KR20220138093A - OsWRKY5 gene controlling resistance to abiotic stress in plant and uses thereof - Google Patents

Abstract

The present invention relates to an OsWRKY5 gene for regulating resistance to abiotic stress of plants and uses thereof, wherein a mutant in which an OsWRKY5 gene function is lost through a CRISPR/Cas9 system has increased resistance to abiotic stress, and transformants in which the OsWRKY5 gene is overexpressed have increased sensitivity to abiotic stress. Therefore, by applying gene editing technology to the OsWRKY5 gene, the development of multi-stress resistant crops can be expected.

Description

OsWRKY5 gene controlling resistance to abiotic stress in plant and uses thereof

The present invention relates to the OsWRKY5 gene for regulating abiotic stress resistance of plants and uses thereof.

Plants are exposed to various environmental stresses while living a sedentary life, and environmental stress is caused by biotic (disease, pest, virus, etc.) stress caused by other organisms and abiotic (dry, salt damage) caused by changes in the physical or chemical environment. , cold damage, high temperature, pollutants, etc.) stress. Such environmental stress has a great influence on the growth and development of plants.

Environmental stress is a factor that inhibits plant growth and limits the productivity of crops in the agricultural field, and includes moisture (drying) stress, osmotic stress, and low temperature stress. Since the ability of plants to adapt to environmental stress is directly related to agricultural productivity, research on this has been an important research topic that has been continuously interested in humans since they started farming. Assuming that 100% of the total production that a plant can produce, the actual production is only 21%, and most of it is lost due to environmental stress such as drought, cold damage, salt damage, etc., which accounts for about 69% of total crop production. reach Of these, areas affected by high salt stress account for 20% of the world's agricultural land area, and more than 40% of related agricultural areas that require water are affected by salt. Therefore, even if this loss can be reduced by only 1% by securing key substances related to environmental stress resistance and salt resistance, it is expected that the food problem facing mankind in the future will be dramatically improved.

On the other hand, Korean Patent Application Laid-Open No. 2017-0057564 discloses 'WRKY transcriptional regulatory gene responding to short-term moisture stress and its use', and Korean Patent Publication No. 2015-0010299 discloses 'Environmental stress tolerance of plants using ARR22 gene' A method for regulating the 'and a plant according thereto' are disclosed, but there is no description of the OsWRKY5 gene for regulating the abiotic stress resistance of the plant of the present invention and its use.

The present invention was derived from the above needs, and designed sgRNA (single guide RNA) targeting the CDS (coding sequence) of OsWRKY5 ( Os05g04640 ) gene, cloned into pOs-sgRNA vector, and pH-Ubi-Cas9- After final cloning in the 7 vector, Dongjinbyeo was transformed with the recombinant plasmid to prepare an oswrky5-2 mutant in which 4 bases were deleted in the 2nd exon of the OsWRKY5 gene. As a result of analyzing the resistance to drought stress of the oswrky5-2 mutant in which the expression of the OsWRKY5 gene was suppressed , the water loss rate, ion leakage rate and MDA ( It was confirmed that the amount of malondialdehyde) was significantly decreased and crop production increased. In addition, as a result of analyzing the resistance to osmotic stress of the oswrky5-2 mutant, the survival rate and above-ground growth of the oswrky5-2 mutant were increased compared to the wild-type control and OsWRKY5 overexpressing transformants, thereby completing the present invention. .

In order to solve the above problem, the present invention provides a plant cell comprising the step of regulating the expression of the OsWRKY5 protein-coding gene by transforming the plant cells with a recombinant vector containing a rice-derived OsWRKY5 protein-coding gene. Resistance to abiotic stress provides a way to control

In addition, the present invention comprises the steps of (a) introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the OsWRKY5 protein-coding gene derived from rice into plant cells to correct the genome; and (b) re-differentiating the plant from the plant cell in which the genome has been corrected;

In addition, the present invention provides a genome editing plant and seeds thereof with increased resistance to abiotic stress prepared by the above method.

In addition, the present invention comprises the steps of transforming plant cells with a recombinant vector containing a rice-derived OsWRKY5 protein coding gene; and re-differentiating the transformed plant from the transformed plant cells; provides a method for producing a transgenic plant with controlled resistance to abiotic stress, comprising a.

In addition, the present invention provides a transgenic plant and a transformed seed thereof with regulated resistance to abiotic stress prepared by the above manufacturing method.

