KR20230041158A - Primer set for discriminating cucumber skin color and use thereof - Google Patents

Abstract

The present invention relates to a primer set for determining the green and white skin color of cucumber and a method for determining the skin color of cucumber using the same. By using the primer set of the present invention, the cucumbers having the green and white skin color can be identified in seeds and in the early stages of growth, and accordingly, the primer set can contribute to the development of molecular breeding of new varieties of cucumbers tailored to the taste of consumers.

Description

Primer set for discriminating cucumber skin color and its use {Primer set for discriminating cucumber skin color and use thereof}

The present invention relates to a primer set for determining the green and white skin color of cucumber ( Cucumis sativus ) and a method for determining the skin color of cucumber using the same.

Cucumber ( Cucumis sativus ) is a horticultural crop cultivated all over the world, and a large amount is produced in Northeast Asia including Korea and China. Cucumber cultivation is also actively carried out in Korea, and cultivation is increasing as it shows high profits per unit area among domestic facility horticultural crops. Since cucumbers have very diverse characteristics depending on the variety, a lot of investment is being made to develop a breeding line that combines the advantages of various varieties. For the production of eggplant cucumbers, it is necessary to rapidly breed cucumbers with desired traits.

However, until now, there has been no research or prior art on molecular markers that can discriminate between white and green skins using mutations related to the skin color of cucumbers.

Therefore, it is necessary to develop a molecular marker that can discriminate the pericarp color of cucumber at an early stage of growth and contribute to molecular breeding of cucumber.

Republic of Korea Patent Publication No. 10-2014-0001809

The problem to be solved by the present invention is to provide a primer set for determining the pericarp color of cucumber.

Another object of the present invention is to provide a kit or composition comprising a set of primers.

Another object of the present invention is to provide a method for determining the pericarp color of a cucumber, including a primer set, kit or composition.

One embodiment of the present invention is a primer set for determining pericarp color of cucumber, including a first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4.

The primer set may be a primer set for amplifying a single nucleotide polymorphism (SNP).

The first primer set amplifies the gene encoding the pyruvate kinase protein represented by SEQ ID NO: 5 (JEF_Chr3CG52930; pyruvate kinase protein), and the second primer set amplifies the gene encoding the protein containing the QWFR motif represented by SEQ ID NO: 6 (JEF_Chr3CG53640 ; QWRF motif-containing protein7) can be amplified.

In addition, the present invention provides a kit for determining the pericarp color of cucumber, including the primer set.

In addition, the present invention provides a composition for determining the pericarp color of cucumber, including the primer set.

In another aspect, the present invention isolates genomic DNA from cucumber samples; Polymerase Chain Reaction (Polymerase Chain Reaction) using the isolated genomic DNA as a template and using a first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 , PCR); treating the amplification product of the PCR with a restriction enzyme; and determining the skin color of cucumber by measuring the size of the amplification product treated with the restriction enzyme.

The product amplified using the first primer set may be digested with restriction enzyme DdeI, and judged as a green peel when the size of the cut band is 347 to 357 bp, and a white peel when the size is 325 to 332 bp.

The product amplified using the second primer set is digested with restriction enzyme Bpu10I, and judged as a green peel when the size of the cut band is 133 to 143 bp, and a white peel when the size of the cut band is 158 to 168 bp.

By using the primer set of the present invention, cucumbers having green or white skin can be identified at the seed and early stage of growth, thereby contributing to the development of molecular breeding of new cucumber varieties tailored to the taste of consumers.

Figure 1 shows the regions where pericarp color-linked mutations exist on the chromosome of the cucumber genome.
Figure 2 shows the verification results of the MK1 primer and MK2 primer molecular markers.
Figure 3 shows the results of applying the MK1 primer molecular marker to 38 genomic DNA.
Figure 4 shows the results of applying the MK2 primer molecular marker to 38 genomic DNA.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein and the experimental methods described below are those well known and commonly used in the art.

The present invention relates to a primer set for determining pericarp color of cucumber, comprising a first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4.

In one embodiment of the present invention, white pericarp line (P1) with white pericarp color, pericarp line (P2) with green pericarp color, white pericarp plants and green pericarp plants among F2 plants obtained by crossing the white pericarp lines and the pericarp lines Genomes was analyzed. A molecular marker for distinguishing cucumber skin color was developed by searching for mutations specific to the white and green skin phenotypes and selecting mutations that lead to changes in the protein sequence of the gene.

