KR102137500B1 - Primer set for Multiplex RT-PCR of Proso millet or Foxtail millet Viruses and use thereof - Google Patents

Abstract

The present invention relates to a primer for multiple diagnostics of a virus derived from millet or crude, and more particularly, a primer set for multiple diagnostics of a virus derived from millet or crude, a composition comprising the same, a kit comprising the composition, and a millet using the primer set or The present invention relates to a method for multiple diagnosis of viruses. Using the primer set for multiple diagnosis of millet or crude virus of the present invention and the method for multiple diagnosis of millet or crude virus using the primer set, it is possible to perform multiple specific diagnosis for viruses occurring in the millet or crude. In addition, accurate and rapid multi-diagnosis of millet or crude virus can be performed even at low concentrations of samples, which can contribute to screening and analysis of damages to viral diseases occurring in domestic millet or crude and development of resistant varieties.

Description

Primer set for Multiplex RT-PCR of Proso millet or Foxtail millet Viruses and use thereof

The present invention relates to a primer for multiple diagnostics of a virus derived from millet or crude, and more particularly, a primer set for multiple diagnostics of a virus derived from millet or crude, a composition comprising the same, a kit comprising the composition, and a millet using the primer set or The present invention relates to a method for multiple diagnosis of viruses.

The majority of agriculturally important crops show reduced yields and poor quality due to plant virus or viroid infection, resulting in serious economic losses. Diseases caused by plant viruses cannot be prevented or treated by spraying pesticides, unlike diseases caused by fungi or bacteria. Therefore, a precise and rapid diagnosis of whether a plant or a seed is infected with a virus is a prerequisite for preventing damage caused by a viral infection of a cultivated crop in advance, and managing a viral disease.

In the past, electron microscopy and serological methods were mainly used as virus diagnostic methods. Among them, the method using an electron microscope can confirm the existence of a virus, but it is a method that cannot diagnose a species with morphological characteristics. Among the serological methods, enzyme-linked immunosorbent assay (ELISA) is about 1000 times lower in sensitivity than most commonly used diagnostic methods or PCR diagnostic methods, and unexpected non-specificity of antibodies and test samples The reaction often fails to diagnose. In addition, in the field of quarantine, it is necessary to perform diagnosis of various pathogens on one test sample, and thus, when using various diagnostic methods, it takes a lot of labor and testing costs.

Therefore, in the current diagnosis of viruses, PCR method with high detection sensitivity and convenience is most commonly used. An important point in the development of primers for PCR diagnosis of pathogens is that first, it is necessary to be able to detect all strains and strains present in the virus species. To this end, primers should be designed for common sequences of all strains and isolates of the virus species to be detected. Second, there must be specificity between different species. To this end, primers that do not respond to nucleotide sequences of other viruses that are closely related to the virus species to be detected should be designed.

However, in the case of the primers described above, in general, only a fragmentary diagnosis for individual viruses is possible, so there is a problem in diagnosing crops infected with a large number of viruses. In addition, development of species-specific primers capable of detecting all isolates present in a virus species is required because diagnosis may fail when using isolate-specific primers.

Accordingly, the present inventors completed the present invention by developing primers for multiple diagnostics of viruses derived from millet or crude, while studying primers for multiple diagnosis of viral diseases occurring in millet and crude.

Accordingly, an object of the present invention is to provide a multi-diagnostic primer set for millet or crude virus-derived viruses, a composition comprising the same, a kit containing the composition, and a method for diagnosing millet or crude virus multiplex using the primer set.

In order to achieve the above object, the present invention SEQ ID NO: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; And it provides a primer set for diagnosing millet virus, comprising at least one selected from the group consisting of primer pairs of SEQ ID NOs: 17 and 18.

In addition, the present invention SEQ ID NO: 1 and 2; SEQ ID NOs: 5 and 6; SEQ ID NOs: 9 and 10; And it provides a primer set for diagnosing crude viruses, comprising at least one member selected from the group consisting of primer pairs of SEQ ID NOs: 11 and 12.

In addition, the present invention SEQ ID NO: 1 and 2; SEQ ID NOs: 5 and 6; SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; And it provides a primer set for multiple diagnosis of millet or crude virus, comprising at least one selected from the group consisting of primer pairs represented by SEQ ID NOs: 17 and 18.

In addition, the present invention provides a composition for multiple diagnosis of millet or crude virus, comprising the primer set for multiple diagnosis of millet or crude virus.

In addition, the present invention provides a kit for multiple diagnosis of millet or crude virus, comprising the composition for multiple diagnosis of millet or crude virus.

In addition, the present invention comprises the steps of: a) obtaining DNA from a sample; b) amplifying the DNA obtained in step a) using the primer set for multiple diagnostics of the millet or crude virus; And c) detecting the amplification product obtained in step b).

Using the primer set for multiple diagnosis of millet or crude virus of the present invention and the method for multiple diagnosis of millet or crude virus using the primer set, it is possible to perform multiple specific diagnosis for viruses occurring in the millet or crude. In addition, accurate and rapid multi-diagnosis of millet or crude virus can be performed even at low concentrations of samples, which can contribute to screening and analysis of damages to viral diseases occurring in domestic millet or crude and development of resistant varieties.

1 is a diagram showing the results of confirming the utility of the species-specific primer set of millet or crude by PCR and agarose gel electrophoresis.
FIG. 2 is a diagram showing the results of confirming the effectiveness of the final selected primer set for multiple diagnosis of millet virus by PCR and agarose gel electrophoresis.
FIG. 3 is a diagram showing the results of confirming the utility of primer sets for the final selection of crude virus multiplex diagnostics by PCR and agarose gel electrophoresis.
4 is a diagram showing the results of measuring the detection limit of a primer set for multiple diagnosis of millet or crude virus.

The present invention SEQ ID NO: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; And it provides a primer set for diagnosing millet virus, comprising at least one selected from the group consisting of primer pairs of SEQ ID NOs: 17 and 18.

The viruses include Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), and Panicum-like mosaic virus ( Panicum distortion mosaic virus (PDMV) may be one or more selected from the group consisting of. In addition, by using the primer set for multiple diagnosis of millet virus, it is possible to perform multiple specific diagnosis for viruses occurring in the millet.

In addition, the present invention SEQ ID NO: 1 and 2; SEQ ID NOs: 5 and 6; SEQ ID NOs: 9 and 10; And it provides a primer set for diagnosing crude viruses, comprising at least one selected from the group consisting of primer pairs of SEQ ID NOs: 11 and 12.

The viruses include Barley virus G (BVG), Rice stripe virus (RSV), Northern cereal mosaic virus (NCMV), and Setaria yellow dwarf virus (Setaria yellow dwarf virus, SeYDV) may be one or more selected from the group consisting of. In addition, by using the primer set for multiple diagnostics of the crude virus, multiple species-specific diagnosis of viruses occurring in the crude is possible.

