KR102202687B1 - Primer set for loop-mediated isothermal amplification reaction for detecting Aichivirus-A, and use thereof - Google Patents

Abstract

The invention Aichi virus that can cause acute gastroenteritis, a person -A (Aichivirus - A; AiV- A) a primer set for an isothermal amplification reaction for rapidly detecting the Aichi virus -A to determine with a high detection sensitivity, and It relates to its use.

Description

Primer set for loop-mediated isothermal amplification reaction for detecting Aichivirus-A, and use thereof for detecting Aichivirus-A

The invention Aichi virus that can cause acute gastroenteritis, a person -A (Aichivirus - A; AiV- A) a primer set for an isothermal amplification reaction for rapidly detecting the Aichi virus -A to determine with a high detection sensitivity, and It relates to its use.

Waterborne food-borne diseases refer to all diseases caused by ingestion of water or food contaminated with pathogenic microorganisms (viruses) or toxic substances. Water-borne food-borne diseases are known to cause inflammation while the causative pathogenic microorganisms proliferate in the gastrointestinal tract through oral administration, and it has been reported to show symptoms related to the gastrointestinal tract, such as abdominal pain, diarrhea, nausea, and vomiting. Viruses that cause waterborne food-borne diseases prevalent in Korea have been reported as norovirus, rotavirus, coxsackie virus, adenovirus, and Aichi virus-A.

Aichivirus- A is known as a virus first reported in Aichi Prefecture, Japan in 1989. It is mainly related to epidemic enteritis in children, and shows symptoms of gastroenteritis such as diarrhea and abdominal pain. It has been reported that mixed infections with other waterborne viruses occur well, and cases of infection have been reported worldwide regardless of developed and developed countries.

As a conventional diagnostic method for Aichivirus- A, reverse transcription polymerase chain reaction (RT-PCR), which is one of the polymerase chain reactions, has been mainly reported. Polymerase chain reaction (PCR) High detection sensitivity and convenience, but specialized equipment such as a polymerase chain reactor (thermocycler) because the target genetic material is amplified and detected by controlling the reaction temperature more than tens of times. There is a disadvantage in that it is necessary and the temperature change must be stably implemented within tens of seconds.

In addition, in the case of a method using an electron microscope, the presence of a virus can be confirmed, but there is a disadvantage in that morphological analysis is difficult. The enzyme immunoassay method has the advantage that it is possible to distinguish viruses with similar clinical features, but it is difficult to evaluate the proliferation and infectivity of the virus, and it has disadvantages of inferior accuracy as false negative results are reported.

Therefore, such a problem without Aichi virus -A (Aichivirus - A; AiV- A) to be a need to develop technologies capable of detecting with high sensitivity and specificity also exists.

"Identification by next-generation sequencing of Aichivirus B in a calf with enterocolitis and neurologic signs: a cautionary tale "Journal of veterinary diagnostic investigation: official publication of the American Association of Veterinary Laboratory Diagnosticians, Inc v.29 no.2, 2017 , pp.208-211

The present inventors -A Aichi virus that can cause acute gastroenteritis; research efforts result to detect the (Aichivirus AiV A-A) with a high sensitivity, rapidly and in a high detection sensitivity isothermal to diagnose Aichi virus -A The present invention was completed by developing a primer set for amplification reaction.

Therefore, it is an object of the present invention to detect Aichi virus-A with high specificity and high detection sensitivity because it has high species specificity that does not react with viruses of other species other than Aichi virus-A and allows gene amplification at a single temperature. It is to provide a primer set for isothermal amplification reaction.

Another object of the present invention is to provide a diagnostic kit and a diagnostic method capable of quickly and accurately diagnosing infection of Aichi virus-A using a primer set for isothermal amplification reaction capable of detecting Aichi virus-A.

Objects of the present invention are not limited to the above-mentioned objects, and other objects not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the above-described object of the present invention, the present invention comprises a primer set for isothermal amplification reaction for detecting Aichivirus-A (Aichivirus-A; AiV-A) comprising the nucleotide sequence of SEQ ID NO: 1 to 4 to provide.

