KR20220151089A - Reverse transcriptase polymerase chain reaction for the detection of Severe acute respiratory syndrome coronavirus 2 and a diagnosing kit for Severe acute respiratory syndrome coronavirus 2 using the same - Google Patents

Abstract

The present invention relates to: a reverse transcription (RT)-polymerase chain reaction (PCR) primer set for detecting severe acute respiratory syndrome coronavirus2 (SARS-CoV2), capable of diagnosing SARS-CoV2; a positive control gene for a false-positive test; and SARS-CoV2 detection kit and detection method including the same. The primer set of the present invention can rapidly detect multiple variants included in SARS-CoV2 with high specificity and high detection sensitivity.

Description

Reverse transcriptase polymerase chain reaction for the detection of Severe acute respiratory syndrome coronavirus 2 and a diagnosing kit for Severe acute respiratory syndrome coronavirus 2 using the same}

The present invention is a reverse transcription (RT)-polymerase chain reaction (PCR) for detecting SARS-CoV2 capable of diagnosing severe acute respiratory syndrome coronavirus2 (SARS-CoV2) It relates to a primer set, a positive control gene for false positive assay, a SARS-CoV2 detection kit including the same, and a detection method.

SARS-CoV2 is classified as viral group IV positive sense single-stranded RNA viruses, Coronaviridae, and Betacoronavirus. It is a zoonotic disease that can be transmitted by humans and bats. After being infected mainly through the respiratory tract, it proliferates in the bronchi and lungs, causing symptoms or diseases such as high fever, dry cough, dyspnea, pneumonia, and heart failure.

Conventional SARS-CoV2 diagnostic techniques include general RT-PCR, which mainly amplifies a specific nucleic acid fragment, real-time reverse transcription quantitative [(RT-quantitative) PCR; RT-qPCR], loop-mediated isothermal amplification (LAMP), etc. have been reported.

Of these, RT-qPCR is capable of rapid diagnosis, but is relatively expensive and has limitations in subsequent genotyping due to its limited sequencing. LAMP reacts at the same temperature and has excellent field applicability, but a number of unknown false positive reactions have been reported. On the other hand, general RT-PCR has been verified for stability through relatively long research compared to the two technologies, and has the advantage of being able to perform sequencing, so it is highly applicable as a standard diagnostic technique. In addition, the range of users (or utilization layer) is wide, and it can be utilized in developing countries at low cost.

However, the RT-PCR method developed by a number of researchers may have poor field applicability due to differences in composition and conditions. On the other hand, enzyme immunoassay, etc., other than specific nucleic acid fragment amplification techniques can be used, but the detection sensitivity is about 100-1,000 times lower, and the criteria for false positive reactions can be relatively subjective.

On the other hand, PCR diagnostic technology is being built mainly for Orf1ab (RdRp), N and E genes among the entire nucleic acids of SARS-CoV2. While a PCR-based test method is commonly used to analyze the genetic characteristics of positive samples, a positive control group is absolutely necessary to ensure the accuracy, precision, reproducibility, and certainty of the experimental process. The example is the norovirus positive control prepared by the Korea Centers for Disease Control and Prevention, Lee et al. reported in the Virology Journal. (2011) and others. In this report, the positive control must be able to be amplified in consideration of the location of the PCR primers, and mentions the importance of provision at a specific concentration, storage and stabilization, and reproducibility. However, since laboratory contamination may occur from the positive control, a device capable of assaying it must be devised, and methods such as changing the size of amplification and inserting a specific nucleotide sequence have been reported as such methods.

Therefore, there is a need to develop technologies that can reflect the above, such as specificity, detection sensitivity, and reactive positive control group, for SARS-CoV2 diagnosis.

Republic of Korea Patent Publication No. 10-2007-0050672

The present inventors completed the present invention by developing a primer set capable of accurately diagnosing SARS-CoV2 through a number of studies.

Therefore, an object of the present invention is to amplify three genes (Orf1ab, E, and N) of a plurality of mutant strains included in SARS-CoV2, a virus that causes severe acute respiratory syndrome, with excellent detection sensitivity and under the same conditions, respectively, to include SARS-CoV2. To provide a primer set for RT-PCR capable of detecting a plurality of mutant strains.

Another object of the present invention is detection that can quickly and accurately diagnose the infection of multiple mutants included in SARS-CoV2 by using a primer set for RT-PCR capable of detecting multiple mutants included in SARS-CoV2. It is to provide a kit and a detection method.

Another object of the present invention is to provide a positive control gene for false positive assays that can guarantee the accuracy, precision, reproducibility and certainty of the experimental process in performing detection experiments of multiple variants included in SARS-CoV2.

The objects of the present invention are not limited to the objects mentioned above, and other objects not mentioned will be clearly understood by those skilled in the art from the description below.

