KR20220151090A - Reverse transcriptase polymerase chain reaction for the detection of Middle East respiratory syndrome-related coronavirus and a diagnosing kit for Middle East respiratory syndrome-related coronavirus using the same - Google Patents

Abstract

The present invention relates to: a reverse transcription (RT)-polymerase chain reaction (PCR) primer set for detecting the Middle East respiratory syndrome-related coronavirus (MERS-CoV) capable of diagnosing the MERS-CoV; a positive control gene for a false positive test; a MERS-CoV detection kit including the same; and a detection method thereof. The primer set includes: a primer pair represented by SEQ ID NO: 1 and 7; a primer pair represented by SEQ ID NO: 10 and 12; and a primer pair represented by SEQ ID NO: 15 and 20.

Description

Reverse transcriptase polymerase chain reaction for the detection of Middle East respiratory syndrome-related coronavirus and a diagnosing kit for Middle East respiratory syndrome-related coronavirus using the same}

The present invention is a reverse transcription (RT)-polymerase chain reaction (PCR) for detecting MERS-CoV capable of diagnosing Middle East respiratory syndrome-related coronavirus (MERS-CoV). It relates to a primer set, a positive control gene for false positive assay, a MERS-CoV detection kit including the same, and a detection method.

MERS-CoV is classified as viral group IV positive sense single-stranded RNA viruses, Coronaviridae and Betacoronavirus . It is a zoonosis that can be transmitted by bats and camels. It is mainly infected through the respiratory tract and then proliferates in the bronchi and lungs, causing symptoms or diseases such as high fever, cough, dyspnea, vomiting, diarrhea, and impaired renal function.

Conventional MERS-CoV diagnosis techniques mainly include real-time reverse transcription (RT-quantitative) PCR that amplifies a specific nucleic acid fragment; RT-qPCR], loop-mediated isothermal amplification (LAMP), enzyme immunoassay, general RT-PCR, etc. have been reported. Of these, RT-qPCR is capable of rapid diagnosis, but is relatively expensive and has limitations in subsequent genotyping due to its limited sequencing. LAMP reacts at the same temperature and has excellent field applicability, but a number of unknown false positive reactions have been reported.

On the other hand, enzyme immunoassay, etc., other than specific nucleic acid fragment amplification techniques can be used, but the detection sensitivity is about 100-1,000 times lower, and the criteria for false positive reactions can be relatively subjective. Disadvantages have been reported. On the other hand, general RT-PCR has been verified for stability through relatively long research compared to the two technologies, and has the advantage of being able to perform sequencing, so it is highly applicable as a standard diagnostic technique. In addition, the range of users (or utilization layer) is wide, and it can be utilized in developing countries at low cost. However, the RT-PCR method developed by a number of researchers may have poor field applicability due to differences in composition and conditions. On the other hand, enzyme immunoassay, etc., other than specific nucleic acid fragment amplification techniques can be used, but the detection sensitivity is about 100-1,000 times lower, and the criteria for false positive reactions can be relatively subjective. Disadvantages have been reported.

While a PCR-based test method is commonly used to analyze the genetic characteristics of positive samples, a positive control group is required to ensure the accuracy, precision, and reproducibility of the experimental process. The example is the norovirus positive control prepared by the Korea Centers for Disease Control and Prevention, Lee et al. reported in the Virology Journal. (2011) and others. In this report, the positive control must be able to be amplified in consideration of the location of the PCR primers, and mentions the importance of provision at a specific concentration, storage and stabilization, and reproducibility. However, since laboratory contamination may occur from the positive control, a device capable of assaying it must be devised, and methods such as changing the size of amplification and inserting a specific nucleotide sequence have been reported as such methods.

Therefore, there is a need to develop a technology that can reflect the above, such as specificity, detection sensitivity, and reactive positive control group, for MERS-CoV diagnosis.

Republic of Korea Patent Publication No. 10-2007-0050672

The present inventors completed the present invention by developing a primer set capable of accurately diagnosing MERS-CoV through a number of studies.

Therefore, an object of the present invention is mainly to be infected through the respiratory tract and proliferate in the bronchi and lungs, and to include MERS-CoV, a virus that causes symptoms or diseases such as high fever, cough, dyspnea, vomiting, diarrhea, and renal function damage. To provide a primer set for RT-PCR capable of detecting a plurality of mutants included in MERS-CoV by amplifying three genes (Orf1ab, E and N) of a plurality of mutant strains with excellent detection sensitivity and the same conditions, respectively.

Another object of the present invention is detection that can quickly and accurately diagnose the infection of multiple mutants included in MERS-CoV by using a primer set for RT-PCR capable of detecting multiple mutants included in MERS-CoV. It is to provide a kit and a detection method.

Another object of the present invention is to provide a positive control gene for false positive testing that can guarantee the accuracy, precision, reproducibility and certainty of the experimental process in performing detection experiments of multiple mutant strains included in MERS-CoV.

