CN109810197B - Artificial antigen presenting cell for efficiently amplifying NK (natural killer) and construction method thereof - Google Patents

Abstract

The invention provides an artificial antigen presenting cell for efficiently amplifying NK (natural killer) and a construction method thereof. In particular, the present invention relates to a fusion protein comprising IL-15, IL-21 and MICA proteins, and optionally a tag sequence and/or a signal peptide sequence. Experimental results show that cells expressing the fusion protein can well induce proliferation, differentiation and activation of NK cells, and the prepared NK cells are large in number, high in purity and strong in killing activity. The invention expresses the genes in series, realizes the expression of the genes with the sequence number of 1:1, simplifies the operation process and greatly reduces the time and labor cost. The invention optimizes the construction method for the NK cell artificial antigen presenting cell, and lays a foundation for the future application of the NK cell in tumor treatment, prevention and the like.

Description

Artificial antigen presenting cell for efficiently amplifying NK (natural killer) and construction method thereof

Technical Field

The invention belongs to the field of biotechnology. Specifically, the invention relates to an artificial antigen presenting cell for efficiently amplifying NK and a construction method thereof.

Background

Natural Killer (NK) cells, a natural Killer cell, have the following characteristics: 1. no specific antigen recognition is required; 2. killing target cells directly; 3. not restricted by MHC; 4. has a wider anti-tumor spectrum; 5. basically has no adverse reaction. Plays a very important role in controlling the occurrence and development of cancer. It can destroy viruses, bacteria and cancer cells in the human body by releasing perforin/granzyme, ADCC effect, Fas/FasL system and NK cytotoxic factor. Is the core component of the innate immunity of the human body, and is a third type of lymphocyte except T lymphocytes and B lymphocytes. It can be used as the first line of defense of human body, and can remove harmful substances such as virus and bacteria, and can also remove aging, pathological changes and cancerated cells, thereby maintaining human health. Because of the unique characteristics of the NK, the application of the NK in tumor immunotherapy is more and more emphasized. In Japan, NK cells are widely used not only for the treatment of cancer patients but also for sub-health people to prevent the occurrence of cancer. Therefore, how to obtain a large amount of NK cells becomes a problem to be solved urgently.

At present, the methods for in vitro amplification culture of NK cells mainly comprise the following three methods: (1) the method for stimulating culture by using interleukin cytokines such as IL-2, IL-15 and the like usually needs to be sorted, has high culture cost, often has the condition that the quantity or the purity is difficult to meet the experimental requirements, and cannot be applied to large-scale clinical research; (2) the amplification culture after NK activation by using antibodies such as CD16 has great difference in cell amplification efficiency and NK cell activity of different batches. Therefore, artificial antigen presenting cells are mainly used at present. An artificial antigen presenting cell (aAPC) is a new emerging strategy for immunotherapy, and is to express ligands or antibodies of MHC (major histocompatibility complex), costimulatory molecules and adhesion molecules on the surface of a certain vector to simulate natural antigen presenting cells. At present, the existing artificial antigen presenting cells cannot well amplify or activate NK cells.

Therefore, there is an urgent need in the art to develop an artificial antigen presenting cell for culturing NK cells and a method for preparing the same.

Disclosure of Invention

The invention aims to provide an artificial antigen presenting cell for culturing NK cells and a preparation method thereof.

In a first aspect of the invention, there is provided a fusion protein comprising IL-15, IL-21 and MICA proteins, and optionally a tag sequence and/or a signal peptide sequence.

In another preferred embodiment, the fusion protein comprises IL-15, IL-21, and MICA protein in that order.

In another preferred embodiment, the IL-15, IL-21 and MICA proteins are linked in tandem in the fusion protein.

In another preferred embodiment, the IL-15, IL-21 and MICA proteins may be linked together without or through a linker peptide.

In another preferred embodiment, the linker peptide is selected from the group consisting of: a flexible peptide, a rigid peptide, a 2A peptide, an IRES, or a combination thereof. Preferably, the linking peptide is a flexible peptide.

In another preferred embodiment, the molar ratio of IL-15, IL-21, and MICA protein in the fusion protein is (0.8-1.2): (0.8-1.2): (0.8-1.2).

In another preferred embodiment, the molar ratio of IL-15, IL-21 and MICA protein in the fusion protein is 1: 1: 1.

in another preferred embodiment, the fusion protein has the structure of formula I:

L-I1-X1-I2-X2-I3-X3 (I)，

wherein the content of the first and second substances,

l is nothing, a tag sequence or a signal peptide sequence;

i1 is nothing or a first linking peptide;

x1 is IL-15;

i2 is nothing or a second linking peptide;

x2 is IL-21;

i3 is nothing or a third linking peptide;

x3 is MICA protein; and

"-" denotes a linker peptide or peptide bond linking the above elements.

In another preferred embodiment, the positions of X1, X2, and X3 in the fusion protein are interchangeable.

In another preferred embodiment, L is a signal peptide, preferably a signal peptide from MICA protein.

In another preferred embodiment, the amino acid sequence of L is shown in the 1 st to 23 rd position of SEQ ID NO. 2.

In another preferred embodiment, the IL-15 is human IL-15, murine IL-15, or rabbit IL-15.

In another preferred embodiment, the IL-21 is human IL-21, murine IL-21, or rabbit IL-21.

In another preferred embodiment, the amino acid sequence of the IL-15 is shown in SEQ ID NO. 2 at positions 33-146.

In another preferred embodiment, the amino acid sequence of IL-21 is shown in SEQ ID NO. 2 at position 156 and 288.

In another preferred embodiment, the amino acid sequence of the MICA protein is as shown in SEQ ID NO. 2 at position 298-663.

In another preferred embodiment, I1 is none.

In another preferred embodiment, I2 is none.

In another preferred embodiment, I3 is none.

In another preferred embodiment, the I1, I2 and I3 are each independently selected from the group consisting of: a flexible peptide, a rigid peptide, a 2A peptide, an IRES, or a combination thereof.

In another preferred example, the I1, I2 and I3 are all connecting peptides without self-splicing function.

In another preferred embodiment, each of I1, I2, and I3 is independently a flexible peptide.

In another preferred embodiment, the flexible peptide is non-immunogenic and creates sufficient spatial distance between the elements to minimize steric hindrance between each other.

In another preferred embodiment, the flexible peptide linker contains two or more amino acids selected from the group consisting of glycine (G), serine (S), alanine (a) and threonine (T).

In another preferred embodiment, the flexible peptide comprises a (GmX) n sequence, wherein X is serine (S), alanine (a), glycine (G), threonine (T), leucine (L), isoleucine (I), or valine (V); m and n are integers; m is 1, 2, 3 or 4; and n is 1, 2, 3, 4, 5, 6 or 7. Preferably, X is serine (S).

In another preferred embodiment, the flexible peptide is a GS-linked peptide.

In another preferred embodiment, the flexible peptide consists of one or more (e.g., 1-20, 1-18, or 1-16) amino acid sequences of glycine (G) and/or serine (S).

