KR20190072945A - Primer set for Multiplex RT-PCR of Proso millet or Foxtail millet Viruses and use thereof - Google Patents

Abstract

The present invention relates to a primer for multi-diagnosis of viruses derived from millet and more specifically, to a primer set for multi-diagnosis of viruses derived from millet, a composition comprising the same, a kit comprising the composition and a method for multi-diagnosis of viruses derived from millet using the primer set. According to the primer set for multi-diagnosis of viruses derived from millet and the method for multi-diagnosis of viruses derived from millet using the primer set, a multi-diagnosis for species-specific viruses generating in millet is possible. In addition, the present invention enables accurate and rapid multi-diagnosis of millet viruses even with a low concentrate sample, thereby contributing to screening and damage analysis related to viral diseases occurring in domestic millet and development of species having resistance.

Description

Multi-diagnostic primers for veterinary or avian viruses and their uses {Primer set for Multiplex RT-PCR of Proso millet or Foxtail millet Viruses and use thereof.

More particularly, the present invention relates to a primer set for multi-diagnosis of a mammalian or roe-derived virus, a composition comprising the same, a kit comprising the composition, and a primer set using the primer set And more particularly, to a method for multiplex diagnosis of avian virus.

Most of the agronomically important crops are harvested and quality degraded by plant viruses or viroid infections, resulting in serious economic losses. Unlike diseases caused by fungi or bacteria, diseases caused by plant viruses can not be prevented or treated by spraying pesticides. Therefore, precise and rapid diagnosis of viral infection of plants and seeds is a prerequisite for virus disease management in advance, and prevention of damage caused by viral infection of cultivated crops.

In the past, electron microscopy and serological methods were mainly used for virus diagnosis. Among them, electron microscopy can detect the presence of virus but it is impossible to diagnose the species as a morphological feature. Among the serologic methods, the enzyme-linked immunosorbent assay (ELISA) is about 1,000 times lower in detection sensitivity than the most commonly used diagnostic methods or PCR methods, and the unexpected non-specificity of the antibody and test sample Often, the diagnosis fails due to a reaction. In addition, since the diagnosis of various pathogens must be performed on a single test sample at the quarantine site, many laboratories and inspection costs are required when using various diagnostic methods.

Therefore, PCR method which has high detection sensitivity and convenience is most commonly used for diagnosis of viruses. An important point in the development of primers for PCR diagnosis of pathogens is that first, all strains and isolates present in the virus species must be detectable. For this purpose, a primer should be designed for all strains of the viruses to be detected and the common nucleotide sequence of the isolate. Second, there should be specificity among different species. For this purpose, a primer that does not react with the nucleotide sequences of other viruses that are closely related to the target virus species should be designed.

However, in the case of such a primer, since it is a primer capable of only a partial diagnosis of individual viruses, there is a problem in diagnosing a crop infected with a large number of viruses. In addition, since the use of isolate-specific primers may fail to diagnose, development of species-specific primers capable of detecting all the isolates present in the virus species is required.

Accordingly, the inventors of the present invention have completed the present invention by developing a multi-diagnostic primer for veterinary or crude viruses while studying a primer for multiplex diagnosis of viral diseases occurring in a millet and a barn.

Accordingly, an object of the present invention is to provide a multiplex diagnostic primer set for a mammalian or crude virus, a composition comprising the same, a kit containing the composition, and a method for diagnosing a mammal or avian virus using the primer set.

In order to achieve the above object, SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; And a pair of primers of SEQ ID NOS: 17 and 18, respectively.

The present invention also relates to a pharmaceutical composition comprising a compound of SEQ ID NO: 1 and 2; SEQ ID NOS: 5 and 6; SEQ ID NOS: 9 and 10; And a pair of primers of SEQ ID NOS: 11 and 12, respectively.

The present invention also relates to a pharmaceutical composition comprising a compound of SEQ ID NO: 1 and 2; SEQ ID NOS: 5 and 6; SEQ ID NOS: 9 and 10; SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; And a pair of primers represented by SEQ ID NOs: 17 and 18, wherein the primer set comprises at least one selected from the group consisting of:

In addition, the present invention provides a composition for multiparity or avirulent multiple diagnosis comprising a primer set for multiparous or aviriviral multiple diagnosis.

The present invention also provides a kit for multiparameter or avirulent multiple diagnosis comprising the composition for multiparity or avirulence diagnosis.

The present invention also relates to a method for preparing a DNA fragment, comprising: a) obtaining DNA from a sample; b) amplifying the DNA obtained in step a) using the primer set or crude virus multiple primer set; And c) detecting the amplification product obtained in step b).

Using the primer set or aviriviral multiplex diagnosis primer set of the present invention and the primer set or aviriviral multiplex diagnosis method using the primer set of the present invention, species-specific multiple diagnosis of viruses occurring in a plant or a plant can be performed. In addition, accurate and rapid diagnosis of millet or virus can be performed even at a low concentration of sample, which can contribute to the screening of viral diseases occurring in Korean millet or barn, analysis of damage status and development of resistant varieties.

FIG. 1 shows the result of PCR and agarose gel electrophoresis confirming the utility of a primer set specific for a shoot or a shoot. FIG.
FIG. 2 is a graph showing the results of PCR and agarose gel electrophoresis showing the utility of a finally selected primer set for multiplex detection of vernier virus. FIG.
FIG. 3 is a graph showing the results of PCR and agarose gel electrophoresis showing the utility of the finally selected multi-diagnostic primer set for crude virus. FIG.
Fig. 4 is a diagram showing the results of detection limit measurement of primer sets or aviral multivariate diagnostic primer sets.

The present invention relates to an isolated nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; And a pair of primers of SEQ ID NOS: 17 and 18, respectively.

The virus may be selected from the group consisting of Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), and Panicum malformed virus Panicum distortion mosaic virus, PDMV). In addition, by using the primer set for multiparity virus detection, it is possible to carry out species-specific multiple diagnosis of viruses occurring in the mammary gland.

The present invention also relates to a pharmaceutical composition comprising a compound of SEQ ID NO: 1 and 2; SEQ ID NOS: 5 and 6; SEQ ID NOS: 9 and 10; And a pair of primers of SEQ ID NOS: 11 and 12, respectively.

The virus may be selected from Barley virus G, BVG, Rice stripe virus (RSV), Northern cereal mosaic virus (NCMV) and Setaria yellow dwarf virus SeYDV). ≪ / RTI > In addition, by using the above-mentioned multiplex virus-diagnostic primer set, species-specific multiple diagnosis of viruses occurring in the strains is possible.

In addition, the present invention can be used in the form of a diagnostic composition comprising a primer set for diagnosing millipedes virus or a primer set for coagulovirus diagnosis, and a diagnostic kit comprising the composition, have.