In order to achieve the object of the present invention described above, the present invention is a pair of primers represented by SEQ ID NOs: 2 and 5; Primer pairs represented by SEQ ID NOs: 8 and 11; And it provides an RT-PCR primer set for detecting severe acute respiratory syndrome coronavirus 2; SARS-CoV2, including the primer pair represented by SEQ ID NOs: 14 and 18.

In a preferred embodiment, the nucleotide sequences of SEQ ID NOs: 2 and 5 were designed and produced using the nucleotide sequence 15,347-15,614 of the Orf1ab gene region of SARS-CoV2 as a template, and the SEQ ID NOs: 8 and 11 are the base sequences of SARS-CoV2. The base sequence 26,246-26,471 of the E gene region was designed and manufactured as a template, and SEQ ID NOs: 14 and 18 were designed and manufactured using the base sequence 28,622-28,917 of the N gene region of SARS-CoV2 as a template.

In a preferred embodiment, a positive control gene represented by SEQ ID NO: 21 is further included.

In addition, the present invention provides a RT-PCR primer composition for detecting Severe Acute Respiratory Syndrome Coronavirus 2 comprising the above-described primer set for RT-PCR.

In a preferred embodiment, it further comprises reverse transcriptase, DNA polymerase, dNTPs and reaction buffer.

In a preferred embodiment, a positive control gene represented by SEQ ID NO: 21 is further included.

In addition, the present invention provides a severe acute respiratory syndrome coronavirus 2 detection kit comprising any one of the above-described compositions.

In a preferred embodiment, the severe acute respiratory syndrome coronavirus 2 is GenBank accession number NC_045512.2 and a mutant strain thereof.

In addition, the present invention comprises the steps of extracting RNA from a target sample other than the human body; Amplifying a target sequence by performing RT-PCR using the RNA as a template and using any one of the above-described primer sets; And detecting the amplification product; provides a method for diagnosing severe acute respiratory syndrome coronavirus 2, including.

In a preferred embodiment, the step of detecting the amplification product is performed through any one selected from the group consisting of a DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, phosphorus measurement, and combinations thereof.

In a preferred embodiment, when the positive control gene represented by SEQ ID NO: 21 is further included, false positive factors are removed when the experimental results are read.

First, since the RT-PCR primer set of the present invention does not react with viruses of other species other than the plurality of mutants included in SARS-CoV2, it rapidly detects a number of mutants included in SARS-CoV2 with high specificity and high detection sensitivity. can be detected.

In addition, according to the diagnostic composition comprising a primer set for RT-PCR for detecting a plurality of variants contained in SARS-CoV2 of the present invention and a detection kit comprising the same, a plurality of variants contained in SARS-CoV2 are rapidly and with high detection intensity. Since it is possible to diagnose the infection of SARS-CoV2, rapid treatment for follow-up treatment is possible even for patients infected with multiple mutant strains included in low-level SARS-CoV2.

When using the SARS-CoV2 RT-PCR positive control gene of the present invention, it is possible to confirm the occurrence of false positive reactions due to contamination of the control group, enabling accurate diagnosis of multiple mutant strains included in SARS-CoV2.

These technical effects of the present invention are not limited to the above-mentioned range, and even if not explicitly mentioned, the effects of the invention that can be recognized by those skilled in the art from the description of specific contents for the practice of the invention described later included of course

1a, 1b and 1c are RT-PCR primer combinations capable of amplifying the SARS-CoV2 Orf1ab gene fragment Orf1ab-#01 to Orf1ab-#06, E RT-PCR primer combinations capable of amplifying the gene fragment E-#, respectively. 01 to E-#08 and the RT-PCR primer combination N-#01 to N-#08 capable of amplifying the N gene fragment confirmed the amplification of the specific reaction of SARS-CoV2.
2a, 2b and 2c are RT-PCR primer combinations capable of amplifying the SARS-CoV2 Orf1ab gene fragment, respectively Orf1ab-#01, #02, #04, #06 and #08, RT capable of amplifying the E gene fragment. -PCR primer combination, E-#01, #05, #06, #10 and #11, and RT-PCR primer combination N-#01, #05, #06, #12 capable of amplifying the N gene fragment; and four reference viruses for #13 [Severe acute respiratory syndrome-related coronavirus (SARS-CoV), Middle East respiratory syndrome-related coronavirus (MERS-CoV), Coronavirus-229E (CoV-229E) and respiratory Adenovirus (R- AdV)] This is the result of confirming a non-specific reaction to nucleic acid.
3a, 3b and 3c show specific amplification capable of amplifying Orf1ab, E and N genes of SARS-CoV2 obtained in FIGS. 2a to 2c and non-specific amplification of the reference virus nucleic acid for each RT-PCR primer combination This is the result of confirming the detection sensitivity for
4a, 4b, and 4c show the result of reacting each selected primer combination with total RNA extracted from a sample of a healthy person without symptoms for each selected primer combination for SARS-CoV2 gene amplification.
5a, 5b, and 5c show artificial infection detection sensitivity test results. After adding a specific concentration of SARS-CoV2 plasmid to total nucleic acid extracted from a sample of a healthy person, each selection primer combination was reacted from a serial dilution using total nucleic acid. is a result
Figure 6 shows that all three final primer combinations selected from the three SARS-CoV2 genes (Orf1ab, E and N) can react, and the restriction enzyme EcoRV (5'-GATATC-3') in the expected amplification product reacts. This is the base sequence information of the positive control into which a specific base sequence has been inserted so that
7a, 7b and 7c are the results of assaying the amplification of the positive control prepared based on FIG. 6 and the reaction of the restriction enzyme EcoRV.