In another preferred embodiment, the flexible peptide has the general amino acid sequence formed by the combination of (GS) a (GGS) b (GGGS) c (GGGGS) d cyclic units, wherein a, b, c and d are integers greater than or equal to 0, and a + b + c + d is greater than or equal to 1.

In another preferred embodiment, the flexible peptide is selected from the group consisting of: GSGGSGGSG (SEQ ID NO.:3) or GGGGS (SEQ ID NO.: 4).

In another preferred embodiment, the fusion protein is selected from the group consisting of:

(A) a polypeptide having an amino acid sequence shown in SEQ ID NO. 2;

(B) a polypeptide having 80% homology (preferably 85% or more, more preferably 90% or more, more preferably 95% or more, most preferably 97% or more) with the amino acid sequence shown in SEQ ID NO. 2 and retaining the property;

(C) 2 by substitution, deletion or addition of 1-5 amino acid residues, and the property is retained.

In another preferred embodiment, the fusion protein has the following properties:

a) inducing proliferation, differentiation and activation of immune cells (e.g., NK cells); and/or

b) Increasing the killing activity of immune cells (such as NK cells).

In a second aspect of the invention, there is provided a polynucleotide encoding a fusion protein according to the first aspect of the invention.

In another preferred embodiment, the polynucleotide is selected from the group consisting of:

(a) a polynucleotide encoding a fusion protein as set forth in SEQ ID No. 2;

(b) a polynucleotide having a sequence as shown in SEQ ID No. 1;

(c) a polynucleotide having a nucleotide sequence having a homology of 75% or more (preferably 80% or more) to the sequence of (b);

(d) a polynucleotide in which 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides are truncated or added to the 5 'end and/or the 3' end of the polynucleotide shown in (b);

(e) a polynucleotide complementary to any one of the polynucleotides of (a) - (d).

In another preferred embodiment, the polynucleotide sequence is as shown in SEQ ID No. 1.

In another preferred embodiment, the polynucleotide encodes a product wherein the molar ratio of IL-15, IL-21, and MICA protein is (0.8-1.2): (0.8-1.2): (0.8-1.2), preferably 1: 1: 1.

in another preferred embodiment, the coding sequences for IL-15, IL-21 and MICA are linked in tandem by a linker sequence.

In another preferred embodiment, the linker sequence encodes a linker peptide that does not have a self-splicing function, preferably a flexible peptide.

The invention also provides an expression cassette for expressing the fusion protein of the first aspect of the invention.

In another preferred embodiment, the expression cassette has the structure of formula II from 5 'end to 3' end:

Z0-Z1-Z2-Z3-Z4-Z5-Z6-Z7 (II)

wherein each "-" is independently a bond or a nucleotide linking sequence;

z0 is a promoter, preferably a CMV promoter;

z1 is a null or signal peptide coding sequence;

z2 is nothing or a first linker peptide coding sequence;

z3 is an IL-15 coding sequence;

z4 is nothing or a second linker peptide coding sequence;

z5 is an IL-21 coding sequence;

z6 is nothing or a third linker peptide coding sequence; and

z7 is the MICA protein coding sequence.

In another preferred embodiment, the expression cassette expresses IL-15, IL-21 and MICA protein in a molar ratio of (0.8-1.2): (0.8-1.2): (0.8-1.2), preferably 1: 1: 1.

in another preferred embodiment, the linker peptide encoded by the first linker peptide encoding sequence, the second linker peptide encoding sequence, and the third linker peptide encoding sequence is a flexible peptide.

In a third aspect of the invention, there is provided a vector comprising a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the vector comprises DNA and RNA.

In another preferred embodiment, the carrier is selected from the group consisting of: a plasmid, a viral vector, a transposon, or a combination thereof.

In another preferred embodiment, the vector comprises a DNA virus or a retroviral vector.

In another preferred embodiment, the carrier is selected from the group consisting of: a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a combination thereof.

In another preferred embodiment, the vector is a lentiviral vector.

In another preferred embodiment, the vector comprises one or more promoters operably linked to the nucleic acid sequence, enhancer, intron, transcription termination signal, polyadenylation sequence, origin of replication, selectable marker, nucleic acid restriction site, and/or homologous recombination site.

In another preferred embodiment, the vector is a vector comprising or inserted with a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the vector is for expressing a fusion protein according to the first aspect of the invention.

In another preferred embodiment, the vector is used to express the IL-15, IL-21 and MICA proteins in a molar ratio of IL-15, IL-21 and MICA proteins of (0.8-1.2): (0.8-1.2): (0.8-1.2), preferably 1: 1: 1.

in another preferred embodiment, the vector comprises an expression cassette for expression of the fusion protein according to the first aspect of the invention.

In a fourth aspect of the invention, there is provided a host cell expressing a fusion protein according to the first aspect of the invention; and/or

(ii) the host cell genome incorporates an exogenous polynucleotide according to the second aspect of the invention; and/or

The host cell comprises a vector according to the third aspect of the invention.

In another preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.

In another preferred embodiment, the host cell is a human cell or a non-human mammalian cell.

In another preferred embodiment, the host cell is an antigen presenting cell, preferably an artificial antigen presenting cell.

In another preferred embodiment, the host cell is a K562 cell.

In a fifth aspect of the invention, an artificial antigen presenting cell is provided, wherein the artificial antigen presenting cell expresses the fusion protein of the first aspect of the invention.

In another preferred embodiment, the fusion protein according to the first aspect of the present invention is expressed on the cell membrane of the artificial antigen presenting cell.

In another preferred embodiment, the artificial antigen presenting cell is ex vivo.

In another preferred embodiment, the artificial antigen presenting cells are autologous or allogeneic.

In another preferred embodiment, the artificial antigen presenting cell is from a human or non-human mammal.

In another preferred embodiment, the artificial antigen presenting cell is a K562 cell.

In a sixth aspect of the invention, there is provided a use of the fusion protein of the first aspect of the invention, the polynucleotide of the second aspect of the invention, the vector of the third aspect of the invention or the artificial antigen presenting cell of the fifth aspect of the invention for (a) culturing NK cells; and/or (b) preparing a formulation for culturing NK cells.

In another preferred embodiment, the culture is an in vitro culture.

In a seventh aspect of the present invention, there is provided a culture method comprising the steps of:

(1) providing an NK cell or PBMC cell to be cultured; and

(2) contacting and culturing the NK cells or PBMC cells with the fusion protein according to the first aspect of the invention, or the host cell according to the fourth aspect of the invention, or the artificial antigen presenting cell according to the fifth aspect of the invention in a culture medium, thereby obtaining cultured NK cells or PBMC cells.

In another preferred embodiment, the host cell or artificial antigen presenting cell is an irradiated cell.

In another preferred example, the method further comprises: prior to step (2), the fusion protein of the first aspect of the invention, or the host cell of the fourth aspect of the invention, or the artificial antigen presenting cell of the fifth aspect of the invention.