In addition, the present invention provides a primer set for isothermal amplification reaction for detecting Aichi virus-A, including the nucleotide sequence of SEQ ID NO: 5 to 8.

In a preferred embodiment, the nucleotide sequence of SEQ ID NO: 1 to 4 or the nucleotide sequence of SEQ ID NO: 5 to 8 is designed and manufactured by the 2AB gene of the Aichivirus-A (Aichivirus-A; AiV-A) as a template. will be.

In addition, the present invention provides a primer composition for isothermal amplification reaction for detecting Aichivirus-A (AiV-A) comprising any one of the above-described primer sets.

In a preferred embodiment, a DNA polymerase for isothermal amplification reaction, dNTPs, and a reaction buffer are further included.

In addition, the present invention provides a diagnostic kit for detecting Aichivirus-A (AiV-A), including the composition described above.

In a preferred embodiment, the Aichi virus-A is GenBank accession number NC_001918.1.

In addition, the present invention comprises the steps of extracting RNA from a subject sample; Synthesizing cDNA from the RNA; Amplifying the target sequence by performing an isothermal amplification method (LAMP) at 60°C to 65°C using the cDNA as a template and the primer set of claim 1 or 2; It provides a method for diagnosing Aichivirus-A (Aichivirus-A; AiV-A) comprising; and detecting the amplified product.

In a preferred embodiment, the step of detecting the amplified product is performed through any one of DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, or phosphorus measurement.

First, the primer set for isothermal amplification reaction of the present invention has high species specificity that does not react with viruses of other species other than Aichivirus-A, and allows gene amplification at a single temperature, so Aichi virus with rapid, high specificity and high detection sensitivity. A can be detected.

In addition, according to the diagnostic kit and diagnostic method including a primer set for isothermal amplification reaction capable of detecting Aichi virus-A of the present invention, it is possible to diagnose the infection of Aichi virus-A accurately while having a fast and high detection intensity. Yes, it is possible to quickly treat infected patients for treatment.

These technical effects of the present invention are not limited only to the ranges mentioned above, and even if not explicitly mentioned, the effects of the invention that can be recognized by those of ordinary skill in the art from the description of specific details for the implementation of the invention described later are also Of course it is included.

1A and 1B show the results of electrophoresis of isothermal amplification products of Aichi virus-A using a primer set for isothermal amplification according to an embodiment of the present invention.
2 shows the specificity results of a primer set through a total of 10 isothermal amplification reactions including Aichi virus-A and 9 reference waterborne viruses according to an embodiment of the present invention.
3 shows the detection sensitivity of the primer set through an isothermal amplification reaction after diluting the nucleic acid of Aichi virus-A by a step dilution method in order to confirm the detection sensitivity of the primer set according to an embodiment of the present invention.
4 shows the result of electrophoresis after treatment with a restriction enzyme in order to determine whether the primer set according to an embodiment of the present invention is false-positive.

The terms used in the present invention have been selected from general terms that are currently widely used while considering functions in the present invention, but this may vary depending on the intention or precedent of a technician working in the field, the emergence of new technologies, and the like. In addition, in certain cases, there are terms arbitrarily selected by the applicant, and in this case, the meaning of the terms will be described in detail in the description of the corresponding invention.

When'include','have', and'consist of' mentioned in the present invention are used, other parts may be added unless'only' is used. In the case of expressing the constituent elements in the singular, it includes the case of including the plural unless specifically stated otherwise.

In interpreting the constituent elements, it is interpreted as including an error range even if there is no explicit description.

The characteristic parts of each of the various embodiments of the present invention can be partially or entirely combined or combined with each other, technically various interlocking and driving are possible, and each of the embodiments may be independently implemented with respect to each other, or in a related relationship. You can also do it together.

In the present invention, the'primer' is a nucleic acid sequence having a short free 3'hydroxyl group, and can form a base pair with a template of a complementary nucleic acid, and for strand copying of a nucleic acid template It refers to a short nucleic acid sequence that functions as a starting point. The primers are capable of initiating DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymer raise or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer and temperature.

Hereinafter, the technical configuration of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. The same reference numerals used to describe the present invention throughout the specification denote the same elements.