The objects of the present invention are not limited to the objects mentioned above, and other objects not mentioned will be clearly understood by those skilled in the art from the description below.

In order to achieve the object of the present invention described above, first, the present invention is a pair of primers represented by SEQ ID NOs: 1 and 7; Primer pairs represented by SEQ ID NOs: 10 and 12; And it provides a RT-PCR primer set for detecting Middle East respiratory syndrome-related coronavirus ; MERS-CoV, including a primer pair represented by SEQ ID NOs: 15 and 20.

In a preferred embodiment, the nucleotide sequences of SEQ ID NOs: 1 and 7 were designed and produced using the nucleotide sequence 15,301-15,600 of the Orf1ab gene region of the MERS-CoV as a template, and the SEQ ID NOs 10 and 12 are the MERS-CoV The base sequence 27,590-27,838 of the E gene region was designed and manufactured as a template, and SEQ ID NOs: 15 and 20 were designed and manufactured using the base sequence 28,585-28,836 of the MERS-CoV N gene region as a template.

In a preferred embodiment, a positive control gene represented by SEQ ID NO: 22 is further included.

In addition, the present invention provides a RT-PCR primer composition for detecting Middle East Respiratory Syndrome coronavirus, including the above-described primer set for RT-PCR.

In a preferred embodiment, it further comprises reverse transcriptase, DNA polymerase, dNTPs and reaction buffer.

In a preferred embodiment, a positive control gene represented by SEQ ID NO: 22 is further included.

In addition, the present invention provides a Middle East respiratory syndrome coronavirus detection kit comprising any one of the above-described compositions.

In a preferred embodiment, the Middle East respiratory syndrome coronavirus is GenBank accession number NC_019843.3 and a mutant thereof.

In addition, the present invention comprises the steps of extracting RNA from a target sample other than the human body; Amplifying a target sequence by performing RT-PCR using the RNA as a template and using any one of the above-described primer sets; And detecting the amplification product; provides a method for diagnosing Middle East respiratory syndrome coronavirus, including.

In a preferred embodiment, the step of detecting the amplification product is performed through any one selected from the group consisting of a DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, phosphorus measurement, and combinations thereof.

In a preferred embodiment, when the positive control gene represented by SEQ ID NO: 22 is further included, false positive factors are removed when reading the experimental results.

First, since the RT-PCR primer set of the present invention does not react with viruses of other species other than the multiple mutants included in MERS-CoV, it can quickly detect multiple mutants included in MERS-CoV with high specificity and high detection sensitivity. can be detected.

In addition, according to the diagnostic composition comprising a primer set for RT-PCR for detecting multiple mutant strains included in MERS-CoV of the present invention and a detection kit including the same, a large number of mutant strains included in MERS-CoV are rapidly and with high detection intensity. Since it is possible to diagnose the infection of MERS-CoV, rapid treatment for follow-up treatment is possible even for patients infected with multiple mutant strains included in low-level MERS-CoV.

When using the MERS-CoV RT-PCR positive control gene of the present invention, it is possible to confirm the occurrence of false positive reactions due to contamination of the control group, enabling accurate diagnosis of multiple mutant strains included in MERS-CoV.

These technical effects of the present invention are not limited to the above-mentioned range, and even if not explicitly mentioned, the effects of the invention that can be recognized by those skilled in the art from the description of specific contents for the practice of the invention described later included of course

1a, 1b and 1c are RT-PCR primer combinations capable of amplifying the MERS-CoV Orf1ab gene fragment Orf1ab-#01 to Orf1ab-#14, E RT-PCR primer combinations capable of amplifying the gene fragment E-#, respectively. This is the result of confirming the amplification of the specific reaction of MERS-CoV to 01 to E-#08 and the RT-PCR primer combination N-#01 to N-#07 capable of amplifying the N gene fragment.
Figure 2a shows three reference viruses [ Severe acute respiratory syndrome ] for the RT-PCR primer combination Orf1ab-#01, #02, #03, #04, #07 and #14 capable of amplifying the MERS-CoV Orf1ab gene fragment, respectively. -related coronavirus (SARS-CoV), Coronavirus-229E (CoV-229E) and respiratory Adenovirus (R-AdV)] This is the result of confirming a non-specific reaction to nucleic acids, and FIGS. RT-PCR primer combination, E-#01, #02, #04, #05 and #06, and RT-PCR primer combination N-#01, #02, #03, #04 capable of amplifying the N gene fragment , and four reference viruses for #06 [Severe acute respiratory syndrome-related coronavirus (SARS-CoV), Middle East respiratory syndrome-related coronavirus (MERS-CoV), Coronavirus-229E (CoV-229E) and respiratory Adenovirus (R -AdV)] This is the result of confirming a non-specific reaction to nucleic acid.
3a, 3b and 3c show specific amplification capable of amplifying Orf1ab, E and N genes of MERS-CoV obtained in FIGS. 2a to 2c and non-specific amplification of the reference virus nucleic acid for each RT-PCR primer combination This is the result of confirming the detection sensitivity for In particular, FIG. 3a is a result of confirming a non-specific reaction to nucleic acid of one reference virus (SARS-CoV2) for the RT-PCR primer combination Orf1ab-#03 and #07 capable of amplifying the MERS-CoV Orf1ab gene fragment.
4a, 4b, and 4c show the result of reacting each selected primer combination with total RNA extracted from a sample of a healthy person without symptoms for each selected primer combination for MERS-CoV gene amplification.
5a, 5b, and 5c show artificial infection detection sensitivity test results. After adding a specific concentration of MERS-CoV plasmid to total nucleic acid extracted from a sample of a healthy person, each selection primer combination was reacted from a serial dilution using total nucleic acid. is a result
6 shows that all three final primer combinations selected from the three MERS-CoV genes (Orf1ab, E and N) can react, and the restriction enzyme EcoRV (5'-GATATC-3') in the expected amplification product reacts. This is the base sequence information of the positive control into which a specific base sequence has been inserted so that
7a, 7b, and 7c are the results of assaying the amplification of the positive control prepared based on FIG. 6 and the reaction of the restriction enzyme EcoRV.