In another preferred embodiment, the radiation dose is 300Gy for 100-.

In another preferred embodiment, the culture medium comprises plasma, preferably 2% to 10% (v/v) plasma, more preferably 4% to 6% plasma, based on the total volume of the culture medium.

In another preferred embodiment, the plasma is autologous plasma.

In another preferred embodiment, the culture medium further contains IL-2.

In another preferred embodiment, the final concentration of IL-2 is 500-1500IU/mL, preferably 900-1100 IU/mL.

In another preferred embodiment, the ratio of the number of PBMC cells to the number of host cells or artificial antigen presenting cells is 10:1 to 1:10, preferably 5:1 to 1:5, more preferably 2:1 to 1:2, more preferably 1: 1.

In another preferred embodiment, the ratio of the number of NK cells to host cells or artificial antigen presenting cells is 10:1 to 1:10, preferably 5:1 to 1:5, more preferably 2:1 to 1:2, more preferably 1: 1.

In another preferred example, in the step (2), the culturing time is 14 to 21 days.

In another preferred example, the method further comprises the steps of: (3) contacting the cultured NK cells or PBMC cells of the step (2) with the fusion protein of the first aspect of the invention, or the host cells of the fourth aspect of the invention, or the artificial antigen presenting cells of the fifth aspect of the invention again, and culturing to obtain secondary cultured NK cells or PBMC cells.

In another preferred example, in step (3), the ratio of the number of PBMC cells to the number of host cells or artificial antigen presenting cells is 1:1-1:10, preferably 1:2-1: 4.

In another preferred example, in step (3), the number ratio of NK cells to host cells or artificial antigen presenting cells is 1:1-1:10, preferably 1:2-1: 4.

In another preferred example, the method further comprises the steps of: (4) isolating said cultured NK cells or PBMC cells from the cultured system.

The invention also provides an NK cell obtained by the culture method of the seventh aspect of the invention.

In an eighth aspect of the present invention, there is provided a method of producing the host cell of the fourth aspect of the present invention, the method comprising the steps of: transducing the polynucleotide of the second aspect of the invention or the vector of the third aspect of the invention into a host cell, thereby obtaining the host cell.

In another preferred embodiment, the host cell is an artificial antigen presenting cell.

The present invention also provides a formulation comprising: a fusion protein according to the first aspect of the invention, a polynucleotide according to the second aspect of the invention, a vector according to the third aspect of the invention or an artificial antigen presenting cell according to the fifth aspect of the invention, and a pharmaceutically acceptable carrier or excipient.

In another preferred embodiment, the formulation is a liquid formulation.

The invention also provides a kit for preparing a host cell according to the fourth aspect of the invention, the kit comprising a container, and a nucleic acid sequence comprising an expression cassette for expressing a fusion protein according to the first aspect of the invention located within the container.

The present invention also provides a method of preparing a fusion protein according to the first aspect of the invention, comprising the steps of:

culturing the host cell of the fourth aspect of the invention under conditions suitable for expression, thereby expressing the fusion protein of the first aspect of the invention; and isolating the fusion protein.

In another preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows a schematic representation of the structure of mIl-15-IL-21-MICA.

FIG. 2 shows the results of flow assay mIl-15-IL-21-MICA K562 after sorting and expansion.

FIG. 3 shows the NK cell killing activity assay on K562 and tumor cells.

Detailed Description

The inventor of the invention has extensively and deeply studied, the first time unexpectedly found that the fusion protein containing IL-15, IL-21 and MICA protein and the cell expressing the fusion protein of the invention can well induce the proliferation, differentiation and activation of NK cells, and the prepared NK cells have the advantages of high quantity, high purity and strong killing activity.

In addition, in preparation, more than two genes are usually required to be expressed at the same time to modify K562, and there are two schemes: 1) when the 2A peptide or IRES is used for connection during the construction of the vector, the purpose gene can not be easily connected to 1:1 is expressed 100%. 2) Or the genes are expressed one by one, and the second gene is modified on the cell strain with the successfully expressed first gene, so that the method is more complicated and has longer preparation period.

The invention surprisingly discovers that the genes coding the elements are expressed in series, and the expression ratio of the genes is 1:1, the biological activity of each element in the fusion protein is still maintained while the expression is performed by 100 percent, the operation process is simplified, the time and the labor cost are greatly reduced, and only one transfection and one screening are needed. The invention optimizes the construction method for the NK cell artificial antigen presenting cell, and lays a foundation for the future application of the NK cell in tumor treatment, prevention and the like. On this basis, the inventors have completed the present invention.

Description of the terms

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

As used herein, the term "about" when used in reference to a specifically recited value means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes 99 and 101 and all values in between (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

Artificial antigen presenting cells

In the present invention, the artificial antigen presenting cell (aAPC) is a new emerging strategy for immunotherapy, and expresses ligands or antibodies of MHC, costimulatory molecules, adhesion molecules, etc. on the surface of a certain vector, mimicking a natural antigen presenting cell. Through the aAPC, the addition of cell factors can be obviously reduced, and meanwhile, a plurality of research groups have proved from different sides that the aAPC is a powerful tool for effectively amplifying antigen-specific T cells and NK cells in vitro, enhances and maintains the toxic action of the aAPC to kill tumor cells, has the advantages of simplified operation process, good repeatability and low cost, provides a new method for adoptive cell immunotherapy of tumors or chronic infectious diseases, is applied to clinic and generates encouraging application prospects.

The present invention provides an artificial antigen presenting cell expressing a fusion protein according to the first aspect of the present invention. In another preferred embodiment, the artificial antigen presenting cell is a K562 cell.

NK cells

Natural Killer (NK) cells are a major class of immune effector cells that protect the body from viral infection and tumor cell invasion through non-antigen specific pathways. In autoimmune diseases, NK cell imbalance (depletion) is an important mechanism leading to the pathogenesis of autoimmune diseases, and NK cell depletion leads to a decrease in its function of non-specifically inhibiting B cell secretion of antibodies. However, NK92 cells are the only cell line approved by FDA clinical test at present, the cytotoxic ability is strong, the survival time after killing tumor cells is short, the cells are easy to expand in vitro, and most of patients receiving treatment do not reject NK92-MI cells and have no risk of graft-versus-host reaction.

Fusion proteins

As used herein, the terms "fusion protein", "fusion protein of the invention", "active polypeptide" and "polypeptide of the invention" have the same meaning and all have the structure described in the first aspect of the invention. After being expressed, the fusion protein of the invention can pass through a cell membrane and be positioned on the cell membrane.

In another preferred embodiment, the amino acid sequence of the fusion protein is shown in SEQ ID No. 2.