The technical feature of the present invention is that it has high species specificity that does not react with viruses of other species other than Aichi virus-A, and allows gene amplification at a single temperature, so that Aichi virus that can cause acute gastroenteritis with rapid, high specificity and high detection sensitivity- It is to provide a primer set for isothermal amplification reaction capable of detecting A with rapid and high detection sensitivity and a use thereof.

That is, the present inventors used a loop-mediated isothermal amplification (LAMP) method to detect Aichi virus-A that can cause acute gastroenteritis without specialized equipment within a short time in real time in the field, but the isothermal amplification method is conventional Unlike RT-PCR (polymerase chain reaction), since it does not require temperature control to amplify genes, genes can be amplified without specialized equipment, and high-concentration genes can be amplified within a short time.

Therefore, the primer set for isothermal amplification reaction of the present invention is for detecting Aichivirus-A ( Aichivirus - A ; AiV-A), and includes a nucleotide sequence of SEQ ID NO: 1 to 4 or a nucleotide sequence of SEQ ID NO: 5 to 8 can do. If necessary, the primer set for isothermal amplification reaction of the present invention may consist only of the nucleotide sequences of SEQ ID NOs: 1 to 4, or may consist only of the nucleotide sequences of SEQ ID NOs: 5 to 8.

Here, in order to use loop-mediated isothermal amplification (LAMP), four primers (F3, B3, FIP, and BIP) must act as one set, of which F3 and FIP are in the 5 directions of the gene. It is a primer that binds, B3 and BIP are primers that bind in the reverse direction in three directions, and FIP and BIP are primers that include the base sequences of F2 (or B2) and F1c (or B1c). The four types of primers used in the isothermal amplification method can be specifically classified into forward and reverse external primers, and forward and reverse internal loop primers. The primer set for isothermal amplification reaction according to the present invention The nucleotide sequences of SEQ ID NOs: 1 to 4 included in, as an embodiment, an external forward primer of SEQ ID NO: 1, an external reverse primer of SEQ ID NO: 2, an internal forward ring primer of SEQ ID NO: 3, and an internal reverse ring primer of SEQ ID NO: 4 It can be made including. In addition, the nucleotide sequence of SEQ ID NO: 5 to 8 included in the primer set for isothermal amplification reaction according to the present invention is an external forward primer of SEQ ID NO: 5, an external reverse primer of SEQ ID NO: 6, and an internal forward direction of SEQ ID NO: 7. It may comprise a ring primer, an internal reverse ring primer of SEQ ID NO: 8.

The primer set of the present invention, i.e., the nucleotide sequence of SEQ ID NO: 1 to 4 or the nucleotide sequence of SEQ ID NO: 5 to 8, is prepared using the nucleotide sequence (4,400-5,199) of the 2AB gene site of Aichi virus-A, not the entire virus sequence I did. The 2AB gene is a protein related to the diversity of picornavirus and is known as a cellular protein, and is known as a gene that plays an important role in the distinction of picornaviruses such as human parechovirus , Aichivirus, and avian encephalomyelitis virus . In the present invention, a primer is designed and produced using the 2AB gene as a template.

The primer composition for isothermal amplification reaction for detecting Aichivirus-A (AiV-A) of the present invention comprises a primer set comprising SEQ ID NOs: 1 to 4 or a primer set comprising SEQ ID NOs: 5 to 8 However, if necessary, a DNA polymerase for isothermal amplification reaction, dNTPs, and a reaction buffer may be further included.

The diagnostic kit of the present invention can detect Aichivirus-A (Aichivirus-A; AiV-A) by including a primer composition for isothermal amplification reaction, and Aichivirus-A may be GenBank accession number NC_001918.1.

In addition, the diagnostic method of the present invention comprises the steps of extracting RNA from a target sample; Synthesizing cDNA from the RNA; Using the cDNA as a template, a primer set comprising SEQ ID NOs: 1 to 4 or a primer set comprising SEQ ID NOs: 5 to 8 by performing isothermal amplification (LAMP) at 60 to 65 °C to amplify the target sequence step; And detecting the amplification product. Here, the step of detecting the amplification product may be performed through any one of DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement, or phosphorus measurement.