In addition, the present invention provides a composition for regulating resistance to abiotic stress of a plant comprising a rice-derived OsWRKY5 protein-coding gene as an active ingredient.

The present invention suggested the possibility of the OsWRKY5 gene as a target for developing multiple stress-resistant crops. Since securing multiple stress-resistant crops is a very important characteristic in the agricultural field, the rice-derived OsWRKY5 gene of the present invention is expected to have high utility. In addition, it has been confirmed that the OsWRKY5 gene is related to various abiotic stress-related genes, so it will be available as a very important material for gene editing based on gene editing.

1 is a diagram showing the Cas9/sgRNA target position in the OsWRKY5 gene sequence.
2 is a result of confirming the expression level of OsWRKY5 gene in various tissues of wild-type rice grown for 10 days and wild-type rice grown for 120 days under natural long-day conditions (>14 hours light conditions/1 day). FL: flag leaf, LB: leaf blade, LS: leaf sheath, LJ: lamina joint, S: stem, N: node, IN: internode ( internode), R: root, TB: tiller base, P: panicle.
Figure 3 shows the growth status of rice after drought stress treatment in wild-type Dongjinbyeo (control group, WT), a mutant with a loss of OsWRKY5 gene function ( oswrky5-2 ) and a transformant overexpressing the OsWRKY5 gene ( oswrky5-D ) (A) ), viability (B), ion leakage rate (C), and MDA (malondialdehyde) content (D) were measured.
4 shows the state of rice leaves after drought stress treatment in wild-type Dongjinbyeo (control group, WT), a mutant with a loss of OsWRKY5 gene function ( oswrky5-2 ) and a transformant overexpressing the OsWRKY5 gene ( oswrky5-D ) (A) ), moisture loss rate (B), pore morphology (C), pore conductivity (D), and pore density (E) were measured.
Figure 5 is a wild-type Dongjinbyeo (control group, WT), a mutant with a loss of OsWRKY5 gene function ( oswrky5-2 ; A) and a transformant overexpressing the OsWRKY5 gene ( oswrky5-D ; B) after drought stress treatment of rice. This is a picture of the growth status.
Figure 6 is a wild-type Dongjinbyeo (control, WT), OsWRKY5 gene loss mutant ( oswrky5-2 ; A) and OsWRKY5 gene overexpression transformant ( oswrky5-D ; B) after treatment of drought stress in rice It is the result of checking factors related to productivity. Yield, Yield; 500 GW, 500 grain weight; TGW, Total grain weight; FR, Filling rate; NFG, Number of filled grains; NSP, Number of spikelets per panicle; NTS, Number of total spikelets; PL, Particle length; NP, Number of panicles; CL, Culm length.
7 shows the survival status of rice after osmotic stress treatment ( oswrky5-D ) in wild-type Dongjinbyeo (control group, WT), a mutant in which the OsWRKY5 gene function is lost ( oswrky5-2 ) and a transformant in which the OsWRKY5 gene is overexpressed ( oswrky5-D ) ) and the result of measuring the length (B) of the above-ground part.

In order to achieve the object of the present invention, the present invention is to transform plant cells with a recombinant vector containing a rice-derived OsWRKY5 protein-coding gene to control the expression of the OsWRKY5 protein-coding gene. A method for controlling resistance to

In the control method according to an embodiment of the present invention, the OsWRKY5 protein may be a rice-derived OsWRKY5 protein consisting of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

The range of the rice-derived OsWRKY5 protein according to the present invention includes a protein having the amino acid sequence shown in SEQ ID NO: 2 and functional equivalents of the protein. In the present invention, the term "functional equivalent" means at least 70% or more, preferably 80% or more, more preferably 90% of the amino acid sequence represented by SEQ ID NO: 2 as a result of addition, substitution or deletion of amino acids. As described above, more preferably, it refers to a protein having a sequence homology of 95% or more and exhibiting physiological activity substantially identical to that of the protein represented by SEQ ID NO: 2. "Substantially homogenous physiological activity" means an activity for regulating the abiotic stress resistance of a plant.

The method for regulating the abiotic stress resistance of a plant according to the present invention is to inhibit the expression of the rice-derived OsWRKY5 protein-coding gene in plant cells to increase the resistance of the plant to abiotic stress compared to the wild type. , or by overexpressing the expression of the OsWRKY5 protein-coding gene in plant cells to increase the sensitivity to abiotic stress compared to the wild type, but is not limited thereto.

