Gly Pro Glu Pro Gly Ala Leu Cys Glu Leu Ser Pro

20 25 30

Val Ser Ala Ser His Pro Val Gln Ala Leu Met Glu Ser Phe Thr Val

35 40 45

Leu Ser Gly Cys Ala Ser Arg Gly Thr Thr Gly Leu Pro Gln Glu Val

50 55 60

His Val Leu Asn Leu Arg Thr Ala Gly Gln Gly Pro Gly Gln Leu Gln

65 70 75 80

Arg Glu Val Thr Leu His Leu Asn Pro Ile Ser Ser Val His Ile His

85 90 95

His Lys Ser Val Val Phe Leu Leu Asn Ser Pro His Pro Leu Val Trp

100 105 110

His Leu Lys Thr Glu Arg Leu Ala Thr Gly Val Ser Arg Leu Phe Leu

115 120 125

Val Ser Glu Gly Ser Val Val Gln Phe Ser Ser Ala Asn Phe Ser Leu

130 135 140

Thr Ala Glu Thr Glu Glu Arg Asn Phe Pro His Gly Asn Glu His Leu

145 150 155 160

Leu Asn Trp Ala Arg Lys Glu Tyr Gly Ala Val Thr Ser Phe Thr Glu

165 170 175

Leu Lys Ile Ala Arg Asn Ile Tyr Ile Lys Val Gly Glu Asp Gln Val

180 185 190

Phe Pro Pro Lys Cys Asn Ile Gly Lys Asn Phe Leu Ser Leu Asn Tyr

195 200 205

Leu Ala Glu Tyr Leu Gln Pro Lys Ala Ala Glu Gly Cys Val Met Ser

210 215 220

Ser Gln Pro Gln Asn Glu Glu Val His Ile Ile Glu Leu Ile Thr Pro

225 230 235 240

Asn Ser Asn Pro Tyr Ser Ala Phe Gln Val Asp Ile Thr Ile Asp Ile

245 250 255

Arg Pro Ser Gln Glu Asp Leu Glu Val Val Lys Asn Leu Ile Leu Ile

260 265 270

Leu Lys Cys Lys Lys Ser Val Asn Trp Val Ile Lys Ser Phe Asp Val

275 280 285

Lys Gly Ser Leu Lys Ile Ile Ala Pro Asn Ser Ile Gly Phe Gly Lys

290 295 300

Glu Ser Glu Arg Ser Met Thr Met Thr Lys Ser Ile Arg Asp Asp Ile

305 310 315 320

Pro Ser Thr Gln Gly Asn Leu Val Lys Trp Ala Leu Asp Asn Gly Tyr

325 330 335

Ser Pro Ile Thr Ser Tyr Thr Met Ala Pro Val Ala Asn Arg Phe His

340 345 350

Leu Arg Leu Glu Asn Asn Ala Glu Glu Met Gly Asp Glu Glu Val His

355 360 365

Thr Ile Pro Pro Glu Leu Arg Ile Leu Leu Asp Pro Gly Ala Leu Pro

370 375 380

Ala Leu Gln Asn Pro Pro Ile Arg Gly Gly Glu Gly Gln Asn Gly Gly

385 390 395 400

Leu Pro Phe Pro Phe Pro Asp Ile Ser Arg Arg Val Trp Asn Glu Glu

405 410 415

Gly Glu Asp Gly Leu Pro Arg Pro Lys Asp Pro Val Ile Pro Ser Ile

420 425 430

Gln Leu Phe Pro Gly Leu Arg Glu Pro Glu Glu Val Gln Gly Ser Val

435 440 445

Asp Ile Ala Leu Ser Val Lys Cys Asp Asn Glu Lys Met Ile Val Ala

450 455 460

Val Glu Lys Asp Ser Phe Gln Ala Ser Gly Tyr Ser Gly Met Asp Val

465 470 475 480

Thr Leu Leu Asp Pro Thr Cys Lys Ala Lys Met Asn Gly Thr His Phe

485 490 495

Val Leu Glu Ser Pro Leu Asn Gly Cys Gly Thr Arg Pro Arg Trp Ser

500 505 510

Ala Leu Asp Gly Val Val Tyr Tyr Asn Ser Ile Val Ile Gln Val Pro

515 520 525

Ala Leu Gly Asp Ser Ser Gly Trp Pro Asp Gly Tyr Glu Asp Leu Glu

530 535 540

Ser Gly Asp Asn Gly Phe Pro Gly Asp Met Asp Glu Gly Asp Ala Ser

545 550 555 560

Leu Phe Thr Arg Pro Glu Ile Val Val Phe Asn Cys Ser Leu Gln Gln

565 570 575

Val Arg Asn Pro Ser Ser Phe Gln Glu Gln Pro His Gly Asn Ile Thr

580 585 590

Phe Asn Met Glu Leu Tyr Asn Thr Asp Leu Phe Leu Val Pro Ser Gln

595 600 605