In addition, the present invention can be used in the form of a diagnostic kit comprising the primer set for diagnosing the millet virus or a primer set for diagnosing the crude virus, and a diagnostic kit comprising the composition, which can be utilized as a method for diagnosing millet or crude virus using the same. have.

In addition, the present invention SEQ ID NO: 1 and 2; SEQ ID NOs: 5 and 6; SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; And it provides a primer set for multiple diagnosis of millet or crude virus, comprising at least one selected from the group consisting of primer pairs represented by SEQ ID NOs: 17 and 18.

In the present invention, "multi-diagnosis" means that various types of viruses occurring in millet, crude, or mixtures thereof can be simultaneously diagnosed or detected.

The virus is barley virus G (Barley virus G, BVG), rice black-streaked dwarf virus (RBSDV), rice stripe virus (RSV), panicum-like mosaic virus (Panicum) It may be one or more selected from the group consisting of distortion mosaic virus (PDMV), Northern cereal mosaic virus (NCMV) and Setaria yellow dwarf virus (SeYDV). In addition, using the primer set for multiple diagnosis of the millet or crude virus, it is possible to perform multiple specific diagnosis for viruses occurring in the millet or crude.

The base sequences described in SEQ ID NOs: 1 to 18 included in the primer set of the present invention are not limited thereto, and homologs of the base sequences are included within the scope of the present invention. Specifically, the primer set has a base sequence having a sequence homology of 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more, respectively, to the base sequences of SEQ ID NOs: 1 to 18. It may include. “% of sequence homology” to a polynucleotide is identified by comparing two optimally aligned sequences with a comparison region, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. It does not include) may be added or deleted (i.e., gap).

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3'hydroxyl group and a base pair and a template of a complementary nucleic acid.

can form (base pair) and function as a starting point for strand copying of nucleic acid templates

Means a short nucleic acid sequence. Primers can initiate DNA synthesis in the presence of reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures and four different nucleoside triphosphates.

When designing the primer, various restrictions such as the A, G, C, T content ratio of the primer, prevention of primer formation (dimer) formation, and prohibition of repetition of the same base sequence three or more times follow. (template) Conditions such as the amount of DNA, the concentration of the primer, the concentration of dNTP, the concentration of Mg ²⁺ , the reaction temperature, and the reaction time should be appropriate.

These primers can incorporate additional features that do not change the basic properties. That is, the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications are methylation, encapsulation, substitution of nucleotides with one or more homologues, and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates, or phosphorothioates or phosphorodithioates. It is possible to modify the nucleotides into a charged connection of the back. In addition, nucleic acids may include nucleases, toxins, antibodies, signal peptides, proteins such as poly L lysine, inserts such as acridine or psoralen, chelating agents such as metals, radioactive metals, iron oxidizing metals, and alkylating agents. It may have additional covalently bonded residues.

In addition, the primer sequence of the present invention can be modified using a label that can directly or indirectly provide a detectable signal. The primer may include a label that can be detected using spectroscopy, photochemistry, biochemistry, immunochemistry or chemical means. Useful labels include 32P, fluorescent dyes, electron dense reagents, enzymes (generally used in ELISA), biotin or haptens, and proteins available with antiserum or monoclonal antibodies.

The primers of the present invention include cloning of appropriate sequences and digestion of restriction enzymes and phosphotriester methods such as Narang (1979, Meth, Enzymol. 68:90-99), diethylphosphoramidi such as Beaucage. The method can be chemically synthesized using any other well-known method, including direct chemical synthesis, such as the Tetrahedron Lett. 22: 1859-1862 (1981, Tetrahedron Lett. 22: 18580-1862), and the solid support method of U.S. Pat.

In addition, the present invention provides a composition for multiple diagnosis of millet or crude virus, comprising the primer set for multiple diagnosis of millet or crude virus.

The composition may further include a reaction amplification mixture, wherein the reaction amplification mixture contains reagents, thermally stable DNA polymerase, deoxynucleotides, nuclease-free sterile water, and divalent metal cations necessary to perform the amplification reaction. Refers to a solution and the like, and preferably may include a reaction buffer, deoxynucleotide, and DNA polymerase.

In addition, the present invention provides a kit for multiple diagnosis of millet or crude virus, comprising the composition for multiple diagnosis of millet or crude virus.

The kit may further include reagents commonly used in methods for detecting nucleic acids in addition to the above-described composition for multiple diagnosis of millet or crude virus. For example, metal ion salts such as deoxynulceotide triphosphate (dNTP), heat-resistant polymerase, and magnesium chloride required for PCR reactions may be included, and dNTP, sequenase, etc. required for sequencing may be included. Can.

The kits can take the form of bottles, tubs, sachets, envelopes, tubes, ampoules, etc., which are partially or wholly plastic, glass, paper, foil, wax, etc. It can be formed from. The container may be equipped with a fully or partially removable stopper, which may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container can also be equipped with a stopper, which allows access to the contents by means of a needle. The kit may include an external package, and the external package may include instructions for use of components.

In addition, the present invention comprises the steps of: a) obtaining DNA from a sample; b) amplifying the DNA obtained in step a) using the primer set for multiple diagnostics of the millet or crude virus; And c) detecting the amplification product obtained in step b).

The virus is barley virus G (Barley virus G, BVG), rice black-streaked dwarf virus (RBSDV), rice stripe virus (RSV), panicum-like mosaic virus (Panicum) It may be one or more selected from the group consisting of distortion mosaic virus (PDMV), Northern cereal mosaic virus (NCMV) and Setaria yellow dwarf virus (SeYDV).

The amplification of step b) includes polymerase chain reaction, duplex polymerase chain reaction, duplex PCR, multiplex polymerase chain reaction, multiplex PCR, and reverse transcription polymerase. Reverse Transcription Polymerase Chain Reaction (RT-PCR), Competitive Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Realtime Quantitative Polymerase Chain Reaction), DNA chip (DNA chip), isothermal amplification (Loop-mediated isothermal amplification), and may be performed using any one method selected from the group consisting of, but is not limited to. Preferably, the amplification of step b) may be performed using a polymerase chain reaction or a reverse transcription polymerase chain reaction.

The detection of the amplification product in step c) may be performed using any one method selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, and combinations thereof, It is not limited to this. Preferably, the detection of the amplification product in step c) may be performed using gel electrophoresis.

Using the primer set for multiple diagnosis of millet or crude virus of the present invention and the method for multiple diagnosis of millet or crude virus using the primer set, it is possible to perform multiple specific diagnosis for viruses occurring in the millet or crude. In addition, accurate and rapid multi-diagnosis of millet or crude virus is also possible in low concentration samples, preferably samples diluted to 10 ^-1 to 10 ^-3 concentrations, and more preferably samples diluted to 10 ^-1 to 10 ^-2 concentrations. It is possible.