The term 'molecular marker' of the present invention refers to a marker molecule that can be used as a marker for a specific trait by using differences in molecules such as DNA nucleotide sequences. Since it indicates the physical location on the chromosome and indicates a specific phenotype, it can be used as a genetic marker that can be used when introducing a specific trait into other crop varieties.

The molecular marker of the present invention may include a first primer set composed of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set composed of the nucleotide sequences of SEQ ID NOs: 3 and 4, but is not limited thereto.

The primer set can be used as a molecular marker for determining the pericarp color of cucumbers to distinguish between white skin varieties and green skin varieties.

The primer set may be a primer set for amplifying a single nucleotide polymorphism (SNP).

The term 'Single Nucleotide Polymorphism (SNP)' of the present invention refers to the appearance of different mutations in one part of a DNA base sequence depending on the individual, usually 1 mutation per 1000 bases, which occurs during DNA replication. It results from base changes due to failure to repair errors and biochemical base modifications. SNPs can be analyzed and confirmed using Next Generation Sequencing (NGS).

The first primer set amplifies the sequence around the SNP inside the gene (JEF_Chr3CG52930; pyruvate kinase protein) encoding the pyruvate kinase protein represented by SEQ ID NO: 5, and the second primer set contains the QWFR motif represented by SEQ ID NO: 6 It may be to amplify the sequence around the SNP inside the gene encoding the protein (JEF_Chr3CG53640; QWRF motif-containing protein7).

The first primer set may consist of a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2, and the second primer set may consist of a forward primer of SEQ ID NO: 3 and a reverse primer of SEQ ID NO: 4, but are limited thereto. it is not going to be

In another aspect, the present invention relates to a kit for determining pericarp color of cucumber, including the primer set.

The kit may be a PCR kit, a microarray, or a kit for Fluidigm SNP analysis. The PCR kit may include a primer set capable of detecting the single nucleotide polymorphism. In addition to the primer set, reagents for performing an amplification reaction may be included, and specifically, a DNA polymerase, a dNTP mixture, and a PCR buffer solution may be further included. The DNA polymerase may be, for example, a klenow fragment of E.coli DNA polymerase I, a thermostable DNA polymerase or a bacteriophage T7 polymerase. The PCR buffer solution may contain KCl, Tris-HCl and MgCl ₂ . The microarray may be one in which polynucleotides capable of detecting the single nucleotide polymorphism, for example, probes, are immobilized at high density on distinct regions of a substrate surface. The Fluidigm SNP analysis kit may include primers for the Fluidigm system, and may specifically include STA, LSP, and ASP 1&2 primers. The Fluidigm SNP analysis kit may further include a DNA polymerase, a dNTP mixture, and a PCR buffer solution. DNA polymerase and PCR buffer solution can be understood by referring to the contents described in the PCR kit.

The kit may further include a user guide describing optimal reaction performance conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and a description on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

In addition, the present invention relates to a composition for determining pericarp color of cucumber, including the primer set.

In another aspect of the present invention, isolating genomic DNA from cucumber samples; Polymerase Chain Reaction (Polymerase Chain Reaction) using the isolated genomic DNA as a template and using a first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 , PCR); treating the amplification product of the PCR with a restriction enzyme; and determining the skin color of cucumber by measuring the size of the amplification product treated with the restriction enzyme.

The cucumber sample may be one or more tissues selected from the group consisting of seeds, roots, leaves, stems, and fruits of cucumber.

The PCR can be performed using a PCR reaction mixture containing components known in the art as necessary for a PCR reaction or using commercially available cucumbers. The PCR reaction mixture may include genomic DNA extracted from cucumber, the dCAPS primer set of the present invention, an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water. The PCR buffer solution may include Tris-HCl, MgCl ₂ , KCl, etc., but may not be limited thereto.

The amplified target sequence may be labeled with a detectable labeling substance. For example, the label material may be a material that emits fluorescence, phosphorescence, or radioactivity, but may not be limited thereto. The labeling material may be Cy-5 or Cy-3, and when PCR is performed by labeling the 5'-end of the primer with Cy-5 or Cy-3 during amplification of the target sequence, the target sequence is converted into a detectable fluorescent labeling material. can be labeled. In addition, when a radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution during PCR, the radioactive isotope may be incorporated into the amplification product to be radioactively labeled as the amplification product is synthesized. Alternatively, amplification products can be visualized using a silver staining kit (Bioneer, Daejeon, Korea).