Gly Val Phe Ser Val Pro Glu Asn Gly His Val Tyr Val Glu Val Ser

610 615 620

Val Thr Lys Ala Glu Gln Glu Leu Gly Phe Ala Ile Gln Thr Cys Phe

625 630 635 640

Ile Ser Pro Tyr Ser Asn Glu Pro Lys Ser Cys Asp Lys Thr His Thr

645 650 655

Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe

660 665 670

Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro

675 680 685

Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val

690 695 700

Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr

705 710 715 720

Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val

725 730 735

Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys

740 745 750

Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser

755 760 765

Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro

770 775 780

Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val

785 790 795 800

Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly

805 810 815

Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp

820 825 830

Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp

835 840 845

Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His

850 855 860

Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys

865 870 875

<210>12

<211>489

<212>DNA

<213>Homo sapiens

<400>12

atgagaattt cgaaaccaca tttgagaagt atttccatcc agtgctactt gtgtttactt 60

ctaaacagtc attttctaac tgaagctggc attcatgtct tcattttggg ctgtttcagt 120

gcagggcttc ctaaaacaga agccaactgg gtgaatgtaa taagtgattt gaaaaaaatt 180

gaagatctta ttcaatctat gcatattgat gctactttat atacggaaag tgatgttcac 240

cccagttgca aagtaacagc aatgaagtgc tttctcttgg agttacaagt tatttcactt 300

gagtccggag atgcaagtat tcatgataca gtagaaaatc tgatcatcct agcaaacaac 360

agtttgtctt ctaatgggaa tgtaacagaa tctggatgca aagaatgtga ggaactggag 420

gaaaaaaata ttaaagaatt tttgcagagt tttgtacata ttgtccaaat gttcatcaac 480

acttcttga 489

<210>13

<211>804

<212>DNA

<213>Homo sapiens

<400>13

atggctccta ggagagccag agggtgtagg acactgggac tgccagctct gctgctgctg 60

ctgctgctga gacctccagc tacaagggga atcacctgcc ctcctcctat gagcgtggag 120

cacgccgaca tttgggtgaa gagctacagc ctgtacagcc gggagcgcta catttgcaac 180

agcggcttca agaggaaggc cggaacaagc tctctcaccg agtgcgtgct gaacaaggcc 240

accaacgtgg cccattggac aacccctagc ctgaagtgca tcagggaccc agcactggtg 300

caccagagac cagctcctcc tagcacagtg accacagccg gagtgacacc tcagccagaa 360

agcctgagcc ctagcggaaa agaaccagcc gcctctagcc ccagcagcaa taataccgcc 420

gccacaacag ccgctattgt gccaggaagc cagctgatgc ctagcaagag ccctagcacc 480

ggcacaacag agatcagcag ccacgagagc agccacggaa cacctagcca gaccacagcc 540

aagaattggg agctgaccgc cagcgccagc caccagcctc caggagtgta ccctcaggga 600

cacagcgata ccaccgtggc catctctacc agcacagtgc tgctgtgcgg actgtcagct 660

gtgtccctgc tggcttgcta cctgaagagc agacagaccc ctcctctggc cagcgtggaa 720

atggaggcta tggaggccct gccagtgact tggggaacct ctagcagaga cgaggacctg 780

gagaattgca gccaccacct gtag 804

Claims (7)