Hereinafter, the present invention will be described in more detail based on examples. The examples are only intended to illustrate the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the invention is not limited by these examples according to the gist of the present invention.

Example 1. Virus diagnosis in millet and jaw

Example 1-1. Sample collection and extraction of total RNA

In order to investigate the viruses occurring in the millet and group, samples of 60 and 100 groups of millet were collected from 10 cities and counties nationwide from April to September 2015. Then, the total RNA of the collected millet and crude was extracted using the easy-spin™ Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea) according to the manufacturer's manual.

Example 1-2. Virus diagnosis

The total RNA of the extracted millet and crude was analyzed by Next Generation Sequencing (NGS) and RT-PCR method to diagnose the virus.

As a result of the diagnosis, in the millet, 7 points of Barley virus G ( BVG), 1 point of rice black-streaked dwarf virus ( RBSDV), 2 points of rice stripe virus ( RSV) , Panicum distortion mosaic virus ( PDMV) 4 points were detected.

In addition, 10 points of BVG, 3 points of RSV, 1 point of Northern cereal mosaic virus ( NCMV) and 1 point of Setaria yellow dwarf virus ( SeYDV) were detected in the group. In particular, it was confirmed that the PDMV detected in the millet and the SeYDV detected in the tank are new viruses belonging to the Polerovirus genus.

Example 2. Design and confirmation of species-specific primer sets

Example 2-1. Species-specific primer set design

Species specific primers for each virus detected in the millet and bath were designed as follows. First, the nucleotide sequence information of viruses belonging to the genus such as 4 viruses derived from millet (BVG, RBSDV, RSV, PDMV) and 4 viruses derived from crude (BVG, NCMV, RSV, SeYDV) was downloaded from NCBI Genbank. Table 1 shows this.

Genus
(Genus) Virus name Abbreviation Accession Number country Polerovirus Barley virus G BVG NC_029906 Korea Panicum distortion mosaic virus PDMV - Korea Setaria yellow dwarf virus SeYDV LC333290 Korea Beet chlorosis virus BChV NC_002766 - Beet mild yellowing virus BMYV DQ132996 Germany Beet western yellows virus BWYV LC198684 Korea Carrot red leaf virus CtRLV NC_006265 - Cereal yellow dwarf virus-RPS CYDV-RPS NC_001298 - Cereal yellow dwarf virus-PRV CYDV-RPV EF521848 USA Chickpea chlorotic stunt virus CpCSV JF507725 China Cotton leafroll dwarf virus CLRDV NC_014545 Argentina Cucurbit aphid-borne yellows virus CABYV KR231959 Korea Maize yellow dwarf virus-RMV MYDV-RMV KC921392 USA Melon aphid-borne yellows virus MABYV JQ700307 Taiwan Pepper vein yellows virus PeYVV KP326573 China Potato leafroll virus PLRV KC456054 China Suakwa aphid-borne yellows virus SABYV KX122023 East Timor Sugarcane yellow leaf virus ScYLV JF925152 India Tobacco vein distorting virus TVDV NC_010732 China Turnip yellows virus TuYV KR706247 China White clover mottle virus WClMoV LC192169 Korea Fijivirus Rice black-streaked dwarf virus RBSDV JX083209 China Fiji disease virus FDV AY297694 - Maize rough dwarf virus MRDV JQ975001 Spain Mal de Rio Cuarto virus MRCV NC_008734 Argentina Nilaparvata lugens reovirus NLRV NC_003652 - Oat sterile dwarf virus OSDV AB011027 Japan Tenuivirus Rice stripe virus RSV JQ927433 China Iranian wheat stripe virus IWSV AY312434 Iran Maize stripe virus MSpV MSU53224 - Rice grassy stunt virus RGSV AF511072 China Cytorhabdovirus Northern cereal mosaic virus NCMV AB030277 Japan Alfalfa dwarf virus ADV KP205452 Argentina Barley yellow striate mosaic virus BYSMV KM213865 China Lettuce necrotic yellows virus LNYV NC_007642 Australia Lettuce yellow mottle virus LYMoV NC_011532 France

In the case of the new viruses PDMV and SeYDV, the entire base sequence analyzed in the inventors' lab was used, and the total base sequences of PDMV and SeYDV are shown in SEQ ID NOs: 21 and 22, respectively. The entire base sequence of the PDMV and SeYDV and the base sequence downloaded from NCBI Genbank were sorted by viruses of the same genus and sequence aligned using the DNAMAN ver 7.0 program. Subsequently, a species-specific primer set was designed using a sequence having only the virus to be amplified, and it is shown in Table 2.

Set number Virus name
(Acronym) Sequence number Primer name Sequence
(5' to 3') size
(bp) One Northern cereal mosaic virus
(NCMV) SEQ ID NO: 1 F-NCMV-F1 TAGATCTGATCATCAGCGAGG 512 SEQ ID NO: 2 F-NCMV-R1 TGATGGCCTCTTACCTGTCCT 2 Northern cereal mosaic virus
(NCMV) SEQ ID NO: 3 F-NCMV-F2 AGGAGAGCAAGTGAAGGTGTC 1,196 SEQ ID NO: 4 F-NCMV-R2 GATCTCATGCTCAATCCCTCG 3 Setaria yellow dwarf virus
(SeYDV) SEQ ID NO: 5 F-ScYLV-F1 ATCAACAATCGCGACAGAGC 789 SEQ ID NO: 6 F-ScYLV-R6 AGAAGTGTCATCTGCCGTCA 4 Setaria yellow dwarf virus
(SeYDV) SEQ.ID No. 7 F-ScYLV-F3 ACCTTGTACGCCCAGATTCA 713 SEQ.ID No. 8 F-ScYLV-R7 AGTCCTGACCATGACCACTG 5 Barley virus G
(BVG) SEQ ID NO: 9 F-BVG-F2 ATCCAGCTTCGACTGCTTGT 965 SEQ.ID No. 10 F-BVG-R2 CATCGACTTGCGAACTTCAA 6 Rice stripe virus
(RSV) SEQ ID NO: 11 F-RSV-F1 AAGCCCACCATAGTTGTTCG 1,509 SEQ.ID No. 12 F-RSV-R3 GTAATAGACGCCGGTGGAAA 7 Panicum distortion mosaic virus
(PDMV) SEQ.ID No. 13 P-CYDV-F3 TTTTCCGCGAGCCAAAACTG 794 SEQ.ID No. 14 P-CYDV-R3 CTGACCAGTCGAAACCGGAA 8 Panicum distortion mosaic virus
(PDMV) SEQ.ID No. 15 P-CYDV-F6 TATTTGCCGGTTCTCGCACT 843 SEQ.ID No. 16 P-CYDV-R6 ATGAGCTTCTGCGCCTCTTT 9 Rice black-streaked dwaf virus (RBSDV) SEQ.ID No. 17 S-RBSDV-S10-F5 CATTGTCAAATCGCCCCACG 561 SEQ.ID No. 18 S-RBSDV-S10-R5 CATCCGTAGTGCTTGCAGGA 10 Rice black-streaked dwaf virus (RBSDV) SEQ.ID No. 19 S-RBSDV-S10-F7 ACTCGAACAGACTTGGAGCG 503 SEQ.ID No. 20 S-RBSDV-S10-R7 CGGGTGCCAAATGAAATGCT