The terms used in the present invention have been selected from general terms that are currently widely used as much as possible while considering the functions in the present invention, but these may vary depending on the intention of a person skilled in the art or precedent, the emergence of new technologies, and the like. In addition, in a specific case, there is also a term arbitrarily selected by the applicant, and in this case, the meaning will be described in detail in the description of the invention.

When 'includes,' 'has,' or 'consists of' mentioned in the present invention is used, other parts may be added unless 'only' is used. In the case where a component is expressed in the singular, the case including the plural is included unless otherwise explicitly stated.

In interpreting the components, even if there is no separate explicit description, it is interpreted as including the error range.

Characteristic parts of each of the various embodiments of the present invention can be partially or entirely combined or combined with each other, technically various interlocking and driving are possible, and each embodiment can be implemented independently of each other or in an association relationship. may be performed together.

In the present invention, a 'primer' is a nucleic acid sequence having a short free 3' hydroxyl group, which can form a base pair with a complementary nucleic acid template and is used for copying a strand of a nucleic acid template. A short nucleic acid sequence that serves as a starting point. The primer can initiate DNA synthesis in the presence of a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates in an appropriate buffer and temperature.

Hereinafter, the technical configuration of the present invention will be described in detail with reference to the accompanying drawings and preferred embodiments.

However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Like reference numbers used to describe the invention throughout the specification indicate like elements.

The technical feature of the present invention is that after selecting SARS-CoV2 as well as its various mutants and aligning Orf1ab (RdRp), N and E genes among these sequences as targets, it can cover not only commonly conserved sites but also mutant sites. A number of primer pairs designed to be tested were produced, and an optimal primer set was selected through experiments. Since the base sequence included in the selected primer set is a stable base sequence without degeneracy commonly found in conventional RT-PCR diagnostic methods, RT - RT-PCR primer set with improved detection accuracy by including a positive control gene that can test false positive reactions in the diagnosis of SARS-CoV2 and its variants, as well as improved sensitivity and specificity of the PCR reaction, and the primers A detection kit and detection method comprising a set.

Therefore, the RT-PCR primer set for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV2) of the present invention is for detecting SARS-CoV2 and various variants thereof, and is represented by SEQ ID NOs: 2 and 5. Primer pairs indicated; Primer pairs represented by SEQ ID NOs: 8 and 11; And it may include a pair of primers represented by SEQ ID NOs: 14 and 18, and homologs of the base sequences are included within the scope of the present invention. Specifically, the RT-PCR primer set of the present invention contains 70% or more, preferably 80% or more, more preferably 90% of the nucleotide sequences of SEQ ID NOs: 2 and 5, SEQ ID NOs: 8 and 11, and SEQ ID NOs: 14 and 18, respectively. Or more, most preferably, it may include a base sequence having a sequence homology of 95% or more. The "percentage of sequence homology" for polynucleotides is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).

The RT-PCR primer set of the present invention is suitable for cloning of appropriate sequences, digestion with restriction enzymes, and the phosphotriester method of Narang et al. (1979, Meth, Enzymol. 68:90-99), Beaucage et al. The ethylphosphoramidite method (1981, Tetrahedron Lett. 22: 1859-1862), and any other well-known methods including direct chemical synthesis methods such as the solid support method of U.S. Patent No. 4458066 can be used to synthesize chemically. can

Three primer pairs included in the primer set of the present invention, that is, a primer pair represented by SEQ ID NOs: 2 and 5; Primer pairs represented by SEQ ID NOs: 8 and 11; And the primer pair represented by SEQ ID NOs: 14 and 18 is not the entire SARS-CoV2 sequence, but the nucleotide sequence of the Orf1ab gene region 15,347-15,614 [length 267 nucleotide (nt)], the E gene region nucleotide sequence 26,246-26,471 (227 nt) ), and the nucleotide sequence 28,622-28,917 (296 nt) of the N gene region as a template. The present invention is characterized by designing and manufacturing three pairs of primers using the above three genes as templates. That is, as described below, the present invention selects 56 SARS-CoV2 whose entire base sequence has been analyzed in the GenBank database, aligns Orf1ab (RdRp), N and E gene regions among these base sequences, and then commonly conserves This is because a number of primer pairs designed to cover not only the site but also the mutation site were produced, and the optimal primer set was selected through experiments to determine the RT-PCR primer set.