Analysis of the amplified DNA product can be performed by a conventional method known in the art, for example, capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorescence measurement. may not be limited thereto. For example, capillary electrophoresis may be performed to detect amplification products, and may be performed using an ABI sequencer, but may not be limited thereto. In addition, gel electrophoresis can be performed, and for gel electrophoresis, agarose gel electrophoresis or acrylamide gel electrophoresis can be used depending on the size of the amplification product. For example, 6% acrylamide gel electrophoresis can be used. For example, 1 to 5%, preferably 3.5% agarose gel electrophoresis can be used.

In addition, in the fluorescence measurement method, when PCR is performed by labeling Cy-5 or Cy-3 at the 5'-end of the primer, the target sequence is labeled with a detectable fluorescent labeling material, and the labeled fluorescence is measured using a fluorescence meter. can do. In addition, the radioactive measurement method is to label the amplification product by adding a radioactive isotope such as ³² P or ³⁵ S to the PCR reaction solution during PCR, and then use a radioactive measuring instrument, such as a Geiger counter or liquid scintillation Radioactivity can be measured using a liquid scintillation counter. When the amplified DNA product is analyzed using gel electrophoresis, the amplified product is electrophoresed on an agarose gel or acrylamide gel, and bands can be identified by ethidium bromide (EtBr), silver staining, etc. there is.

The product amplified using the first primer set is digested with restriction enzyme DdeI, and when the size of the cut band is 347 to 357 bp, it is judged as a green peel, and when it is 325 to 332 bp, it is judged as a white peel, Preferably, in the case of 352 bp, green rind and 327 bp can be determined as white rind.

If the genotype is heterozygous, two bands of 327 bp and 352 bp appear simultaneously, and considering that the green skin phenotype is dominant and the white skin phenotype is recessive, it can be judged as green skin at this time as well.

The product amplified using the second primer set is cleaved with restriction enzyme Bpu10I, and when the size of the cleaved band is 133 to 143 bp, it is judged as a green rind, and when it is 158 to 168 bp, it is judged as a white rind, Preferably, in the case of 138 bp, green rind and 163 bp can be determined as white rind.

If the genotype is heterozygous, two bands of 138 bp and 163 bp appear simultaneously, and considering that the green skin phenotype is dominant and the white skin phenotype is recessive, it can be judged as green skin at this time as well.

The cucumber pericarp color discrimination method of the present invention is a method of isolating genomic DNA from a cucumber sample, and a DNA extraction kit can be used. A first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 using the isolated DNA as a template Or performing PCR using a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4, but is not limited thereto, and any other suitable method for amplifying and detecting nucleic acid molecules known in the art can be used, , Methods known in the art may be appropriately modified and used by those skilled in the art.

Hereinafter, specific embodiments of the present invention will be described in more detail so that those skilled in the art can easily implement the present invention. However, the present invention may be embodied in many different forms and is not limited to the embodiments described herein.

Example 1: Exploration of variations related to pericarp color of cucumber

Genomic DNA was extracted from leaf samples of cucumbers received from Anseong Farm. The genomes of cucumbers with white skin and cucumbers with green skin were used as parents, and among the F ₂ samples of the parents, 500 ng of each genomic DNA of 16 white skin lines and 20 dadagi lines were downsampled (Pooled). . The parent and downsampled genomic DNA were analyzed using next-generation sequencing (NGS) data.

It was produced with sequencing data of 29Gb to 35Gb, respectively, and genetic mutation information was confirmed by comparing with the reference genome database of cucumber. As a reference genome, the chromosome sequence of the JEF cucumber genome (CucumberJEF.Chr_level.Final_Genome.ragoo.fasta) assembled by the Poster Genome Dabucha project was used. Specifically, the white skin line and the dada line by inputting them into the QTL-seq program (http://genome-e.ibrc.or.jp/home/bioinformaticsteam/mutmap,https://github.com/YuSugihara/QTL-seq) were compared and finally, chromosomal regions with statistically significant differences (p-value<0.05) between white and green skins were searched.

As a result, as shown in Table 1 below, it was confirmed that there was a mutation with a significant difference between white and green skin in one QTL region each on sequences of chromosomes 3 and 5 (FIG. 1).