The terms used in the present invention have been selected from general terms that are currently widely used as much as possible while considering the functions in the present invention, but these may vary depending on the intention of a person skilled in the art or precedent, the emergence of new technologies, and the like. In addition, in a specific case, there is also a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the invention.

When 'includes,' 'has,' or 'consists of' mentioned in the present invention is used, other parts may be added unless 'only' is used. In the case where a component is expressed in the singular, the case including the plural is included unless otherwise explicitly stated.

In interpreting the components, even if there is no separate explicit description, it is interpreted as including the error range.

Characteristic parts of each of the various embodiments of the present invention can be partially or entirely combined or combined with each other, technically various interlocking and driving are possible, and each embodiment can be implemented independently of each other or in an association relationship. may be performed together.

In the present invention, a 'primer' is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary nucleic acid template and is used for copying a strand of a nucleic acid template. A short nucleic acid sequence that serves as a starting point. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.

Hereinafter, the technical configuration of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Like reference numbers used to describe the invention throughout the specification indicate like elements.

The technical feature of the present invention is to select MERS-CoV as well as its various mutant strains, align Orf1ab (RdRp), N and E genes among these nucleotide sequences to the target, and then cover commonly conserved sites as well as mutant sites. A number of primer pairs designed to perform the test were produced, and an optimal primer set was selected through experiments. The base sequences included in the selected primer sets are stable base sequences without degeneracy commonly found in conventional RT-PCR diagnostic methods. Therefore, the sensitivity and specificity of the RT-PCR reaction is improved, as well as a RT-PCR primer set with improved detection accuracy by including a positive control gene that can test false positive reactions in diagnosing MERS-CoV and its mutants. A detection kit and detection method including a primer set.

Therefore, the RT-PCR primer set for detecting Middle East respiratory syndrome-related coronavirus (MERS-CoV) of the present invention is for detecting MERS-CoV and its various mutants, as SEQ ID NOs: 1 and 7. Primer pairs indicated; Primer pairs represented by SEQ ID NOs: 10 and 12; And it may include a pair of primers represented by SEQ ID NOs: 15 and 20, and homologues of the base sequences are included within the scope of the present invention. Specifically, the RT-PCR primer set of the present invention contains 70% or more, preferably 80% or more, more preferably 90% of the nucleotide sequences of SEQ ID NOs: 1 and 7, SEQ ID NOs: 10 and 12, and SEQ ID NOs: 15 and 20, respectively. Or more, most preferably, it may include a base sequence having a sequence homology of 95% or more. The "percentage of sequence homology" for polynucleotides is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).

The RT-PCR primer set of the present invention is suitable for cloning of appropriate sequences, digestion with restriction enzymes, and the phosphotriester method of Narang et al. (1979, Meth, Enzymol. 68:90-99), Beaucage et al. The ethylphosphoramidite method (1981, Tetrahedron Lett. 22: 1859-1862), and any other well-known methods including direct chemical synthesis methods such as the solid support method of U.S. Patent No. 4458066 can be used to synthesize chemically. can

Three primer pairs included in the primer set of the present invention, that is, a primer pair represented by SEQ ID NOs: 1 and 7; Primer pairs represented by SEQ ID NOs: 10 and 12; And the primer pair represented by SEQ ID NOs: 15 and 20 is not the entire MERS-CoV sequence, but the nucleotide sequence of the Orf1ab gene region 15,301-15,600 [length 300 nucleotide (nt)], the E gene region nucleotide sequence 27,590-27,838 (249 nt) ) and the nucleotide sequence 28,585-28,836 (252 nt) of the N gene region as a template. The present invention is characterized by designing and manufacturing three pairs of primers using the above three genes as templates. That is, as described below, the present invention selects 67 MERS-CoVs whose entire base sequence has been analyzed in the GenBank database, aligns Orf1ab (RdRp), N and E gene regions among these base sequences, and then commonly conserves This is because a number of primer pairs designed to cover not only the site but also the mutation site were produced, and the optimal primer set was selected through experiments to determine the RT-PCR primer set.