The present invention also relates to a pharmaceutical composition comprising a compound of SEQ ID NO: 1 and 2; SEQ ID NOS: 5 and 6; SEQ ID NOS: 9 and 10; SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; And a pair of primers represented by SEQ ID NOs: 17 and 18, wherein the primer set comprises at least one selected from the group consisting of:

In the present invention, the term " multiple diagnosis " means that various kinds of viruses occurring in a millet, a crude, or a mixture thereof can be simultaneously diagnosed or detected.

The virus may be selected from Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), Panicum mosaic virus distortion mosaic virus (PDMV), Northern cereal mosaic virus (NCMV), and Setaria yellow dwarf virus (SeYDV). In addition, by using the above-described primer set for multiple or avirulent virus diagnosis, multiple species-specific diagnosis of viruses occurring in a mammal or a mammal is possible.

The nucleotide sequences of SEQ ID NOS: 1 to 18 contained in the primer set of the present invention are not limited thereto, and the homologues of the nucleotide sequences are included within the scope of the present invention. Specifically, the primer set preferably has a nucleotide sequence having a sequence homology of at least 70%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95%, to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 18 . ≪ / RTI > "% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In the present invention, the term "primer" is a nucleic acid sequence having a short free 3 'hydroxyl group. The template and base pair of the complementary nucleic acid

(base pair) and serves as a starting point for strand duplication of the nucleic acid template

≪ / RTI > The primer can initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures.

In the design of the primer, there are various restrictions such as a ratio of A, G, C and T content of the primer, prevention of formation of a primer complex (dimer) and repetition of the same base sequence three times or more. the conditions such as the amount of template DNA, the concentration of the primer, the concentration of dNTP, the concentration of Mg ²⁺ , the reaction temperature, and the reaction time should be appropriate.

Such primers may incorporate additional features that do not alter the basic properties. I.e. the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more nucleotides into nucleotides, and uncharged linkages such as phosphonates, phosphotriesters, phosphoramidates or carbamates, phosphorothioates or phosphorodithioates Or the like can be transformed into a charged nucleus. The nucleic acid may be at least one of a protein such as a nuclease, a toxin, an antibody, a signal peptide, a poly-L-lysine, an intercalating agent such as acridine or psoralen, a chelating agent such as a metal, a radioactive metal, And may have additional covalently bonded moieties.

The primer sequences of the present invention can also be modified using a label that can directly or indirectly provide a detectable signal. The primers can include labels that can be detected using spectroscopic, photochemical, biochemical, immunochemical or chemical means. Useful labels include 32P, fluorescent dyes, electron dense reagents, enzymes (commonly used in ELISA), biotin or haptens, and proteins that are available for antisera or monoclonal antibodies.

The primers of the present invention can be prepared by cloning and restriction cleavage of appropriate sequences and digestion with restriction enzymes such as the phosphotriester method of Narang et al. (1979, Meth, Enzymol. 68: 90-99), diethylphosphoramidate Including, for example, direct chemical synthesis methods, such as the solid support method of Tetrahedron Lett. 22: 1859-1862 (1981), and the solid support method of US 4458066.

In addition, the present invention provides a composition for multiparity or avirulent multiple diagnosis comprising a primer set for multiparous or aviriviral multiple diagnosis.

The composition may further comprise a reaction amplification mixture, wherein the reaction amplification mixture contains a reagent necessary for performing an amplification reaction, a thermostable DNA polymerase, a deoxynucleotide, a sterile water without nucleases, and a divalent metal cation Solution and the like, preferably a reaction buffer, a deoxynucleotide, and a DNA polymerase.

The present invention also provides a kit for multiparameter or avirulent multiple diagnosis comprising the composition for multiparity or avirulence diagnosis.

The kit may further include a reagent generally used in a method for detecting nucleic acid, in addition to the composition for diagnosing a millet or avirulent virus. For example, it may include metal ion salts such as dNTP (deoxynucleotide triphosphate), heat-resistant polymerase, and magnesium chloride required for the PCR reaction, and may include dNTPs, sequenase, and the like required for sequencing .

The kit may take the form of a bottle, a tub, a sachet, an envelope, a tube, an ampoule, etc., which may be partly or wholly made of plastic, glass, paper, foil, / RTI > The container may be fitted with a cap which is initially part of the container or can be fully or partially detachable, which may be attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which is accessible to the contents by the injection needle. The kit may include an external package, and the external package may include instructions for use of the components.

The present invention also relates to a method for preparing a DNA fragment, comprising: a) obtaining DNA from a sample; b) amplifying the DNA obtained in step a) using the primer set or crude virus multiple primer set; And c) detecting the amplification product obtained in step b).

The virus may be selected from Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), Panicum mosaic virus distortion mosaic virus (PDMV), Northern cereal mosaic virus (NCMV), and Setaria yellow dwarf virus (SeYDV).

The amplification of step b) may be performed using a polymerase chain reaction, a duplex polymerase chain reaction, a duplex PCR, a multiplex polymerase chain reaction, a reverse transcription polymerase The RT-PCR method can be applied to competitive polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (RT-PCR), real-time quantitative polymerase chain reaction A DNA chip, a Loop-mediated isothermal amplification, and a combination thereof. The present invention is not limited thereto. Preferably, the amplification of step b) may be performed using a polymerase chain reaction or a reverse transcription polymerase chain reaction.

The detection of the amplification product in step c) may be performed using any one method selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radioactive measurement, fluorescence measurement, phosphorescence measurement, and combinations thereof, But is not limited thereto. Preferably, the detection of the amplification product of step c) can be carried out using gel electrophoresis.

Using the primer set or aviriviral multiplex diagnosis primer set of the present invention and the primer set or aviriviral multiplex diagnosis method using the primer set of the present invention, species-specific multiple diagnosis of viruses occurring in a plant or a plant can be performed. In addition, the accurate and rapid diagnosis of multiple samples of low concentration, preferably 10 ^-1 to 10 ^-3 concentration of a sample, even more preferably at a sample dilution of 10 ^-1 to 10 ^-2 or crude virus diluted to a concentration of millet It is possible.

Hereinafter, the present invention will be described more specifically based on examples. It will be apparent to those skilled in the art that the embodiments are only for describing the present invention in more detail and that the scope of the invention is not limited by these embodiments in accordance with the gist of the present invention.

EXAMPLES Example 1 Virus Diagnosis in Cattle and Cows

Example 1-1. Sampling and extraction of total RNA

In order to investigate the viruses originating from the captains and mackerels, samples of 60 capillary spots and 100 spots were collected from 10 cities and counties throughout the country from April to September, 2015. Then, the total RNAs of the shoots and tubers collected were extracted according to the manufacturer's manual using the easy-spin ™ Total RNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea).