Example 2-2. Validation of species-specific primer sets

PCR analysis was performed to confirm the effectiveness of the designed species-specific primer set. To this end, cDNA was synthesized by using SuperiorScript III Reverse Transcriptase (Enzynomics, Korea) for the entire RNA extracted from millet and crude. Next, using the synthesized cDNA as a template strand, 2X TOPsimple™ DyeMIX (aliquot)-HOT was used to perform polymerase chain reaction (PCR) under the following conditions. First, 1 μl of cDNA template strand, 1 μl of 10 pmol/μl forward primer, 1 μl of 10 pmol/μl reverse primer, and 7 μl of DNase/RNase-free water (DW) were added to 10 μl of Premix to total 20 μl A reaction solution was prepared. After the initial denaturation at 95°C for 10 minutes, 35 cycles were repeated under conditions of 30 seconds at 95°C, 30 seconds at 55°C, and 1 minute and 30 seconds at 72°C. After the last extension for 5 minutes at 72°C, The PCR reaction was terminated by lowering the temperature to 10°C. Gene products amplified through PCR were electrophoresed with a 1.5% agarose gel to which 60 ml of 0.5 X TAE buffer, 1.5 g of Agarose LE, and 2 µl of EtBr were added, and confirmed by gel documentation (Gel Documentation). This is shown in Figure 1. Each lane number in FIG. 1 represents a set number in Table 2.

Example 3. Screening and identification of multiple diagnostic primer sets

Example 3-1. Selection of primer sets for multiple diagnostics

Primer sets capable of multi-diagnosing the viruses detected in the millet and bath were selected as follows. At this time, a variety of combinations were selected so that the bands of each species-specific primer did not show an interference effect with each other, so that a clearly distinguishable band appeared on the gel. To this end, RT-PCR was performed using Genetbio SuPrimeScript RT-PCR Premix SR-8000 (GeNeTBio Inc., Korea), and detailed conditions are as follows. To 10 µl of Premix, 0.5 µl of each viral RNA template strand derived from millet and crude, 1 µl of 10 pmol/µl forward primer of each virus, and 10 pmol/µl reverse primer were added to prepare a total reaction solution of 20 µl Did. Then, after undergoing a reverse transcription reaction at 50°C for 30 minutes and 95°C for 10 minutes, 35 cycles were repeated under conditions of 30 seconds at 95°C, 30 seconds at 55°C, and 1 minute and 30 seconds at 72°C, and 5 minutes at 72°C. Finally, after extending, the temperature was reduced to 10°C to terminate the reaction. The amplified gene product was confirmed by gel documentation by electrophoresis on a 1.5% agarose gel to which 60 ml of 0.5 X TAE buffer, 1.5 g of Agarose LE, and 2 µl of EtBr were added. Through this, a primer combination capable of clearly distinguishing the amplification products visually with minimal interference effect between each primer set and finally was selected. Multiple diagnostic primer sets 21 of the selected millet-derived viruses are shown in Table 3, and multiple diagnostic primer sets 12 of crude-derived viruses are shown in Table 4. In Tables 3 and 4, the Ref. number is a number corresponding to the set number in Table 2.

Set number Ref.
number Virus name
(Acronym) Primer name Sequence
(5'to 3') size
(bp) 11 5 Barley virus G
(BVG) F-BVG-F2 ATCCAGCTTCGACTGCTTGT 965 F-BVG-R2 CATCGACTTGCGAACTTCAA 6 Rice stripe virus
(RSV) F-RSV-F1 AAGCCCACCATAGTTGTTCG 1,509 F-RSV-R3 GTAATAGACGCCGGTGGAAA 7 Panicum distortion mosaic virus
(PDMV) P-CYDV-F3 TTTTCCGCGAGCCAAAACTG 794 P-CYDV-R3 CTGACCAGTCGAAACCGGAA 9 Rice black-streaked dwaf virus (RBSDV) S-RBSDV-S10-F5 CATTGTCAAATCGCCCCACG 561 S-RBSDV-S10-R5 CATCCGTAGTGCTTGCAGGA

Set number Ref.
No. Virus name
(Acronym) Primer name Sequence
(5'to 3') size
(bp) 12 One Northern cereal mosaic virus
(NCMV) F-NCMV-F1 TAGATCTGATCATCAGCGAGG 512 F-NCMV-R1 TGATGGCCTCTTACCTGTCCT 3 Setaria yellow dwarf virus
(SeYDV) F-ScYLV-F3 ACCTTGTACGCCCAGATTCA 713 F-ScYLV-R7 AGTCCTGACCATGACCACTG 5 Barley virus G
(BVG) F-BVG-F2 ATCCAGCTTCGACTGCTTGT 965 F-BVG-R2 CATCGACTTGCGAACTTCAA 6 Rice stripe virus
(RSV) F-RSV-F1 AAGCCCACCATAGTTGTTCG 1,509 F-RSV-R3 GTAATAGACGCCGGTGGAAA

Example 3-2. Validation of multiple diagnostic primer sets

PCR analysis was performed under the same conditions as in Example 2 to confirm the effectiveness of the primer set 11 for millet virus multi-diagnosis of Table 3 and the primer set 12 for crude virus multi-diagnosis of Table 4. Subsequently, the gene product amplified by PCR was confirmed through gel electrophoresis, and the results of the primer sets for multiple diagnosis of millet and crude viruses are shown in FIGS. 2 and 3, respectively.

As shown in FIG. 2, it was confirmed that the set 11, which is a primer set for multiple diagnosis of millet virus, can accurately detect BVG, RBSDV, RSV, and PDMV, which are millet-derived viruses, without causing each primer to interfere with each other.

In addition, as shown in FIG. 3, it is confirmed that the set 12, which is a primer set for multiple diagnosis of crude virus, can accurately and simultaneously detect the virus, BVG, NCMV, RSV, and SeYDV, from each primer, without interfering with each other. Did.

Example 4. Measurement of detection limit of primer set for multiple diagnosis

In order to evaluate the virus detection limit of the finally selected primer sets 11 and 12, first, the positive control of each virus derived from millet and crude was collected, and total RNA for each virus was extracted. The extracted RNA was diluted 10-fold (10 ^-1 , 10 ^-2 , 10 ^-3 , 10 ^-4 , 10 ^-5 , 10 ^-6 , 10 ^-7 ) and used in the experiment. PCR conditions were the same as in the conditions and methods of the above Examples, and only the samples were used with different RNAs extracted and diluted for each virus. The gene product amplified by PCR was analyzed by gel electrophoresis and shown in FIG. 4. In Figure 4, Lanes 1 to 8 represent 10 ^0, 10 ^-1 , 10 ^-2 , 10 ^-3 , 10 ^-4 , 10 ^-5 , 10 ^-6 , and 10 ^-7 dilution multiples, respectively.

