KR101613113B1 - Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same - Google Patents

Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same Download PDF

Info

Publication number
KR101613113B1
KR101613113B1 KR1020130147937A KR20130147937A KR101613113B1 KR 101613113 B1 KR101613113 B1 KR 101613113B1 KR 1020130147937 A KR1020130147937 A KR 1020130147937A KR 20130147937 A KR20130147937 A KR 20130147937A KR 101613113 B1 KR101613113 B1 KR 101613113B1
Authority
KR
South Korea
Prior art keywords
primer
detecting
nodavirus
primer set
dna
Prior art date
Application number
KR1020130147937A
Other languages
Korean (ko)
Other versions
KR20150062854A (en
Inventor
이택견
서승석
황진익
박미례
Original Assignee
한국해양과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국해양과학기술원 filed Critical 한국해양과학기술원
Priority to KR1020130147937A priority Critical patent/KR101613113B1/en
Publication of KR20150062854A publication Critical patent/KR20150062854A/en
Application granted granted Critical
Publication of KR101613113B1 publication Critical patent/KR101613113B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 노다바이러스(nodavirus)를 검출하기 위한 프라이머에 대한 것으로, 특히 LAMP(Loop-mediated isothermal amplification)법을 이용하여 노다바이러스를 검출하기 위한 것이며, 더욱 상세하게는 노다바이러스에 감염되었는지의 여부를 현장에서 육안으로 신속하게 고감도로 확인할 수 있는 노다바이러스를 검출하기 위한 등온증폭 반응용 프라이머 세트, 이를 포함하는 프라이머 조성물, 및 이를 이용한 검출방법에 관한 것이다.The present invention relates to a primer for detecting nodavirus, and more particularly to a primer for detecting Nodavirus using Loop-mediated isothermal amplification (LAMP), more particularly, The present invention relates to a primer set for isothermal amplification reaction for detecting Noda virus which can be confirmed with high sensitivity by the naked eye in the field, a primer composition containing the same, and a detection method using the same.

Description

노다바이러스를 검출하기 위한 등온증폭 반응용 프라이머 세트, 이를 포함하는 프라이머 조성물, 및 이를 이용한 노다바이러스 검출방법{Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same}[0001] The present invention relates to a primer set for isothermal amplification reaction for detecting Noda virus, a primer composition containing the primer composition, and a method for detecting Noda virus using the same. nodavirus using the same}

본 발명은 노다바이러스(nodavirus)를 검출하기 위한 프라이머에 대한 것으로, 특히 LAMP(Loop-mediated isothermal amplification)법을 이용하여 노다바이러스를 검출하기 위한 것이며, 더욱 상세하게는 노다바이러스에 감염되었는지의 여부를 현장에서 육안으로 신속하게 고감도로 확인할 수 있는 노다바이러스를 검출하기 위한 등온증폭 반응용 프라이머 세트, 이를 포함하는 프라이머 조성물, 및 이를 이용한 검출방법에 관한 것이다.
The present invention relates to a primer for detecting nodavirus, and more particularly to a primer for detecting Nodavirus using Loop-mediated isothermal amplification (LAMP), more particularly, The present invention relates to a primer set for isothermal amplification reaction for detecting Noda virus which can be confirmed with high sensitivity by the naked eye in the field, a primer composition containing the same, and a detection method using the same.

우리나라의 대표적인 어류질병으로는 노다바이러스병을 포함해서 이리도바이러스별, 에드와드병, 연쇄구균병, 비브리오병, 활주세균병 등이 있다. 이들 바이러스는 수산동물 질병으로 국내 총 피해규모가 연간 약 2,500억원으로 추정된다. The most common fish diseases in Korea include Nodaviridae, Irido virus, Edwad, Streptococcus, Vibrio and Slide bacterial diseases. These viruses are estimated to total about 250 billion won in total damage due to animal diseases in Korea.

특히, 노다바이러스(nodavirus)는 동남아시아 국가들 에서 발병한 어류전염병으로 수평 감염 과 20~30℃의 고수온기에 발병한다. 감염된 어류는 무기력하게 유영하며 채색흑화/ 회색, 출혈, 안구돌출 등의 증상이 있으며, 해부시 지장 종대/흑화, 위심강내 출혈 등이 특징적으로 나타난다. In particular, nodavirus is a fish infectious disease that occurs in Southeast Asian countries, and it occurs in horizontal infection and high temperature of 20 ~ 30 ℃. The infected fish swim helplessly and have symptoms such as color blackening / graying, bleeding, and protrusion of the eyeball. The anatomical features of the anatomic tendon / blackening and intracranial hemorrhage are characteristic features.

한편, 종래의 바이러스 진단법으로는 전자현미경 또는 혈청학적 방법을 주로 사용하였다. 그러나, 전자현미경을 이용한 방법은 바이러스의 존재를 확인할 수는 있지만 형태학적 특징으로 종을 진단하는 것은 거의 불가능하다. 또한, 혈청학적 방법 중 ELISA(Enzyme-Linked Immunosorbent Assay) 방법은 가장 일반적으로 사용되는 진단 방법이나 중합효소연쇄반응(Polymerase Chain Reaction, PCR) 진단법보다 검출감도가 약 1,000배 정도 낮으며, 항체와 검사시료의 예상하지 못한 비특이적 반응으로 정확한 진단이 실패하는 경우가 자주 발생한다. On the other hand, an electron microscope or a serological method was mainly used as a conventional virus diagnosis method. However, electron microscopy can detect the presence of virus, but it is almost impossible to diagnose the species as a morphological feature. In addition, among the serological methods, ELISA (Enzyme-Linked Immunosorbent Assay) has a detection sensitivity about 1,000 times lower than the most commonly used diagnostic methods or Polymerase Chain Reaction (PCR) Accurate diagnosis often fails due to unexpected nonspecific reactions of the sample.

최근에는 바이러스를 진단하기 위하여 높은 검출감도와 편리성을 가지고 있는 PCR 방법을 일반적으로 많이 사용하고 있으나, PCR을 이용한 진단 방법은 특이적인 프라이머(primer)의 개발이 매우 중요하며, 증폭된 반응산물을 전기영동(electrophoresis)으로 확인하고, 최종적으로는 염기서열 분석(DNA sequencing)을 해야 하는 일련의 과정을 거쳐야한다. 더불어 이러한 방법은 중합효소연쇄반응기(Thermocycler)와 같은 전문적인 장비 및 이를 운용할 수 있는 전문 인력이 요구되며, 최종 확인을 위한 증폭산물의 염기서열 분석은 고비용 및 고기술력을 요구하는 과정이다. 또한 이러한 일련의 과정들은 수행하는데 있어서 많은 시간이 소요되며 육안으로 식별 가능한 검출법이 아니기 때문에 분석 장비가 갖춰지지 않은 현장에서의 활용력은 현저히 떨어진다. 이와 같이 바이러스를 단시간 내에 효과적으로 검출하기 위해서는, 전문장비 없이 현장에서 실시간으로 검출할 수 있는 방법의 개발이 요구되고 있는 실정이다.In recent years, PCR methods with high detection sensitivity and convenience have been widely used for the diagnosis of viruses. However, it is very important to develop specific primers for the diagnostic method using PCR. It must be confirmed by electrophoresis and finally subjected to a sequence of DNA sequencing. In addition, this method requires specialized equipment such as a thermocycler and a professional manpower to operate it, and sequencing of the amplification product for final confirmation is a process requiring high cost and high technology. In addition, this process is time-consuming to perform and is not visually detectable. Therefore, the ability to use analytical equipment in the field is significantly reduced. In order to effectively detect the virus in such a short time, development of a method capable of real-time detection on the spot without professional equipments is required.

등온증폭법(Loop-mediated isothermal amplification, LAMP)은 기존의 PCR 방법과 유사하나 기존 PCR 방법은 변성, 접합, 및 신장의 세 단계를 반복적으로 수행하면서 유전자의 증폭을 시행하기 때문에 반응과정 중 지속적으로 온도의 변화를 필요로 하는 반면, 등온증폭법은 고정된 일정 온도에서 접합 및 신장이 가능한 장점을 가지고 있다. 이는 기존 PCR 방법에 사용되는 Taq DNA 중합효소(Taq DNA polymerase)를 사용하는 대신, 핵산말단가수분해(exonuclease) 기능을 갖고 있는 Bst DNA 중합효소(Bst DNA polymerase)를 사용함으로써 열에 의존하지 않고 DNA의 이중나선 구조의 변성을 유발할 수 있기 때문이다. 따라서 등온증폭법은 유전자를 증폭하는 동안 온도의 변화를 필요로 하지 않기 때문에 전문장비 없이 손쉽게 고정된 온도에서 유전자 증폭을 가능하게 한다.The isothermal amplification method (LAMP) is similar to the conventional PCR method, but the conventional PCR method repeatedly performs three steps of denaturation, splicing, and elongation to amplify the gene, The isothermal amplification method has the advantage of being able to bond and stretch at a fixed temperature. This is because the Taq DNA polymerase ( Taq DNA It is because the polymerase) may result in place of the nucleic acid ends hydrolysis (denaturation of the double helix structure of the DNA rather than relying column by using an exonuclease) Bst DNA polymerase (Bst DNA polymerase) that has the ability to use. Therefore, isothermal amplification does not require a temperature change during amplification of the gene, which makes gene amplification possible at fixed temperature with no special equipment.