1. An immunopotentiating pharmaceutical composition comprising a modulator and survivin or a nucleic acid encoding the survivin, wherein the modulator consists of the following (a) and (b):

(a) nucleic acid of the sequence shown in SEQ ID NO. 6 or BCL2 protein of the amino acid sequence shown in SEQ ID NO. 1, nucleic acid of the sequence shown in SEQ ID NO. 5 or CD40L protein of the amino acid sequence shown in SEQ ID NO. 2, and nucleic acid of the sequence shown in SEQ ID NO. 8 for coding IL-15 and IL-15Ra or IL-15 of the amino acid sequence shown in SEQ ID NO. 3 and IL-15Ra of the amino acid sequence shown in SEQ ID NO. 4;

(b) 10 or a fusion protein of the extracellular domain of TGFBR3 encoded thereby and the Fc portion of an immunoglobulin.

2. The pharmaceutical composition according to claim 1, wherein the molar ratio of survivin to the regulator is 1:1 to 0.3: 1.

3. The pharmaceutical composition according to claim 1, wherein (a) and (b) are each a protein, and the molar ratio of the (a) and (b) components is 0.1-10: 1.

4. A cell which is a DC cell or a PBMC cell comprising a nucleic acid encoding survivin and a nucleic acid having a sequence as shown in SEQ ID NO 6, SEQ ID NO 5, SEQ ID NO 8 or SEQ ID NO 10, respectively.

5. Use of a modulator and survivin or a nucleic acid encoding the same for the preparation of a pharmaceutical composition for increasing the level of TNF-a or IFN-r in lymphocytes, wherein the modulator consists of the following components (a) and (b):

(a) nucleic acid of the sequence shown in SEQ ID NO. 6 or BCL2 protein of the amino acid sequence shown in SEQ ID NO. 1, nucleic acid of the sequence shown in SEQ ID NO. 5 or CD40L protein of the amino acid sequence shown in SEQ ID NO. 2, and nucleic acid of the sequence shown in SEQ ID NO. 8 for coding IL-15 and IL-15Ra or IL-15 of the amino acid sequence shown in SEQ ID NO. 3 and IL-15Ra of the amino acid sequence shown in SEQ ID NO. 4;

(b) 10 or a fusion protein of the extracellular domain of TGFBR3 encoded thereby and the Fc portion of an immunoglobulin.

6. Use of a modulator and survivin or a nucleic acid encoding the same for the preparation of a pharmaceutical composition for increasing the proportion of TNF-a + or IFN-r + cells in a population of lymphocytes, wherein the modulator consists of the following (a) and (b) components:

(a) nucleic acid of the sequence shown in SEQ ID NO. 6 or BCL2 protein of the amino acid sequence shown in SEQ ID NO. 1, nucleic acid of the sequence shown in SEQ ID NO. 5 or CD40L protein of the amino acid sequence shown in SEQ ID NO. 2, and nucleic acid of the sequence shown in SEQ ID NO. 8 for coding IL-15 and IL-15Ra or IL-15 of the amino acid sequence shown in SEQ ID NO. 3 and IL-15Ra of the amino acid sequence shown in SEQ ID NO. 4;

(b) 10 or a fusion protein of the extracellular domain of TGFBR3 encoded thereby and the Fc portion of an immunoglobulin.

7. Use of an agent for the preparation of a pharmaceutical composition for increasing the proportion of TNF-a + and/or IFN-r + cells in a population of lymphocytes by a method comprising the steps of:

1) introducing a reagent into the expression cells to obtain transfected cells; and

2) a step of co-culturing the transfected cells with the lymphocyte population or contacting at least a partial secretion of the transfected cells with the lymphocyte population;

the reagent comprises nucleic acids with sequences shown as SEQ ID NO 6, SEQ ID NO 5, SEQ ID NO 8 and SEQ ID NO 10 respectively and nucleic acid for coding survivin.

Images