If necessary, the RT-PCR primer set for detecting MERS-CoV of the present invention may further include a positive control gene represented by SEQ ID NO: 22, and the positive control gene is for false positive verification. As an embodiment, the positive control gene in the present invention is Orf1ab gene region nucleotide sequence 15,301-15,600 [length 300 nucleotide (nt)], E gene region nucleotide sequence 27,590-27,838 (249 nt) and N gene region nucleotide sequence 28,585 -28,836 (252 nt) may be a nucleotide sequence formed by linking each of them to a sequence that can be cleaved by a restriction enzyme. As shown in FIG. 6, the restriction enzyme EcoRV (5'-GATATC-3') can react It may be formed by inserting a specific nucleotide sequence so that

The RT-PCR primer composition for detecting MERS-CoV of the present invention includes the above-described RT-PCR primer set, and may further include reverse transcriptase, DNA polymerase, dNTPs, and a reaction buffer, if necessary. Of course, a positive control gene represented by SEQ ID NO: 22 may be further included to increase detection accuracy.

The detection kit of the present invention can detect MERS-CoV by including the RT-PCR primer composition, and Middle East Respiratory Syndrome coronavirus can be GenBank accession number NC_019843.3 and its variants. In particular, the mutant strains KU233362.1, KU710265.1, MG923481.1, MG923480.1, MG923479.1, MG923478.1, MG923477.1, MG923476.1, MG923475.1, MG923474.1, MG021452.1, MG021452.1, 1, MG987421.1, MG987420.1, KX154694.1, KX154693.1, KT806050.1, KT806054.1, KU233364.1, KU851859.1, KT861627.1, MK280984.2, KJ477103.2, MK1, MK462255 MK462246.1, MN481964, MN481965, MN481966, MN481967, MN481968, MN481969, MN481970, MN481971, MN481972, MN481973, MN481974, MN481975, MN481976, MN481977, MN481978, MN481979, MN481980, MN481981, MN481982, MN481983, MN481984, MN481985, MN481986, MN723542, MN723543, MN723544, MK967708, MN507638, KF961222.1, KF961221.1, MN507638.1, KM027262.1, KM027261.1, KM027260.1, KF192507.1, KP719931.1, KP719928.1, KP719927.1, KT326819.1, KJ361502.1 and KT003529.1 and the like.

In addition, the MERS-CoV diagnosis method of the present invention comprises the steps of extracting RNA from a target sample other than the human body; Amplifying a target sequence by performing RT-PCR using the RNA as a template and using the primer set of any one of claims 1 to 3; and detecting the amplification product. Here, the step of detecting the amplification product may be performed through any one selected from the group consisting of a DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, phosphorus measurement, and combinations thereof. Here, if the positive control gene represented by SEQ ID NO: 22 is further included, false-positive factors are removed when reading the experimental results, enabling a more accurate test.

The RT-PCR primers of the present invention are primers designed from species-specific nucleotide sequences, and can not only diagnose whether or not you are actually infected with MERS-CoV, but also detect the theoretically synthesized MERS-CoV gene. There is no non-specific reaction with nucleic acids other than viruses, and the detection ability for target viruses is excellent.

Example 1

1. Collection of viral nucleic acids

To confirm the specificity of the general RT-PCR method, MERS-CoV Orf1ab gene [15,301-15,600 (300 nt)], E gene [27,590-27,838 (249 nt)], N gene [28,585-28,836 (252 nt)] ] and four reference viruses (SARS-CoV, SARS-CoV2, CoV-229E and R-AdV) were collected.

2. Construction of RT-PCR primers for MERS-CoV detection

The RT-PCR primer design for MERS-CoV diagnosis was based on GenBank accession number NC_019843.3 as the reference nucleotide sequence, targeting three genes (Orf1ab, E and N), Primer 3 ver.0.4.0 (https:/ /bioinfo.ut.ee/primer3-0.4.0/primer3/) and candidate primers were selected. Then, the selected primer combinations were modified using base sequences such as nucleotide letter codes to prepare RT-PCR primers with wide coverage that could react to a total of 67 MERS-CoV strains. In order to react with general RT-PCR, two types of primers (forward and reverse) must act as one set. The collected RT-PCR primers were prepared as above, and a specific primer combination was developed by assaying the reaction in the collected nucleic acids. Meanwhile, Table 1 below shows the nucleotide sequences of primers for detecting MERS-CoV Orf1ab, N and E genes designed and manufactured according to an embodiment of the present invention.