The term "fusion protein" as used herein also includes variants of the sequence of SEQ ID No. 2 having the above-described activity. These variants include (but are not limited to): deletion, insertion and/or substitution of 1 to 3 (usually 1 to 2, more preferably 1) amino acids, and addition or deletion of one or several (usually up to 3, preferably up to 2, more preferably up to 1) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids of similar or similar properties will not generally alter the function of the protein. Also, for example, the addition or deletion of one or several amino acids at the C-terminus and/or N-terminus does not generally alter the structure and function of the protein. In addition, the term also includes monomeric and multimeric forms of the polypeptides of the invention. The term also includes linear as well as non-linear polypeptides (e.g., cyclic peptides).

The invention also includes active fragments, derivatives and analogs of the above fusion proteins. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that substantially retains the function or activity of a fusion protein of the invention. The polypeptide fragment, derivative or analogue of the present invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which a polypeptide is fused with another compound (such as a compound for increasing the half-life of the polypeptide, e.g., polyethylene glycol), or (iv) a polypeptide in which an additional amino acid sequence is fused with the polypeptide sequence (a fusion protein in which a tag sequence such as a leader sequence, a secretory sequence or 6His is fused). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

A preferred class of reactive derivatives refers to polypeptides formed by the replacement of up to 3, preferably up to 2, more preferably up to 1 amino acid with an amino acid of similar or analogous nature compared to the amino acid sequence of the present invention. These conservative variants are preferably produced by amino acid substitutions according to Table A.

TABLE A

The analogs can differ from the polypeptide set forth in SEQ ID No. 2 by amino acid sequence differences, by modifications that do not affect the sequence, or by both.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the polypeptide, such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications in the synthesis and processing of the polypeptide or in further processing steps. Such modification may be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides modified to increase their resistance to proteolysis or to optimize solubility.

In one embodiment of the invention, the amino acid sequence of the fusion protein is shown in SEQ ID No. 2.

MGLGPVFLLLAGIFPFAPPGAAAGSGGSGGSGNWVNVISDLKKIEDLIQSMHIDATLYTESDVHPSCKVTAMKCFLLELQVISLESGDASIHDTVENLIILANNSLSSNGNVTESGCKECEELEEKNIKEFLQSFVHIVQMFINTSGSGGSGGSGQGQDRHMIRMRQLIDIVDQLKNYVNDLVPEFLPAPEDVETNCEWSAFSCFQKAQLKSANTGNNERIINVSIKKLKRKPPSTNAGRRQKHRLTCPSCDSYEKKPPKEFLERFKSLLQKMIHQHLSSRTHGSEDSGSGGSGGSGEPHSLRYNLTVLSGDGSVQSGFLAEVHLDGQPFLRCDRQKCRAKPQGQWAEDVLGNKTWDRETRDLTGNGKDLRMTLAHIKDQKEGLHSLQEIRVCEIHEDNSTRSSQHFYYDGELFLSQNLETEEWTMPQSSRAQTLAMNVRNFLKEDAMKTKTHYHAMHADCLQELRRYLKSGVVLRRTVPPMVNVTRSEASEGNITVTCRASGFYPWNITLSWRQDGVSLSHDTQQWGDVLPDGNGTYQTWVATRICQGEEQRFTCYMEHSGNHSTHPVPSGKVLVLQSHWQTFHVSAVAAAAAAAAAIFVIIIFYVCCCKKKTSAAEGPELVSLQVLDQHPVGTSDHRDATQLGFQPLMSDLGSTGSTEGA*(SEQ ID NO.:2)

Wherein, the 1-23 th position is a signal peptide from MICA protein; positions 24-32 are the first linker peptide; positions 33-146 are IL-15; position 147-155 is a second connecting peptide; position 148-288 is IL-21; 289-297 is a third connecting peptide; 298-662 th site is MICA protein.

Coding sequence

The invention also relates to polynucleotides encoding the fusion proteins according to the invention.

The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence encoding the polypeptide set forth in SEQ ID No. 2 or a degenerate variant. As used herein, "degenerate variant" refers in the present invention to nucleic acid sequences that encode a polypeptide having the sequence shown in SEQ id No. 2, but differ in the sequence of the corresponding coding region.

In a preferred embodiment of the invention, the sequence of the polynucleotide is as shown in SEQ ID No. 1.

The full-length nucleotide sequence or its fragment of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. At present, DNA sequences encoding the polypeptides of the present invention (or fragments or derivatives thereof) have been obtained entirely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art.

The invention also relates to vectors comprising the polynucleotides of the invention, and to genetically engineered host cells with the vector or polypeptide coding sequences of the invention. The polynucleotide, vector or host cell may be isolated.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in the natural state in the living cell is not isolated or purified, but the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in the natural state.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand.

The present invention also relates to variants of the above polynucleotides which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polynucleotide encoding the fusion protein of the invention.

The full-length nucleotide sequence encoding the fusion protein of the present invention or a fragment thereof can be obtained by PCR amplification, recombinant methods, or synthetic methods. For the PCR amplification method, primers can be designed based on the disclosed nucleotide sequences, particularly open reading frame sequences, and the sequences can be amplified using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

In one embodiment of the invention, the polynucleotide sequence encoding the fusion protein is shown in SEQ ID No. 1.

ATGGGGCTGGGCCCGGTCTTCCTGCTTCTGGCTGGCATCTTCCCTTTTGCACCTCCGGGAGCTGCTGCTGGCAGCGGCGGCAGCGGCGGCAGCGGCAACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGATCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCTGGCAGCGGCGGCAGCGGCGGCAGCGGCCAAGGTCAAGATCGCCACATGATTAGAATGCGTCAACTTATAGATATTGTTGATCAGCTGAAAAATTATGTGAATGACTTGGTCCCTGAATTTCTGCCAGCTCCAGAAGATGTAGAGACAAACTGTGAGTGGTCAGCTTTTTCCTGTTTTCAGAAGGCCCAACTAAAGTCAGCAAATACAGGAAACAATGAAAGGATAATCAATGTATCAATTAAAAAGCTGAAGAGGAAACCACCTTCCACAAATGCAGGGAGAAGACAGAAACACAGACTAACATGCCCTTCATGTGATTCTTATGAGAAAAAACCACCCAAAGAATTCCTAGAAAGATTCAAATCACTTCTCCAAAAGATGATTCATCAGCATCTGTCCTCTAGAACACACGGAAGTGAAGATTCCGGCAGCGGCGGCAGCGGCGGCAGCGGCGAGCCCCACAGTCTTCGTTATAACCTCACGGTGCTGTCCGGGGATGGATCTGTGCAGTCAGGGTTTCTCGCTGAGGTACATCTGGATGGTCAGCCCTTCCTGCGCTGTGACAGGCAGAAATGCAGGGCAAAGCCCCAGGGACAGTGGGCAGAAGATGTCCTGGGAAATAAGACATGGGACAGAGAGACCAGGGACTTGACAGGGAACGGAAAGGACCTCAGGATGACCCTGGCTCATATCAAGGACCAGAAAGAAGGCTTGCATTCCCTCCAGGAGATTAGGGTCTGTGAGATCCATGAAGACAACAGCACCAGGAGCTCCCAGCATTTCTACTACGATGGGGAGCTCTTCCTCTCCCAAAACCTGGAGACTGAGGAATGGACAATGCCCCAGTCCTCCAGAGCTCAGACCTTGGCCATGAACGTCAGGAATTTCTTGAAGGAAGATGCCATGAAGACCAAGACACACTATCACGCTATGCATGCAGACTGCCTGCAGGAACTACGGCGATATCTAAAATCCGGCGTAGTCCTGAGGAGAACAGTGCCCCCCATGGTGAATGTCACCCGCAGCGAGGCCTCAGAGGGCAACATTACCGTGACATGCAGGGCTTCTGGCTTCTATCCCTGGAATATCACACTGAGCTGGCGTCAGGATGGGGTATCTTTGAGCCACGACACCCAGCAGTGGGGGGATGTCCTGCCTGATGGGAATGGAACCTACCAGACCTGGGTGGCCACCAGGATTTGCCAAGGAGAGGAGCAGAGGTTCACCTGCTACATGGAACACAGCGGGAATCACAGCACTCACCCTGTGCCCTCTGGGAAAGTGCTGGTGCTTCAGAGTCATTGGCAGACATTCCATGTTTCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGCTGCTATTTTTGTTATTATTATTTTCTACGTCTGTTGTTGTAAGAAGAAAACATCAGCTGCAGAGGGTCCAGAGCTCGTGAGCCTGCAGGTCCTGGATCAACACCCAGTTGGGACGAGTGACCACAGGGATGCCACACAGCTCGGATTTCAGCCTCTGATGTCAGATCTTGGGTCCACTGGCTCCACTGAGGGCGCCTAG(SEQ ID NO.:1)