As shown in FIG. 4, bands were visually confirmed in samples diluted to 10 ^{-2 in} both sets 11 and 12, which are the primer set for the diagnosis of millet or crude virus multiplexing, as a result of the detection limit measurement. In addition, it was confirmed that it is possible to accurately detect viruses derived from millet or crude in multiples even when using a sample with a low concentration.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Primer set for Multiplex RT-PCR of Proso millet or Foxtail millet Viruses and use thereof <130> KNU1.306P <160> 22 <170> KoPatentIn 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-F1 <400> 1 tagatctgat catcagcgag g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-R1 <400> 2 tgatggcctc ttacctgtcc t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-F2 <400> 3 aggagagcaa gtgaaggtgt c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-R2 <400> 4 gatctcatgc tcaatccctc g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-F1 <400> 5 atcaacaatc gcgacagagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-R6 <400> 6 agaagtgtca tctgccgtca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-F3 <400> 7 accttgtacg cccagattca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-R7 <400> 8 agtcctgacc atgaccactg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-BVG-F2 <400> 9 atccagcttc gactgcttgt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-BVG-R2 <400> 10 catcgacttg cgaacttcaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-RSV-F1 <400> 11 aagcccacca tagttgttcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-RSV-R3 <400> 12 gtaatagacg ccggtggaaa 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-F3 <400> 13 ttttccgcga gccaaaactg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-R3 <400> 14 ctgaccagtc gaaaccggaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-F6 <400> 15 tatttgccgg ttctcgcact 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-R6 <400> 16 atgagcttct gcgcctcttt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S-RBSDV-S10-F5 <400> 17 cattgtcaaa tcgccccacg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S-RBSDV-S10-R5 <400> 18 catccgtagt gcttgcagga 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S-RBSDV-S10-F7 <400> 19 actcgaacag acttggagcg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> S-RBSDV-S10-R7 <400> 20 cgggtgccaa atgaaatgct 20 <210> 21 <211> 5863 <212> DNA <213> Unknown <220> <223> Panicum distortion mosaic virus <400> 21 tctcagcaga gttcctgcat ggcagtaaaa agatagggag gggactcacc tgtcttttga 60 agcactcctc tgctctcgca cgaagttgat caagatcctt catgcgagct attcttggca 120 caaccagaat agtcttccac ggtcgtaacg ctcccgaaac ggtcgaagag ctcgcttctt 180 gcttgacgct catcgaattt caggctagaa ggtattacgc cctcgcccga agcgaccccc 240 tctcagcaga gttcctgcat ggcgctaact tttctaatgt tggtgcttat gttagccacc 300 ttaggcgcct cttgtgcgcc tacatccctg tgctactcct taacggaacc agccttacaa 360 gcacagggct catcaccgta cgactcgact tcctggtacc agtcctacga tggttacaat 420 gtcaccggct ttacccgtac attaccatcc gtagtagaag gttcaggatt gaccaaaatc 480 gaacggtcgg accaacgctt tatcgatctc tcatatggag atatgatttt ctggttcggc 540 ttcaagatac gagtcgactt gctaacatta gcaggagagg tccagagtat ttcaacaccc 600 aaatggcagt cattctgtca gggattgaaa gaaggattct cgagattcct gaacagcact 660 ttgtggatga tatacaacta ctatctttgg tgtgttttat acacgatcaa attgatagca 720 tcattcttgt tgatgacctg gaagccgatg tcagccattg ggctggctct ggccatcaca 780 tcatccatga tttgggccat caagcggata tactcgtgca ttccggtctt ttggatcgga 840 atacctttca ggcttttgca caaagccctc cgctggctgt tcaggaagaa cggagatgaa 900 aaagctgttc aaggctttaa cagctactcc gttaagatgg cccctccagg aaagtcggtt 960 ctggaaatcc tcttcgcaga caactcacac tgtggttacg cttcgtgcgt acgccttcag 1020 accggagagg acgccctgtt aacttcacta cactgttgcg atccaacata caaagtgagg 1080 tctttcagga ctggctcaat gatcccgttg agccaattcc agatcatttt cccttccgag 1140 aagcttgatt tggtgattct tcgaggtcca accgaatgga aatcgcttct cggcgccaaa 1200 gcctcccaca tgaagacagc agaccgcctt tcaaaacaag gtgtgtcctt cttcaccttt 1260 aatggacagt gggaaatgca taacgcaaaa gtggttggct cggacggact cttcgtgagc 1320 gtcctgagca acaccactaa aggctacagc ggaaccccct acttcgttgg caaagacatt 1380 attggggtgc acaagggata tgacgggaat gactcgagca agaactacaa tctgatggct 1440 ccgatccctc ccatcgaggg attgacgaag cctcagtacg tttacgagtc ttctacgatt 1500 gacggagacg tatacagcga agaagaaatt gaagaattaa cgaaatacgc tgtagacacc 1560 tttgaaaagg ttaagaaggt gtcgtcctcc tggagaccta gccacaatga agaatggtgg 1620 ctagatagcc tcgctgatga agcagcatca cccccaaaaa ctccggcaac cgttgagttt 1680 cagggaaacg aggcgcgtgg caccgaccac caggaaaaac cggtatccac ccttgccaag 1740 cccgccgact ctaccgacga catgctgcgc gaaatcgtag cacagatagt gggcaggatc 1800 gacctgagtg ctctcactca gagggtggag gggaagctgc tgaaccaagt caaatctgca 1860 cagaacaagc aggttcggca gccggaggtc aagaggacac gatcacgaaa acgaaatacc 1920 tcgaagagtt cctcaagtcc gccttcaaat gggatgacga acccaccagt ggtgaaatcc 1980 cagggttcag gaaaacagga cgcctccccg cgctatatca tccccaaaaa ccgaaagaca 2040 caaccttcgg ggatggtatc atcagcgccc acccagaaat ggcggccaaa atcgccgggt 2100 tcgggtggcc ccagttcggc gctgccgccg aaaagacaag tctgaaactt caggctgatc 2160 gctggctctc tcgagctcag tcagcggtta aaccatcggc agcaaaacga gagctcgtga 2220 tccaacatgc ggtagaaagg tacaaactct gccaaacaca aatgccgcat actagtgccc 2280 ctggacagct taaatgggga aatttcttga aagatttcaa ggaagctgtc cactcacttg 2340 agctggatgc aggaatcggc ctcccataca aagtcctgaa gatgcaaacc cacagagata 2400 tggttgagga ccccgattac ctgcccttat tgactcgcct cgtctggaac cgcctatcga 2460 agatgtccca ggcgaagttt gaggatatga gcccagaaca gctcgtgaga gagggattgt 2520 