Examples 1-2. Virus diagnosis

The viruses were analyzed by next generation sequencing (NGS) and RT-PCR method.

As a result of the diagnosis, 7 points of Barley virus G ( BVG), 1 point of Rice black-streaked dwarf virus ( RBSDV) and 2 points of Rice stripe virus ( RSV) , And 4 points of Panicum distortion mosaic virus ( PDMV) were detected.

In addition, BVG 10, RSV 3, Northern cereal mosaic virus ( NCMV) 1, and Setaria yellow dwarf virus ( SeYDV) 1 spot were detected. In particular, PDMV detected in the field and SeYDV detected in the medium were confirmed to be new virus belonging to Polerovirus genus.

Example 2 Design and Identification of Species Specific Primer Set

Example 2-1. Species specific primer set design

Species specific primers of each virus detected in the embryo and the kit were designed as follows. First, the nucleotide sequence information of viruses belonging to genus such as four viruses (BVG, RBSDV, RSV, PDMV) originated from the capitals and four viruses (BVG, NCMV, RSV, SeYDV) This is shown in Table 1.

Genius
(Genus) Virus name Abbreviation Accession Number country Polerovirus Barley virus G BVG NC_029906 Korea Panicum distortion mosaic virus PDMV - Korea Setaria yellow dwarf virus SeYDV LC333290 Korea Beet chlorosis virus BChV NC_002766 - Beet mild yellowing virus BMYV DQ132996 Germany Beet western yellows virus BWYV LC198684 Korea Carrot red leaf virus CtRLV NC_006265 - Cereal yellow dwarf virus-RPS CYDV-RPS NC_001298 - Cereal yellow dwarf virus-PRV CYDV-RPV EF521848 United States of America Chickpea chlorotic stunt virus CpCSV JF507725 China Cotton leafroll dwarf virus CLRDV NC_014545 Argentina Cucurbit aphid-borne yellows virus CABYV KR231959 Korea Maize yellow dwarf virus-RMV MYDV-RMV KC921392 United States of America Melon aphid-borne yellows virus MABYV JQ700307 Taiwan Pepper vein yellows virus PeYVV KP326573 China Potato leafroll virus PLRV KC456054 China Suakwa aphid-borne yellows virus SABYV KX122023 East Timor Sugarcane yellow leaf virus ScYLV JF925152 India Tobacco vein distorting virus TVDV NC_010732 China Turnip yellows virus TuYV KR706247 China White clover mottle virus WClMoV LC192169 Korea Fijivirus Rice black-streaked dwarf virus RBSDV JX083209 China Fiji disease virus FDV AY297694 - Maize rough dwarf virus MRDV JQ975001 Spain Mal de Rio Cuarto virus MRCV NC_008734 Argentina Nilaparvata lugens reovirus NLRV NC_003652 - Oat sterile dwarf virus OSDV AB011027 Japan Tenuivirus Rice stripe virus RSV JQ927433 China Iranian wheat stripe virus IWSV AY312434 Iran Maize stripe virus MSpV MSU53224 - Rice grassy stunt virus RGSV AF511072 China Cytorhabdovirus Northern cereal mosaic virus NCMV AB030277 Japan Alfalfa dwarf virus ADV KP205452 Argentina Barley yellow striate mosaic virus BYSMV KM213865 China Lettuce necrotic yellows virus LNYV NC_007642 Australia Lettuce yellow mottle virus LYMoV NC_011532 France

Among them, the entire nucleotide sequence analyzed in the laboratory of the present inventors was used for the novel viruses PDMV and SeYDV, and the entire nucleotide sequences of PDMV and SeYDV are shown in SEQ ID NOs: 21 and 22, respectively. The whole nucleotide sequence of PDMV and SeYDV and the nucleotide sequence downloaded from NCBI Genbank were classified by the virus of the same genus and then aligned using DNAMAN ver 7.0 program. After that, a species-specific primer set was designed using a sequence that specifically contains the virus to be amplified.

Set number Virus name
(Acronym) SEQ ID NO: Primer name Base sequence
(5 'to 3') size
(bp) One Northern cereal mosaic virus
(NCMV) SEQ ID NO: 1 F-NCMV-F1 TAGATCTGATCATCAGCGAGG 512 SEQ ID NO: 2 F-NCMV-R1 TGATGGCCTCTTACCTGTCCT 2 Northern cereal mosaic virus
(NCMV) SEQ ID NO: 3 F-NCMV-F2 AGGAGAGCAAGTGAAGGTGTC 1,196 SEQ ID NO: 4 F-NCMV-R2 GATCTCATGCTCAATCCCTCG 3 Setaria yellow dwarf virus
(SeYDV) SEQ ID NO: 5 F-ScYLV-F1 ATCAACAATCGCGACAGAGC 789 SEQ ID NO: 6 F-ScYLV-R6 AGAAGTGTCATCTGCCGTCA 4 Setaria yellow dwarf virus
(SeYDV) SEQ ID NO: 7 F-ScYLV-F3 ACCTTGTACGCCCAGATTCA 713 SEQ ID NO: 8 F-ScYLV-R7 AGTCCTGACCATGACCACTG 5 Barley virus G
(BVG) SEQ ID NO: 9 F-BVG-F2 ATCCAGCTTCGACTGCTTGT 965 SEQ ID NO: 10 F-BVG-R2 CATCGACTTGCGAACTTCAA 6 Rice stripe virus
(RSV) SEQ ID NO: 11 F-RSV-F1 AAGCCCACCATAGTTGTTCG 1,509 SEQ ID NO: 12 F-RSV-R3 GTAATAGACGCCGGTGGAAA 7 Panicum distortion mosaic virus
(PDMV) SEQ ID NO: 13 P-CYDV-F3 TTTTCCGCGAGCCAAAACTG 794 SEQ ID NO: 14 P-CYDV-R3 CTGACCAGTCGAAACCGGAA 8 Panicum distortion mosaic virus
(PDMV) SEQ ID NO: 15 P-CYDV-F6 TATTTGCCGGTTCTCGCACT 843 SEQ ID NO: 16 P-CYDV-R6 ATGAGCTTCTGCGCCTCTTT 9 Rice black-streaked dwaf virus (RBSDV) SEQ ID NO: 17 S-RBSDV-S10-F5 CATTGTCAAATCGCCCCACG 561 SEQ ID NO: 18 S-RBSDV-S10-R5 CATCCGTAGTGCTTGCAGGA 10 Rice black-streaked dwaf virus (RBSDV) SEQ ID NO: 19 S-RBSDV-S10-F7 ACTCGAACAGACTTGGAGCG 503 SEQ ID NO: 20 S-RBSDV-S10-R7 CGGGTGCCAAATGAAATGCT