Chromosome (Chr.) Position Length (Size(bp)) Variant type (SNP/InDel nos.) JEF_Chr3 34100000 - 41679492 7,579,492 11,435 JEF_Chr5 12200000 - 12700000 500,000 743

Figure 1 shows the regions where pericarp color-linked mutations exist on the chromosome of the cucumber genome. Referring to FIG. 1, 12,178 mutations were identified at 7,579,492 bp length of chromosome 3 (34,100,000 - 41,679,492 bp position) and 500,000 bp length of chromosome 5 (12,200,000 - 12,700,000 bp position). Eight mutations that could cause protein sequence changes were finally selected, and two indel and six SNP mutations were confirmed to exist in seven genes. The results are shown in Table 2 below.

Chr Position Gene ID Gene Description Type JEF_Chr3 34626707 JEF_Chr3CG43770 LSi6 [Cucumis sativus var. sativus], aquaporin NIP InDel JEF_Chr3 40443941 JEF_Chr3CG51850 thioredoxin-related transmembrane protein 2 isoform X1 [Cucumis sativus] SNPs JEF_Chr3 40660199 JEF_Chr3CG52290 inactive poly [ADP-ribose] polymerase RCD1 [Cucumis sativus] SNPs JEF_Chr3 41075124 JEF_Chr3CG52880 beta-amyrin 11-oxidase [Cucumis sativus], AIT72036.1 cytochrome P450 [Cucumis sativus] SNPs JEF_Chr3 41075140 JEF_Chr3CG52880 beta-amyrin 11-oxidase [Cucumis sativus], AIT72036.1 cytochrome P450 [Cucumis sativus] SNPs JEF_Chr3 41102542 JEF_Chr3CG52910 hypothetical protein Csa_013022 [Cucumis sativus], PHT; solute carrier family 15 (peptide/histidine transporter) InDel JEF_Chr3 41106529 JEF_Chr3CG52930 pyruvate kinase isozyme G, chloroplastic isoform X1 [Benincasa hispida], pyk; pyruvate kinase [EC:2.7.1.40] SNPs JEF_Chr3 41641571 JEF_Chr3CG53640 QWRF motif-containing protein 7
[Cucumis sativus] SNPs

Example 2: Molecular marker design for pericarp color discrimination of cucumber

Among the 8 mutations in Table 2, the SNP mutation (41,106,529 bp position of chromosome 3) present on the sequence of the gene encoding the pyruvate kinase protein (JEF_Chr3CG52930) and the gene encoding the protein containing the QWFR motif (JEF_Chr3CG53640) present on the sequence A SNP mutation (41,641,571 bp position of chromosome 3) was selected, and using this, two types of dCAPS molecular markers were designed for discrimination of white and green pericarp color, and the first primer set (hereinafter referred to as MK1 primer) and the second primer set ( MK2 primer below) was prepared (Table 3).

marker ID forward primer reverse primer restriction enzyme Type MK1
(First Primer Set) SEQ ID NO: 1 AACCTTGTGGACACTCGATGGACTT SEQ ID No. 2
ATGCGTGTTCCTCTAGTTTGTT DdeI dCAPS MK2
(Second Primer Set) SEQ ID No. 3
ATGGAAGTCTCTGCTCTAACCTAAG SEQ ID No. 4
AAAACTAGGCAGTCAACGAGGT Bpu10I dCAPS

The MK1 primer amplifies the sequence around the SNP inside the gene (JEF_Chr3CG52930; pyruvate kinase protein) encoding the pyruvate kinase protein represented by SEQ ID NO: 5 below, and the gene contains the SNP [c/t] mutation at position 1013 ( Table 4).