If necessary, the RT-PCR primer set for detecting SARS-CoV2 of the present invention may further include a positive control gene represented by SEQ ID NO: 21, and the positive control gene is for false positive verification. As an embodiment, the positive control gene in the present invention is Orf1ab gene region nucleotide sequence 15,347-15,614 [length 267 nucleotide (nt)], E gene region nucleotide sequence 26,246-26,471 (227 nt), and N gene region nucleotide sequence 28,622-28,917 (296 nt) may be a nucleotide sequence formed by linking each of 28,622-28,917 (296 nt) to a sequence that can be cleaved by a restriction enzyme. As shown in FIG. 6, the restriction enzyme EcoRV (5'-GATATC-3') can react. It may be formed by inserting a specific base sequence so that

The RT-PCR primer composition for detecting SARS-CoV2 of the present invention includes the above-described RT-PCR primer set, and may further include reverse transcriptase, DNA polymerase, dNTPs, and a reaction buffer, if necessary. Of course, a positive control gene represented by SEQ ID NO: 21 may be further included to increase detection accuracy.

The detection kit of the present invention can detect SARS-CoV2 by including the RT-PCR primer composition. Severe acute respiratory syndrome coronavirus 2 can be GenBank accession number NC_045512.2 and its variants. In particular, the mutant strains were MT215193.1, MT215194.1, MT215195.1, MT270814.1, MT270815.1, MT276600.1, MT419810.1, MT419811.1, MT419812.1, MT419813.1, MT252797.1, MT252782. 1、MT358401.1、MT344963.1、MT325586.1、MT339041.1、MT344952.1、MT326070.1、MT344952.1、MT339041.1、MT325609.1、MT325605.1、MT325619.1; MT374111.1, MT324684.1, MT233521.1, MT371569.1, MT415320.1, MT163718.1, MT276326.1, MT163720.1, MT380733.1, MT344952.1, MT385489.1, MT385490.1, MT385491. 1、MT385492.1、MT385493.1、MT385494.1、MT385495.1、MT385496.1、MT385497.1、MT081059.1、MT081060.1、MT081061.1、MT081062.1、MT081063.1; MT081065.1, MT081066.1, MT081067.1, MT081068.1, MN988669.1 and MN988668.1.

In addition, the method for diagnosing SARS-CoV2 of the present invention comprises the steps of extracting RNA from a target sample other than the human body; Amplifying a target sequence by performing RT-PCR using the RNA as a template and using the primer set of any one of claims 1 to 3; and detecting the amplification product. Here, the step of detecting the amplification product may be performed through any one selected from the group consisting of a DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, phosphorus measurement, and combinations thereof. Here, if the positive control gene represented by SEQ ID NO: 21 is further included, false positive factors are removed when reading the experimental results, enabling more accurate testing.

The RT-PCR primers of the present invention are primers designed from species-specific nucleotide sequences, and can not only diagnose whether or not you are actually infected with SARS-CoV2, but also detect the theoretically synthesized SARS-CoV2 gene. There is no non-specific reaction with nucleic acids other than viruses, and the detection ability for target viruses is excellent.

Example 1

1. Collection of viral nucleic acids

In order to confirm the specificity of the general RT-PCR method, SARS-CoV2 Orf1ab gene [15,277-15,544 (268 nt)], E gene [26,177-26347 (231 nt)], N gene [28,471-28,766 (296 nt)] ] and four reference viruses (SARS-CoV, MERS-CoV, CoV-229E and R-AdV) were collected.

2. Construction of RT-PCR primers for SARS-CoV2 detection

RT-PCR primer design for SARS-CoV2 diagnosis targeted three genes (Orf1ab, E, and N) of which GenBank accession number NC_045512.2 was used as the reference sequence, and Primer 3 ver.0.4.0 (https:/ /bioinfo.ut.ee/primer3-0.4.0/primer3/), candidate primers were picked. Then, in order to prepare RT-PCR primers with a wide coverage that can respond to a total of 56 SARS-CoV2 strains, the selected primer combinations were modified using base sequences such as nucleotide letter codes. In order to react with general RT-PCR, two types of primers (forward and reverse) must act as one set. The collected RT-PCR primers were prepared as above, and a specific primer combination was developed by assaying the reaction in the collected nucleic acids. Meanwhile, Table 1 below shows the nucleotide sequences of primers for detecting SARS-CoV2 Orf1ab, N and E genes designed and manufactured according to an embodiment of the present invention.