division Base sequence (5'-3') sequence number length
(nt) location ^a gene direction name Orf1ab forward MERS-O_F10 TWGCWCGYAARCATGGHACT One 20 15,324-15,343 MERS-O_F20 AGTGYGCTCAGGTRYTAAG 2 19 15,384-15,402 MERS-O_F30 TAAGYGAATATGTBYTVTGY 3 20 15,399-15,418 MERS-O_F40 ATGTBYTVTGYGGYGGYGGY 4 21 15,408-15,427 reverse MERS-O_R10 CAATYTTGTTGCCRTTAGY 5 19 15,539-15,557 MERS-O_R20 GCCRTTAGYDCCCATAAGT 6 19 15,529-15,547 MERS-O_R30 GCACTVACATTNGCAGTWGT 7 20 15,509-15,528 MERS-O_R40 TRTTGGCATAWGCDGTRGT 8 19 15,467-15,485 E forward MERS-E_F10 ATGTTACCCTTTGTCCAAGA 9 20 27,590-27,609 MERS-E_F20 CAAGAACGAATAGGGTTGTT 10 20 27,605-27,624 MERS-E_F30 CTCTTGGTGTGTATGGCTTT 11 20 27,668-27,687 reverse MERS-E_R10 TTAAACCCACTCGTCAGGTG 12 20 27,819-27,838 MERS-E_R20 AGAGGGGGTTTACTATCCTG 13 20 27,797-27,816 MERS-E_R30 GTATAATGCGGGCTGAACTA 14 20 27,741-27,760 MERS-N_F10 CTGTTTCCTTTGCCGATAAC 15 20 28,591-28,610 N forward MERS-N_F20 CTRTCTCGAGGTAGAGGACGT 16 22 28,632-28,652 MERS-N_F30 CGAGGTAGAGGACGTAATCC 17 20 28,638-28,657 MERS-N_F40 CGAGCTGCACCAAATAACACTG 18 22 28,665-28,686 reverse MERS-N_R10 CCTGTCTCCGCCAATACCCAG 19 21 28,789-28,809 MERS-N_R20 WGGGGTRGAATTGGCATTA 20 19 28,760-28,778 MERS-N_R30 GTGGAAAGGTAAGAGGGACT 21 20 28,721-28,740

a : GenBank number NC_019843.3 base position

The nucleic acid of MERS-CoV was gene synthesized by requesting the nucleotide sequence known from Genbank accession number NC_019843.3 to Macrogen. The synthetic nucleotide sequence was gene cloned using the pTOP Blunt V2 vector, and was provided in the form of a final plasmid.

3. RT-PCR amplification combination construction

MERS-CoV Orf1ab gene (primer combination number Orf1ab-#01 to Orf1ab-#14), E gene (primer combination number E-#01 to E-#08) and N gene (primer combination number Each primer combination was constructed from N-#01 to N-#07). Table 2 below shows the sizes of RT-PCR primer combinations and reaction products designed and produced in the present invention.

Example 2

As shown in Table 2, among a plurality of RT-PCR primer sets for detecting MERS-CoV, one or more optimal primer sets capable of detecting each of three genes were aimed at selection. Each RT-PCR primer set capable of amplifying each MERS-CoV gene was then selected through the following 4-step process; i) specific response to MERS-CoV nucleic acid, ii) non-specific response to reference virus nucleic acid, iii) detection sensitivity, iv) response and detection sensitivity in samples through sample assay and artificial infection.

A composition for RT-PCR reaction for a specific reaction was prepared as follows;

AccuPower® RT-PCR PreMix (Bioneer, Korea), 17 uL of tertiary sterile distilled water, 2 uL of RT-PCR primer combination (25 pmol, 1 uL each of forward and reverse primers), and 1 uL of template nucleic acid. In addition, RT-PCR goes through a reverse transcription process at 42 ° C for 60 minutes, followed by pre-denaturation at 95 ° C for 5 minutes and repeated 35 times [denaturation at 95 ° C for 45 seconds, annealing 55°C 60 seconds, extension 72°C 60 seconds] and final extension 72°C 5 minutes. The reaction of the RT-PCR amplification product was confirmed under ultraviolet (UV) wavelength after electrophoresis using a 1.2% agarose gel containing a UV coloring reagent.

Here, as the RT-PCR primer set, a plurality of RT-PCR primer sets for detecting MERS-CoV shown in Table 2 were sequentially used.

Through the experiments described below, it was confirmed that among the multiple RT-PCR primer sets for MERS-CoV detection shown in Table 2, the best RT-PCR primer sets for MERS-CoV detection were the three primer pairs shown in Table 3 below. .