그러나, LAMP법을 이용하여 바이러스와 관련된 특정 유전자의 검출이 가능하였다 하더라도 결과의 확인을 위해서는 전기영동기 등의 실험실적 장비와 기술을 필요로 한다. 따라서 실제로 LAMP를 이용한 검출법의 현장적용을 위해서는 검출단계에서 뿐만 아니라 결과의 확인 단계에서도 현장에서 시행할 수 있는 손쉬운 방법이 요구된다.However, even if detection of a specific gene related to a virus is possible by using the LAMP method, it requires laboratory equipments and techniques such as electrophoresis to confirm the result. Therefore, in order to apply the detection method using LAMP in practice, an easy method that can be performed in the field is required not only in the detection step but also in the confirmation step of the result.

본 발명자들은 어류 양식에서 크게 문제가 되고 있는 노다바이러스(nodavirus)를 용이하게 검출하기 위해 연구한 결과, 현장에서 전문장비 없이 노다바이러스를 모두 검출할 수 있는 등온증폭반응용 프라이머 세트를 개발하여 본 발명을 완성하게 되었다.
The inventors of the present invention have studied to easily detect nodavirus which is a major problem in fish culture, and as a result, developed a primer set for isothermal amplification reaction capable of detecting all Nodaviruses without professional equipment in the field, .

본 발명은 상기한 문제점을 해결하기 위한 것으로, 노다바이러스를 검출하거나 노다바이러스 감염 여부를 고감도이면서 신속하고 정확하게 확인할 수 있는 LAMP법을 이용한 노다바이러스 감염 진단용 프라이머 세트 및/또는 조성물을 제공하는데 그 목적이 있다.The object of the present invention is to provide a primer set and / or composition for diagnosing Nodavirus infection using LAMP method capable of detecting Nodavirus or detecting Nodavirus infection with high sensitivity and promptly and accurately. have.

또한, 본 발명은 상기 프라이머 세트를 이용하여 노다바이러스 감염여부 결과를 신속하면서도 고감도로 육안 확인이 가능하도록 한 노다바이러스 검출방법을 제공하는데 다른 목적이 있다.It is another object of the present invention to provide a method for detecting Nodavirus by using the primer set so that the Nodavirus infection result can be visually confirmed promptly and with high sensitivity.

또한, 본 발명은 노다바이러스 감염 여부의 진단을 용이하게 확인할 수 있는 진단용 키트를 제공하는데 또 다른 목적이 있다.
Another object of the present invention is to provide a diagnostic kit which can easily confirm diagnosis of Nodavirus infection.

상기한 목적을 달성하기 위한 본 발명은 서열번호 26 내지 29의 염기서열을 가지는 프라이머를 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스(nodavirus) 검출용 프라이머 세트이다.In order to accomplish the above object, the present invention is a primer set for detection of nodavirus using LAMP method, which comprises primers having the nucleotide sequences of SEQ ID NOS: 26 to 29.

또한, 본 발명은 상기한 프라이머 세트를 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스 검출용 프라이머 조성물인 것도 가능하다. The present invention can also be a primer composition for detecting Nodaca virus using the LAMP method, which comprises the above-described primer set.

또한, 본 발명의 다른 실시형태는, 시료에서 게놈 DNA(gDNA)를 추출하는 단계; 상기 게놈 DNA를 주형으로 상기한 프라이머 조성물을 이용하여 동온증폭법을 수행하여 표적서열을 증폭시키는 단계; 및 상기 증폭시킨 산물을 검출하는 단계;를 포함하는 노다바이러스 검출방법이다.According to another embodiment of the present invention, there is also provided a method for producing a genomic DNA comprising: extracting genomic DNA (gDNA) from a sample; Amplifying the target sequence by performing a homothermic amplification method using the genomic DNA as a template and the primer composition described above; And a step of detecting the amplified product.

또한, 본 발명의 또 다른 실시형태는, 상기한 프라이머 세트 및/또는 조성물을 포함하는 LAMP법을 이용한 노다바이러스(nodavirus) 검출용 진단 키트일 수 있다.
Further, another embodiment of the present invention may be a diagnostic kit for detection of nodavirus using the LAMP method including the above primer set and / or composition.

기타 실시예들의 구체적인 사항들은 상세한 설명 및 도면들에 포함되어 있다.
The details of other embodiments are included in the detailed description and drawings.

상기한 본 발명에 따른 노다바이러스 검출용 프라이머 세트는 이를 포함하는 진단용 키트에 시료를 넣고 LAMP법으로 항온 증폭시킨 다음 발광물질인 SybrGreen을 넣고 녹색의 형광을 관찰함으로써, 전기영동 등의 복잡한 과정 없이 시료에 노다바이러스가 포함되었는지 여부를 고감도이면서 신속하게 육안으로 확인할 수 있다는 이점이 있다.
In the primer set for detecting Nodaca virus according to the present invention, a sample is put in a diagnostic kit containing the sample, incubated at a constant temperature by the LAMP method, and then SybrGreen, which is a luminescent material, is inserted and green fluorescence is observed. It is advantageous to visually confirm whether or not the enodavirus is contained with high sensitivity and promptly.

도 1은 본 발명의 바람직한 일 실시예에 따른 등온증폭반응용 프라이머 세트를 이용하여 노다바이러스(Viral nervous necrosis virus :VNNV)를 증폭시킨 증폭 산물의 전기영동 결과를 보여주는 도면이다.
도 2는 본 발명의 바람직한 일 실시예에 따른 등온증폭반응용 프라이머 세트를 이용하여 이리도바이러스(Red sea bream iridovirus : RSIV)를 증폭시킨 증폭 산물의 전기영동 결과를 보여주는 도면이다.
도 3은 본 발명의 바람직한 일 실시예에 따른 프라이머 세트를 이용하여 증폭된 유전자를 SYBR Green Ⅰ을 이용하여 자연광원 하에서 확인한 결과를 보여주는 도면이다.FIG. 1 is a diagram showing the result of electrophoresis of an amplification product obtained by amplifying viral Nervous necrosis virus (VNNV) using a primer set for isothermal amplification according to a preferred embodiment of the present invention.
FIG. 2 is a graph showing an electrophoresis result of an amplification product obtained by amplifying Irido virus (RSIV) using a primer set for isothermal amplification according to a preferred embodiment of the present invention.
FIG. 3 is a diagram showing the result of checking a gene amplified using a primer set according to a preferred embodiment of the present invention under a natural light source using SYBR Green I.

본 발명은 다양한 변환을 가할 수 있고 여러 가지 실시 예를 가질 수 있는 바, 특정 실시 예들을 도면에 예시하고 상세한 설명에서 상세하게 설명하고자 한다. 그러나, 이는 본 발명을 특정한 실시 형태에 대해 한정하려는 것이 아니며, 본 발명의 사상 및 기술 범위에 포함되는 모든 변환, 균등물 내지 대체물을 포함하는 것으로 이해되어야 한다. 본 발명을 설명함에 있어서 관련된 공지 기술에 대한 구체적인 설명이 본 발명의 요지를 흐릴 수 있다고 판단되는 경우 그 상세한 설명을 생략한다.BRIEF DESCRIPTION OF THE DRAWINGS The present invention is capable of various modifications and various embodiments, and specific embodiments are illustrated in the drawings and will be described in detail in the detailed description. It is to be understood, however, that the invention is not to be limited to the specific embodiments, but includes all modifications, equivalents, and alternatives falling within the spirit and scope of the invention. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Hereinafter, the present invention will be described in detail with reference to the accompanying drawings.

본 출원에서 사용한 용어는 단지 특정한 실시예를 설명하기 위해 사용된 것으로, 본 발명을 한정하려는 의도가 아니다. 단수의 표현은 문맥상 명백하게 다르게 뜻하지 않는 한, 복수의 표현을 포함한다. 본 출원에서, "포함하다" 또는 "가지다" 등의 용어는 명세서상에 기재된 특징, 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것이 존재함을 지정하려는 것이지, 하나 또는 그 이상의 다른 특징들이나 숫자, 단계, 동작, 구성요소, 부품 또는 이들을 조합한 것들의 존재 또는 부가 가능성을 미리 배제하지 않는 것으로 이해되어야 한다.The terminology used in this application is used only to describe a specific embodiment and is not intended to limit the invention. The singular expressions include plural expressions unless the context clearly dictates otherwise. In the present application, the terms "comprises" or "having" and the like are used to specify that there is a feature, a number, a step, an operation, an element, a component or a combination thereof described in the specification, But do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, or combinations thereof.