The primer for isothermal amplification reaction of the present invention is a primer designed from a species-specific nucleotide sequence, and not only can diagnose whether it is actually infected with Aichi virus-A, but also detect the theoretically synthesized Aichi virus-A gene. , There is no nonspecific reaction with nucleic acids other than the target virus, and the detection power is excellent for the target virus. In addition, the reaction using the primer for isothermal amplification reaction of the present invention was designed to increase the detection efficiency by making the reaction conditions the same for all virus and primer combinations.

Example 1

1. Viral nucleic acid collection

To confirm the specificity of the isothermal amplification method, the 2AB gene of Aichi virus-A (4,400-5,199) and 16 reference viruses [Rotavirus (RV), Enterovirus 5 (E5), Norovirus (NoV), Coronavirus (Co), Enterovirus) 68(E68), Coxsackievirus A6 (CA6), Coxsackievirus B1 (CB1), Coxsackievirus B5 (CB5), Enterovirus 71(E71), Adenovirus 41 (Adv-41), non-enteric Adenovirus (nAdV), Parvovirus-B19 (ParV) ), Aichivirus-B (AiV-B), Aichivirus-C (AiV-C), Sapovirus (SV) and Hepatitis A virus (HAV)] were collected.

2. Preparation of specific primer for isothermal amplification reaction

In order to diagnose Aichiviru s-A (AiV-A) through isothermal amplification method, primer design was designed using the Primerexplorer V3 program. In order to perform the isothermal amplification method, four types of primers (F3, B3, FIP, BIP) must act as one set, and Aichi virus-A specificity by comparing the nucleotide sequences of the target virus and reference virus genes collected as above. A typical primer (set 1) was prepared.

Table 1 below shows the base sequence of the primer for isothermal amplification reaction (LAMP primer) set 1 designed and manufactured according to an embodiment of the present invention.

primer LAMP primer sequence
(5'-3') Combination number name division Sequence number Set 1 AiV set1 F3 Outer One AACCCCCATGTCCATCTCC AiV set1 B3 Outer 2 ACTCGACGTTGCGCATTG AiV set1 FIP Inner 3 AGGACATTTCCAGAGGCGGTGACTCCTCGTCATCATCTGTGC AiV set1 BIP Inner 4 ATTAGGCCTGTCCGTCACGCGTCTTTGAGCCCTTGAGGTTC

Example 2

Using the same method as in Example 1, Aichivirus-A specific primers (set 2) were prepared. Table 2 below shows the nucleotide sequence of the primer for isothermal amplification reaction (LAMP primer) set 2 designed and manufactured according to another embodiment of the present invention.

primer LAMP primer sequence
(5'-3') Combination number name division Sequence number Set 2 AiV set2 F3 Outer 5 CAAATCCGGCCCTCA AiV set2 B3 Outer 6 GGGGAGTAGACGTCATCGG AiV set2 FIP Inner 7 GGCATTTGCGGTGTTGGGAGATCTCTTCCTTCCTCAACCAAGCA AiV set2 BIP Inner 8 GAACCCGTGGTGGTCTACCTCTGGAAAGGGTTTGAGCGAGG

Comparative Examples 1 to 3

Using the same method as in Example 1, Aichi virus-A specific primers (sets 3 to 5) were prepared.

Table 3 below shows the nucleotide sequences of sets 3 to 5 for isothermal amplification reaction primers (LAMP primers) designed and manufactured according to Comparative Examples 1 to 3 of the present invention.