Target
gene Set# Primer Name Type Primer seq. Orf1ab #3 MERS-O_F10 F TWGCWCGYAARCATGGHACT MERS-O_R30 R GCACTVACATTNGCAGTWGT E #4 MERS-E_F20 F CAAGAACGAATAGGGTTGTT MERS-E_R10 R TTAAACCCACTCGTCAGGTG N #2 MERS-N_F10 F CTGTTTCCTTTGCCGATAAC MERS-N_R20 R WGGGGTRGAATTGGCATTA

Example 3

A positive control group capable of reacting with the RT-PCR primer set for detecting MERS-CoV and performing a false positive test from the control group after amplification was prepared. In the prepared positive control group, the reaction was confirmed in the same manner as in Example 2 using each RT-PCR primer combination capable of amplifying the three MERS-CoV genes (Orf1ab, E and N). Using 5 uL of each RT-PCR amplification product reacted in the same manner as in Example 2, 1 uL of restriction enzyme EcoRV (Enzynomics, Korea) and 4 uL of reaction buffer were used to make a total of 10 uL and reacted at 37 ° C for 1 hour, After the reaction, 5 uL was mixed with 1 uL of 6X Loading dye, and after electrophoresis using a 1.2% agarose gel containing a UV coloring reagent, it was confirmed under ultraviolet (UV) wavelength.

On the other hand, molecular biological methods such as general PCR require a positive control for reliability of analysis, but contamination from the positive control is always possible during diagnosis, so there is a concern about false positives. can be expected. One of the methods for solving the problem and securing reliability is to secure a standard positive control, and in the case of the positive control of the present invention, as shown in FIG. Even if there are amplification products of different sizes and a non-specific reaction of the same size as the positive control is confirmed, it contains functionality that can confirm false positives and cross-contamination using the restriction enzyme EcoRV, so it is unlikely to appear due to laboratory contamination. It is characterized by rapid response to possible false positive reactions.

Experimental Example 1. Specific reaction to MERS-CoV nucleic acid

Using the RT-PCR primer set capable of detecting the MERS-CoV gene fragment prepared in Example 1, RT-PCR was performed with the same composition and conditions as in Example 2 to obtain a specific size for the MERS-CoV corresponding gene fragment. The amplification band of was confirmed. "N" was subjected to electrophoresis after RT-PCR reaction using tertiary sterile distilled water (or nucleic acid free water) as a template that does not contain any nucleic acids such as MERS-CoV plasmid as a negative control. The RT-PCR reaction composition, conditions and electrophoresis method were the same as in Example 2, and the results of Experimental Example 1 are shown in FIGS. 1A to 1C. 1a to 1c show the specific reaction of the MERS-CoV plasmid of the RT-PCR set estimated to amplify each of the three MERS-CoV genes (Orf1ab, E and N), and this Among them, RT-PCR primer combinations selected in consideration of reaction intensity, amplification product size, amplification location, etc. are shown.

From FIG. 1A, primer combination numbers #1, #2, #3, #4, #7, and #14 shown in Table 2 for the Orf1ab gene, and primer combinations shown in Table 2 for the E gene from FIG. 1B. Numbers #1, #2, #4, #5, and #6 are MERS- It can be seen that a specific reaction to the CoV nucleic acid appears.

Experimental Example 2. Non-specific reaction to reference virus nucleic acid

In Example 2 and Experimental Example 1, the non-specific reaction to the reference virus nucleic acid was assayed for the RT-PCR primer combinations for which a specific size reaction was confirmed, and MERS-CoV nucleic acid as a positive control and tertiary sterile distilled water as a negative control was used. The reaction composition and conditions are the same as in Example 2, and the results of Experimental Example 2 are shown in FIGS. 2a to 2c.

From FIGS. 2a to 2c, it is possible to confirm combination numbers that specifically react only to MERS-CoV by examining non-specific reactions to four reference viruses among the RT-PCR primer sets in which MERS-CoV-specific reactions have been confirmed. . From these results, it is possible to select an RT-PCR primer set capable of detecting MERS-CoV. Combination numbers #3 and #7 for the Orf1ab gene from FIG. 2a, and combination numbers #4 and #4 for the E gene from FIG. 2b It can be seen that #5 and #7 are combination numbers #1, #2, #4 and #6 for the N gene from FIG. 2c.

Experimental Example 3. Detection Sensitivity

Based on 1 ng/uL of MERS-CoV plasmid, 10 ⁸ (10 ag/uL) was prepared at the 0th power (1 ng/uL) of 10-fold serial dilution with tertiary sterile distilled water. For the RT-PCR primer set selected through the results of Experimental Examples 1 and 2, detection sensitivity was confirmed by RT-PCR reaction using the MERS-CoV plasmid stage dilution as a template. Tertiary sterile distilled water was used as a negative control, and the reaction composition and conditions were the same as in Example 2. The results of Experimental Example 3 are shown in FIGS. 3a to 3c. 3a to 3c show a relative comparison of detection sensitivities for a plurality of RT-PCR primer combinations capable of detecting three genes of MERS-CoV that are specific to MERS-CoV and non-specific to the reference virus nucleic acid. that showed a result. From FIGS. 3a to 3c, it is possible to select an RT-PCR primer set that is optimal for detecting three genes of MERS-CoV, that is, Orf1ab gene, E gene, and N gene. As shown in Table 3, FIG. 3A Combination number #3 for the Orf1ab gene, combination number #4 for the E gene from FIG. 3B, and combination number #2 for the N gene from FIG. 3C.