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. The primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein, and can be synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The invention also relates to a vector comprising the polynucleotide of the invention, as well as a genetically engineered host cell with the vector or protein coding sequence of the invention, and a method for expressing the fusion protein of the invention on the NK cells by recombinant techniques.

NK cells expressing the fusion protein of the present invention can be obtained by using the polynucleotide sequence of the present invention by a conventional recombinant DNA technique. Generally comprising the steps of: transducing the first expression cassette and/or the second expression cassette according to the invention into an NK cell, thereby obtaining said NK cell.

Methods well known to those skilled in the art can be used to construct expression vectors containing the DNA sequences encoding the fusion proteins of the invention and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: bacterial cells of the genera escherichia coli, bacillus subtilis, streptomyces; fungal cells such as pichia, saccharomyces cerevisiae cells; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, NS0, COS7, or 293 cells. In a preferred embodiment of the invention, the antigen presenting cell is selected as a host cell.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the protein encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The protein in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If desired, the proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Carrier

The present invention also provides vectors comprising the polynucleotides of the invention. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer, since they allow long-term, stable integration of the transgene and its propagation in daughter cells. Lentiviral vectors have advantages over vectors derived from oncogenic retroviruses such as murine leukemia virus, in that they can transduce non-proliferating cells such as hepatocytes. They also have the advantage of low immunogenicity.

Briefly summarized, the expression cassettes or nucleic acid sequences of the invention are typically incorporated into expression vectors by operably linking them to a promoter. The vector is suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcriptional and translational terminators, initiation sequences, and promoters that may be used to regulate the expression of the desired nucleic acid sequence.

The expression constructs of the invention may also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols. Methods of gene delivery are known in the art. See, for example, U.S. Pat. nos. 5,399,346, 5,580,859, 5,589,466, which are incorporated herein by reference in their entirety. In another embodiment, the invention provides a gene therapy vector.

The expression cassette or nucleic acid sequence can be cloned into many types of vectors. For example, the expression cassette or nucleic acid sequence can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Specific vectors of interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

Further, the expression vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold spring Harbor Laboratory, New York) and other virology and Molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, and lentiviruses. Generally, suitable vectors comprise an origin of replication, a promoter sequence, a convenient restriction enzyme site, and one or more selectable markers that function in at least one organism (e.g., WO 01/96584; WO 01/29058; and U.S. Pat. No. 6,326,193).

Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject cells in vivo or ex vivo. Many retroviral systems are known in the art.

Additional promoter elements, such as enhancers, may regulate the frequency of transcription initiation. Typically, these are located in the 30-110bp region upstream of the start site, although many promoters have recently been shown to also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible so that promoter function is maintained when the elements are inverted or moved relative to one another. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased by 50bp apart, and activity begins to decline. Depending on the promoter, it appears that the individual elements may function cooperatively or independently to initiate transcription.

Another example of a suitable promoter is elongation growth factor-1 α (EF-1 α). however, other constitutive promoter sequences can also be used, including but not limited to simian virus 40(SV40) early promoter, mouse mammary carcinoma virus (MMTV), Human Immunodeficiency Virus (HIV) Long Terminal Repeat (LTR) promoter, MoLV promoter, avian leukemia virus promoter, Epstein-Barr (Epstein-Barr) virus immediate early promoter, Russian flesh promoter, and human gene promoters, such as but not limited to actin promoter, myosin promoter, heme promoter, and creatine kinase promoter.

The expression vector introduced into the cells may also contain either or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a population of cells sought to be transfected or infected by the viral vector. In other aspects, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in a host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

A suitable reporter gene can include genes encoding luciferase, β -galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein genes (e.g., Ui-Tei et al, 2000FEBSletters479: 79-82). suitable expression systems are well known and can be prepared using known techniques or obtained commercially.

Methods for introducing and expressing genes into cells are known in the art. In the context of expression vectors, the vector can be readily introduced into a host cell, e.g., a mammalian (e.g., human T cell), bacterial, yeast, or insect cell, by any method known in the art. For example, the expression vector may be transferred into a host cell by physical, chemical or biological means.

Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells comprising vectors and/or exogenous nucleic acids are well known in the art. See, e.g., Sambrook et al (2001, Molecular Cloning: A Laboratory Manual, Cold spring harbor Laboratory, New York). A preferred method for introducing the polynucleotide into a host cell is calcium phosphate transfection.

Biological methods for introducing polynucleotides into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human, cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, and the like. See, for example, U.S. patent nos. 5,350,674 and 5,585,362.

Chemical means of introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Exemplary colloidal systems for use as delivery vehicles in vitro and in vivo are liposomes (e.g., artificial membrane vesicles).