Example 2-2. Identification of the utility of species-specific primer sets

PCR analysis was performed to verify the utility of the designed species-specific primer sets. For this purpose, cDNA was synthesized using SuperiorScript III Reverse Transcriptase (Enzynomics, Korea). Next, PCR was carried out using 2X TOPsimple ™ DyeMIX (aliquot) -HOT using the synthesized cDNA as a template strand under the following conditions. First, 1 μl of a template DNA template, 10 pmol / μl of a forward primer, 1 μl of a 10 pmol / μl reverse primer, and 7 μl of a DNase / RNase-free water (DW) were added to 10 μl of Premix, To prepare a reaction solution. After the initial denaturation at 95 ° C for 10 minutes, 35 cycles were repeated at 95 ° C for 30 seconds, at 55 ° C for 30 seconds, and at 72 ° C for 1 minute 30 seconds. After the last extension at 72 ° C for 5 minutes The PCR reaction was terminated by lowering the temperature to 10 ° C. The gene product amplified by PCR was electrophoresed with 1.5% agarose gel to which 60 ml of 0.5 × TAE buffer, 1.5 g of Agarose LE and 2 μl of EtBr were added and confirmed by Gel Documentation The results are shown in FIG. Each lane number in Fig. 1 represents the set number in Table 2.

Example 3. Screening and confirmation of multiple diagnostic primer sets

Example 3-1. Selection of multiple diagnostic primer sets

A primer set capable of multiple diagnosis of the viruses detected in the embryo and the kit was selected as follows. At this time, various combinations were selected so that each species-specific primer set exhibits a band that can be clearly distinguished visually on the gel without exhibiting interference effects with each other. For this, RT-PCR using Genetbio SuPrimeScript RT-PCR Premix SR-8000 (GeNeTBio Inc., Korea) was performed and the detailed conditions were as follows. To 10 μl of the premix, 0.5 μl of each viral RNA template (origin) and crude origin, 10 μl of each of the viruses, 1 μl of the forward primer and 10 pmol / μl of the reverse primer were added to prepare 20 μl of the reaction solution Respectively. Thereafter, the cells were subjected to a reverse transcription reaction at 50 ° C for 30 minutes and 95 ° C for 10 minutes, followed by 35 cycles at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 1 minute and 30 seconds. Finally, after the extension, the reaction was terminated by lowering the temperature to 10 ° C. The amplified gene product was confirmed by gel-electrophoresis on a 1.5% agarose gel to which 60 ml of 0.5 X TAE buffer, 1.5 g of Agarose LE and 2 μl of EtBr were added. This resulted in the final selection of a primer combination that minimally interferes between each primer set and can distinguish amplified products visually. The multiple diagnostic primer set 21 of the selected cattle-derived viruses is shown in Table 3, and the multiplex diagnostic primer set 12 of the crude viruses is shown in Table 4. Ref. Numbers in Tables 3 and 4 are numbers corresponding to the set numbers in Table 2.

Set number Ref.
number Virus name
(Acronym) Primer name Base sequence
(5'to 3 ') size
(bp) 11 5 Barley virus G
(BVG) F-BVG-F2 ATCCAGCTTCGACTGCTTGT 965 F-BVG-R2 CATCGACTTGCGAACTTCAA 6 Rice stripe virus
(RSV) F-RSV-F1 AAGCCCACCATAGTTGTTCG 1,509 F-RSV-R3 GTAATAGACGCCGGTGGAAA 7 Panicum distortion mosaic virus
(PDMV) P-CYDV-F3 TTTTCCGCGAGCCAAAACTG 794 P-CYDV-R3 CTGACCAGTCGAAACCGGAA 9 Rice black-streaked dwaf virus (RBSDV) S-RBSDV-S10-F5 CATTGTCAAATCGCCCCACG 561 S-RBSDV-S10-R5 CATCCGTAGTGCTTGCAGGA

Set number Ref.
No. Virus name
(Acronym) Primer name Base sequence
(5'to 3 ') size
(bp) 12 One Northern cereal mosaic virus
(NCMV) F-NCMV-F1 TAGATCTGATCATCAGCGAGG 512 F-NCMV-R1 TGATGGCCTCTTACCTGTCCT 3 Setaria yellow dwarf virus
(SeYDV) F-ScYLV-F3 ACCTTGTACGCCCAGATTCA 713 F-ScYLV-R7 AGTCCTGACCATGACCACTG 5 Barley virus G
(BVG) F-BVG-F2 ATCCAGCTTCGACTGCTTGT 965 F-BVG-R2 CATCGACTTGCGAACTTCAA 6 Rice stripe virus
(RSV) F-RSV-F1 AAGCCCACCATAGTTGTTCG 1,509 F-RSV-R3 GTAATAGACGCCGGTGGAAA

Example 3-2. Check the utility of multiple diagnostic primer sets

PCR analysis was performed under the same conditions as in Example 2 to confirm the efficacy of primer set 11 for multiparametric virus detection in Table 3 and primer set 12 for multiple virus detection in Table 4. The gene products amplified by PCR were confirmed by gel electrophoresis, and primer sets for millet and aviral multiple diagnosis were shown in FIG. 2 and FIG. 3, respectively.

As shown in FIG. 2, it was confirmed that the set 11, which is a primer set for multiparity virus multiplex diagnosis, can accurately detect BVG, RBSDV, RSV, and PDMV, which are origins of the virus, without causing interference between the primers.

Also, as shown in FIG. 3, set 12, which is a primer set for coarse virus multiple diagnosis, confirms that each primer can accurately and simultaneously detect both BVG, NCMV, RSV, and SeYDV, which are derived viruses, without interference with each other Respectively.

Example 4. Detection limit detection of multiple diagnostic primer sets

In order to evaluate the virus detection limit of the selected primer sets 11 and 12, the positive control in which each virus was detected was collected and the total RNA of each virus was extracted. The extracted RNA was diluted 10 times (10 ^-1 , 10 ^-2 , 10 ^-3 , 10 ^-4 , 10 ^-5 , 10 ^-6 , 10 ^-7 ) and used for the experiment. PCR conditions were the same according to the conditions and the method of the above example, except that the extracted and diluted RNAs were used differently for each virus only. The gene products amplified by PCR were analyzed by gel electrophoresis and shown in FIG. In FIG. 4, Lanes 1 to 8 represent dilutions of 10 ^0, 10 ^-1 , 10 ^-2 , 10 ^-3 , 10 ^-4 , 10 ^-5 , 10 ^-6 , and 10 ^-7 dilution, respectively.