In addition, one primer pair of the RT-PCR primer set prepared from FIG. 3a was up to 10 ^-5 dilution, and the other one primer pair of the RT-PCR primer set prepared from FIG. 3b was up to 10 ^-4 dilution. Another primer pair among the RT-PCR primer sets prepared from 3c was confirmed to detect MERS-CoV up to a dilution of 10 ^-5 .

Experimental Example 4. Reaction and detection sensitivity in samples through sample assay and artificial infection

After taking a sample from the upper respiratory tract (oropharynx and nasopharynx) of a healthy person using an autoclaved plastic swab (i.e. floced swab), total RNA was extracted using the RNA extraction kit Ribospin™ vRD (GeneAll, Korea) according to the manual. did RT-PCR was performed using the total RNA extracted from the RT-PCR primer combination capable of amplifying each of the three MERS-CoV genes (Orf1ab, N, and E) selected through Experimental Example 3 as a template, followed by electrophoresis. On the other hand, after artificial contamination with 100 pg/uL using 1 ng/uL of MERS-CoV plasmid and any one type of nucleic acid extracted from the sample, a 10-fold serial dilution was prepared with the nucleic acid extracted from the sample. Electrophoresis was performed after the RT-PCR reaction using the artificially contaminated step-by-step dilution as a template. MERS-CoV nucleic acid was used as a positive control group and tertiary sterile distilled water was used as a negative control group. The reaction composition and conditions are the same as in Example 2, and the results of Experimental Example 4 are shown in FIGS. 4a to 4c and 5a to 5c. 4a to 4c show the results of the reaction of the RT-PCR primer combination capable of amplifying each gene from the total nucleic acid extracted from 10 samples, and FIGS. 5a to 5c show the total nucleic acid of the sample with MERS-CoV plamid In , the results of relative comparison of detection sensitivities from serial dilutions after artificial contamination are shown.

4a to 4c, it can be confirmed that MERS-CoV was not detected in total RNA extracted from 10 samples. MERS-CoV was detected in artificially contaminated templates at a dilution factor of 10 ^-4 for the Orf1ab gene from Figure 5a, a dilution factor of 10 ^-7 for the E gene from Figure 5b, and a dilution factor of 10 ^-5 for the N gene from Figure 5c. can confirm that it is.

Experimental Example 5. Preparation of positive control for diagnosis of MERS-CoV, RT-PCR primer combination reaction and false positive reaction test

An RT-PCR reaction was performed using the RT-PCR primer combination capable of amplifying the three MERS-CoV genes (Orf1ab, E and N) and the prepared positive control as a template, and the reaction product was tested for restriction enzyme EcoRV reaction. . The RT-PCR reaction composition and conditions are the same as in Example 2, and the restriction enzyme reaction is the same as in Example 3. The results are shown in FIGS. 6 to 7c, and FIG. 6 includes information on the nucleotide sequence of the designed and manufactured positive control, the binding site of the primer, and the reaction site of the restriction enzyme EcoRV. 7a to 7c show the reaction of RT-PCR amplification products before and after treatment with EcoRV restriction enzyme.

A total of 207 nt amplification products are 85 nt and 122 nt from FIG. 7a, a total of 236 nt amplification products are 70 nt and 166 nt from FIG. 7b, and a total of 190 nt amplification products are 45 nt and 145 nt from FIG. 7c cutting can be seen.

Although the present invention has been shown and described with preferred embodiments as described above, it is not limited to the above embodiments, and to those skilled in the art within the scope of not departing from the spirit of the present invention Various changes and modifications will be possible. For example, even if the described techniques are performed in a different order from the described method, and/or the described components are combined or combined in a different form than the described method, or substituted or replaced by other components or equivalents. Appropriate results can be achieved.