제1, 제2 등의 용어는 다양한 구성요소들을 설명하는데 사용될 수 있지만, 상기 구성요소들은 상기 용어들에 의해 한정되어서는 안 된다. 상기 용어들은 하나의 구성요소를 다른 구성요소로부터 구별하는 목적으로만 사용된다.
The terms first, second, etc. may be used to describe various components, but the components should not be limited by the terms. The terms are used only for the purpose of distinguishing one component from another.

본 발명은 서열번호 26 내지 29의 염기서열을 가지는 프라이머를 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스(nodavirus) 검출용 프라이머 세트이다. The present invention is a primer set for detection of nodavirus using the LAMP method, which comprises a primer having the nucleotide sequence of SEQ ID NOS: 26 to 29.

본 발명자들은 단시간 내에 전문장비 없이 노다바이러스를 검출하기 위하여 등온증폭법(loop-mediated isothermal amplification, LAMP)을 이용하였다. 등온증폭법은 기존의 PCR(polymerase chain reaction)과 달리 유전자를 증폭하기 위한 온도조절을 필요로 하지 않기 때문에 전문장비 없이 유전자를 증폭할 수 있으며 단시간 내에 고농도의 유전자 증폭이 가능하다. 등온증폭법(loop-mediated isothermal amplification, LAMP)을 이용하기 위해서는 4개의 프라이머(F3, B3, FIP, 및 BIP)가 하나의 세트로 작용하여야 하는데, 이중 F3와 FIP는 유전자의 5'방향에 결합하는 프라이머이며, B3와 BIP는 3'방향에서 역방향으로 결합하는 프라이머이다. 또한 FIP와 BIP는 F2(혹은 B2)와 F1c(혹은 B1c)의 염기서열을 포함하도록 하는 프라이머이다. The present inventors used loop-mediated isothermal amplification (LAMP) in order to detect Nod virus without professional equipment in a short time. Unlike conventional polymerase chain reaction (PCR), the isothermal amplification method does not require temperature control to amplify the gene, so it can amplify the gene without specialized equipments and it is possible to amplify the gene at a high concentration in a short time. In order to utilize loop-mediated isothermal amplification (LAMP), four primers (F3, B3, FIP, and BIP) must function as one set. Among them, F3 and FIP , And B3 and BIP are primers that bind in the reverse direction in the 3 'direction. In addition, FIP and BIP are primers that contain the nucleotide sequence of F2 (or B2) and F1c (or B1c).

이와 같이 LAMP법을 위해서는 네 개의 프라이머가 필요하고, 구체적으로는 inner-정방향 프라이머, inner-역방향 프라이머, outer-정방향 프라이머 및 outer-역방향 프라이머를 필요로 한다. 본 발명에 따른 각각의 프라이머는 후술하는 표 3에 나타낸 바와 같으며, 구체적으로 상기 프라이머는 서열번호 26의 outer-정방향 프라이머, 서열번호 27의 outer-역방향 프라이머, 서열번호 28의 inner-정방향 프라이머, 서열번호 29의 inner-역방향 프라이머를 포함하여 이루어진 것이 바람직하다. Thus, four primers are required for the LAMP method, specifically, an inner-forward primer, an inner-reverse primer, an outer-forward primer and an outer-reverse primer. Each of the primers according to the present invention is as shown in Table 3 below. Specifically, the primers include an outer-forward primer of SEQ ID NO: 26, an outer-reverse primer of SEQ ID NO: 27, an inner- And an inner-reverse primer of SEQ ID NO: 29.

본 발명자들은 등온증폭법을 이용하여 노다바이러스를 검출할 수 있는 프라이머를 제작하기 위하여, 노다바이러스의 전체 서열이 아닌 외피단백질(coat protein 또는 virion protein)의 서열을 주형으로 하였다. 외피단백질은 바이러스가 하나의 개체로 만들어지기 위해 반드시 필요한 단백질로서, 바이러스 종에 따라서는 어류 내에서 바이러스가 세포간의 이동을 할 때에도 관여한다고 알려져 있다. 즉, 외피단백질은 바이러스가 감염되었다면 무조건 생성되는 단백질일 수 있고, 본 발명에서는 이를 주형으로 사용하여 프라이머를 제작한 것이 특징이다. In order to prepare a primer capable of detecting Nodavirus using isothermal amplification, the present inventors used a sequence of a coat protein (virion protein) or a coat protein that is not a whole sequence of Nodavirus as a template. The coat protein is a protein that is essential for the virus to be made into an individual. It is also known that some virus species are involved in the movement of viruses among fish in the fish. That is, the envelope protein may be a protein that is unconditionally produced if the virus is infected, and in the present invention, it is characterized in that a primer is prepared using the template as a template.

또한, 본 발명의 프라이머는 노다바이러스 유전자에서 변이가 극히 적은 부분을 바탕으로 디자인된 것이 특징이며, 이에 따라 실제 노다바이러스에 감염되었는지 여부를 진단할 수 있을 뿐만 아니라, 이론적으로 합성된 노다바이러스 유전자도 검출할 수 있다. In addition, the primer of the present invention is characterized by being designed based on a region having a very small mutation in the Nodavirus gene. Thus, it is possible to diagnose whether or not the Nodavirus is actually infected, and also theoretically synthesized Nodavirus gene Can be detected.

상기 노다바이러스는 특별히 제한되지는 않지만, 출혈성 신경 괴사증 바이러스(Viral nervous necrosis virus : VNNV)인 것이 바람직하고, 이외에 이 기술분야에 알려진 다른 노다바이러스를 포함할 수 있다. The NODA virus is preferably, but not limited to, Viral nervous necrosis virus (VNNV), and may include other NODA viruses known in the art.

또한, 본 발명은 상기한 프라이머 세트를 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스 검출용 프라이머 조성물일 수 있고, 이러한 프라이머 조성물은 등온증폭 반응용 DNA 중합효소, dNTPs, 및 반응버퍼를 더 포함하는 것이 가능하다.
Further, the present invention may be a primer composition for detecting Nodaca virus using the LAMP method, which comprises the above-mentioned primer set. The primer composition further includes a DNA polymerase for isothermal amplification reaction, dNTPs, and a reaction buffer It is possible to do.

한편, 본 발명은 상기한 본 발명에 따른 프라이머 세트를 이용하여 LAMP 증폭시키는 단계를 포함하는 노다바이러스 검출 또는 진단 방법일 수 있다. 상기에서 적용되는 LAMP법은 공지된 방법을 적용하면 용이하게 실시할 수 있다.In the meantime, the present invention may be a method for detecting or diagnosing Nodaca virus comprising amplifying LAMP using the primer set according to the present invention. The LAMP method applied in the above can be easily carried out by applying a known method.

구체적으로, 본 발명의 다른 실시형태는, 시료에서 게놈 DNA(gDNA)를 추출하는 단계; 상기 게놈 DNA를 주형으로 상기한 프라이머 세트, 등온증폭 반응용 DNA 중합효소, dNTPs, 및 반응버퍼를 포함하는 조성물을 이용하여 동온증폭법(LAMP)을 수행하여 표적서열을 증폭시키는 단계; 및 상기 증폭시킨 산물을 검출하는 단계;를 포함하는 노다바이러스 검출방법이다. Specifically, another embodiment of the present invention includes: extracting genomic DNA (gDNA) from a sample; Amplifying the target sequence by performing a direct temperature amplification (LAMP) method using the above genomic DNA as a template and using a composition comprising the above primer set, a DNA polymerase for isothermal amplification reaction, dNTPs, and a reaction buffer; And a step of detecting the amplified product.

여기서, 상기 시료는 특별히 제한되지 않고, 노다바이러스를 포함할 것으로예상되는 모든 시료일 수 있으며, 예를 들어 어류 샘플, 가축이나 동물, 또는 식물 샘플인 것도 가능하다. 그 중에서도, 상기 시료는 노다바이러스가 가장 잘 발생하는 어류인 것이 바람직하고, 상기 어류는 참돔, 돌돔, 감성돔, 방어류, 부시림, 농어 및 전갱이류로 이루어진 군에서 선택된 하나 이상일 수 있다. Here, the sample is not particularly limited and may be any sample expected to contain novirus, for example, a fish sample, a livestock animal, or a plant sample. In particular, the sample is preferably one in which nodavirus is most likely to occur, and the fish may be at least one selected from the group consisting of red sea bream, red sea bream, rhododendron, defense fish, bush rim, sea bass and mackerel.

또한, 상기 등온증폭법은 등온조건하에서 실시하게 되는데, 바람직한 것은 59℃ 내지 61℃에서 30분 내지 2시간 동안 수행하는 것이다. 만약, 상기 온도범위 및/또는 상기 시간 범위를 벗어나는 경우에는 증폭이 느리게 진행되거나 증폭이 일어나지 않는 문제점이 있다.In addition, the isothermal amplification method is performed under an isothermal condition, preferably at 59 캜 to 61 캜 for 30 minutes to 2 hours. If the temperature range and / or the time range is exceeded, there is a problem that amplification proceeds slowly or amplification does not occur.