As shown in FIG. 4, the detection limits showed that bands could be visually observed in samples diluted up to 10 ^{-2 in} both sets 11 and 12, which were primer sets or multiple viruses for diagnosis. Also, it was confirmed that even when low concentration sample is used, it is possible to detect multiple or precise viruses of the millet or the crude virus.

<110> Kyungpook National University Industry-Academic Cooperation Foundation <120> Primer set for Multiplex RT-PCR of Proso nation or Foxtail nation          Viruses and use thereof <130> KNU 1.306P <160> 22 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-F1 <400> 1 tagatctgat catcagcgag g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-R1 <400> 2 tgatggcctc ttacctgtcc t 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-F2 <400> 3 aggagagcaa gtgaaggtgt c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> F-NCMV-R2 <400> 4 gatctcatgc tcaatccctc g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-F1 <400> 5 atcaacaatc gcgacagagc 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-R6 <400> 6 agaagtgtca tctgccgtca 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-F3 <400> 7 accttgtacg cccagattca 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-ScYLV-R7 <400> 8 agtcctgacc atgaccactg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > F-BVG-F2 <400> 9 atccagcttc gactgcttgt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > F-BVG-R2 <400> 10 catcgacttg cgaacttcaa 20 <210> 11 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> F-RSV-F1 <400> 11 aagcccacca tagttgttcg 20 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> F-RSV-R3 <400> 12 gtaatagacg ccggtggaaa 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-F3 <400> 13 ttttccgcga gccaaaactg 20 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-R3 <400> 14 ctgaccagtc gaaaccggaa 20 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-F6 <400> 15 tatttgccgg ttctcgcact 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> P-CYDV-R6 <400> 16 atgagcttct gcgcctcttt 20 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > S-RBSDV-S10-F5 <400> 17 cattgtcaaa tcgccccacg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > S-RBSDV-S10-R5 <400> 18 catccgtagt gcttgcagga 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > S-RBSDV-S10-F7 <400> 19 actcgaacag acttggagcg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > S-RBSDV-S10-R7 <400> 20 cgggtgccaa atgaaatgct 20 <210> 21 <211> 5863 <212> DNA <213> Unknown <220> <223> Panicum distortion mosaic virus <400> 21 tctcagcaga gttcctgcat ggcagtaaaa agatagggag gggactcacc tgtcttttga 60 agcactcctc tgctctcgca cgaagttgat caagatcctt catgcgagct attcttggca 120 caaccagaat agtcttccac ggtcgtaacg ctcccgaaac ggtcgaagag ctcgcttctt 180 gcttgacgct catcgaattt caggctagaa ggtattacgc cctcgcccga agcgaccccc 240 tctcagcaga gttcctgcat ggcgctaact tttctaatgt tggtgcttat gttagccacc 300 ttaggcgcct cttgtgcgcc tacatccctg tgctactcct taacggaacc agccttacaa 360 gcacagggct catcaccgta cgactcgact tcctggtacc agtcctacga tggttacaat 420 gtcaccggct ttacccgtac attaccatcc gtagtagaag gttcaggatt gaccaaaatc 480 gaacggtcgg accaacgctt tatcgatctc tcatatggag atatgatttt ctggttcggc 540 ttcaagatac gagtcgactt gctaacatta gcaggagagg tccagagtat ttcaacaccc 600 aaatggcagt cattctgtca gggattgaaa gaaggattct cgagattcct gaacagcact 660 ttgtggatga tatacaacta ctatctttgg tgtgttttat acacgatcaa attgatagca 720 tcattcttgt tgatgacctg gaagccgatg tcagccattg ggctggctct ggccatcaca 780 tcatccatga tttgggccat caagcggata tactcgtgca ttccggtctt ttggatcgga 840 atacctttca ggcttttgca caaagccctc cgctggctgt tcaggaagaa cggagatgaa 900 aaagctgttc aaggctttaa cagctactcc gttaagatgg cccctccagg aaagtcggtt 960 ctggaaatcc tcttcgcaga caactcacac tgtggttacg cttcgtgcgt acgccttcag 1020 accggagagg acgccctgtt aacttcacta cactgttgcg atccaacata caaagtgagg 1080 tctttcagga ctggctcaat gatcccgttg agccaattcc agatcatttt cccttccgag 1140 aagcttgatt tggtgattct tcgaggtcca accgaatgga aatcgcttct cggcgccaaa 1200 gcctcccaca tgaagacagc agaccgcctt tcaaaacaag gtgtgtcctt cttcaccttt 1260 aatggacagt gggaaatgca taacgcaaaa gtggttggct cggacggact cttcgtgagc 1320 gtcctgagca acaccactaa aggctacagc ggaaccccct acttcgttgg caaagacatt 1380 attggggtgc acaagggata tgacgggaat gactcgagca agaactacaa tctgatggct 1440 ccgatccctc ccatcgaggg attgacgaag cctcagtacg tttacgagtc ttctacgatt 1500 gacggagacg tatacagcga agaagaaatt gaagaattaa cgaaatacgc tgtagacacc 1560 tttgaaaagg ttaagaaggt gtcgtcctcc tggagaccta gccacaatga agaatggtgg 1620 ctagatagcc tcgctgatga agcagcatca cccccaaaaa ctccggcaac cgttgagttt 1680 cagggaaacg aggcgcgtgg caccgaccac caggaaaaac cggtatccac ccttgccaag 1740 cccgccgact ctaccgacga catgctgcgc gaaatcgtag cacagatagt gggcaggatc 1800 gacctgagtg ctctcactca gagggtggag gggaagctgc tgaaccaagt caaatctgca 1860 cagaacaagc aggttcggca gccggaggtc aagaggacac gatcacgaaa acgaaatacc 1920 tcgaagagtt cctcaagtcc gccttcaaat gggatgacga acccaccagt ggtgaaatcc 1980 cagggttcag gaaaacagga cgcctccccg cgctatatca tccccaaaaa ccgaaagaca 2040 caaccttcgg ggatggtatc atcagcgccc acccagaaat ggcggccaaa atcgccgggt 2100 tcgggtggcc ccagttcggc gctgccgccg aaaagacaag tctgaaactt caggctgatc 2160 gctggctctc tcgagctcag tcagcggtta aaccatcggc agcaaaacga gagctcgtga 2220 tccaacatgc ggtagaaagg tacaaactct gccaaacaca aatgccgcat actagtgccc 2280 ctggacagct taaatgggga aatttcttga aagatttcaa ggaagctgtc cactcacttg 2340 agctggatgc aggaatcggc ctcccataca aagtcctgaa gatgcaaacc cacagagata 2400 tggttgagga ccccgattac ctgcccttat tgactcgcct cgtctggaac cgcctatcga 2460 agatgtccca ggcgaagttt