SEQ ID No. 5 atggcgacgt ttaatctctc tactggagtt cctctcttga aatctgattc taccagactt 60
gccgatcgcc ttgcttcgtg tagaattgtt tctgatgctt ttggtcttga agtgaagagt 120
ggaaatatgt gtttgcaatc gaaacaaatc ggtttggtta gatgcttgag aatagtggag 180
cagcgggaag ttgcgtccta taatggctct ctggatactg atcaggacgt ttcgaactct 240
acccttgagc ttcagtctaa tgcattccat cgtagcagga cgaagttaac gacaaagtct 300
cgaaggaaaa ctaagatagt atgcacgatt ggcccttcga caagttcacg ggaaatgata 360
tggaaattgg cagagactgg gatgaatgtg gctcgtttaa atatgtcgca tggagaccat 420
tcttcccacc agaaaacaat tgatttggtt aaggaatata acgcccaatt taatgacaaa 480
gttatagcca tcatgcttga tacgaagggt cctgaggttc gaagtggaga tgtacctaaa 540
ccaatcttgc tcaaagaggg acaagaattt aacttcacaa tcaaaagagg agtcagcaca 600
aaagacactg ttagtgtcaa ctacgacgac tttgtaaacg atgtcgaagt tggagatact 660
ttacttgttg atgacaagga ctgggaagat ataaagtttg gggtggataa tcaggttgat 720
ttttatgctg tttcttttgt gaaggatgct agagtggagg atattatcaa aagatgtcgt 780
agcatgcaga aaccagttat tgtggcaaca aacatgctgg aaagcatgat tgatcacccc 840
acaccgacta gagccgaggt ttctgatatt gctattgcag tgcgtgaagg tgctgatgca 900
gtcatgcttt caggagaaac tgctcatggg aaatatccgt tgaaggctgt gaaagtgatg 960
catactgtgg ctttgaggac ggaatctagt ctaccaatta attctactac tc[c/t]aattcca 1020
tcgagtgtcc acaagagcca tatgggagac atgtttgctt tccacgccac cactatggcc 1080
aacaccctta atactcctat cattgttttc acaagaaccg gctccatggc tattctctta 1140
agtcattata ggcccggctc tactatcttt gccttcactg atgacgaaag aattaaacaa 1200
aggctagtgc tttatcatgg ggtcatgcct atctacatgc agttttcaaa tgatgcagaa 1260
gagacgttct ccagagcact cgagtttttg ctggataagg gtcacgtggt agaaggagac 1320
cacgtcacgc ttgtccaaag tggagctcaa ccaatttggc ggaaagaatc cactcaccac 1380
attcaagact cgccggtaaa gaaaaatgaa aactgcgaca ctgagaatgt caaagctgga 1440
catgcttgca gtatccttct accacggttc attgaacagt ccttggcatc aagactgtat 1500
agttcatctc cacttgctgg catcttgacc gttgattttt tagctgcagc aacaatgacc 1560
tggcagaacc ttgagagagg gttgccgctt ggcttgaagt gtctgtacct tgggattcca 1620
caaagaaaca acaccaatgc tgcaaaagct gagccagctg acacccagaa gcccagagcc 1680
cacactcctt catcttcaaa gtaccctaaa atggtgtttg agaagagaga acccaagtta 1740
agcgccaagt aa

The MK2 primer amplifies the sequence around the SNP inside the gene (JEF_Chr3CG53640) encoding the QWFR motif-containing protein represented by SEQ ID NO: 6 below, and the gene contains the SNP [g/a] mutation at position 511 (Table 6) .

SEQ ID No. 6 atggagaaca cacgaatacg ccgaccaaaa acccccgccc ttcctccccc gccgtctccc 60
ggcagcaaaa gccgctcctc ccctgccata accctacccg ataacaactc atgtgccgca 120
aacacaagcc aacgctcaac cattcaccga tcaaaatcag tgacaaagtc aagaaataag 180
aacgacaagg atgaagagaa tttaaacccc ttgaattgta aaaccaaggc aggttttacc 240
aagttcttga agtcctcccc ggcgacttcc ccgtctgcat gggcactgtc acctggccgg 300
tccttgggct ctccccttgt tttgtctccg ctgacggcgg ttgagcacgc ggcgacagat 360
ggacggagag gaaaactagg cagtcaacga ggtggtgcag tgagcggagt tttgaggttt 420
tttaaaccaa agaaagcggc agcgatgatg gaagcagaag agcttcatcg gtttaggatt 480
ttgcagaata ggttgttgca atggaagtat [g/a]ctaacgtta gagcagagac ttccatggct 540
aacgttaaaa cacttgttca ggacagaata ttcagtgtgt ggcttcataa tttgagaatg 600
agaaatcgga tattagaaaa acgaattgaa gttgaaaagt tgagaaagga gatcaagtta 660
tacagaataa tcttccctca agttagtctc ctgaagcaat gggccaagtt agacaaaaga 720
aaccaagaat cagttggcag tttagcctct attctttcaa cattctcact caaactccct 780
ctactccatg gagccaagat tgacacaaag gcttttcaac aagcattaag catggccatg 840
gaggtgatgg tcaaactaga ggcaatgatc accaaacgcg catcccagca actggagaaa 900
acgttgtacg tgctaacgga gcggctaagc atatttaaag aacaggaaga atgcttggaa 960
aagctggagg aggctgtatg ttcggtcatc actttactgg cgaaggagaa tagtattaga 1020
atacaagtca tacaagcaac aaattctacc acgaaggatc atccttttcc tacttgttaa