In the case of non-viral delivery systems, an exemplary delivery vehicle is a liposome. Lipid formulations are contemplated for use to introduce nucleic acids into host cells (ex vivo or in vivo). In another aspect, the nucleic acid can be associated with a lipid. The nucleic acid associated with the lipid may be encapsulated in the aqueous interior of the liposome, dispersed within the lipid bilayer of the liposome, attached to the liposome via a linker molecule associated with both the liposome and the oligonucleotide, entrapped in the liposome, complexed with the liposome, dispersed in a solution comprising the lipid, mixed with the lipid, associated with the lipid, contained as a suspension in the lipid, contained in or complexed with a micelle, or otherwise associated with the lipid. The lipid, lipid/DNA or lipid/expression vector associated with the composition is not limited to any particular structure in solution. For example, they may be present in bilayer structures, either as micelles or with a "collapsed" structure. They may also simply be dispersed in a solution, possibly forming aggregates that are not uniform in size or shape. Lipids are fatty substances, which may be naturally occurring or synthetic lipids. For example, lipids include fatty droplets that occur naturally in the cytoplasm as well as such compounds that contain long-chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

Construction and culture method

In order to overcome the defects of the prior art, the invention provides an in vitro construction method of an artificial antigen presenting cell for efficiently amplifying NK (natural killer), which solves the problem that a target gene is difficult to achieve to reach 1:1, while simplifying the operation flow and greatly reducing the time and labor cost.

In a preferred embodiment, the method is as described in the eighth aspect of the invention.

The present invention also provides a culture method for efficiently amplifying NK cells, which is the seventh aspect of the present invention.

In one embodiment, the present invention provides a method for efficiently preparing NK cells, comprising the steps of:

1) transfecting the series gene IL-15-IL-21-MICA to K562 cells by using a lentivirus transfection system, carrying out gene expression screening, amplifying and irradiating the cells successfully expressed by the genes, wherein the irradiated K562 cells are used as feeder cells for preparing NK cells when the irradiation dose is 200 Gy.;

2) PBMCs isolated from peripheral blood were resuspended in culture medium and mixed with the above modified irradiated K562 in a ratio of 1:1, and IL-2 was added to the culture medium at a final concentration of 1000IU/mL, and the culture was performed as day 0.

3) On day 7, secondary stimulation was performed with the addition of inactivated K562 cells again;

4) the expansion culture was continued until day 14, and the cells were harvested to complete the preparation of NK cells.

Preferably, the nucleotide sequence of the tandem gene Il-15-IL-21-MICA in the step 1) of the invention is: 1 in SEQ ID no.

And the irradiation dose of the K562 cells screened in the step 1) is 200Gy.

And the ratio of K562 to PBMC after irradiation in the step 2) is 1: 1.

and the final concentration of IL-2 in the step 2) is 1000 IU/mL.

And the addition amount of K562 in the step 3) is 1-4 times of the number of original PBMCs.

Compared with the prior art, the invention has the beneficial results that:

the fusion protein constructed by the invention contains IL-15, IL-21 and MICA protein, and the cells expressing the fusion protein can well induce the proliferation, differentiation and activation of NK cells, and the prepared NK cells have the advantages of high quantity, high purity and strong killing activity.

In addition, the invention expresses the genes in series, and realizes that the expression ratio of 1:1, simplifies the operation process and greatly reduces the time and labor cost, and only needs one transfection and one screening. The invention optimizes the construction method for the NK cell artificial antigen presenting cell, and lays a foundation for the future application of the NK cell in tumor treatment, prevention and the like.

The technical scheme of the invention has the following beneficial effects:

1. the fusion protein constructed by the invention contains IL-15, IL-21 and MICA protein, and cells expressing the fusion protein can well induce the proliferation, differentiation and activation of NK cells, and the prepared NK cells have the advantages of large quantity, high purity, strong killing activity, simple later separation and purification and good quality stability.

2. The invention expresses the genes in series, realizes the expression of the genes with the sequence number of 1:1, simplifies the operation process and greatly reduces the time and labor cost. The preparation method has the advantages of simple process, low cost and high yield, and is suitable for large-scale production.

The invention is further illustrated with reference to specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring Harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Example 1

1. The feeder cells were constructed as follows:

(1) vector construction

The gene synthesized tandem gene Il-15-IL-21-MICA nucleotide fragment (SEQ ID NO.:1) was ligated into pCDH-CMV-MCS-EF1-Puro vector (shown in FIG. 1) by enzymatic transformation. Transforming Stbl3 colibacillus strain with the vector, screening ampicillin to obtain positive clone, extracting plasmid, and enzyme-cutting to identify clone to obtain target vector.

(2) Lentiviral preparation

A lentiviral packaging protocol based on Lipofectamine2000 transfection reagent and the four plasmid system pLP1, pLP2, pLP/VSVG, pLVX-shRNA, 293FT (human embryonic kidney cell) cells of P10-P12 were prepared for lentiviral packaging using the instant transfection method, with pLP1, pLP2, pLP/VSVG molar ratio of 1:2:1, with four plasmid doses of about 20ug, and each plasmid concentration >0.5 ug/ul. Transfection was performed using 10cm cell culture plates with 12ml transfection medium and 40ul Lipofectamine2000, and plasmid packaging mixed solution preparation: pLP1(4.62ug), pLP2(4.35ug), pLP/VSVG (3.03 ug). After 6 hours of transfection and 48 or 72 hours of culture, lentiviral particles were concentrated and purified from the virus-containing supernatant using a 20% sucrose cushion ultracentrifugation method. The ultracentrifugation conditions were: 130000g, 2h, split frozen and stored in a refrigerator of 80 degrees below zero.

(3) Preparation of IL-15-IL-21-MICA-K562 cells

The density of K562 cells was adjusted to 1X 105 cells/ml, and the virus concentrate and polybrene 8ug/ml were added at a volume ratio (virus concentrate: medium: 1: 5-10). After 24 hours, the cells were centrifuged and K562 cells were cultured using normal medium and flow sorted after 72 hours. The obtained positive cells were subjected to scale-up culture. After culturing, carrying out flow identification, identifying the expression of target genes, and carrying out cell irradiation on the cells after the enlarged culture, wherein the irradiation dose is 200Gy. And (5) performing split charging and cryopreservation after irradiation.

NK cell culture

(1) PBMC isolation and autologous serum preparation

PBMC in human blood were isolated using Ficoll and the PBMC concentration was adjusted to about 1X10 using X-VIVO15 medium⁶one/mL. Simultaneously inactivating the separated plasma at 56 deg.C for 30 min. The supernatant was then centrifuged and stored at 4 ℃ until use.

(2) NK cell activation culture

The prepared PBMC (4.4X 10)⁷) Inoculating the cells into a T75 culture bottle according to the density of 1x106, adding the uniformly mixed cell suspension into the culture bottle, and adding the pretreated mIL-15-IL-21-MICA-K562 cells and 5% of autologous plasma. Put in CO₂Culturing in an incubator. On day 7 of culture, IL-15-IL-21-MICA-K562 cells were supplemented and the fluid was replenished.

During the NK cell culture, the cell status was observed daily, and fluid replacement was generally performed every other day, and X-VIVO15 medium to which IL-2 had been added was supplemented to a final IL-2 concentration of 1000 IU/mL. Maintain the cell concentration at 1X10⁶. After 14 days of culture, the collected cells were NK cells.