또한, 상기 증폭시킨 산물을 검출하는 단계는 전기영동(electrophoresis) 또는 SYBR Green I을 이용하여 증폭된 DNA를 확인하는 것이 바람직하다. 예를 들어, 본 발명은 상기 LAMP 증폭하여 생성된 생성물에 감염여부의 육안 확인을 위한 발광물질을 첨가하는 단계를 더 실시할 수 있다. 즉, 상기한 프라이머 세트를 포함하는 반응액을 만들고, 여기에 시료를 첨가하여 DNA 합성을 진행한 후 발광물질을 첨가하는 것이 가능하다. 상기 발광물질은 당해분야에서 일반적으로 사용되는 것을 적용할 수 있으나, 바람직하게는 SybrGreen을 사용하는 것이 가능하다.In addition, the step of detecting the amplified product preferably confirms the amplified DNA using electrophoresis or SYBR Green I. For example, the present invention may further include the step of adding a luminescent material for visual confirmation of the infection to the product produced by amplifying the LAMP. That is, it is possible to prepare a reaction solution containing the above-described primer set, to add a sample thereto, to proceed DNA synthesis, and then to add a light emitting material. The light emitting material may be one commonly used in the art, but it is preferable to use SybrGreen.

상기 SybrGreen은 DNA 이중가닥에 결합하는 특성을 이용하여 추가적 실험을 필요로 하지 않고도 결과의 여부를 판독할 수 있도록 하기 위하여 첨가한 것이다. 특히, 상기 SybrGreen은 DNA 이중 가닥에 삽입되어 자외선 조사시 녹색의 형광을 발현하는 물질이다. 따라서 노다바이러스에 감염된 시료를 본 발명에 따른 프라이머 세트를 이용하여 LAMP법으로 증폭시키고, 증폭된 생성물에 SybrGreen을 첨가한 후 자외선을 조사하게 되면 녹색 형광을 나타내게 된다. 즉, 본 발명은 전기영동 등 별도의 추가적 실험을 하지 않고도 LAMP 증폭실험 후 SybrGreen 염색에서 녹색형광을 나타내면 질병에 감염된 것을 의미하고, 녹색형광을 나타내지 않으면 비감염을 의미하므로 시료에 노다바이러스가 포함되었는지 또는 감염되었는지의 여부를 고감도이면서 신속하게 육안으로 확인할 수 있다.The above-mentioned SybrGreen was added in order to make it possible to read out the result without requiring additional experiment using the property of binding to the DNA double strand. In particular, SybrGreen is a substance that is inserted into a DNA double strand and expresses green fluorescence upon irradiation with ultraviolet light. Therefore, when a sample infected with Nodavirus is amplified by the LAMP method using the primer set according to the present invention, and SybrGreen is added to the amplified product, when the UV light is irradiated, green fluorescence appears. That is, the present invention means that when green fluorescence is expressed by SybrGreen staining after infection with LAMP amplification test without any additional experiment such as electrophoresis, infection is implicated in the disease, and when it does not show green fluorescence, It is possible to visually confirm whether or not the virus has been infected with high sensitivity and promptly.

또한, 본 발명에서는 상기 프라이머 세트를 포함하는 진단용 키트를 제공한다. 상기 진단용 키트는 필요에 따라서 시료를 제외한 반응액이 포함되도록 제작될 수도 있으며, 이는 공지기술을 적용하면 용이하게 실시할 수 있는 것이다.In addition, the present invention provides a diagnostic kit comprising the primer set. The diagnostic kit may be prepared so as to include a reaction solution other than the sample as required, which can be easily performed by applying a known technique.

이와 같은 본 발명에 따른 등온증폭 반응용 프라이머 세트, 상기 프라이머 세트를 포함하는 프라이머 조성물 및 이를 이용한 검출방법을 이용하면, 단시간 내에 전문장비 없이 효과적으로 노다바이러스를 검출할 수 있다. 또한, 고농도의 SYBR Green I을 이용하면 자연광하에서 육안으로 신속하게 진단할 수 있다. 따라서 참돔, 돌돔, 감성돔, 방어류, 부시림, 농어, 전갱이류와 같은 양식어가에 막대한 피해를 줄 수 있는 바이러스를 조기에 검출 가능하게 하여 보다 신속하고 효율적인 Viral nervous necrosis virus (VNNV) 진단 시스템을 구축할 수 있을 뿐만 아니라, 이를 통해 바이러스 감염으로 인한 경제적 손실을 방지할 수 있을 것으로 기대된다.
By using the primer set for the isothermal amplification reaction according to the present invention, the primer composition including the primer set, and the detection method using the primer set, it is possible to detect nodavirus effectively without professional equipments in a short time. In addition, SYBR Green I at high concentration can be diagnosed visually under natural light quickly. Therefore, it is possible to detect viruses that can cause enormous damage to fish species such as red sea bream, red sea bream, rhododendron, armorfish, bush rim, perch, and mackerel, thereby enabling faster and more efficient diagnosis of viral nervous necrosis virus (VNNV) And it is expected that it will prevent economic loss due to virus infection.

본 발명은 하기의 실시예에 의하여 보다 더 잘 이해 될 수 있으며, 하기의 실시예는 본 발명의 예시 목적을 위한 것이며, 첨부된 특허청구범위에 의하여 한정되는 보호범위를 제한하고자 하는 것은 아니다.
The present invention may be better understood by the following examples, which are for the purpose of illustrating the invention and are not intended to limit the scope of protection defined by the appended claims.

실시예Example 1: 노다바이러스 주형 제작 1: Noda virus mold production

실시예Example 1-1 :  1-1: ViralViral nervousnervous necrosisnecrosis virusvirus ( ( VNNVVNNV ) 유전자 합성) Gene synthesis

VNNV 유전자는 NCBI site에서 확인된 GenBank number EU391590.1를 바탕으로 합성해서 사용했다. 유전자의 길이는 1017 bp로 확인되었으며, bioneer 유전자 합성팀에 유전자 합성을 의뢰했다. 유전자 합성은 1000bp 이상의 유전자 합성이 불가능해서 300~400 bp로 나누어 3개의 유전자로 합성했다.The VNNV gene was synthesized based on the GenBank number EU391590.1 identified in the NCBI site. The length of the gene was confirmed to be 1017 bp, and the bioneer gene synthesis team was commissioned for gene synthesis. Gene synthesis can not synthesize more than 1000 bp, so it is divided into 300 ~ 400 bp and synthesized into 3 genes.

하기 표 1은 본 발명의 프라이머 제작에 사용된 Viral nervous necrosis virus (VNNV)의 coat protein 서열을 나타내고 있다. Table 1 below shows the coat protein sequence of Viral nervous necrosis virus (VNNV) used in the preparation of the primer of the present invention.

GeneGene 유전자 서열Gene sequence VNNV-1st
(서열번호1)VNNV-1st
(SEQ ID NO: 1) GCTAGCATGGTACGCAAAGGTGAGAAGAAATTGGCAAAACCCGCGACCACCAAGGCCGCGAATCCGCAACCCCGCCGACGTGCTAACAATCGTCGGCGTAGTCAGCGCACTGACGCACCTGTGTCTAAAGCCTCGACTGTAACTGGGTTTGGACGTGGGACCAATGACGTCCATCTCTCAGGTATGTCGAGAATCTCCCAGGCCGTCCTCCCAGCCGGGACAGGAACAGACGGATACGTTGTTGTTGACGCAACCATCGTCCCCGACCTCCTGCCACGACTGGGACACGCTGCTAGAATCTTCCAGCGATACGCTGTTGAAACACTGGAGTTTGAAATTCAGCCAGGATCCGCTAGCGCTAGCATGGTACGCAAAGGTGAGAAGAAATTGGCAAAACCCGCGACCACCAAGGCCGCGAATCCGCAACCCCGCCGACGTGCTAACAATCGTCGGCGTAGTCAGCGCACTGACGCACCTGTGTCTAAAGCCTCGACTGTAACTGGGTTTGGACGTGGGACCAATGACGTCCATCTCTCAGGTATGTCGAGAATCTCCCAGGCCGTCCTCCCAGCCGGGACAGGAACAGACGGATACGTTGTTGTTGACGCAACCATCGTCCCCGACCTCCTGCCACGACTGGGACACGCTGCTAGAATCTTCCAGCGATACGCTGTTGAAACACTGGAGTTTGAAATTCAGCCAGGATCCGCTAGC VNNV-2nd
(서열번호2)VNNV-2nd
(SEQ ID NO: 2) GCTAGCATGTGCCCCGCAAACACGGGCGGTGGTTACGCTGCTGGCTTCTTGCCTGATCCAACTGACAACGATCACACCTTCGACGCGCTTCAAGCAACTCGTGGTGCAGTCGTTGCCAAATGGTGGGAAAGCAGAACAGTCCGACCTCAGTACACCCGTACGCTCCTCTGGACCTCGTCGGGAAAGGAGCAGCGTCTCACGTCACCTGGTCGGCTGATACTCCTGTGTGTCGGCCAGAACACTGATGTGGTCCAGGTGTCAGTGCTGTGTCGCTGGAGTGTTCGACTGAGCGTTCCATCTCTTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACCAGGATTCCCTTTCCACAAATGACTTCAAGTCCATCCTCCTAGGATCCATACCACTGGACATTGCCCCTGATGGATCAGTCTTCCAGCTGGACCGCCCGCTGTCCATTGACTACAGCCTTGGAACTGGAGATGTTGACCGTGCTGTTTACTGGCACCTCAAGAAGTTTGCTGGACAGGGATCCGCTAGCATGTGCCCCGCAAACACGGGCGGTGGTTACGCTGCTGGCTTCTTGCCTGATCCAACTGACAACGATCACACCTTCGACGCGCTTCAAGCAACTCGTGGTGCAGTCGTTGCCAAATGGTGGGAAAGCAGAACAGTCCGACCTCAGTACACCCGTACGCTCCTCTGGACCTCGTCGGGAAAGGAGCAGCGTCTCACGTCACCTGGTCGGCTGATACTCCTGTGTGTCGGCCAGAACACTGATGTGGTCCAGGTGTCAGTGCTGTGTCGCTGGAGTGTTCGACTGAGCGTTCCATCTCTTGAGACACCTGAAGAGACCACCGCTCCCATCATGACACAAGGTTCCCTGTACCAGGATTCCCTTTCCACAAATGACTTCAAGTCCATCCTCCTAGGATCCATACCACTGGACATTGCCCCTGATGGATCAGTCTTCCAGCTGGACCGCCCGCTGTCCATTGACTACAGCCTTGGAACTGGAGATGTTGACCGTGCTGTTTACTGGCACCTCAAGAAGTTTGCTGGACAGGGATCC VNNV-3rd
(서열번호3)VNNV-3rd
(SEQ ID NO: 3) GCTAGCACACCTGCAGGCTGGTTTCGCTGGGGCATCTGGGACAATTTCCAGAAGACGTTTACAGATGGCGTTGCTTACTACTCTGATGAGCAGCCTCGTCAAATCCTGCTGCCTGTTGGCACTGTCTGCACCAGGGTTGACTCGGGAAACTAAGGATCCGt;