primer LAMP primer sequence
(5'-3') Combination number name division Sequence number Set 3 AiV set3 F3 Outer One CCTTCCTCAACCAAGCAGTC AiV set3 B3 Outer 2 GAGGGGGAGTAGACGTCAT AiV set3 FIP Inner 3 TAGACCACCACGGGTTCAGGCGTTGGGAGATGGCAAGGG AiV set3 BIP Inner 4 CCGGCACTGGCAAATCCCTCGCAAGACGCTGGGAAAGG Set 4 AiV set4 F3 Outer One CCTTCCTCAACCAAGCAGTCA AiV set4 B3 Outer 2 GGGGAGTAGACGTCATCGG AiV set4 FIP Inner 3 CCGTAGAGGTAGACCACCACGGTCCCAACACCGCAAATGC AiV set4 BIP Inner 4 CCGGCACTGGCAAATCCCTCGCAAGACGCTGGGAAAGG Set 5 AiV set4 F3 Outer One CCATGTCCATCTCCGGTCT AiV set4 B3 Outer 2 ACTCGACGTTGCGCATTG AiV set4 FIP Inner 3 AGGACATTTCCAGAGGCGGTGACATCTGTGCCGACCTTGC AiV set4 BIP Inner 4 ATTAGGCCTGTCCGTCACGCCCTTGAGGTTCAAGGGTTGC

Example 3

In order to confirm whether the primer set (set 1) prepared in Example 1 can be used to detect Aichivirus-A, a primer composition 1 (set 1) for isothermal amplification reaction was prepared as follows.

The nucleic acid of Aichi virus-A was subjected to gene synthesis by requesting the nucleotide sequence of the 2AB gene position (4,400-5,199) known in GenBank accession number NC_001918.1 to Macrogen.

After synthesizing the corresponding nucleotide sequence, the synthesized gene was inserted into the pTOP Blunt V2 vector and provided in a lyophilized form.

Then, a 10-fold (10X) isothermal amplification reaction buffer (20 mM Tris-HCl, 10 mM (NH ₄ ) ₂ SO ₄ , 10 mM KCl, 2 mM MgSO 4, and 0.1% Triton X-100) 2 uL, 10 mM dNTPs (dATP, dGTP, dTTP, dCTP mixture containing 10 mM each) 0.5 uL, 10 pmole concentration of F3 and B3 primer 0.5 uL, 10 pmole concentration of FIP and BIP primer 2 uL, plasmid 1 synthesized from template nucleic acid uL (100 ng/uL) and 10.5 uL of sterile distilled water were added to the reaction tube and then mixed. After reacting the prepared isothermal amplification reaction composition at 95°C for 10 minutes and 4°C for 1 minute, Bst. 1uL of polymerase (8 unit/uL) was added to the reaction tube to finally prepare 20 uL of a primer composition for isothermal amplification reaction (set 1).

Example 4

The primer composition 2 (set 2) for isothermal amplification reaction was prepared in the same manner as in Example 3, except that the primer set (set 2) prepared in Example 2 was used instead of the primer set (set 1) prepared in Example 1. Was prepared.

Comparative Examples 4 to 6

For comparative isothermal amplification reaction in the same manner as in Example 3, except that the primer sets prepared in Comparative Examples 1 to 3 (sets 3 to 5) were used instead of the primer set (set 1) prepared in Example 1 Primer composition 1 (set 3), comparative example primer composition 2 (set 4) for isothermal amplification reaction, and comparative example primer composition 3 (set 5) for isothermal amplification reaction were prepared by 20 uL each.

Experimental Example 1

Primer compositions 1 and 2 for isothermal amplification reactions prepared in Examples 3 and 4 and Comparative Examples 4 to 6, respectively (set 1 and set 2), and primer compositions 1 to 3 for isothermal amplification reaction (sets 3 to 6) Isothermal amplification reaction was performed on the template nucleic acid of Aichi virus-A using set 5), and the isothermal amplification reaction was performed at 60, 61, 62 and 63°C for 1 hour. Of the 20 uL of the amplified product having completed the reaction, 4 uL was electrophoresed on a 1.2% agarose gel to confirm whether the gene was amplified by a color reaction under ultraviolet light, and the results are shown in FIGS. 1A and 1B.

1A and 1B, primer composition 1 for isothermal amplification reaction including primer set 1 of Example 1 (set 1) and primer composition 2 for isothermal amplification reaction including primer set 2 of Example 2 (set 2) In common, isothermal amplification reactions were observed at 61°C and 62°C. On the other hand, for Comparative Example isothermal amplification reaction primer compositions 1 and 3 (Set 3 and Set 5), the reaction of negative control was confirmed, and Comparative Example isothermal amplification reaction primer composition 2 (Set 4) isothermal amplification reaction at all temperatures. Not confirmed. Here, "60, 61, 62, 63" represents the isothermal amplification reaction temperature, and "N" is a negative control, which is a sample that does not contain a plasmid synthesized from Aichi virus-A template nucleic acid.