Example 2

For better illustration, experimental and control groups were provided in the examples. The control group used K562 which was not genetically modified, and the other culture conditions and treatment conditions were the same. The two groups of cells were observed and examined.

The detection results are as follows:

1. the cells of the experimental and control groups were counted on days 0, 14, and 21 of culture. Meanwhile, the cells cultured in the experimental group and the control group are subjected to cellular immunophenotyping analysis and detection at the 14 th day and the 21 th day of cell culture. The flow antibodies of CD3 and CD56 were incubated with PBS-washed cells of the experimental group and the control group under the following conditions: 4 ℃ for 30 min. Washing was then performed 2 times using PBS. And (4) performing on-machine detection on the treated cells. The results are shown in table 1 and fig. 2: the cell expansion multiple of the experimental group is far greater than that of the control group, and the total number of the cells of the experimental group reaches 2.52 multiplied by 10 after 14 days of culture⁹One (see table 1), the total number of cells expanded 60-fold; at day 18 of culture, the total cell count of the experimental group reached 3.7X 10⁹One (see table 1), the total number of cells was 84-fold expanded. The results show that: by using the method in example 1, the obtained NK cells are large in number and rapid in proliferation, and can meet clinical requirements.

TABLE 1 comparison of immunophenotyping of NK cells at different stages of induced differentiation

2. To examine the purity of the cells, the results of the cell assay showed: the NK purity at day 14, 18 in the experimental group was 80.69%, 84.66%, while the NK purity at the corresponding time in the control group was 44.22%, 48.20% (see Table 1). The results show that the NK purity of the experimental group is much higher than that of the control group.

3. In order to further detect the killing activity of NK cultured by the invention, the NK cell killing experiments of an experimental group and a control group are carried out, and the killing activity of the NK cells on K562 is detected. The concentration of K562 cells was adjusted to 1X10⁴Then, plating was performed, and 100. mu.L of each well was added to a 96-well plate. Then, effector cells, i.e., NK cells cultured on day 14, were added at a ratio of 5:1 of effector cells to target cells. Then, a control group is arranged in the laboratory, and the control group comprises 2 groups: one group was treated with target cells only and the other group with effector cells only. After the effector cells were added, the 96-well plate was placed at 37 ℃ in 5% CO₂In the incubatorThe culture was carried out, and after 12 hours of culture, CCK8 was added. Then placing the mixture into an incubator again for culture, placing the mixture into an enzyme-labeling instrument after culturing for 2 hours, and measuring the absorbance of the mixture at 450nm and 600 nm. Wherein 600nm is the reference wavelength. And (5) detecting the absorbance. Then NK killing activity ═ 1- (Experimental OD-Effector cell control OD)/target cell control OD]X 100%. And (3) displaying a detection result: the killing rate of K562 by NK cells of the control and experimental groups was 70.32% and 89.71%, respectively (see fig. 3). The result shows that the NK cells cultured by the invention have higher killing activity.

The artificial antigen presenting cell prepared by the invention solves the problem that the target gene is difficult to achieve to reach 1:1, while still maintaining the biological activity of each element in the fusion protein, the biological activity of each element is not interfered with each other, and the operation process is simplified and the time and labor cost is greatly reduced. The NK cells cultured by the artificial antigen presenting cells prepared by the method have high amplification times and high purity, and have high killing activity on tumor cells. Meets the requirements of large quantity and high purity of NK cells clinically.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Shanghai Shang Tai Biotechnology Ltd

<120> artificial antigen presenting cell for efficiently amplifying NK and construction method thereof

<130>P2019-0108

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>1989

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atggggctgg gcccggtctt cctgcttctg gctggcatct tcccttttgc acctccggga 60