gcgacccgat acgcttgttc atcaaaggag agccgcacaa acaatcgaaa cttgatgaag 2580 gccgctaccg cctcatcatg tcagtgtcac tagtggatca actggtagcc cgggttttat 2640 ttcaaagcca aaacaaacgc gagatatcct tgtggaggga tatcccgtca aaacccggtt 2700 tcggcttatc cactgacagc gaggcgaaag agtttatcag aacgctgtca aaggttgtgg 2760 gttgtcctcc acaaacgctc attcatgagt ggaaggacaa agtcgtaccc accgactgtt 2820 ccggtttcga ctggtcggtc gccgattgga tgctcgagga tgatatggag gtgagaaatc 2880 gcctcacatt taactgcaac gagctcacca ggcgcctccg cgcatgctgg ttgaagtgca 2940 taacaaattc tgtgttgtgc acatccgacg gaaccttgta cgcccagatt catcctggtg 3000 tgcagaaatc cggctcgtac aatacgagct cgtcgaattc caggattaga gttatggccg 3060 catatcactg cggcgccaaa tgggcgatag ccatggggga tgacgcactt gaatccccag 3120 aaaccgacct taacgcctac aagaagctcg gtttcaaagt cgaggtatcc tcacagctag 3180 aattttgctc acacgtcttt gagcaggagg acctcgccag gccgttgaac gtcgcgaaaa 3240 cattatatag gttgatctac ggatacaacc cggcctgtgg caacccggag gtgttagcta 3300 actacctcca agcagtggcg agcgtattga acatactccg tcatgaccct gctgaggttg 3360 ccaagctccg taactggctc cttcctggcg ggggccagta aaaagatacg gagggaaaag 3420 tagccaccat cttcgttgca agagtggagc tttagtcgaa gaacgcagcc gattctggat 3480 tataaattgc tagctggtgt gctcattgga gtaatcatca caactccgct agtagtagtg 3540 gctgcgtacc tggcatttct caaaatcagt gcacatatca gagcgatagt taatgaatac 3600 gggcgctgct agacgctcac gcagaaatgt cagaaggcgc tctaaccgtc gtcgatcgac 3660 tcggccagtg gtcatggtca ggactacccc aagatctcga cgagtacgac gacgtggagc 3720 acgtgtcgga ggaaacgctg tgcgaggatt acgaggagga agcaaccggg atgttctcac 3780 tttcacggtt gacgatctca aagccaacag ctccgggatc ctcaagttcg gaccgagttt 3840 atctcagtac ccagcgttca acaatggctt actcaaagcc taccatgagt ataaaatcac 3900 aagtctcaca gtacagtata actcatgctc ctccgacgcc acttcaggtg caatcgcact 3960 tgaagtggat acgtcctgct cccaaacagc aacaggctcc aaaatcgtta gcttccccgt 4020 caagaggaac gccacgaaag tcttccccac ccagtacatt aagggtcaaa acttcatgac 4080 tacatcagct gatcaatttt ggctgttgta caaagggaat ggcgatggaa gcctagcagg 4140 acaattcgtc tgccgatttg aatgtcaatt tcagaatcca aaataggtag gcgacgctcc 4200 cccaacaccc acacccaccc ctacaccaac accgactccc actccgaccc ctactccggc 4260 accagcaccc aaattctttg gatatcaagg tgtgccgacg agtatcgtca aaaccagagg 4320 aaacaatgag ttttgcgatg tgggttcact caacaatgtc tccatgtatt tctggaaaga 4380 tgaagcttgg agtgttgaga cactgtcagc gggctacagc atcaacaatc gcgacagagc 4440 cacccccttt ttcctggttc cagttgagaa agggagatac tccgtgtaca tacaatgtga 4500 gggctttaag gcagttaaag ccaaaggtgg ttccaatgat ggccgcatga gtggtttcat 4560 cacagataat ccgagtcagg cagggtggag agcgtacaat tacgatgggt gtgtaatatc 4620 gaactacaaa gctagtaacg acagggtgca aggacatccc gacctcaagg tcaacggatg 4680 ttctttctca gaccagcttg tagagaccga tttttactgt tcgtttcacc tcgaggtggc 4740 cactgaagga tactttggtg tccaggcacc tcccatagag aaggatgatc attacaacta 4800 tgtggtgtcc tacgcaaact tcactgagaa agtgatggaa tggggctcag tctccatcgc 4860 gatggacgag gtaaacgagg gagcgtatcg cgcgtcgaaa tgggataaga ccgcaccagt 4920 gaatgctcga ttgtcgggtc agatcagcgc ctcatcggag gtttatactc cggtggaatc 4980 tgacacaaaa ccgcaatcag aacggacgga gagtacgcct ccagcccgga ccctccaggt 5040 acaaggggtt aaaaccgaac cacccatcaa aatcgctgat aaaccggatc ctaaagtcat 5100 gagctggtta catgaccaac cggttgtcga agctgtcgta aagggggatt tcactcacga 5160 aactgtgtat ccaccaccac ccccgcctct gacggcagat gacacttctc gccaagccgc 5220 aaaagtcgtt cgaactttga tggccaacgc tgatgaagcg cctgcccaaa cacctggcca 5280 agatgtgcaa acgtcgatgc cggtttccaa gacagaggag cacagcgata gcgatgagga 5340 tgcggcgtcc atcacaccct cgagagcggg aacgctctct ggagggtctc ttcgaggagg 5400 atctcttcga ggagggttaa agccaaaacc atacgcagct gaacaagcag tggatgatga 5460 attggcttca atcagcggac gttccggagg tggatccctt ggcgggggat ctctccgggg 5520 aggaaccttg cgttccacac ctagtctggt atctcgagaa atgactcaag ccgaacgaaa 5580 catgtatcgg gatatcttga acagcagagg taaaactgct gcagcagagt gggctgcagc 5640 catgggaaaa gacatacctc aggctaggag accgcgcctc tttgggtgat ttaaccacta 5700 cgccaccgtc cagctctcga cattaaatgg agcgcctgcc gaggcaaaac gagacgggct 5760 aaccacccgg ccgccctcca gctaagacca cttagactgg agtggtttct cacggtcaat 5820 gagaagacat tcctgggagc actgcttcca ggttttgttg gta 5863 <210> 22 <211> 5838 <212> DNA <213> Unknown <220> <223> SeYDV <400> 22 gtaaaaagat agggagggga ctcacctgtc ttttgaagca ctcctctgct ctcgcacgaa 60 gttgatcaag atccttcatg cgagctattc ttggcacaac cagaatagtc ttccacggtc 120 gtaacgctcc cgaaacggtc gaagagctcg cttcttgctt gacgctcatc gaatttcagg 180 ctagaaggta ttacgccctc gcccgaagcg accccctctc agcagagttc ctgcatggcg 240 ctaacttttc taatgttggt gcttatgtta gccaccttag gcgcctcttg tgcgcctaca 300 tccctgtgct actccttaac ggaaccagcc ttacaagcac agggctcatc accgtacgac 360 tcgacttcct ggtaccagtc ctacgatggt tacaatgtca ccggctttac ccgtacatta 420 ccatccgtag tagaaggttc aggattgacc aaaatcgaac ggtcggacca acgctttatc 480 gatctctcat atggagatat gattttctgg ttcggcttca agatacgagt cgacttgcta 540 acattagcag gagaggtcca gagtatttca acacccaaat ggcagtcatt ctgtcaggga 600 ttgaaagaag gattctcgag attcctgaac agcactttgt ggatgatata caactactat 660 ctttggtgtg ttttatacac gatcaaattg atagcatcat tcttgttgat gacctggaag 720 ccgatgtcag ccattgggct ggctctggcc atcacatcat ccatgatttg ggccatcaag 780 cggatatact cgtgcattcc ggtcttttgg atcggaatac ctttcaggct tttgcacaaa 840 gccctccgct ggctgttcag gaagaacgga gatgaaaaag ctgttcaagg ctttaacagc 900 tactccgtta agatggcccc tccaggaaag tcggttctgg aaatcctctt cgcagacaac 960 tcacactgtg gttacgcttc gtgcgtacgc cttcagaccg gagaggacgc cctgttaact 1020 tcactacact gttgcgatcc aacatacaaa gtgaggtctt tcaggactgg ctcaatgatc 1080 ccgttgagcc aattccagat cattttccct tccgagaagc ttgatttggt gattcttcga 1140 ggtccaaccg aatggaaatc gcttctcggc gccaaagcct cccacatgaa gacagcagac 1200 cgcctttcaa aacaaggtgt gtccttcttc