gaggatatga gcccagaaca gctcgtgaga gagggattgt 2520 gcgacccgat acgcttgttc atcaaaggag agccgcacaa acaatcgaaa cttgatgaag 2580 gccgctaccg cctcatcatg tcagtgtcac tagtggatca actggtagcc cgggttttat 2640 ttcaaagcca aaacaaacgc gagatatcct tgtggaggga tatcccgtca aaacccggtt 2700 tcggcttatc cactgacagc gaggcgaaag agtttatcag aacgctgtca aaggttgtgg 2760 gttgtcctcc acaaacgctc attcatgagt ggaaggacaa agtcgtaccc accgactgtt 2820 ccggtttcga ctggtcggtc gccgattgga tgctcgagga tgatatggag gtgagaaatc 2880 gcctcacatt taactgcaac gagctcacca ggcgcctccg cgcatgctgg ttgaagtgca 2940 taacaaattc tgtgttgtgc acatccgacg gaaccttgta cgcccagatt catcctggtg 3000 tgcagaaatc cggctcgtac aatacgagct cgtcgaattc caggattaga gttatggccg 3060 catatcactg cggcgccaaa tgggcgatag ccatggggga tgacgcactt gaatccccag 3120 aaaccgacct taacgcctac aagaagctcg gtttcaaagt cgaggtatcc tcacagctag 3180 aattttgctc acacgtcttt gagcaggagg acctcgccag gccgttgaac gtcgcgaaaa 3240 cattatatag gttgatctac ggatacaacc cggcctgtgg caacccggag gtgttagcta 3300 actacctcca agcagtggcg agcgtattga acatactccg tcatgaccct gctgaggttg 3360 ccaagctccg taactggctc cttcctggcg ggggccagta aaaagatacg gagggaaaag 3420 tagccaccat cttcgttgca agagtggagc tttagtcgaa gaacgcagcc gattctggat 3480 tataaattgc tagctggtgt gctcattgga gtaatcatca caactccgct agtagtagtg 3540 gctgcgtacc tggcatttct caaaatcagt gcacatatca gagcgatagt taatgaatac 3600 gggcgctgct agacgctcac gcagaaatgt cagaaggcgc tctaaccgtc gtcgatcgac 3660 tcggccagtg gtcatggtca ggactacccc aagatctcga cgagtacgac gacgtggagc 3720 acgtgtcgga ggaaacgctg tgcgaggatt acgaggagga agcaaccggg atgttctcac 3780 tttcacggtt gacgatctca aagccaacag ctccgggatc ctcaagttcg gaccgagttt 3840 atctcagtac ccagcgttca acaatggctt actcaaagcc taccatgagt ataaaatcac 3900 aagtctcaca gtacagtata actcatgctc ctccgacgcc acttcaggtg caatcgcact 3960 tgaagtggat acgtcctgct cccaaacagc aacaggctcc aaaatcgtta gcttccccgt 4020 caagaggaac gccacgaaag tcttccccac ccagtacatt aagggtcaaa acttcatgac 4080 tacatcagct gatcaatttt ggctgttgta caaagggaat ggcgatggaa gcctagcagg 4140 acaattcgtc tgccgatttg aatgtcaatt tcagaatcca aaataggtag gcgacgctcc 4200 cccaacaccc acacccaccc ctacaccaac accgactccc actccgaccc ctactccggc 4260 accagcaccc aaattctttg gatatcaagg tgtgccgacg agtatcgtca aaaccagagg 4320 aaacaatgag ttttgcgatg tgggttcact caacaatgtc tccatgtatt tctggaaaga 4380 tgaagcttgg agtgttgaga cactgtcagc gggctacagc atcaacaatc gcgacagagc 4440 cacccccttt ttcctggttc cagttgagaa agggagatac tccgtgtaca tacaatgtga 4500 gggctttaag gcagttaaag ccaaaggtgg ttccaatgat ggccgcatga gtggtttcat 4560 cacagataat ccgagtcagg cagggtggag agcgtacaat tacgatgggt gtgtaatatc 4620 gaactacaaa gctagtaacg acagggtgca aggacatccc gacctcaagg tcaacggatg 4680 ttctttctca gaccagcttg tagagaccga tttttactgt tcgtttcacc tcgaggtggc 4740 cactgaagga tactttggtg tccaggcacc tcccatagag aaggatgatc attacaacta 4800 tgtggtgtcc tacgcaaact tcactgagaa agtgatggaa tggggctcag tctccatcgc 4860 gatggacgag gtaaacgagg gagcgtatcg cgcgtcgaaa tgggataaga ccgcaccagt 4920 gaatgctcga ttgtcgggtc agatcagcgc ctcatcggag gtttatactc cggtggaatc 4980 tgacacaaaa ccgcaatcag aacggacgga gagtacgcct ccagcccgga ccctccaggt 5040 acaaggggtt aaaaccgaac cacccatcaa aatcgctgat aaaccggatc ctaaagtcat 5100 gagctggtta catgaccaac cggttgtcga agctgtcgta aagggggatt tcactcacga 5160 aactgtgtat ccaccaccac ccccgcctct gacggcagat gacacttctc gccaagccgc 5220 aaaagtcgtt cgaactttga tggccaacgc tgatgaagcg cctgcccaaa cacctggcca 5280 agatgtgcaa acgtcgatgc cggtttccaa gacagaggag cacagcgata gcgatgagga 5340 tgcggcgtcc atcacaccct cgagagcggg aacgctctct ggagggtctc ttcgaggagg 5400 atctcttcga ggagggttaa agccaaaacc atacgcagct gaacaagcag tggatgatga 5460 attggcttca atcagcggac gttccggagg tggatccctt ggcgggggat ctctccgggg 5520 aggaaccttg cgttccacac ctagtctggt atctcgagaa atgactcaag ccgaacgaaa 5580 catgtatcgg gatatcttga acagcagagg taaaactgct gcagcagagt gggctgcagc 5640 catgggaaaa gacatacctc aggctaggag accgcgcctc tttgggtgat ttaaccacta 5700 cgccaccgtc cagctctcga cattaaatgg agcgcctgcc gaggcaaaac gagacgggct 5760 aaccacccgg ccgccctcca gctaagacca cttagactgg agtggtttct cacggtcaat 5820 gagaagacat tcctgggagc actgcttcca ggttttgttg gta 5863 <210> 22 <211> 5838 <212> DNA <213> Unknown <220> <223> SeYDV <400> 22 gtaaaaagat agggagggga ctcacctgtc ttttgaagca ctcctctgct ctcgcacgaa 60 gttgatcaag atccttcatg cgagctattc ttggcacaac cagaatagtc ttccacggtc 120 gtaacgctcc cgaaacggtc gaagagctcg cttcttgctt gacgctcatc gaatttcagg 180 ctagaaggta ttacgccctc gcccgaagcg accccctctc agcagagttc ctgcatggcg 240 ctaacttttc taatgttggt gcttatgtta gccaccttag gcgcctcttg tgcgcctaca 300 tccctgtgct actccttaac ggaaccagcc ttacaagcac agggctcatc accgtacgac 360 tcgacttcct ggtaccagtc ctacgatggt tacaatgtca ccggctttac ccgtacatta 420 ccatccgtag tagaaggttc aggattgacc aaaatcgaac ggtcggacca acgctttatc 480 gatctctcat atggagatat gattttctgg ttcggcttca agatacgagt cgacttgcta 540 acattagcag gagaggtcca gagtatttca acacccaaat ggcagtcatt ctgtcaggga 600 ttgaaagaag gattctcgag attcctgaac agcactttgt ggatgatata caactactat 660 ctttggtgtg ttttatacac gatcaaattg atagcatcat tcttgttgat gacctggaag 720 ccgatgtcag ccattgggct ggctctggcc atcacatcat ccatgatttg ggccatcaag 780 cggatatact cgtgcattcc ggtcttttgg atcggaatac ctttcaggct tttgcacaaa 840 gccctccgct ggctgttcag gaagaacgga gatgaaaaag ctgttcaagg ctttaacagc 900 tactccgtta agatggcccc tccaggaaag tcggttctgg aaatcctctt cgcagacaac 960 tcacactgtg gttacgcttc gtgcgtacgc cttcagaccg gagaggacgc cctgttaact 1020 tcactacact gttgcgatcc aacatacaaa gtgaggtctt tcaggactgg ctcaatgatc 1080 ccgttgagcc aattccagat cattttccct tccgagaagc ttgatttggt gattcttcga 1140 ggtccaaccg aatggaaatc gcttctcggc gccaaagcct