The nucleic acid of SARS-CoV2 was genetically synthesized by requesting the nucleotide sequence known from Genbank accession number NC045512.2 to Macrogen. The synthetic nucleotide sequence was gene cloned using the pTOP Blunt V2 vector, and was provided in the form of a final plasmid.

division Base sequence (5'-3') sequence number length
nt location ^a gene direction name Orf1ab forward SARS2-O_F08I ACAACGTGTTNNAGCTTGT One 19 15,367-15,385 SARS2-O_F10 AACGTGTTGTAGCTTGTCAC 2 20 15,369-15,388 SARS2-O_F31I GAGTGAAAIIIIIIII-GTGGCGGTT 3 26 15,429-15,454 reverse SARS2-O_R10 AATTGCGGACATACTTATCG 4 20 15,588-15,607 SARS2-O_R22 GACATACTTATCGGCAATTTTG 5 22 15,579-15,600 SARS2-O_R35 GTTACCATCAGTAGATAAAAG 6 21 15,559-15,579 SARS2-O_R42 GACAGCTTGACAAATGTTAAAA 7 22 15,519-15,540 E forward SARS2-E_F05 CTCATTCGTTTCGGAAGAG 8 19 26,250-26,268 SARS2-E_F30 TCGTGGTATTCTTGCTAGTT 9 20 26,312-26,331 SARS2-E_R73 ACCAGAAGATCAGGAACTCTAG 10 22 26,447-26,468 reverse SARS2-E_R75I TAGAAGAATTCAGAIIITTAACACGA 11 26 26,424-26,449 SARS2-E_R77 AGAGTAAACGTAAAAAGAA 12 19 26,406-26,424 SARS2-E_R79I TAAAAAGAAGGIIIIACAAG 13 20 26,395-26,414
N forward SARS2-N_F10 GCTGGACTTCCCTATGGT 14 18 28,628-28,645 SARS2-N_F20 CTAACAAAGACGGCATCATA 15 20 28,647-28,666 SARS2-N_F30 CCTGCTAACAATGCTGCAAT 16 20 28,724-28,743 reverse SARS2-N_R10 AGTTCCCCTACTGCTGCCTG 17 20 28,869-28,888 SARS2-N_R20 GCCATTGCCAGCCATTCTA 18 19 28,897-28,915 SARS2-N_R30 GTTGAATTTCTTGAACTGTT 19 20 28,847-28,866 SARS2-N_R40 TTTCTTGAACTGTTGCGACT 20 20 28,841-28,860

a : GenBank number NC_045512.2 base position

3. RT-PCR amplification combination construction

Orf1ab gene (primer combination number Orf1ab-#01 to Orf1ab-#11), E gene (primer combination number E-#01 to E-#08) and N gene (primer combination number Each primer combination was constructed from N-#01 to N-#012). Table 2 below shows the sizes of RT-PCR primer combinations and reaction products designed and produced in the present invention.

Example 2

As shown in Table 2, among a plurality of SARS-CoV2 detection RT-PCR primer sets, one or more optimal primer sets capable of detecting each of three genes were aimed at selection. Each RT-PCR primer set capable of amplifying each gene of SARS-CoV2 was then selected through the following 4-step process; i) specific response to SARS-CoV2 nucleic acid, ii) non-specific response to reference virus nucleic acid, iii) detection sensitivity, iv) response and detection sensitivity in samples through sample assay and artificial infection.

A composition for RT-PCR reaction for a specific reaction was prepared as follows; AccuPower® RT-PCR PreMix (Bioneer, Korea), 17 uL of sterilized distilled water, 2 uL of RT-PCR primer set (25 pmol, 1 uL each of forward and reverse primers), and 1 uL of template nucleic acid. In addition, RT-PCR goes through a reverse transcription process at 42 ° C for 60 minutes, followed by pre-denaturation at 95 ° C for 5 minutes and repeated 35 times [denaturation at 95 ° C for 45 seconds, annealing 55°C 60 seconds, extension 72°C 60 seconds] and final extension 72°C 5 minutes. The reaction of the RT-PCR amplification product was confirmed under ultraviolet (UV) wavelength after electrophoresis using a 1.2% agarose gel containing a UV coloring reagent. Here, as the RT-PCR primer set, a plurality of RT-PCR primer sets for detecting SARS-CoV2 shown in Table 2 were sequentially used.

Through the experiments described below, it was confirmed that among the plurality of RT-PCR primer sets for SARS-CoV2 detection shown in Table 2, the best RT-PCR primer sets for detecting SARS-CoV2 were the three primer pairs shown in Table 3 below. .