acctttaatg gacagtggga aatgcataac 1260 gcaaaagtgg ttggctcgga cggactcttc gtgagcgtcc tgagcaacac cactaaaggc 1320 tacagcggaa ccccctactt cgttggcaaa gacattattg gggtgcacaa gggatatgac 1380 gggaatgact cgagcaagaa ctacaatctg atggctccga tccctcccat cgagggattg 1440 acgaagcctc agtacgttta cgagtcttct acgattgacg gagacgtata cagcgaagaa 1500 gaaattgaag aattaacgaa atacgctgta gacacctttg aaaaggttaa gaaggtgtcg 1560 tcctcctgga gacctagcca caatgaagaa tggtggctag atagcctcgc tgatgaagca 1620 gcatcacccc caaaaactcc ggcaaccgtt gagtttcagg gaaacgaggc gcgtggcacc 1680 gaccaccagg aaaaaccggt atccaccctt gccaagcccg ccgactctac cgacgacatg 1740 ctgcgcgaaa tcgtagcaca gatagtgggc aggatcgacc tgagtgctct cactcagagg 1800 gtggagggga agctgctgaa ccaagtcaaa tctgcacaga acaagcaggt tcggcagccg 1860 gaggtcaaga ggacacgatc acgaaaacga aatacctcga agagttcctc aagtccgcct 1920 tcaaatggga tgacgaaccc accagtggtg aaatcccagg gttcaggaaa acaggacgcc 1980 tccccgcgct atatcatccc caaaaaccga aagacacaac cttcggggat ggtatcatca 2040 gcgcccaccc agaaatggcg gccaaaatcg ccgggttcgg gtggccccag ttcggcgctg 2100 ccgccgaaaa gacaagtctg aaacttcagg ctgatcgctg gctctctcga gctcagtcag 2160 cggttaaacc atcggcagca aaacgagagc tcgtgatcca acatgcggta gaaaggtaca 2220 aactctgcca aacacaaatg ccgcatacta gtgcccctgg acagcttaaa tggggaaatt 2280 tcttgaaaga tttcaaggaa gctgtccact cacttgagct ggatgcagga atcggcctcc 2340 catacaaagt cctgaagatg caaacccaca gagatatggt tgaggacccc gattacctgc 2400 ccttattgac tcgcctcgtc tggaaccgcc tatcgaagat gtcccaggcg aagtttgagg 2460 atatgagccc agaacagctc gtgagagagg gattgtgcga cccgatacgc ttgttcatca 2520 aaggagagcc gcacaaacaa tcgaaacttg atgaaggccg ctaccgcctc atcatgtcag 2580 tgtcactagt ggatcaactg gtagcccggg ttttatttca aagccaaaac aaacgcgaga 2640 tatccttgtg gagggatatc ccgtcaaaac ccggtttcgg cttatccact gacagcgagg 2700 cgaaagagtt tatcagaacg ctgtcaaagg ttgtgggttg tcctccacaa acgctcattc 2760 atgagtggaa ggacaaagtc gtacccaccg actgttccgg tttcgactgg tcggtcgccg 2820 attggatgct cgaggatgat atggaggtga gaaatcgcct cacatttaac tgcaacgagc 2880 tcaccaggcg cctccgcgca tgctggttga agtgcataac aaattctgtg ttgtgcacat 2940 ccgacggaac cttgtacgcc cagattcatc ctggtgtgca gaaatccggc tcgtacaata 3000 cgagctcgtc gaattccagg attagagtta tggccgcata tcactgcggc gccaaatggg 3060 cgatagccat gggggatgac gcacttgaat ccccagaaac cgaccttaac gcctacaaga 3120 agctcggttt caaagtcgag gtatcctcac agctagaatt ttgctcacac gtctttgagc 3180 aggaggacct cgccaggccg ttgaacgtcg cgaaaacatt atataggttg atctacggat 3240 acaacccggc ctgtggcaac ccggaggtgt tagctaacta cctccaagca gtggcgagcg 3300 tattgaacat actccgtcat gaccctgctg aggttgccaa gctccgtaac tggctccttc 3360 ctggcggggg ccagtaaaaa gatacggagg gaaaagtagc caccatcttc gttgcaagag 3420 tggagcttta gtcgaagaac gcagccgatt ctggattata aattgctagc tggtgtgctc 3480 attggagtaa tcatcacaac tccgctagta gtagtggctg cgtacctggc atttctcaaa 3540 atcagtgcac atatcagagc gatagttaat gaatacgggc gctgctagac gctcacgcag 3600 aaatgtcaga aggcgctcta accgtcgtcg atcgactcgg ccagtggtca tggtcaggac 3660 taccccaaga tctcgacgag tacgacgacg tggagcacgt gtcggaggaa acgctgtgcg 3720 aggattacga ggaggaagca accgggatgt tctcactttc acggttgacg atctcaaagc 3780 caacagctcc gggatcctca agttcggacc gagtttatct cagtacccag cgttcaacaa 3840 tggcttactc aaagcctacc atgagtataa aatcacaagt ctcacagtac agtataactc 3900 atgctcctcc gacgccactt caggtgcaat cgcacttgaa gtggatacgt cctgctccca 3960 aacagcaaca ggctccaaaa tcgttagctt ccccgtcaag aggaacgcca cgaaagtctt 4020 ccccacccag tacattaagg gtcaaaactt catgactaca tcagctgatc aattttggct 4080 gttgtacaaa gggaatggcg atggaagcct agcaggacaa ttcgtctgcc gatttgaatg 4140 tcaatttcag aatccaaaat aggtaggcga cgctccccca acacccacac ccacccctac 4200 accaacaccg actcccactc cgacccctac tccggcacca gcacccaaat tctttggata 4260 tcaaggtgtg ccgacgagta tcgtcaaaac cagaggaaac aatgagtttt gcgatgtggg 4320 ttcactcaac aatgtctcca tgtatttctg gaaagatgaa gcttggagtg ttgagacact 4380 gtcagcgggc tacagcatca acaatcgcga cagagccacc ccctttttcc tggttccagt 4440 tgagaaaggg agatactccg tgtacataca atgtgagggc tttaaggcag ttaaagccaa 4500 aggtggttcc aatgatggcc gcatgagtgg tttcatcaca gataatccga gtcaggcagg 4560 gtggagagcg tacaattacg atgggtgtgt aatatcgaac tacaaagcta gtaacgacag 4620 ggtgcaagga catcccgacc tcaaggtcaa cggatgttct ttctcagacc agcttgtaga 4680 gaccgatttt tactgttcgt ttcacctcga ggtggccact gaaggatact ttggtgtcca 4740 ggcacctccc atagagaagg atgatcatta caactatgtg gtgtcctacg caaacttcac 4800 tgagaaagtg atggaatggg gctcagtctc catcgcgatg gacgaggtaa acgagggagc 4860 gtatcgcgcg tcgaaatggg ataagaccgc accagtgaat gctcgattgt cgggtcagat 4920 cagcgcctca tcggaggttt atactccggt ggaatctgac acaaaaccgc aatcagaacg 4980 gacggagagt acgcctccag cccggaccct ccaggtacaa ggggttaaaa ccgaaccacc 5040 catcaaaatc gctgataaac cggatcctaa agtcatgagc tggttacatg accaaccggt 5100 tgtcgaagct gtcgtaaagg gggatttcac tcacgaaact gtgtatccac caccaccccc 5160 gcctctgacg gcagatgaca cttctcgcca agccgcaaaa gtcgttcgaa ctttgatggc 5220 caacgctgat gaagcgcctg cccaaacacc tggccaagat gtgcaaacgt cgatgccggt 5280 ttccaagaca gaggagcaca gcgatagcga tgaggatgcg gcgtccatca caccctcgag 5340 agcgggaacg ctctctggag ggtctcttcg aggaggatct cttcgaggag ggttaaagcc 5400 aaaaccatac gcagctgaac aagcagtgga tgatgaattg gcttcaatca gcggacgttc 5460 cggaggtgga tcccttggcg ggggatctct ccggggagga accttgcgtt ccacacctag 5520 tctggtatct cgagaaatga ctcaagccga acgaaacatg tatcgggata tcttgaacag 5580 cagaggtaaa actgctgcag cagagtgggc tgcagccatg ggaaaagaca tacctcaggc 5640 taggagaccg cgcctctttg ggtgatttaa ccactacgcc accgtccagc tctcgacatt 5700 aaatggagcg cctgccgagg caaaacgaga cgggctaacc acccggccgc cctccagcta 5760 agaccactta gactggagtg gtttctcacg gtcaatgaga agacattcct gggagcactg 5820 cttccaggtt ttgttggt 5838