Experimental Example 2

For the primer set 1 prepared in Example 1 and the primer set 2 prepared in Example 2 in which the isothermal amplification reaction was confirmed in Experimental Example 1, it was confirmed whether these primer sets were specifically isothermal amplification for Aichivirus-A. For isothermal, including 16 reference viruses collected in Example 1 using the primer composition 1 (set 1) for isothermal amplification reaction prepared in Examples 3 and 4 and the primer composition 2 (set 2) for isothermal amplification reaction The amplification reaction was carried out, and the reaction temperature was 62°C. Of the 20 uL of the amplification product for which the reaction was completed, 4 uL were each electrophoresed on a 1.2% agarose gel to confirm whether the gene was amplified, and the results are shown in FIG.

FIG. 2 shows the specific reaction of Aichi virus-A of primer set 1 and primer set 2 through isothermal amplification reaction using a template nucleic acid of Aichi virus-A and a nucleic acid of 16 reference viruses as a template. Here, "RV, E5, NoV, Co, E68, CA6, CB1, CB5, E71, Adv-41, nAdV, ParV, AiV-B, AiV-C, SV and HAV" is the target virus and reference indicated in Example 1. Abbreviations of 16 kinds of viruses are shown, and "N" is a negative control, which is a sample that does not contain the synthesized plasmid of Aichi virus-A.

As shown in FIG. 2, the isothermal amplification reaction was confirmed only in the target virus, Aichi virus-A, for primer set 1 and primer set 2, and it was confirmed that Aichi virus-A can be specifically amplified.

Accordingly, it can be seen that both primer set 1 prepared in Example 1 and primer set 2 prepared in Example 2 are primer sets suitable for isothermal amplification of Aichi virus-A template nucleic acid.

Experimental Example 3

In order to confirm the detection sensitivity of the primer set 1 prepared in Example 1 and the primer set 2 prepared in Example 2 to Aichi virus-A, the synthesized plasmid, the template nucleic acid of Aichi virus-A, was diluted by a step dilution method. Isothermal amplification reaction was performed. The isothermal amplification primer composition 1 (set 1) and the isothermal amplification primer composition 2 (set 2) prepared in Examples 3 and 4 were used, and the reaction temperature was 62°C. Implemented. Of the 20 uL of the amplification product for which the reaction was completed, 4 uL was electrophoresed on a 1.2% agarose gel to confirm whether the gene was amplified, and the results are shown in FIG. 3.

3 is a result of confirming the detection sensitivity of the primer composition for isothermal amplification reaction (set 2) of the present invention to detect Aichi virus-A. Here, "10 ^-3 to 10 ^-9 "represents the dilution ratio of the synthesized plasmid, which is a template nucleic acid, and "N" is a negative control, which is a sample that does not contain the template nucleic acid. According to FIG. 3, it was confirmed that primer set 1 can diagnose Aichivirus- A up to 10 ^-6 (100 fg/uL) dilution factor, and primer set 2 is Aichivirus up to 10 ^-5 (1 pg/uL) dilution factor. It was confirmed that -A could be diagnosed.

Experimental Example 4

In order to check whether the isothermal amplification reaction of primer set 1 prepared in Example 1 and primer set 2 prepared in Example 2 is false positive, PCR was performed using primers F3 and B3 of set 1, and then the amplification base of set 2 Restriction enzyme treatment was performed with Aci I (5'-C/CGC-3') and Hae III (5'-GG/CC-3') restriction enzymes that can be processed within the sequence range. Restriction enzyme treatment consists of 2 uL of amplification product, 1 uL of restriction enzyme reaction buffer (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate and 100 ug/ml BSA), 4 uL of restriction enzyme and 3 uL of sterile distilled water. 10 uL of the restriction enzyme-treated composition was prepared and then reacted at 37°C for 2 hours. All 10 uL of the reaction-completed product was electrophoresed on a 1.2% agarose gel to confirm false positives, and the results are shown in FIG. 4. Here, "LAMP" represents the result of PCR using the F3 and B3 primers of the isothermal amplification reaction primer set 1, and "Aci I, Hae III" represents the PCR amplification product using the F3 and B3 primers of the primer set 2 It shows the results of treatment with Aci I and Hae III restriction enzymes.