Target
gene Set# Primer Name Type Primer seq. Orf1ab #6 SARS2-O_F10 F AACGTGTTGTAGCTTGTCAC SARS2-O_R22 R GACATACTTATCGGCAATTTTG E #2 SARS2-E_F05 F CTCATTCGTTTCGGAAGAG SARS2-E_R75I R TAGAAGAATTCAGAIIITTAACACGA N #2 SARS2-N_F10 F GCTGGACTTCCCTATGGT SARS2-N_R20 R GCCATTGCCAGCCATTCTA

Example 3

A positive control group capable of reacting with the RT-PCR primer set for detecting SARS-CoV2 and capable of performing a false positive test from the control group after amplification was prepared. In the prepared positive control group, the reaction was confirmed in the same manner as in Example 2 using each RT-PCR primer combination capable of amplifying the three SARS-CoV2 genes (Orf1ab, E and N). Using 5 uL of each RT-PCR amplification product reacted in the same manner as in Example 2, 1 uL of restriction enzyme EcoRV (Enzynomics, Korea) and 4 uL of reaction buffer were used to make a total of 10 uL and reacted at 37 ° C for 1 hour, After the reaction, 5 uL was mixed with 1 uL of 6X Loading dye, and after electrophoresis using a 1.2% agarose gel containing a UV coloring reagent, it was confirmed under ultraviolet (UV) wavelength.

On the other hand, molecular biological methods such as general PCR require a positive control for reliability of analysis, but contamination from the positive control is always possible during diagnosis, so false positives Concerns can be foreseen. One of the methods for solving the problem and securing reliability is to secure a standard positive control, and in the case of the positive control of the present invention, it has an amplification product of a different size from SARS-CoV2 amplified in an actual environmental sample by inserting a nucleotide sequence of a specific part. Even if a non-specific reaction of the same magnitude as the positive control is confirmed, it contains a functionality that can check false positives and cross-contamination using the restriction enzyme EcoRV, so it is possible to prevent false positive reactions that may occur due to laboratory contamination. It is characterized by rapid response.

Experimental Example 1. Specific response to SARS-CoV2 nucleic acid

Using the RT-PCR primer set capable of detecting the SARS-CoV2 gene fragment prepared in Example 1, RT-PCR was performed with the same composition and conditions as in Example 2 to obtain a specific size for the corresponding SARS-CoV2 gene fragment. The amplification band of was confirmed. "N" was electrophoresed after RT-PCR reaction using tertiary sterile distilled water (or nucleic acid free water) as a template that does not contain any nucleic acids such as SARS-CoV2 plasmid as a negative control. The RT-PCR reaction composition, conditions and electrophoresis method were the same as in Example 2, and the results of Experimental Example 1 are shown in FIGS. 1A to 1C. 1a to 1c show the specific reaction of the SARS-CoV2 plasmid of the RT-PCR set estimated to amplify each gene targeting the three SARS-CoV2 genes (Orf1ab, E and N), and this Among them, RT-PCR primer combinations selected in consideration of reaction intensity, amplification product size, amplification location, etc. are shown.

From FIG. 1A, primer combination numbers #3 and #6 shown in Table 2 for the Orf1ab gene, primer combination numbers #1 and #2 shown in Table 2 for the E gene from FIG. 1B, and N gene from FIG. 1C It can be seen that specific reactions to SARS-CoV2 nucleic acid appear in primer combination numbers #1, #2, #6, and #7 shown in Table 2.

Experimental Example 2. Non-specific reaction to reference virus nucleic acid

In Example 2 and Experimental Example 1, the non-specific reaction to the reference virus nucleic acid was assayed for the RT-PCR primer combinations for which a specific size reaction was confirmed, SARS-CoV2 nucleic acid as a positive control, and tertiary sterile distilled water as a negative control was used. The reaction composition and conditions are the same as in Example 2, and the results of Experimental Example 2 are shown in FIGS. 2a to 2c.

From FIGS. 2a to 2c, it is possible to identify combination numbers that specifically react only to SARS-CoV2 by examining non-specific reactions to four reference viruses among the RT-PCR primer sets in which SARS-CoV2-specific reactions have been confirmed. . From these results, it is possible to select an RT-PCR primer set optimal for detecting SARS-CoV2. Primer pairs optimal for detecting the three genes of SARS-CoV2, Orf1ab gene, E gene, and N gene, are shown in Table 3, respectively. As shown in FIG. 2a, combination number #6 for the Orf1ab gene, FIG. 2b, combination number #2 for the E gene, and FIG. 2c, combination number #2 for the N gene.

Experimental Example 3. Detection Sensitivity

Based on SARS-CoV2 plasmid 1 ng/uL, 10 ⁸ (10 ag/uL) was prepared at the 0th power (1 ng/uL) of 10-fold serial dilution with tertiary sterile distilled water. For the RT-PCR primer set selected through the results of Experimental Examples 1 and 2, detection sensitivity was confirmed by RT-PCR reaction using the SARS-CoV2 plasmid stage dilution as a template. Tertiary sterile distilled water was used as a negative control, and the reaction composition and conditions were the same as in Example 2. The results of Experimental Example 3 are shown in FIGS. 3a to 3c. Figures 3a to 3c show RT-PCR primer combinations that were selected and compared for detection sensitivity relative to RT-PCR primer combinations that were specific for SARS-CoV2 and showed a non-specific reaction to the reference virus nucleic acid.