Example 3: Verification and application of molecular markers for pericarp color discrimination of cucumber

White pericarp line with white pericarp color (P1), Dadagi line with green pericarp color (P2), down-sampling (pooled genomic DNA) of white pericarp plants and green pericarp plants among F ₂ plants obtained by crossing the white pericarp line and the pericarp line Four genomic DNA samples were prepared and PCR was performed using the MK1 and MK2 primers in Table 3.

Specifically, 50ng of genomic DNA was used, and 1x PCR buffer, 0.2 mM dNTP, 1.25 units Taq DNA polymerase, 2 pmole forward primer, and 2 pmole reverse primer were configured and carried out at 94 ° C for 5 minutes. , 30 seconds at 94 ° C, 30 seconds at 60 ° C, 20 seconds at 72 ° C were repeated 37 times, followed by amplification at 72 ° C for 7 minutes.

The amplified PCR product was treated with a restriction enzyme (1.5 to 2.5 units) suitable for the corresponding SNP for about 12 hours, electrophoresis and EtBr staining were performed on a 3.5% agarose gel, and the difference in size of the cleaved band was confirmed by observing under UV light. .

Specifically, the PCR product amplified using the MK1 primer was digested with DdeI restriction enzyme, and the PCR product amplified using MK2 primer was digested with Bpu10I restriction enzyme.

As a result, both of the two primers produced amplification products of a single specific size, and DNA fragments of different sizes were generated between the pericarp colors.

Figure 2 shows the verification results of the MK1 primer and MK2 primer molecular markers. Referring to FIG. 2, the white line (P1), the green line (P2), the white rind plant (FW) of the F ₂ plant and the green rind plant (FG) of the F2 plant are significantly different from the white and green rind color phenotypes after treatment with restriction enzymes. Other band size differences were shown (Table 6).

Gene ID location codon change amino acid change restriction enzyme PCR product size
(bp) After restriction enzyme treatment
green vs white
(bp) JEF_Chr3CG52930 41106529 cCa/cTa P338L Ddel 352 352 vs. 327 JEF_Chr3CG53640 41641571 Gct/Act A171T Bpu10 I 163 138 vs. 163

The size of the product amplified with the MK1 primer was 352 bp, and after treatment with DdeI restriction enzyme, the band of the green skin phenotype was 352 bp and the band of the white skin phenotype was 327 bp. The size of the product amplified with the MK2 primer was 163 bp. By bp, after treatment with Bpu10I restriction enzyme, the green skin phenotype band was 138 bp and the white skin phenotype band was 163 bp.

Since the green skin phenotype is dominant, plants with a heterogeneous green skin color genotype and a white skin color genotype show a green skin color phenotype, but when the product amplified with the MK1 primer is treated with DdeI restriction enzyme, two bands (352 bp, 327 bp) appear, When the product amplified with MK2 primer was treated with Bpu10I restriction enzyme, two bands (163bp, 138bp) were also revealed.

Therefore, it was confirmed that green and white pericarp colors of cucumbers could be distinguished using the MK1 and MK2 primers.

In addition, downsampling (pooled genomic DNA) of white rind plants and green rind plants among F ₂ plants obtained by crossing white skin color (P1), green skin color (P2), and white skin line and dada line. As a result of applying MK1 and MK2 primer molecular markers to a total of 38 samples, DNA fragments of different sizes were generated in white and green pericarp phenotypes.

Figure 3 shows the results of applying MK1 primer molecular markers to 38 genomic DNAs, and Figure 4 shows the results of applying MK2 primer molecular markers to 38 genomic DNAs.

Referring to Figures 3 and 4, the white breeding line (P1), the green breeding line (P2), and 36 F ₂ plants (3 to 38) showed a significantly different band size difference in white and green pericarp phenotypes after restriction enzyme treatment showed up

The presence of two DNA fragments together in the molecular marker results of some of the green pericarp-colored plants is analyzed as a result that can come out as a heterogeneous genotype considering that the green pericarp color is a dominant trait.