실시예Example 1-2 : 유전자 연결( 1-2: Gene association ( OverlappingOverlapping PCRPCR ) ) 프라이머primer 작성 write

상기 실시예 1-1에서 합성된 3개의 유전자를 결합하기 위해서 Overlapping PCR를 수행했다. Overlapping PCR은 유전자 하나당 2개의 프라이머를 제작해서 총 6개의 프라이머를 사용했다. 처음과 마지막의 프라이머(VNNV-1-F 및 VNNV-3-R)를 제외한 4개의 프라이머는 각 유전자의 마지막 염기서열 약 20 bp(하기 표 2에서 굵게 볼드체로 표시된 서열)를 삽입하여 유전자가 결합되도록 유도했다. Overlapping PCR was performed to bind the three genes synthesized in Example 1-1. Overlapping PCR used two primers per gene and a total of 6 primers. Four primers except for the primers (VNNV-1-F and VNNV-3-R) at the beginning and at the end inserted 20 bp of the last nucleotide sequence of each gene (bold and bold in Table 2) .

하기 표 2는 상기 합성된 3개의 유전자를 연결하기 위한 overlapping PCR의 프라이머 서열을 나타낸 것이다. Table 2 below shows the primer sequences of overlapping PCR for linking the synthesized three genes.

유전자 gene 프라이머 primer VNNV-1-F (서열번호 4)VNNV-1-F (SEQ ID NO: 4) ATGGTACGCAAAGGTGAGAAATGGTACGCAAAGGTGAGAA VNNV-1-R (서열번호 5)VNNV-1-R (SEQ ID NO: 5) CGGGGCACATTGGCTGAATTTCAAACTCCAGT CGGGGCACAT TGGCTGAATTTCAAACTCCAGT VNNV-2-F (서열번호 6)VNNV-2-F (SEQ ID NO: 6) AATTCAGCCAATGTGCCCCGCAAACACG AATTCAGCCA ATGTGCCCCGCAAACACG VNNV-2-R (서열번호 7)VNNV-2-R (SEQ ID NO: 7) GTGTGCTAGCCTGTCCAGCAAACTTCTTGAG GTGTGCTAGC CTGTCCAGCAAACTTCTTGAG VNNV-3-F (서열번호 8)VNNV-3-F (SEQ ID NO: 8) TGCTGGACAGGCTAGCACACCTGCAGG TGCTGGACAG GCTAGCACACCTGCAGG VNNV-3-R (서열번호 9)VNNV-3-R (SEQ ID NO: 9) GGATCCTTAGTTTCCCGAGGGATCCTTAGTTTCCCGAG

실시예Example 2: 등온증폭 반응용  2: Isothermal amplification reaction 프라이머primer 제작 making

Viral nervous necrosis virus (VNNV)를 등온증폭법(loop-mediated isothermal amplification, LAMP)을 통하여 검출하기 위하여 프라이머(primer)를 PrimerExplorer V4를 이용하여 작성하였다. 등온증폭법을 이용하기 위해서는 4개의 프라이머가 하나의 세트로 작용하여야 하는데, 상기 실시예 1에 따라 합성된 유전자의 염기서열을 주형으로 프라이머를 제작했다.A primer was prepared using PrimerExplorer V4 to detect viral nervous necrosis virus (VNNV) through iso-thermal amplification (loop-mediated isothermal amplification, LAMP). In order to use the isothermal amplification method, four primers should act as one set. A primer was prepared by using the base sequence of the gene synthesized according to Example 1 as a template.

하기 표 3은 본 발명에 따른 등온증폭반응용 프라이머 세트의 염기서열을 나타낸 것이다.Table 3 below shows the nucleotide sequences of primer sets for isothermal amplification reaction according to the present invention.

리스트 List LAMP 프라이머 서열 (5' - 3')LAMP primer sequence (5'-3 ') 프라이머 세트 1Primer set 1 Outter 프라이머 F (서열번호 10)Outter primer F (SEQ ID NO: 10) CCCGCTGTCCATTGACTACCCCGCTGTCCATTGACTAC Outter 프라이머 B (서열번호 11)Outter primer B (SEQ ID NO: 11) CCAACAGGCAGCAGGATTCCAACAGGCAGCAGGATT Inner 프라이머 F (서열번호 12)Inner primer F (SEQ ID NO: 12) TGTGCTAGCCTGTCCAGCAAACGCCTTGGACTGGAGATGTTTGTGCTAGCCTGTCCAGCAAACGCCTTGGACTGGAGATGTT Inner 프라이머 B (서열번호 13)Inner primer B (SEQ ID NO: 13) GGTTCCCTGTACCAGGATTCCCGGCAATGTCCAGTGGTATGGGGTTCCCTGTACCAGGATTCCCGGCAATGTCCAGTGGTATGG 프라이머 세트 2Primer set 2 Outter 프라이머 F (서열번호 14)Outter primer F (SEQ ID NO: 14) GCAACTCGTGGTGCAGTCGCAACTCGTGGTGCAGTC Outter 프라이머 B (서열번호 15)Outter primer B (SEQ ID NO: 15) GCGACACAGCACTGACACGCGACACAGCACTGACAC Inner 프라이머 F (서열번호 16)Inner primer F (SEQ ID NO: 16) AGGTCCAGAGGAGCGTACGGGCCAAATGGTGGGAAAGCAAGGTCCAGAGGAGCGTACGGGCCAAATGGTGGGAAAGCA Inner 프라이머 B (서열번호 17)Inner primer B (SEQ ID NO: 17) AAGGAGCAGCGTCTCACGTCATCAGTGTTCTGGCCGACAAAGGAGCAGCGTCTCACGTCATCAGTGTTCTGGCCGACA 프라이머 세트 3Primer set 3 Outter 프라이머 F (서열번호 18)Outter primer F (SEQ ID NO: 18) AGTCGTTGCCAAATGGTGGAGTCGTTGCCAAATGGTGG Outter 프라이머 B (서열번호 19)Outter primer B (SEQ ID NO: 19) TGGTCTCTTCAGGTGTCTCATGGTCTCTTCAGGTGTCTCA Inner 프라이머 F (서열번호 20)Inner primer F (SEQ ID NO: 20) GACGCTGCTCCTTTCCCGACAACAGTCCGACCTCAGTACAGACGCTGCTCCTTTCCCGACAACAGTCCGACCTCAGTACA Inner 프라이머 B (서열번호 21)Inner primer B (SEQ ID NO: 21) GCTGCTACTCCTGTGTGTCGGCCGCTCAGTCGAACACTCCGCTGCTACTCCTGTGTGTCGGCCGCTCAGTCGAACACTCC 프라이머 세트 4Primer set 4 Outter 프라이머 F (서열번호 22)Outter primer F (SEQ ID NO: 22) CCCGCTGTCCATTGACTACCCCGCTGTCCATTGACTAC Outter 프라이머 B (서열번호 23)Outter primer B (SEQ ID NO: 23) CCAACAGGCAGCAGGATTCCAACAGGCAGCAGGATT Inner 프라이머 F (서열번호 24)Inner primer F (SEQ ID NO: 24) TGTGCTAGCCTGTCCAGCAAACGCCTTGGAACTGGAGATGTTTGTGCTAGCCTGTCCAGCAAACGCCTTGGAACTGGAGATGTT Inner 프라이머 B (서열번호 25)Inner primer B (SEQ ID NO: 25) CTGGTTTCGCTGGGGCATCTGCGAGGCTGCTCATCAGAGTCTGGTTTCGCTGGGGCATCTGCGAGGCTGCTCATCAGAGT 프라이머 세트 5Primer set 5 Outter 프라이머 F (서열번호 26)Outter primer F (SEQ ID NO: 26) AAAGCCTCGACTGTAACTGGAAAGCCTCGACTGTAACTGG Outter 프라이머 B (서열번호 27)Outter primer B (SEQ ID NO: 27) TGTTTGCGGGGCACATTGTGTTTGCGGGGCACATTG Inner 프라이머 F (서열번호 28)Inner primer F (SEQ ID NO: 28) ACGGCCTGGGAGATTCTCGAGTTTGGACGTGGGACCAAACGGCCTGGGAGATTCTCGAGTTTGGACGTGGGACCAA Inner 프라이머 B (서열번호 29)Inner primer B (SEQ ID NO: 29) CAACATCGTCCCCGACCTCGTGTTTCAACAGCGTATCGCCAACATCGTCCCCGACCTCGTGTTTCAACAGCGTATCGC