One primer pair constituting the RT-PCR primer set prepared from FIG. 3a is up to 10 ^-7 dilution, and the other primer pair of the RT-PCR primer set prepared from FIG. 3b is up to 10 ^-5 dilution, FIG. 3c It was confirmed that another primer pair among the RT-PCR primer sets prepared from detects SARS-CoV 2 up to 10 ^-6 dilution.

Experimental Example 4. Reaction and detection sensitivity in samples through sample assay and artificial infection

After taking a sample from the upper respiratory tract (oropharynx and nasopharynx) of a healthy person using an autoclaved plastic swab (i.e. floced swab), total RNA was extracted using the RNA extraction kit Ribospin™ vRD (GeneAll, Korea) according to the manual. did Total RNA extracted from the RT-PCR primer combination capable of amplifying each of the three SARS-CoV2 genes (Orf1ab, E, and N) selected through Experimental Example 3 was subjected to RT-PCR reaction as a template, followed by electrophoresis. On the other hand, using 1 ng/uL of SARS-CoV2 plasmid and any one type of nucleic acid extracted from the sample, 100 pg/uL was artificially contaminated, and then a 10-fold serial dilution was prepared with the nucleic acid extracted from the sample. Electrophoresis was performed after the RT-PCR reaction using the artificially contaminated step-by-step dilution as a template. SARS-CoV2 nucleic acid was used as a positive control group and tertiary sterile distilled water was used as a negative control group. The reaction composition and conditions are the same as in Example 2, and the results of Experimental Example 4 are shown in FIGS. 4a to 4c and 5a to 5c. 4a to 4c show the results of the reaction of the RT-PCR primer combination capable of amplifying each gene from the total nucleic acid extracted from 10 samples, and FIGS. 5a to 5c show the total nucleic acid of the sample with SARS-CoV2 plamid. In , the results of relative comparison of detection sensitivities from serial dilutions after artificial contamination are shown.

4a to 4c, it can be confirmed that SARS-CoV2 was not detected in total RNA extracted from 10 samples.

SARS-CoV2 was detected in artificially contaminated templates up to a 10 ^-5 dilution factor for the Orf1ab gene from Figure 5a, a 10 ^-6 dilution factor for the E gene from Figure 5b, and a 10 ^-6 dilution factor for the N gene from Figure 5c. could confirm that

Experimental Example 5. Preparation of positive control for diagnosis of SARS-CoV2, RT-PCR primer combination reaction and false positive reaction test

RT-PCR reaction was performed using the RT-PCR primer combination capable of amplifying the three SARS-CoV2 genes (Orf1ab, E and N) and the prepared positive control as a template, and the reaction product was tested for restriction enzyme EcoRV reaction. . The RT-PCR reaction composition and conditions are the same as in Example 2, and the restriction enzyme reaction is the same as in Example 3. The results are shown in FIGS. 6 to 7c, and FIG. 6 includes information on the nucleotide sequence of the designed and manufactured positive control, the binding site of the primer, and the reaction site of the restriction enzyme EcoRV. 7a to 7c show the reaction of RT-PCR amplification products before and after treatment with EcoRV restriction enzyme.

A total of 236 nt amplification products are 90 nt and 146 nt from FIG. 7a, a total of 202 nt amplification products are 70 nt and 132 nt from FIG. 7b, and a total of 292 nt amplification products are 102 nt and 190 nt from FIG. 7c cutting can be seen.

Although the present invention has been shown and described with preferred embodiments as described above, it is not limited to the above embodiments, and to those skilled in the art within the scope of not departing from the spirit of the present invention Various changes and modifications will be possible. For example, even if the described techniques are performed in a different order from the described method, and/or the described components are combined or combined in a different form than the described method, or substituted or replaced by other components or equivalents. Appropriate results can be achieved.