Claims (11)

SEQ ID NOs: 9 and 10; SEQ ID NOs: 11 and 12; SEQ ID NOs: 13 and 14; And a primer set of SEQ ID NOs: 17 and 18, the primer set for multiple diagnosis of millet or crude virus.
According to claim 1,
The viruses include Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), and Panicum-like mosaic virus ( Panicum distortion mosaic virus (PDMV) Primer set for multiple diagnosis of millet or crude virus, 1 or more selected from the group consisting of.
According to claim 1,
SEQ ID NOs: 1 and 2; Or further comprising a primer pair of SEQ ID NO: 5 and 6, the primer set for multiple diagnosis of millet or crude virus.
According to claim 3,
The virus is barley virus G (Barley virus G, BVG), rice black-streaked dwarf virus (RBSDV), rice stripe virus (RSV), panicum-like mosaic virus (Panicum) A set of primers for multiple diagnostics of millet or crude virus, selected from the group consisting of distortion mosaic virus (PDMV), Northern cereal mosaic virus (NCMV) and Setaria yellow dwarf virus (SeYDV).
According to claim 1,
SEQ ID NOs: 1 and 2; And SEQ ID NOs: 5 and 6 primer pairs further comprising a primer set for multiple diagnosis of millet or crude virus.
The method of claim 5,
The virus is barley virus G (Barley virus G, BVG), rice black-streaked dwarf virus (RBSDV), rice stripe virus (RSV), panicum-like mosaic virus (Panicum) A set of primers for multiple diagnostics of millet or crude virus, selected from the group consisting of distortion mosaic virus (PDMV), Northern cereal mosaic virus (NCMV) and Setaria yellow dwarf virus (SeYDV).
A composition for multiple diagnosis of millet or crude virus comprising the primer set for multiple diagnosis of millet or crude virus according to any one of claims 1 to 6.
A kit for multiple diagnosis of millet or crude virus, comprising the composition for multiple diagnosis of millet or crude virus according to claim 7.
a) obtaining DNA from a sample;
b) amplifying the DNA obtained in step a) by using the primer set for multiple diagnosis of millet or crude virus according to any one of claims 1 to 6; And
c) detecting the amplification product obtained in the step b); millet or crude virus multi-diagnosis method comprising a.
The method of claim 9,
The amplification of step b) includes polymerase chain reaction, duplex polymerase chain reaction, duplex PCR, multiplex polymerase chain reaction, multiplex PCR, and reverse transcription polymerase. Reverse Transcription Polymerase Chain Reaction (RT-PCR), Competitive Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Realtime Quantitative Polymerase Chain Reaction), DNA chip (DNA chip), isothermal amplification (Loop-mediated isothermal amplification), and any one method selected from the group consisting of combinations, millet or crude virus multiplex diagnostic method.
The method of claim 9,
The detection of the amplification product in step c) is characterized by using any one method selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radiometric measurement, fluorescence measurement, phosphorescence measurement, and combinations thereof. Or crude virus multiple diagnostic methods.

Images