실시예Example 3: 등온증폭 반응의 수행 및 유용성 확인 3: Isothermal amplification reaction and confirmation of its usefulness

상기 실시예 2에서 제작된 프라이머 세트를 Viral nervous necrosis virus (VNNV)를 검출하는데 사용가능한지 확인하기 위하여, 증폭반응용 프라이머 조성물을 제조하였다. 상기 프라이머 조성물의 제조를 위하여 2 uL의 10배(10X) Bst 중합효소(polymerase) 반응버퍼(20 mM Tris-HCl, 10 mM (NH4)2SO4, 10 mM KCl, 2 mM MgSO4, 0.1% Triton X-100), 1.6 ul의 10 mM dNTPs(dATP, dTTP, dGTP, dCTP 각각 10 mM씩 섞인 혼합물), 0.4 ul의 10 uM F3와 B3 프라이머, 1.6 ul의 10 uM FIP와 BIP 프라이머, 1 ul의 20 mM MgSO4, 1 ul(8 Unit) Bst 중합효소, 1/10로 희석한 주형(실시예 1의 VNNV) cDNA 1 ul 및 증류수 11.5 ul를 반응튜브에 첨가한 후 혼합하였다. A primer composition for amplification reaction was prepared in order to confirm whether the primer set prepared in Example 2 was usable for detecting viral nervous necrosis virus (VNNV). 10 mM Bst Polymerase reaction buffer (20 mM Tris-HCl, 10 mM (NH 4 ) 2 SO 4 , 10 mM KCl, 2 mM MgSO 4 , 0.1 0.4 μl of 10 uM F3 and B3 primer, 1.6 μl of 10 uM FIP and BIP primer, 1 μl of 10 mM FIT, ul of 20 mM MgSO 4 , 1 μl (8 Unit) Bst polymerase, 1 μl of a 1/10 dilution of the cDNA (VNNV of Example 1) and 11.5 μl of distilled water were added to the reaction tube and mixed.

제조된 증폭 반응 조성물을 40 ℃에서 30초 동안 반응 시킨 후 60 ℃ 반응 용기에서 1시간 30분 동안 반응시켜 등온증폭하였다. 반응이 완료된 증폭산물에 1,000배로 농축된 SYBR Green I을 반응물 20 ul 당 1 ul씩 첨가하고, 80 ℃에서 5분간 효소활성을 억제시켜주었다. 총 20 ul의 반응물 중 5 ul를 전기영동(electrophoresis)하여 유전자가 증폭되었는지 확인하였다.
The prepared amplification reaction composition was reacted at 40 ° C for 30 seconds and reacted in a reaction container at 60 ° C for 1 hour and 30 minutes to perform isothermal amplification. SYBR Green I concentrated at 1,000-fold in the amplified product was added at a rate of 1 μl per 20 μl of the reaction, and the enzyme activity was inhibited at 80 ° C for 5 minutes. 5 μl of the total 20 μl reaction was electrophoresed to confirm that the gene was amplified.

도 1은 본 발명의 바람직한 일 실시예에 따른 등온증폭반응용 프라이머 세트를 이용하여 노다바이러스(VNNV)를 증폭시킨 증폭 산물의 전기영동 결과를 자외선 상에서 발색반응으로 확인한 것이다. 여기서, "P"는 positive 시료로서 실시예 1의 VNNV를 주형으로 포함하는 것이고, "N"은 negative 시료로서 상기 주형을 포함하지 않은 시료이며, 숫자 1~5는 각각 상기 표 3에 나타난 바와 같은 프라이머 세트 1~5를 의미한다. 이에 따르면, 상기 프라이머 세트 1~5는 모두 positive 시료에서 녹색 발광을 나타내고 있고, negative 시료에 대해서는 프라이머 세트 1번, 2번, 4번 및 5번만이 녹색 발광을 띠고 있지 않아서, 프라이머 세트 1번, 2번, 4번 및 5번이 상기 VNNV 주형과 반응하여 녹색 발광을 띠고 있음을 알 수 있다. 프라이머 세트 3번의 positive 시료에서는 프라이머 간의 반응에 의해 발광된 것으로 판단된다.FIG. 1 is a graph showing the result of electrophoresis of an amplification product obtained by amplifying Nodavirus (VNNV) using a primer set for isothermal amplification reaction according to a preferred embodiment of the present invention by ultraviolet light. Here, "P" is a positive sample containing VNNV of Example 1 as a template, "N" is a negative sample containing no sample, and numerals 1 to 5 are samples as shown in Table 3 Primer set 1 to 5 means. According to this, all the primer sets 1 to 5 exhibit green light emission from the positive sample and only the primer sets 1, 2, 4 and 5 do not emit green light for the negative sample, 2, 4 and 5 react with the VNNV template to show green light emission. It was judged that the positive sample of the primer set 3 was emitted by the reaction between the primers.

도 2는 본 발명의 바람직한 일 실시예에 따른 등온증폭반응용 프라이머 세트를 이용하여 이리도바이러스(Red sea bream nodavirus (RSIV))를 증폭시킨 증폭 산물의 전기영동 결과를 보여주는 도면이다. 즉, 주형으로 Viral nervous necrosis virus (VNNV) 대신에 다른 어류 바이러스 Red sea bream nodavirus (RSIV)를 사용하여 등온증폭법 시행한 것이다. 그 결과, 본 발명의 프라이머 세트 1번 및 2번에서는 유전자 증폭이 나타났지만, 본 발명의 프라이머 세트 4번 및 5번에 의하면 유전자 증폭이 나타나지 않았고, 결과적으로 4번 및 5번 프라이머 세트는 특이적으로 Viral nervous necrosis virus (VNNV) 유전자에 반응한다는 것을 알 수 있다. 또한, 1번 및 2번 프라이머 세트는 특이적으로 Red sea bream nodavirus (RSIV)와 Viral nervous necrosis virus (VNNV) 유전자에 반응한다는 것을 알 수 있다.FIG. 2 is a diagram showing an electrophoresis result of an amplification product obtained by amplifying Iridovirus (Red sea bream nodavirus (RSIV)) using a primer set for isothermal amplification according to a preferred embodiment of the present invention. In other words, isothermal amplification was performed using a red sea bream nodavirus (RSIV) instead of the viral nervous necrosis virus (VNNV) as a template. As a result, in the primer sets 1 and 2 of the present invention, gene amplification was observed. However, according to the primer sets 4 and 5 of the present invention, no gene amplification was observed. As a result, the primer sets 4 and 5 were specific (VNNV) gene in the viral genome. In addition, primers set # 1 and # 2 specifically react with Red sea bream nodavirus (RSIV) and Viral nervous necrosis virus (VNNV) genes.

도 3은 본 발명의 바람직한 일 실시예에 따른 프라이머 세트를 이용하여 증폭된 유전자를 SYBR Green Ⅰ을 이용하여 자연광원 하에서 확인한 결과를 보여주는 도면이다. 자외선 상에서 발색반응을 확인한 도 1과 비교하여, SYBR Green I을 이용하는 경우에는 자연광 하에서도 명확하게 구분된 결과를 얻을 수 있었다. FIG. 3 is a diagram showing the result of checking a gene amplified using a primer set according to a preferred embodiment of the present invention under a natural light source using SYBR Green I. Compared with FIG. 1 in which the color development reaction was confirmed in ultraviolet light, when SYBR Green I was used, clearly distinguished results were obtained even under natural light.