<110> Shinhan university <120> Reverse transcriptase polymerase chain reaction for the detection of severe acute respiratory syndrome coronavirus 2 and a diagnosing kit for severe acute respiratory syndrome coronavirus 2 using the same <130> DPP-2021-0043-KR <160> 21 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 1 acaacgtgtt nnagcttgt 19 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 2 aacgtgttgt agcttgtcac 20 <210> 3 <211> 17 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 3 gagtgaaagt ggcggtt 17 <210> 4 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 4 aattgcggac atacttatcg 20 <210> 5 <211> 22 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 5 gacatactta tcggcaattt tg 22 <210> 6 <211> 21 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 6 gttaccatca gtagataaaa g 21 <210> 7 <211> 22 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 7 gacagcttga caaatgttaa aa 22 <210> 8 <211> 19 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 8 ctcattcgtt tcggaagag 19 <210> 9 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 9 tcgtggtatt cttgctagtt 20 <210> 10 <211> 22 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 10 accagaagat caggaactct ag 22 <210> 11 <211> 23 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 11 tagaagaatt cagattaaca cga 23 <210> 12 <211> 19 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 12 agagtaaacg taaaaagaa 19 <210> 13 <211> 16 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 13 taaaaagaag gacaag 16 <210> 14 <211> 18 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 14 gctggacttc cctatggt 18 <210> 15 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 15 ctaacaaaga cggcatcata 20 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> forward primer <400> 16 cctgctaaca atgctgcaat 20 <210> 17 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 17 agttccccta ctgctgcctg 20 <210> 18 <211> 19 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 18 gccattgcca gccattcta 19 <210> 19 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 19 gttgaatttc ttgaactgtt 20 <210> 20 <211> 20 <212> DNA <213> artificial sequence <220> <223> Reverse primer <400> 20 tttcttgaac tgttgcgact 20 <210> 21 <211> 812 <212> DNA <213> artificial sequence <220> <223> Positive control gene <400> 21 tcgcgattgt tcttgctcgc aaacatacaa cgtgttgtag cttgtcacac cgtttctata 60 gattagctaa tgagtgtgct caagtattga gtgaaatggt catgtgtggc ggttcgatat 120 ctatatgtta aaccaggtgg aacctcatca ggagatgcca caactgctta tgctaatagt 180 gtttttaaca tttgtcaagc tgtcacggcc aatgttaatg cacttttatc tactgatggt 240 aacaaaattg ccgataagta tgtccgcaat ttacaacatg tactcattcg tttcggaaga 300 gacaggtacg ttaatagtta atagcgtact tctttttctt gctttcgtgg atatctcttg 360 ctagttacac tagccatcct tactgcgctt cgattgtgtg cgtactgctg caatattgtt 420 aacgtgagtc ttgtaaaacc ttctttttac gtttactctc gtgttaaaaa tctgaattct 480 tctagagttc ctgatcttct ggtctaccag aagctggact tccctatggt gctaacaaag 540 acggcatcat atgggttgca actgagggag ccttgaatac accaaaagat cacattggca 600 cccgcaatcc tgatatctaa caatgctgca atcgtgctac aacttcctca aggaacaaca 660 ttgccaaaag gcttctacgc agaagggagc agaggcggca gtcaagcctc ttctcgttcc 720 tcatcacgta gtcgcaacag ttcaagaaat tcaactccag gcagcagtag gggaacttct 780 cctgctagaa tggctggcaa tggcggctgc ag 812

Claims (11)

Primer pairs represented by SEQ ID NOs: 2 and 5; Primer pairs represented by SEQ ID NOs: 8 and 11; And a set of RT-PCR primers for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV2), including a primer pair represented by SEQ ID NOs: 14 and 18.
According to claim 1,
The base sequences of SEQ ID NOs: 2 and 5 were designed and produced using the base sequence 15,347-15,614 of the Orf1ab gene region of SARS-CoV2 as a template, and SEQ ID NOs: 8 and 11 are the base sequences of the E gene region of SARS-CoV2. 26,246-26,471 as a template, and SEQ ID NOs: 14 and 18 are designed and manufactured as a template for the nucleotide sequence 28,622-28,917 of the N gene region of SARS-CoV2 Severe Acute Respiratory Syndrome Coronavirus 2 RT-PCR primer set for detection.
According to claim 2,
An RT-PCR primer set for detecting severe acute respiratory syndrome coronavirus 2, further comprising a positive control gene represented by SEQ ID NO: 21.
An RT-PCR primer composition for detecting severe acute respiratory syndrome coronavirus 2 comprising the RT-PCR primer set of claim 1.
According to claim 4,
An RT-PCR primer composition for detecting severe acute respiratory syndrome coronavirus 2, characterized in that it further comprises reverse transcriptase, DNA polymerase, dNTPs and a reaction buffer.
According to claim 5,
An RT-PCR primer composition for detecting severe acute respiratory syndrome coronavirus 2, characterized in that it further comprises a positive control gene represented by SEQ ID NO: 21.
A kit for detecting severe acute respiratory syndrome coronavirus 2, comprising the composition of any one of claims 4 to 6.
According to claim 7,
The severe acute respiratory syndrome coronavirus 2 is a severe acute respiratory syndrome coronavirus 2 detection kit, characterized in that GenBank accession number NC_045512.2 and its mutant strain.
Extracting RNA from a target sample other than human body;
Amplifying a target sequence by performing RT-PCR using the RNA as a template and using the primer set of any one of claims 1 to 3; and
Detecting the amplification product; Severe Acute Respiratory Syndrome Coronavirus 2 diagnostic method comprising.
According to claim 9,
Severe acute respiratory syndrome, characterized in that the step of detecting the amplification product is performed through any one selected from the group consisting of DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, fluorescence measurement, anthropometry and combinations thereof How to diagnose coronavirus 2.
According to claim 9,
A method for diagnosing severe acute respiratory syndrome coronavirus 2, characterized in that when the positive control gene represented by SEQ ID NO: 21 is further included, false positive factors are removed when reading the experimental results.

Images