From Figure 4, it can be seen that when the amplification product is treated with the restriction enzyme Aci I, the truncated amplification product of 152 + 74 bp is identified, and when the restriction enzyme is treated with Hae III, the truncated amplification product of 128 + 98 bp is confirmed. there was. Thus, it can be seen that the designed primer sets 1 and 2 actually amplify the 2AB gene of Aichivirus- A.

Although the present invention has been illustrated and described with a preferred embodiment as described above, it is not limited to the above-described embodiment, and within the scope not departing from the spirit of the present invention, to those of ordinary skill in the technical field to which the present invention belongs. Various changes and modifications will be possible. For example, even if the described techniques are performed in a different order from the described method, and/or the described components are combined or combined in a form different from the described method, or are replaced or substituted by other components or equivalents. Appropriate results can be achieved.

<110> DANKOOK UNIVERSITY <120> Primer set for loop-mediated isothermal amplification reaction for detecting Aichivirus-A, and use thereof <130> DPP-2018-0186-KR <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F3 primer <400> 1 aacccccatg tccatctcc 19 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> B3 primer <400> 2 actcgacgtt gcgcattg 18 <210> 3 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> FIP primer <400> 3 aggacatttc cagaggcggt gactcctcgt catcatctgt gc 42 <210> 4 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> BIP primer <400> 4 attaggcctg tccgtcacgc gtctttgagc ccttgaggtt c 41 <210> 5 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> F3 primer <400> 5 caaatccggc cctca 15 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> B3 primer <400> 6 ggggagtaga cgtcatcgg 19 <210> 7 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> FIP primer <400> 7 ggcatttgcg gtgttgggag atctcttcct tcctcaacca agca 44 <210> 8 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> BIP primer <400> 8 gaacccgtgg tggtctacct ctggaaaggg tttgagcgag g 41

Claims (9)

As a primer set comprising the nucleotide sequence of SEQ ID NO: 1 to 4,
The primer set specifically binds to Aichivirus-A (Aichivirus-A; AiV-A) with GenBank accession number NC_001918.1,
The base sequence of SEQ ID NO: 1 to 4 is for isothermal amplification reaction for detecting Aichivirus-A, characterized in that the 2AB gene of the Aichivirus-A (AiV-A) is designed and produced as a template Primer set.
As a primer set comprising the nucleotide sequence of SEQ ID NO: 5 to 8,
The primer set specifically binds to Aichivirus-A (Aichivirus-A; AiV-A) with GenBank accession number NC_001918.1,
The base sequence of SEQ ID NO: 5 to 8 is for isothermal amplification reaction for detecting Aichi virus-A, characterized in that the 2AB gene of the Aichivirus-A (AiV-A) is designed and produced as a template Primer set.
delete A primer composition for isothermal amplification reaction for detecting Aichivirus-A (Aichivirus-A; AiV-A) comprising the primer set of claim 1 or the primer set of claim 2. The method of claim 4,
A primer composition for isothermal amplification reaction for detecting Aichi virus-A, characterized in that it further comprises a DNA polymerase for isothermal amplification reaction, dNTPs, and a reaction buffer.
A diagnostic kit for detecting Aichivirus-A (Aichivirus-A), comprising the composition of claim 4.
delete Extracting RNA from a target sample excluding the human body;
Synthesizing cDNA from the RNA;
Amplifying the target sequence by performing an isothermal amplification method (LAMP) at 60°C to 65°C using the cDNA as a template and the primer set of claim 1 or 2; And
Detecting the amplified product; Aichivirus-A (Aichivirus-A; AiV-A) diagnostic method comprising.
The method of claim 8,
The step of detecting the amplification product is Aichivirus-A (Aichivirus-A; AiV-A), characterized in that it is performed through any one of DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement, or factor measurement. ) How to diagnose.

Images