상기 결과들을 통하여 본 실험에 사용된 프라이머 세트는 Viral nervous necrosis virus (VNNV)에만 특이적으로 검출하는데 사용가능하다는 것을 확인할 수 있었으며, 또한 SYBR GreenI을 10,000배로 농축하여 사용할 경우 자연광하에서 육안으로 감염여부를 확인할 수 있다는 것을 확인할 수 있었다.
From the above results, it was confirmed that the primer set used in this experiment can be used to specifically detect Viral nervous necrosis virus (VNNV) only. If SYBR Green I is concentrated at 10,000 times, I can confirm that I can confirm it.

한편, 상기에서는 본 발명을 특정의 바람직한 실시예에 관련하여 도시하고 설명하였지만, 이하의 특허청구범위에 의해 마련되는 본 발명의 기술적 특징이나 분야를 이탈하지 않는 한도 내에서 본 발명이 다양하게 개조 및 변화될 수 있다는 것은 당업계에서 통상의 지식을 가진 자에게 명백한 것이다. While the present invention has been particularly shown and described with reference to preferred embodiments thereof, it is to be understood that the invention is not limited to the disclosed embodiments, but, on the contrary, It will be apparent to those skilled in the art that changes may be made.

<110> Korea Institute of Ocean Science & Technology <120> Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same <130> P13-0004 <160> 29 <170> KopatentIn 2.0 <210> 1 <211> 357 <212> DNA <213> Viral nervous necrosis virus(VNNV-1st) <400> 1 gctagcatgg tacgcaaagg tgagaagaaa ttggcaaaac ccgcgaccac caaggccgcg 60 aatccgcaac cccgccgacg tgctaacaat cgtcggcgta gtcagcgcac tgacgcacct 120 gtgtctaaag cctcgactgt aactgggttt ggacgtggga ccaatgacgt ccatctctca 180 ggtatgtcga gaatctccca ggccgtcctc ccagccggga caggaacaga cggatacgtt 240 gttgttgacg caaccatcgt ccccgacctc ctgccacgac tgggacacgc tgctagaatc 300 ttccagcgat acgctgttga aacactggag tttgaaattc agccaggatc cgctagc 357 <210> 2 <211> 537 <212> DNA <213> Viral nervous necrosis virus(VNNV-2nd) <400> 2 gctagcatgt gccccgcaaa cacgggcggt ggttacgctg ctggcttctt gcctgatcca 60 actgacaacg atcacacctt cgacgcgctt caagcaactc gtggtgcagt cgttgccaaa 120 tggtgggaaa gcagaacagt ccgacctcag tacacccgta cgctcctctg gacctcgtcg 180 ggaaaggagc agcgtctcac gtcacctggt cggctgatac tcctgtgtgt cggccagaac 240 actgatgtgg tccaggtgtc agtgctgtgt cgctggagtg ttcgactgag cgttccatct 300 cttgagacac ctgaagagac caccgctccc atcatgacac aaggttccct gtaccaggat 360 tccctttcca caaatgactt caagtccatc ctcctaggat ccataccact ggacattgcc 420 cctgatggat cagtcttcca gctggaccgc ccgctgtcca ttgactacag ccttggaact 480 ggagatgttg accgtgctgt ttactggcac ctcaagaagt ttgctggaca gggatcc 537 <210> 3 <211> 159 <212> DNA <213> Viral nervous necrosis virus(VNNV-3rd) <400> 3 gctagcacac ctgcaggctg gtttcgctgg ggcatctggg acaatttcca gaagacgttt 60 acagatggcg ttgcttacta ctctgatgag cagcctcgtc aaatcctgct gcctgttggc 120 actgtctgca ccagggttga ctcgggaaac taaggatcc 159 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> VNNV-1-F <400> 4 atggtacgca aaggtgagaa 20 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> VNNV-1-R <400> 5 cggggcacat tggctgaatt tcaaactcca gt 32 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> VNNV-2-F <400> 6 aattcagcca atgtgccccg caaacacg 28 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> VNNV-2-R <400> 7 gtgtgctagc ctgtccagca aacttcttga g 31 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> VNNV-3-F <400> 8 tgctggacag gctagcacac ctgcagg 27 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> VNNV-3-R <400> 9 ggatccttag tttcccgag 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 1 <400> 10 cccgctgtcc attgactac 19 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 1 <400> 11 ccaacaggca gcaggatt 18 <210> 12 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 1 <400> 12 tgtgctagcc tgtccagcaa acgccttgga ctggagatgt t 41 <210> 13 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 1 <400> 13 ggttccctgt accaggattc ccggcaatgt ccagtggtat gg 42 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 2 <400> 14 gcaactcgtg gtgcagtc 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 2 <400> 15 gcgacacagc actgacac 18 <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 2 <400> 16 aggtccagag gagcgtacgg gccaaatggt gggaaagca 39 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 2 <400> 17 aaggagcagc gtctcacgtc atcagtgttc tggccgaca 39 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 3 <400> 18 agtcgttgcc aaatggtgg 19 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 3 <400> 19 tggtctcttc aggtgtctca 20 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 3 <400> 20 gacgctgctc ctttcccgac aacagtccga cctcagtaca 40 <210> 21 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 3 <400> 21 gctgctactc ctgtgtgtcg gccgctcagt cgaacactcc 40 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 4 <400> 22 cccgctgtcc attgactac 19 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 4 <400> 23 ccaacaggca gcaggatt 18 <210> 24 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 4 <400> 24 tgtgctagcc tgtccagcaa acgccttgga actggagatg tt 42 <210> 25 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 4 <400> 25 ctggtttcgc tggggcatct gcgaggctgc tcatcagagt 40 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 5 <400> 26 aaagcctcga ctgtaactgg 20 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 5 <400> 27 tgtttgcggg gcacattg 18 <210> 28 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 5 <400> 28 acggcctggg agattctcga gtttggacgt gggaccaa 38 <210> 29 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 5 <400> 29 caacatcgtc cccgacctcg tgtttcaaca gcgtatcgc 39 <110> Korea Institute of Ocean Science & Technology <120> Primer set for loop-mediated isothermal amplification reaction          for detecting nodavirus, Primer composition having the same, and          Detecting method for nodavirus using the same <130> P13-0004 <160> 29 <170> Kopatentin 2.0 <210> 1 <211> 357 <212> DNA <213> Viral nervous necrosis virus (VNNV-1st) <400> 1 gctagcatgg tacgcaaagg tgagaagaaa ttggcaaaac ccgcgaccac caaggccgcg 60 aatccgcaac cccgccgacg tgctaacaat cgtcggcgta gtcagcgcac tgacgcacct 120 gtgtctaaag cctcgactgt aactgggttt ggacgtggga ccaatgacgt ccatctctca 180 ggtatgtcga gaatctccca ggccgtcctc ccagccggga caggaacaga cggatacgtt 240 gttgttgacg caaccatcgt ccccgacctc ctgccacgac tgggacacgc tgctagaatc 300 ttccagcgat acgctgttg aacactggag tttgaaattc agccaggatc cgctagc 357 <210> 2 <211> 537 <212> DNA <213> Viral nervous necrosis virus (VNNV-2nd) <400> 2 gctagcatgt gccccgcaaa cacgggcggt ggttacgctg ctggcttctt gcctgatcca 60 actgacaacg atcacacctt cgacgcgctt caagcaactc gtggtgcagt cgttgccaaa 120 tggtgggaaa gcagaacagt ccgacctcag tacacccgta cgctcctctg gacctcgtcg 180 cggctgatc actgatgtgg tccaggtgtc agtgctgtgt cgctggagtg ttcgactgag cgttccatct 300 cttgagacac ctgaagagac caccgctccc atcatgacac aaggttccct gtaccaggat 360 tccctttcca caaatgactt caagtccatc ctcctaggat ccataccact ggacattgcc 420 cctgatggat cagtcttcca gctggaccgc ccgctgtcca ttgactacag ccttggaact 480 ggagatgttg accgtgctgt ttactggcac ctcaagaagt ttgctggaca gggatcc 537 <210> 3 <211> 159 <212> DNA <213> Viral nervous necrosis virus (VNNV-3rd) <400> 3 gctagcacac ctgcaggctg gtttcgctgg ggcatctggg acaatttcca gaagacgttt 60 acagatggcg ttgcttacta ctctgatgag cagcctcgtc aaatcctgct gcctgttggc 120 actgtctgca ccagggttga ctcgggaaac taaggatcc 159 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > VNNV-1-F <400> 4 atggtacgca aaggtgagaa 20 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> VNNV-1-R <400> 5 cggggcacat tggctgaatt tcaaactcca gt 32 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> VNNV-2-F <400> 6 aattcagcca atgtgccccg caaacacg 28 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> VNNV-2-R <400> 7 gtgtgctagc ctgtccagca aacttcttga g 31 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> VNNV-3-F <400> 8 tgctggacag gctagcacac ctgcagg 27 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> VNNV-3-R <400> 9 ggatccttag tttcccgag 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 1 <400> 10 cccgctgtcc attgactac 19 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 1 <400> 11 ccaacaggca gcaggatt 18 <210> 12 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 1 <400> 12 tgtgctagcc tgtccagcaa acgccttgga ctggagatgt t 41 <210> 13 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 1 <400> 13 ggttccctgt accaggattc ccggcaatgt ccagtggtat gg 42 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 2 <400> 14 gcaactcgtg gtgcagtc 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 2 <400> 15 gcgacacagc actgacac 18 <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 2 <400> 16 aggtccagag gagcgtacgg gccaaatggt gggaaagca 39 <210> 17 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 2 <400> 17 aaggagcagc gtctcacgtc atcagtgttc tggccgaca 39 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 3 <400> 18 agtcgttgcc aaatggtgg 19 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 3 <400> 19 tggtctcttc aggtgtctca 20 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 3 <400> 20 gacgctgctc ctttcccgac aacagtccga cctcagtaca 40 <210> 21 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 3 <400> 21 gctgctactc ctgtgtgtcg gccgctcagt cgaacactcc 40 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 4 <400> 22 cccgctgtcc attgactac 19 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 4 <400> 23 ccaacaggca gcaggatt 18 <210> 24 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 4 <400> 24 tgtgctagcc tgtccagcaa acgccttgga actggagatg tt 42 <210> 25 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 4 <400> 25 ctggtttcgc tggggcatct gcgaggctgc tcatcagagt 40 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Outer forward primer for primer set 5 <400> 26 aaagcctcga ctgtaactgg 20 <210> 27 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Outer backward primer for primer set 5 <400> 27 tgtttgcggg gcacattg 18 <210> 28 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Inner forward primer for primer set 5 <400> 28 acggcctggg agattctcga gtttggacgt gggaccaa 38 <210> 29 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Inner backward primer for primer set 5 <400> 29 caacatcgtc cccgacctcg tgtttcaaca gcgtatcgc 39