gctgctgctg gcagcggcgg cagcggcggc agcggcaact gggtgaatgt aataagtgat 120

ttgaaaaaaa ttgaagatct tattcaatct atgcatattg atgctacttt atatacggaa 180

agtgatgttc accccagttg caaagtaaca gcaatgaagt gctttctctt ggagttacaa 240

gttatttcac ttgagtccgg agatgcaagt attcatgata cagtagaaaa tctgatcatc 300

ctagcaaaca acagtttgtc ttctaatggg aatgtaacag aatctggatg caaagaatgt 360

gaggaactgg aggaaaaaaa tattaaagaa tttttgcaga gttttgtaca tattgtccaa 420

atgttcatca acacttctgg cagcggcggc agcggcggca gcggccaagg tcaagatcgc 480

cacatgatta gaatgcgtca acttatagat attgttgatc agctgaaaaa ttatgtgaat 540

gacttggtcc ctgaatttct gccagctcca gaagatgtag agacaaactg tgagtggtca 600

gctttttcct gttttcagaa ggcccaacta aagtcagcaa atacaggaaa caatgaaagg 660

ataatcaatg tatcaattaa aaagctgaag aggaaaccac cttccacaaa tgcagggaga 720

agacagaaac acagactaac atgcccttca tgtgattctt atgagaaaaa accacccaaa 780

gaattcctag aaagattcaa atcacttctc caaaagatga ttcatcagca tctgtcctct 840

agaacacacg gaagtgaaga ttccggcagc ggcggcagcg gcggcagcgg cgagccccac 900

agtcttcgtt ataacctcac ggtgctgtcc ggggatggat ctgtgcagtc agggtttctc 960

gctgaggtac atctggatgg tcagcccttc ctgcgctgtg acaggcagaa atgcagggca 1020

aagccccagg gacagtgggc agaagatgtc ctgggaaata agacatggga cagagagacc 1080

agggacttga cagggaacgg aaaggacctc aggatgaccc tggctcatat caaggaccag 1140

aaagaaggct tgcattccct ccaggagatt agggtctgtg agatccatga agacaacagc 1200

accaggagct cccagcattt ctactacgat ggggagctct tcctctccca aaacctggag 1260

actgaggaat ggacaatgcc ccagtcctcc agagctcaga ccttggccat gaacgtcagg 1320

aatttcttga aggaagatgc catgaagacc aagacacact atcacgctat gcatgcagac 1380

tgcctgcagg aactacggcg atatctaaaa tccggcgtag tcctgaggag aacagtgccc 1440

cccatggtga atgtcacccg cagcgaggcc tcagagggca acattaccgt gacatgcagg 1500

gcttctggct tctatccctg gaatatcaca ctgagctggc gtcaggatgg ggtatctttg 1560

agccacgaca cccagcagtg gggggatgtc ctgcctgatg ggaatggaac ctaccagacc 1620

tgggtggcca ccaggatttg ccaaggagag gagcagaggt tcacctgcta catggaacac 1680

agcgggaatc acagcactca ccctgtgccc tctgggaaag tgctggtgct tcagagtcat 1740

tggcagacat tccatgtttc tgctgttgct gctgctgctg ctgctgctgc tgctattttt 1800

gttattatta ttttctacgt ctgttgttgt aagaagaaaa catcagctgc agagggtcca 1860

gagctcgtga gcctgcaggt cctggatcaa cacccagttg ggacgagtga ccacagggat 1920

gccacacagc tcggatttca gcctctgatg tcagatcttg ggtccactgg ctccactgag 1980

ggcgcctag 1989

<210>2

<211>662

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>2

Met Gly Leu Gly Pro Val Phe Leu Leu Leu Ala Gly Ile Phe Pro Phe

1 5 10 15

Ala Pro Pro Gly Ala Ala Ala Gly Ser Gly Gly Ser Gly Gly Ser Gly

20 25 30

Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile

35 40 45

Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His

50 55 60

Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln

65 70 75 80

Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu

85 90 95

Asn Leu Ile Ile Leu Ala Asn Asn Ser Leu Ser Ser Asn Gly Asn Val

100 105 110

Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile

115 120 125

Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn

130 135 140

Thr Ser Gly Ser Gly Gly Ser Gly Gly Ser Gly Gln Gly Gln Asp Arg

145 150 155 160

His Met Ile Arg Met Arg Gln Leu Ile Asp Ile Val Asp Gln Leu Lys

165 170 175

Asn Tyr Val Asn Asp Leu Val Pro Glu Phe Leu Pro Ala Pro Glu Asp

180 185 190

Val Glu Thr Asn Cys Glu Trp Ser Ala Phe Ser Cys Phe Gln Lys Ala

195 200 205

Gln Leu Lys Ser Ala Asn Thr Gly Asn Asn Glu Arg Ile Ile Asn Val

210 215 220

Ser Ile Lys Lys Leu Lys Arg Lys Pro Pro Ser Thr Asn Ala Gly Arg

225 230 235 240

Arg Gln Lys His Arg Leu Thr Cys Pro Ser Cys Asp Ser Tyr Glu Lys

245 250 255

Lys Pro Pro Lys Glu Phe Leu Glu Arg Phe Lys Ser Leu Leu Gln Lys

260 265 270

Met Ile His Gln His Leu Ser Ser Arg Thr His Gly Ser Glu Asp Ser

275 280 285

Gly Ser Gly Gly Ser Gly Gly Ser Gly Glu Pro His Ser Leu Arg Tyr

290 295 300

Asn Leu Thr Val Leu Ser Gly Asp Gly Ser Val Gln Ser Gly Phe Leu

305 310 315 320

Ala Glu Val His Leu Asp Gly Gln Pro Phe Leu Arg Cys Asp Arg Gln

325 330 335

Lys Cys Arg Ala Lys Pro Gln Gly Gln Trp Ala Glu Asp Val Leu Gly

340 345 350

Asn Lys Thr Trp Asp Arg Glu Thr Arg Asp Leu Thr Gly Asn Gly Lys

355 360 365

Asp Leu Arg Met Thr Leu Ala His Ile Lys Asp Gln Lys Glu Gly Leu

370 375 380

His Ser Leu Gln Glu Ile Arg Val Cys Glu Ile His Glu Asp Asn Ser

385 390 395 400

Thr Arg Ser Ser Gln His Phe Tyr Tyr Asp Gly Glu Leu Phe Leu Ser

405 410 415

Gln Asn Leu Glu Thr Glu Glu Trp Thr Met Pro Gln Ser Ser Arg Ala

420425 430

Gln Thr Leu Ala Met Asn Val Arg Asn Phe Leu Lys Glu Asp Ala Met

435 440 445

Lys Thr Lys Thr His Tyr His Ala Met His Ala Asp Cys Leu Gln Glu

450 455 460

Leu Arg Arg Tyr Leu Lys Ser Gly Val Val Leu Arg Arg Thr Val Pro

465 470 475 480

Pro Met Val Asn Val Thr Arg Ser Glu Ala Ser Glu Gly Asn Ile Thr

485 490 495

Val Thr Cys Arg Ala Ser Gly Phe Tyr Pro Trp Asn Ile Thr Leu Ser

500 505 510

Trp Arg Gln Asp Gly Val Ser Leu Ser His Asp Thr Gln Gln Trp Gly

515 520 525

Asp Val Leu Pro Asp Gly Asn Gly Thr Tyr Gln Thr Trp Val Ala Thr

530 535 540

Arg Ile Cys Gln Gly Glu Glu Gln Arg Phe Thr Cys Tyr Met Glu His

545 550 555 560

Ser Gly Asn His Ser Thr His Pro Val Pro Ser Gly Lys Val Leu Val

565 570 575

Leu Gln Ser His Trp Gln Thr Phe His Val Ser Ala Val Ala Ala Ala

580585 590

Ala Ala Ala Ala Ala Ala Ile Phe Val Ile Ile Ile Phe Tyr Val Cys

595 600 605

Cys Cys Lys Lys Lys Thr Ser Ala Ala Glu Gly Pro Glu Leu Val Ser

610 615 620

Leu Gln Val Leu Asp Gln His Pro Val Gly Thr Ser Asp His Arg Asp

625 630 635 640

Ala Thr Gln Leu Gly Phe Gln Pro Leu Met Ser Asp Leu Gly Ser Thr

645 650 655

Gly Ser Thr Glu Gly Ala

660

<210>3

<211>9

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>3

Gly Ser Gly Gly Ser Gly Gly Ser Gly

1 5

<210>4

<211>5

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>4

Gly Gly Gly Gly Ser

1 5

Claims (11)

1. A fusion protein is characterized in that the amino acid sequence of the fusion protein is shown as SEQ ID NO. 2.

2. A polynucleotide encoding the fusion protein of claim 1.

3. The polynucleotide of claim 2, wherein the polynucleotide has the sequence shown in SEQ ID No. 1.

4. A vector comprising the polynucleotide of claim 2.

5. A host cell expressing the fusion protein of claim 1; and/or

The host cell genome having integrated therein an exogenous polynucleotide of claim 2; and/or

The host cell comprising the vector of claim 4.

6. An artificial antigen presenting cell expressing the fusion protein of claim 1.

7. Use of the fusion protein of claim 1, the polynucleotide of claim 2, the vector of claim 4, or the artificial antigen presenting cell of claim 6, for (a) culturing NK cells; and/or (b) preparing a formulation for culturing NK cells.

8. A method of culture comprising the steps of:

(1) providing an NK cell or PBMC cell to be cultured; and

(2) contacting and culturing the NK cells or PBMC cells with the fusion protein of claim 1, or the host cell of claim 5, or the artificial antigen presenting cell of claim 6 in a culture medium to obtain cultured NK cells or PBMC cells.

9. The method of claim 8, wherein the host cell or artificial antigen presenting cell is an irradiated cell.

10. A formulation, comprising: the fusion protein of claim 1, the polynucleotide of claim 2, the vector of claim 4, or the artificial antigen presenting cell of claim 6, and a pharmaceutically acceptable carrier or excipient.

11. A method of making the fusion protein of claim 1, comprising the steps of:

culturing the host cell of claim 5 under conditions suitable for expression, thereby expressing the fusion protein of claim 1; and isolating the fusion protein.

Images