cccacatgaa gacagcagac 1200 cccctttcaa aacaaggtgt gtccttcttc acctttaatg gacagtggga aatgcataac 1260 gcaaaagtgg ttggctcgga cggactcttc gtgagcgtcc tgagcaacac cactaaaggc 1320 tacagcggaa ccccctactt cgttggcaaa gacattattg gggtgcacaa gggatatgac 1380 gggaatgact cgagcaagaa ctacaatctg atggctccga tccctcccat cgagggattg 1440 acgaagcctc agtacgttta cgagtcttct acgattgacg gagacgtata cagcgaagaa 1500 gaaattgaag aattaacgaa atacgctgta gacacctttg aaaaggttaa gaaggtgtcg 1560 tcctcctgga gacctagcca caatgaagaa tggtggctag atagcctcgc tgatgaagca 1620 gcatcacccc caaaaactcc ggcaaccgtt gagtttcagg gaaacgaggc gcgtggcacc 1680 gaccaccagg aaaaaccggt atccaccctt gccaagcccg ccgactctac cgacgacatg 1740 ctgcgcgaaa tcgtagcaca gatagtgggc aggatcgacc tgagtgctct cactcagagg 1800 gtggagggga agctgctgaa ccaagtcaaa tctgcacaga acaagcaggt tcggcagccg 1860 gaggtcaaga ggacacgatc acgaaaacga aatacctcga agagttcctc aagtccgcct 1920 tcaaatggga tgacgaaccc accagtggtg aaatcccagg gttcaggaaa acaggacgcc 1980 tccccgcgct atatcatccc caaaaaccga aagacacaac cttcggggat ggtatcatca 2040 gcgcccaccc agaaatggcg gccaaaatcg ccgggttcgg gtggccccag ttcggcgctg 2100 ccgccgaaaa gacaagtctg aaacttcagg ctgatcgctg gctctctcga gctcagtcag 2160 cggttaaacc atcggcagca aaacgagagc tcgtgatcca acatgcggta gaaaggtaca 2220 aactctgcca aacacaaatg ccgcatacta gtgcccctgg acagcttaaa tggggaaatt 2280 tcttgaaaga tttcaaggaa gctgtccact cacttgagct ggatgcagga atcggcctcc 2340 catacaaagt cctgaagatg caaacccaca gagatatggt tgaggacccc gattacctgc 2400 ccttattgac tcgcctcgtc tggaaccgcc tatcgaagat gtcccaggcg aagtttgagg 2460 atatgagccc agaacagctc gtgagagagg gattgtgcga cccgatacgc ttgttcatca 2520 aaggagagcc gcacaaacaa tcgaaacttg atgaaggccg ctaccgcctc atcatgtcag 2580 tgtcactagt ggatcaactg gtagcccggg ttttatttca aagccaaaac aaacgcgaga 2640 tatccttgtg gagggatatc ccgtcaaaac ccggtttcgg cttatccact gacagcgagg 2700 cgaaagagtt tatcagaacg ctgtcaaagg ttgtgggttg tcctccacaa acgctcattc 2760 atgagtggaa ggacaaagtc gtacccaccg actgttccgg tttcgactgg tcggtcgccg 2820 attggatgct cgaggatgat atggaggtga gaaatcgcct cacatttaac tgcaacgagc 2880 tcaccaggcg cctccgcgca tgctggttga agtgcataac aaattctgtg ttgtgcacat 2940 ccgacggaac cttgtacgcc cagattcatc ctggtgtgca gaaatccggc tcgtacaata 3000 cgagctcgtc gaattccagg attagagtta tggccgcata tcactgcggc gccaaatggg 3060 cgatagccat gggggatgac gcacttgaat ccccagaaac cgaccttaac gcctacaaga 3120 agctcggttt caaagtcgag gtatcctcac agctagaatt ttgctcacac gtctttgagc 3180 aggaggacct cgccaggccg ttgaacgtcg cgaaaacatt atataggttg atctacggat 3240 acaacccggc ctgtggcaac ccggaggtgt tagctaacta cctccaagca gtggcgagcg 3300 tattgaacat actccgtcat gaccctgctg aggttgccaa gctccgtaac tggctccttc 3360 ctggcggggg ccagtaaaaa gatacggagg gaaaagtagc caccatcttc gttgcaagag 3420 tggagcttta gtcgaagaac gcagccgatt ctggattata aattgctagc tggtgtgctc 3480 attggagtaa tcatcacaac tccgctagta gtagtggctg cgtacctggc atttctcaaa 3540 atcagtgcac atatcagagc gatagttaat gaatacgggc gctgctagac gctcacgcag 3600 aaatgtcaga aggcgctcta accgtcgtcg atcgactcgg ccagtggtca tggtcaggac 3660 taccccaaga tctcgacgag tacgacgacg tggagcacgt gtcggaggaa acgctgtgcg 3720 aggattacga ggaggaagca accgggatgt tctcactttc acggttgacg atctcaaagc 3780 caacagctcc gggatcctca agttcggacc gagtttatct cagtacccag cgttcaacaa 3840 tggcttactc aaagcctacc atgagtataa aatcacaagt ctcacagtac agtataactc 3900 atgctcctcc gacgccactt caggtgcaat cgcacttgaa gtggatacgt cctgctccca 3960 aacagcaaca ggctccaaaa tcgttagctt ccccgtcaag aggaacgcca cgaaagtctt 4020 ccccacccag tacattaagg gtcaaaactt catgactaca tcagctgatc aattttggct 4080 gttgtacaaa gggaatggcg atggaagcct agcaggacaa ttcgtctgcc gatttgaatg 4140 tcaatttcag aatccaaaat aggtaggcga cgctccccca acacccacac ccacccctac 4200 accaacaccg actcccactc cgacccctac tccggcacca gcacccaaat tcttttggata 4260 tcaaggtgtg ccgacgagta tcgtcaaaac cagaggaaac aatgagtttt gcgatgtggg 4320 ttcactcaac aatgtctcca tgtatttctg gaaagatgaa gcttggagtg ttgagacact 4380 gtcagcgggc tacagcatca acaatcgcga cagagccacc ccctttttcc tggttccagt 4440 tgagaaaggg agatactccg tgtacataca atgtgagggc tttaaggcag ttaaagccaa 4500 aggtggttcc aatgatggcc gcatgagtgg tttcatcaca gataatccga gtcaggcagg 4560 gtggagagcg tacaattacg atgggtgtgt aatatcgaac tacaaagcta gtaacgacag 4620 ggtgcaagga catcccgacc tcaaggtcaa cggatgttct ttctcagacc agcttgtaga 4680 gaccgatttt tactgttcgt ttcacctcga ggtggccact gaaggatact ttggtgtcca 4740 ggcacctccc atagagaagg atgatcatta caactatgtg gtgtcctacg caaacttcac 4800 tgagaaagtg atggaatggg gctcagtctc catcgcgatg gacgaggtaa acgagggagc 4860 gtatcgcgcg tcgaaatggg ataagaccgc accagtgaat gctcgattgt cgggtcagat 4920 cagcgcctca tcggaggttt atactccggt ggaatctgac acaaaacccc aatcagaacg 4980 gcggagagt acgcctccag cccggaccct ccaggtacaa ggggttaaaa ccgaaccacc 5040 catcaaaatc gctgataaac cggatcctaa agtcatgagc tggttacatg accaaccggt 5100 tgtcgaagct gtcgtaaagg gggatttcac tcacgaaact gtgtatccac caccaccccc 5160 gcctctgacg gcagatgaca cttctcgcca agccgcaaaa gtcgttcgaa ctttgatggc 5220 caacgctgat gaagcgcctg cccaaacacc tggccaagat gtgcaaacgt cgatgccggt 5280 ttccaagaca gaggagcaca gcgatagcga tgaggatgcg gcgtccatca caccctcgag 5340 agcgggaacg ctctctggag ggtctcttcg aggaggatct cttcgaggag ggttaaagcc 5400 aaaaccatac gcagctgaac aagcagtgga tgatgaattg gcttcaatca gcggacgttc 5460 cggaggtgga tcccttggcg ggggatctct ccggggagga accttgcgtt ccacacctag 5520 tctggtatct cgagaaatga ctcaagccga acgaaacatg tatcgggata tcttgaacag 5580 cagaggtaaa actgctgcag cagagtgggc tgcagccatg ggaaaagaca tacctcaggc 5640 taggagaccg cgcctctttg ggtgatttaa ccactacgcc accgtccagc tctcgacatt 5700 cctgccgagg agaccactta gactggagtg gtttctcacg gtcaatgaga agacattcct gggagcactg 5820 cttccaggtt ttgttggt 5838