<110> Shinhan university <120> Reverse transcriptase polymerase chain reaction for the detection of Middle East respiratory syndrome-related coronavirus and a diagnosing kit for Middle East respiratory syndrome-related coronavirus using the same <130> DPP-2021-0044-KR <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 1 twgcwcgyaa rcatgghact 20 <210> 2 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 2 agtgygctca ggtrytaag 19 <210> 3 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 3 taagygaata tgtbytvtgy 20 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 4 atgtbytvtg yggyggyggy 20 <210> 5 <211> 19 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 5 caatyttgtt gccrttagy 19 <210> 6 <211> 19 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 6 gccrttagyd cccataagt 19 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 7 gcactvacat tngcagtwgt 20 <210> 8 <211> 19 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 8 trttggcata wgcdgtrgt 19 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 9 atgttaccct ttgtccaaga 20 <210> 10 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 10 caagaacgaa tagggttgtt 20 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 11 ctcttggtgt gtatggcttt 20 <210> 12 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 12 ttaaacccac tcgtcaggtg 20 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 13 agagggggtt tactatcctg 20 <210> 14 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 14 gtataatgcg ggctgaacta 20 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 15 ctgtttcctt tgccgataac 20 <210> 16 <211> 21 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 16 ctrtctcgag gtagaggacg t 21 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 17 cgaggtagag gacgtaatcc 20 <210> 18 <211> 22 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 18 cgagctgcac caaataacac tg 22 <210> 19 <211> 21 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 19 cctgtctccg ccaataccca g 21 <210> 20 <211> 19 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 20 wggggtrgaa ttggcatta 19 <210> 21 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 21 gtgggaaaggt aagagggact 20 <210> 22 <211> 819 <212> DNA <213> artificial sequence <220> <223> Positive control gene <400> 22 tcgcgataga atcttcgctt cactcatatt agctcgtaaa catggcactt gttgtactac 60 aagggacaga ttttatcgct tggcaaatga gtggtgctcag gtgctaagcg agatatcgtt 120 ctatgtggtg gtggttacta cgtcaaacct ggaggtacca gtagcggaga tgccaccact 180 gcatatgcca atagtgtctt taacattttg caggcgacaa ctgctaatgt cagtgcactt 240 atgggtgcta atggcaacaa gattgttgac aaagaagtta aagacatgca gtttgatttg 300 tatgtcaaat gttacccttt gtccaagaac gaatagggtt gttcatagta aactttttca 360 tttttaccgt agtatgtgct ataacactct tggtgtgtat ggctttcctt acggctacta 420 gattatgtgt gcaatgtatg acaggcttca ataccctgtt agttcagccc gcattatact 480 tgtatagata tctggacgtt cagtctatgt aaaattccag gatagtaaac cccctctacc 540 acctgacgag tgggtttaac tcgtgctgtt tcctttgccg ataacaatga tataacaaat 600 acaaaccgat atctcgaggt agaggacgta atccaaaacc acgagctgca ccaaataaca 660 ctgtctcttg gtacactggg cttacccaac acgggaaagt ccctcttacc tttccacctg 720 ggcagggtgt acctcttaat gccaattcta cccctgcgca aaatgctggg tattggcgga 780 gacaggacag aaaaattaat accgggaatg gaactgcag 819

Claims (11)

Primer pairs represented by SEQ ID NOs: 1 and 7; Primer pairs represented by SEQ ID NOs: 10 and 12; And an RT-PCR primer set for detecting Middle East respiratory syndrome-related coronavirus ; MERS-CoV, including a primer pair represented by SEQ ID NOs: 15 and 20.
According to claim 1,
The nucleotide sequences of SEQ ID NOs: 1 and 7 were designed and prepared using the nucleotide sequence 15,301-15,600 of the MERS-CoV Orf1ab gene region as a template, and SEQ ID NOs 10 and 12 are the nucleotide sequences of the MERS-CoV E gene region. 27,590-27,838 as a template, and SEQ ID NOs: 15 and 20 are designed and manufactured as a template for the nucleotide sequence 28,585-28,836 of the N gene region of the MERS-CoV for detecting Middle East respiratory syndrome coronavirus. RT-PCR primer set.
According to claim 2,
An RT-PCR primer set for detecting Middle East respiratory syndrome coronavirus, characterized in that it further comprises a positive control gene represented by SEQ ID NO: 22.
An RT-PCR primer composition for detecting Middle East respiratory syndrome coronavirus comprising the RT-PCR primer set of claim 1.
According to claim 4,
RT-PCR primer composition for detecting Middle East respiratory syndrome coronavirus, characterized in that it further comprises a reverse transcriptase, DNA polymerase, dNTPs and a reaction buffer.
According to claim 5,
RT-PCR primer composition for detecting Middle East respiratory syndrome coronavirus, characterized in that it further comprises a positive control gene represented by SEQ ID NO: 22.
A kit for detecting Middle East respiratory syndrome coronavirus, comprising the composition of any one of claims 4 to 6.
According to claim 7,
The Middle East respiratory syndrome coronavirus detection kit, characterized in that GenBank accession number NC_019843.3 and its mutant strain.
Extracting RNA from a target sample other than human body;
Amplifying a target sequence by performing RT-PCR using the RNA as a template and using the primer set of any one of claims 1 to 3; and
Detecting the amplification product; Middle East respiratory syndrome coronavirus diagnostic method comprising.
According to claim 9,
The step of detecting the amplification product is performed through any one selected from the group consisting of DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, anthropometry, and combinations thereof Middle East Respiratory Syndrome Corona Virus diagnosis method.
According to claim 9,
A method for diagnosing Middle East respiratory syndrome coronavirus, characterized in that when the positive control gene represented by SEQ ID NO: 22 is further included, false positive factors are removed when reading the experimental results.

Images