Claims (10)

서열번호 26의 outer-정방향 프라이머, 서열번호 27의 outer-역방향 프라이머, 서열번호 28의 inner-정방향 프라이머 및 서열번호 29의 inner-역방향 프라이머를 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스(nodavirus) 검출용 프라이머 세트.
A reverse primer of SEQ ID NO: 26, an outer-forward primer of SEQ ID NO: 26, an outer-reverse primer of SEQ ID NO: 27, an inner- ) Detection primer set.
삭제delete 제1항에 있어서,
상기 노다바이러스는 출혈성 신경 괴사증 바이러스(Viral nervous necrosis virus : VNNV)인 것을 특징으로 하는 LAMP법을 이용한 노다바이러스 검출용 프라이머 세트.
The method according to claim 1,
Wherein the NODA virus is Viral nervous necrosis virus (VNNV). 2. The primer set of claim 1, wherein the NODA virus is Viral nervous necrosis virus (VNNV).
제1항 또는 제3항에 따른 프라이머 세트를 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스 검출용 프라이머 조성물.
A primer composition for detecting Nodaca virus using the LAMP method, which comprises the primer set according to claim 1 or 3.
제4항에 있어서,
LAMP 반응용 DNA 중합효소, dNTPs, 및 반응버퍼를 더 포함하는 것을 특징으로 하는 LAMP법을 이용한 노다바이러스 검출용 프라이머 조성물.
5. The method of claim 4,
A DNA polymerase for LAMP reaction, dNTPs, and a reaction buffer.
시료에서 게놈 DNA(gDNA)를 추출하는 단계;
상기 게놈 DNA를 주형으로 제4항에 따른 조성물을 이용하여 LAMP법을 수행하여 표적서열을 증폭시키는 단계; 및
상기 증폭시킨 산물을 검출하는 단계;를 포함하는 노다바이러스 검출방법.
Extracting genomic DNA (gDNA) from the sample;
Amplifying the target sequence by performing the LAMP method using the genomic DNA as a template and the composition according to claim 4; And
And detecting the amplified product.
제6항에 있어서,
상기 시료는 어류인 것을 특징으로 하는 노다바이러스 검출방법.
The method according to claim 6,
Wherein the sample is a fish.
제7항에 있어서,
상기 어류는 참돔, 돌돔, 감성돔, 방어류, 부시림, 농어 및 전갱이류로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는 노다바이러스 검출방법.
8. The method of claim 7,
Wherein the fish is at least one selected from the group consisting of red sea bream, red sea bream, rhododendron, defense brood, bush rim, sea bass, and whole mackerel.
제6항에 있어서,
상기 LAMP법은 59℃ 내지 61℃에서 30분 내지 2시간 동안 수행하는 것을 특징으로 하는 노다바이러스 검출방법.
The method according to claim 6,
Wherein the LAMP method is performed at 59 DEG C to 61 DEG C for 30 minutes to 2 hours.
제6항에 있어서,
상기 증폭시킨 산물을 검출하는 단계는 전기영동(electrophoresis) 또는 SYBR Green I을 이용하여 증폭된 DNA를 확인하는 것을 특징으로 하는 노다바이러스 검출방법.
The method according to claim 6,
Wherein the step of detecting the amplified product comprises detecting DNA amplified using electrophoresis or SYBR Green I.
KR1020130147937A 2013-11-29 2013-11-29 Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same KR101613113B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020130147937A KR101613113B1 (en) 2013-11-29 2013-11-29 Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020130147937A KR101613113B1 (en) 2013-11-29 2013-11-29 Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same

Publications (2)

Publication Number Publication Date
KR20150062854A KR20150062854A (en) 2015-06-08
KR101613113B1 true KR101613113B1 (en) 2016-04-18

Family

ID=53500777

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020130147937A KR101613113B1 (en) 2013-11-29 2013-11-29 Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same

Country Status (1)

Country Link
KR (1) KR101613113B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102552812B1 (en) 2022-10-26 2023-07-11 대한민국 A primer composition for distinguishing genotype of fish nodavirus and diagnostic kit comprising the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
J Microbiol Biotechnol. 2012 Jul,22(7):1021-8.

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102552812B1 (en) 2022-10-26 2023-07-11 대한민국 A primer composition for distinguishing genotype of fish nodavirus and diagnostic kit comprising the same

Also Published As

Publication number Publication date
KR20150062854A (en) 2015-06-08

Similar Documents

Publication Publication Date Title
JP7322063B2 (en) Novel primers and uses thereof
KR101642784B1 (en) Genetic Markers for Discrimination of Viral Hemorrhagic Septicemia Virus, and Method for Discrimination of Causative Virus Using the Same
ES2704489T3 (en) Methods of detection of origin of species of samples
JP2022535584A (en) Methods and reagents for nucleic acid amplification and/or detection
KR101642783B1 (en) Genetic Markers for Detection of Causative Virus of Red Sea Bream Iridoviral Disease(RSIVD), and Method for Detection of Causative Virus Using the Same
KR101557844B1 (en) Primer set for loop-mediated isothermal amplification reaction for detecting iridovirus, Primer composition having the same, and Detecting method for iridovirus using the same
KR101720483B1 (en) Peptide nucleic acids set for identifying Anguilliformes species and identifying method of Anguilliformes species using the same
WO2009098789A1 (en) Method of detecting pathogenic virus in crustacean by lamp method and reagent kit for detection
KR102096635B1 (en) Specific primer set for detecting blackberry chlorotic ringspot virus, quarantine plant virus and uses thereof
CA2924234A1 (en) Multiplex diagnostic assay for detecting salmonid pathogens
KR101559287B1 (en) Primer set for loop-mediated isothermal amplification reaction for detecting iridovirus, Primer composition having the same, and Detecting method using the same
KR101395344B1 (en) Peptide nucleic acids set for identifying raja kenojei mueller et henle species and identifying method of raja kenojei mueller et henle species using the same
KR101613113B1 (en) Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method for nodavirus using the same
KR101677127B1 (en) Primer set for genotyping of horse
KR101613109B1 (en) Primer set for loop-mediated isothermal amplification reaction for detecting nodavirus, Primer composition having the same, and Detecting method using the same
KR101909962B1 (en) Method for Detecting Genetic Variant of Virarl Hemorrhagic Septicemia Virus
KR102261713B1 (en) Method for detecting maritime pathogenic bacteria, and primer-probe set, composition and kit for the same
JP5548357B2 (en) Method for detecting Aspergillus fumigatus-related bacteria
JP6853523B2 (en) PCR using helicase
JP6661963B2 (en) How to detect staphylococci
JP2008072951A (en) Method for rapid detection of serum type of salmonella o4 group using lamp method
KR20200063566A (en) Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same
KR101717181B1 (en) Primer set for diagnosing meningitis and use thereof
KR101517493B1 (en) Efficient Multiplex PCR method using fluorescent markers and mobility markers
JP2007000040A (en) Method for detecting b-type hepatitis virus

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20190408

Year of fee payment: 4