Therefore, it was confirmed that white and green pericarp colors could be distinguished by successfully applying the molecular marker MK1 and MK2 primers to the breeding population.

As described above, in the present invention, eight candidate Single Nucleotide Polymorphism (SNP) mutations associated with green and white skin color were identified through next-generation sequencing (NCS) of the cucumber genome. among them Two dCAPS primer sets were designed and verified using the two SNP information, and finally, a molecular marker capable of discriminating green and white skin of cucumber was developed.

Using the primer set for distinguishing cucumber skin color of the present invention, cucumbers having green and white skins can be identified at the seed or early stage of growth, and can be used for molecular breeding of cucumbers having desired traits.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Primer set for discriminating cucumber skin color and use thereof <130> 2021-0242-10-A <160> 6 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> artificial sequence <220> <223> MK1-F <400> 1 aaccttgtgg acactcgatg gactt 25 <210> 2 <211> 22 <212> DNA <213> artificial sequence <220> <223> MK1-R <400> 2 atgcgtgttc ctctagtttg tt 22 <210> 3 <211> 25 <212> DNA <213> artificial sequence <220> <223> MK2-F <400> 3 atggaagtct ctgctctaac ctaag 25 <210> 4 <211> 21 <212> DNA <213> artificial sequence <220> <223> MK2-R <400> 4 aaactaggca gtcaacgagg t 21 <210> 5 <211> 1752 <212> DNA <213> artificial sequence <220> <223> JEF_Chr3CG52930 <400> 5 atggcgacgt ttaatctctc tactggagtt cctctcttga aatctgattc taccagactt 60 gccgatcgcc ttgcttcgtg tagaattgtt tctgatgctt ttggtcttga agtgaagagt 120 ggaaatatgt gtttgcaatc gaaacaaatc ggtttggtta gatgcttgag aatagtggag 180 cagcgggaag ttgcgtccta taatggctct ctggatactg atcaggacgt ttcgaactct 240 acccttgagc ttcagtctaa tgcattccat cgtagcagga cgaagttaac gacaaagtct 300 cgaaggaaaa ctaagatagt atgcacgatt ggcccttcga caagttcacg ggaaatgata 360 tggaaattgg cagagactgg gatgaatgtg gctcgtttaa atatgtcgca tggagaccat 420 tcttcccacc agaaaacaat tgatttggtt aaggaatata acgcccaatt taatgacaaa 480 gttatagcca tcatgcttga tacgaagggt cctgaggttc gaagtggaga tgtacctaaa 540 ccaatcttgc tcaaagaggg acaagaattt aacttcacaa tcaaaagagg agtcagcaca 600 aaagacactg ttagtgtcaa ctacgacgac tttgtaaacg atgtcgaagt tggagatact 660 ttacttgttg atgacaagga ctgggaagat ataaagtttg gggtggataa tcaggttgat 720 ttttatgctg tttcttttgt gaaggatgct agagtggagg atattatcaa aagatgtcgt 780 agcatgcaga aaccagttat tgtggcaaca aacatgctgg aaagcatgat tgatcacccc 840 acaccgacta gagccgaggt ttctgatatt gctattgcag tgcgtgaagg tgctgatgca 900 gtcatgcttt caggagaaac tgctcatggg aaatatccgt tgaaggctgt gaaagtgatg 960 catactgtgg ctttgaggac ggaatctagt ctaccaatta attctactac tcnaattcca 1020 tcgagtgtcc acaagagcca tatgggagac atgtttgctt tccacgccac cactatggcc 1080 aacaccctta atactcctat cattgttttc acaagaaccg gctccatggc tattctctta 1140 agtcattata ggcccggctc tactatcttt gccttcactg atgacgaaag aattaaacaa 1200 aggctagtgc tttatcatgg ggtcatgcct atctacatgc agttttcaaa tgatgcagaa 1260 gagacgttct ccagagcact cgagtttttg ctggataagg gtcacgtggt agaaggagac 1320 cacgtcacgc ttgtccaaag tggagctcaa ccaatttggc ggaaagaatc cactcaccac 1380 attcaagact cgccggtaaa gaaaaatgaa aactgcgaca ctgagaatgt caaagctgga 1440 catgcttgca gtatccttct accacggttc attgaacagt ccttggcatc aagactgtat 1500 agttcatctc cacttgctgg catcttgacc gttgattttt tagctgcagc aacaatgacc 1560 tggcagaacc ttgagagagg gttgccgctt ggcttgaagt gtctgtacct tgggattcca 1620 caaagaaaca acaccaatgc tgcaaaagct gagccagctg acacccagaa gcccagagcc 1680 cacactcctt catcttcaaa gtaccctaaa atggtgtttg agaagagaga acccaagtta 1740 agcgccaagt aa 1752 <210> 6 <211> 1080 <212> DNA <213> artificial sequence <220> <223> JEF_Chr3CG53640 <400> 6 atggagaaca cacgaatacg ccgaccaaaa acccccgccc ttcctccccc gccgtctccc 60 ggcagcaaaa gccgctcctc ccctgccata accctacccg ataacaactc atgtgccgca 120 aacacaagcc aacgctcaac cattcaccga tcaaaatcag tgacaaagtc aagaaataag 180 aacgacaagg atgaagagaa tttaaacccc ttgaattgta aaaccaaggc aggttttacc 240 aagttcttga agtcctcccc ggcgacttcc ccgtctgcat gggcactgtc acctggccgg 300 tccttgggct ctccccttgt tttgtctccg ctgacggcgg ttgagcacgc ggcgacagat 360 ggacggagag gaaaactagg cagtcaacga ggtggtgcag tgagcggagt tttgaggttt 420 tttaaaccaa agaaagcggc agcgatgatg gaagcagaag agcttcatcg gtttaggatt 480 ttgcagaata ggttgttgca atggaagtat nctaacgtta gagcagagac ttccatggct 540 aacgttaaaa cacttgttca ggacagaata ttcagtgtgt ggcttcataa tttgagaatg 600 agaaatcgga tattagaaaa acgaattgaa gttgaaaagt tgagaaagga gatcaagtta 660 tacagaataa tcttccctca agttagtctc ctgaagcaat gggccaagtt agacaaaaga 720 aaccaagaat cagttggcag tttagcctct attctttcaa cattctcact caaactccct 780 ctactccatg gagccaagat tgacacaaag gcttttcaac aagcattaag catggccatg 840 gaggtgatgg tcaaactaga ggcaatgatc accaaacgcg catcccagca actggagaaa 900 acgttgtacg tgctaacgga gcggctaagc atatttaaag aacaggaaga atgcttggaa 960 aagctggagg aggctgtatg ttcggtcatc actttactgg cgaaggagaa tagtattaga 1020 atacaagtca tacaagcaac aaattctacc acgaaggatc atccttttcc tacttgttaa 1080 1080