Claims (11)

SEQ ID NOS: 9 and 10; SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; And primer pairs of SEQ ID NOS: 17 and 18, respectively.
The method according to claim 1,
The virus may be selected from the group consisting of Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), and Panicum malformed virus Panicum distortion mosaic virus, PDMV).
SEQ ID NOS: 1 and 2; SEQ ID NOS: 5 and 6; SEQ ID NOS: 9 and 10; And a pair of primers of SEQ ID NOS: 11 and 12, respectively.
The method of claim 3,
The virus may be selected from Barley virus G, BVG, Rice stripe virus (RSV), Northern cereal mosaic virus (NCMV) and Setaria yellow dwarf virus SeYDV). &Lt; / RTI &gt;
SEQ ID NOS: 1 and 2; SEQ ID NOS: 5 and 6; SEQ ID NOS: 9 and 10; SEQ ID NOS: 11 and 12; SEQ ID NOS: 13 and 14; And a pair of primers represented by SEQ ID NOS: 17 and 18, respectively.
6. The method of claim 5,
The virus may be selected from Barley virus G (BVG), Rice black-streaked dwarf virus (RBSDV), Rice stripe virus (RSV), Panicum mosaic virus wherein the primer set is at least one selected from the group consisting of a strain mosaic virus (PDMV), a Northern cereal mosaic virus (NCMV), and a Setaria yellow dwarf virus (SeYDV).
6. A composition for diagnosing millet or avirulent multiple viruses, comprising a primer set for multiparity or avirulence multiplex diagnosis according to claim 5 or 6.
7. A kit for multiple or avirulent multiple diagnosis, comprising a composition for multiparity or avirulence multiplex diagnosis according to claim 7.
a) obtaining DNA from a sample;
b) amplifying the DNA obtained in step a) using a primer set for multiparous or coarse virus detection according to claim 5 or 6; And
and c) detecting the amplification product obtained in step b).
10. The method of claim 9,
The amplification of step b) may be performed using a polymerase chain reaction, a duplex polymerase chain reaction, a duplex PCR, a multiplex polymerase chain reaction, a reverse transcription polymerase The RT-PCR method can be applied to competitive polymerase chain reaction (RT-PCR), real-time polymerase chain reaction (RT-PCR), real-time quantitative polymerase chain reaction Wherein the method is one selected from the group consisting of Reaction, DNA chip, Loop-mediated isothermal amplification, and combinations thereof.
10. The method of claim 9,
Wherein the detection of the amplification product in step c) is performed using any one method selected from the group consisting of capillary electrophoresis, DNA chip, gel electrophoresis, radioactivity measurement, fluorescence measurement, phosphorescence measurement and combinations thereof. Or multiple viruses.

Images