Claims (8)

Comprising a first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4,
A set of primers for determining the skin color of cucumbers. According to claim 1,
The primer set is a primer set for amplifying a single nucleotide polymorphism (SNP),
A set of primers for determining the skin color of cucumbers. According to claim 1,
The first primer set amplifies the gene (JEF_Chr3CG52930; pyruvate kinase protein) encoding the pyruvate kinase protein represented by SEQ ID NO: 5, and the second primer set amplifies the gene encoding the protein containing the QWFR motif represented by SEQ ID NO: 6 (JEF_Chr3CG53640; QWRF motif-containing protein7) to amplify,
A set of primers for determining the skin color of cucumbers. Comprising the primer set of claims 1 to 3,
A kit for determining the skin color of cucumbers. Comprising the primer set of claims 1 to 3,
Composition for determining pericarp color of cucumber. isolating genomic DNA from cucumber samples;
Polymerase Chain Reaction (Polymerase Chain Reaction) using the isolated genomic DNA as a template and using a first primer set consisting of the nucleotide sequences of SEQ ID NOs: 1 and 2 or a second primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 , PCR);
treating the amplification product of the PCR with a restriction enzyme; and
Including the step of determining the pericarp color of cucumber by measuring the size of the amplification product treated with the restriction enzyme,
A method for determining the skin color of cucumbers. According to claim 6,
The product amplified using the first primer set is digested with restriction enzyme DdeI, and judged as a green peel when the size of the cut band is 347 to 357 bp and a white peel when the size is 325 to 332 bp,
How to determine the skin color of cucumber According to claim 6,
The product amplified using the second primer set is cleaved with restriction enzyme Bpu10I, and when the size of the cleaved band is 133 to 143 bp, it is judged as a green rind and 158 to 168 bp as a white rind,
A method for determining the skin color of cucumbers.

Images