In one embodiment of the present invention, the suppression of the expression of the gene encoding the OsWRKY5 protein is a CRISPR / Cas9 gene correction system, an endogenous transposon, X-ray or γ-ray irradiation of the OsWRKY5 protein encoding gene mutagenesis through irradiation , RNAi or antisense RNA may be used to inhibit (suppress) the expression of the OsWRKY5 protein-coding gene, but is not limited thereto, and any conventional method in the art for inhibiting gene expression may be possible.

In the method for regulating abiotic stress resistance of a plant according to the present invention, the abiotic stress may be drought or osmotic stress, but is not limited thereto.

The present invention also includes a gene encoding a rice-derived OsWRKY5 protein, and the scope of the gene includes all of genomic DNA, cDNA, and synthetic DNA encoding OsWRKY5 protein. Preferably, the gene encoding the OsWRKY5 protein of the present invention may include a rice-derived OsWRKY5 base sequence represented by SEQ ID NO: 1. In addition, homologs of the nucleotide sequence are included within the scope of the present invention. Specifically, the gene includes a nucleotide sequence having a sequence homology of 70% or more, more preferably 80% or more, more preferably 90% or more, most preferably 95% or more to the nucleotide sequence of SEQ ID NO: 1, respectively. can do. The "% sequence homology" for a polynucleotide is determined by comparing two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is a reference sequence (not including additions or deletions) to the optimal alignment of the two sequences. additions or deletions (ie, gaps) compared to not).

As used herein, the term “recombinant” refers to a cell in which the cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a peptide, a heterologous peptide or a protein encoded by the heterologous nucleic acid. Recombinant cells can express genes or gene segments not found in the native form of the cell, either in sense or antisense form. Recombinant cells can also express genes found in cells in a natural state, but the genes are modified and re-introduced into cells by artificial means.

As used herein, the term “vector” is used to refer to a DNA fragment(s), a nucleic acid molecule, that is delivered into a cell. The vector replicates DNA and can be reproduced independently in a host cell. The term "carrier" is often used interchangeably with "vector."

The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of proceeding transcription (eg, pLλ promoter, Trp promoter, Lac promoter, T7 promoter, Tac promoter, etc.); It generally includes a ribosome binding site for initiation of translation and a transcription/translation termination sequence. When Escherichia coli is used as the host cell, the promoter and operator sites of the E. coli tryptophan biosynthesis pathway, and the left-handed promoter (pLλ promoter) of phage λ may be used as regulatory regions.

In the recombinant vector of the present invention, the promoter is a promoter suitable for transformation, preferably CaMV 35S promoter, actin promoter, ubiquitin promoter, pEMU promoter, MAS promoter or histone promoter, preferably CaMV 35S promoter. However, it is not limited thereto.

In the present invention, the term "promoter" refers to a region upstream of DNA from a structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. A “plant promoter” is a promoter capable of initiating transcription in a plant cell. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental states or cell differentiation. A constitutive promoter may be preferred in the present invention because the selection of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit the selectivity.

The recombinant vector of the present invention can be constructed by methods well known to those skilled in the art. The method includes in vitro recombinant DNA technology, DNA synthesis technology, and in vivo recombination technology. The DNA sequence can be effectively linked to a suitable promoter in an expression vector to direct mRNA synthesis. The vector may also include a ribosome binding site as a translation initiation site and a transcription terminator.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a part of itself, the so-called T-region, into a plant cell when present in a suitable host such as Agrobacterium tumefaciens . Another type of Ti-plasmid vector (see EP 0 116 718 B1) is currently used to transfer hybrid DNA sequences into plant cells, or protoplasts from which new plants can be produced that properly insert the hybrid DNA into the genome of the plant. have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors such as those that can be derived from double-stranded plant viruses (eg CaMV) and single-stranded viruses, gemini viruses, etc. For example, it can be selected from incomplete plant viral vectors. The use of such vectors can be advantageous, especially when it is difficult to adequately transform a plant host.

The recombinant expression vector may preferably comprise one or more selectable markers. The marker is a nucleic acid sequence having characteristics that can be selected by conventional chemical methods, and includes all genes that can distinguish transformed cells from non-transformed cells. The marker gene may be an antibiotic resistance gene (dominant drug resistance gene), but is not limited thereto.

As a host cell capable of stably and continuously cloning and expressing the vector of the present invention, any host cell known in the art, including microalgae and microorganisms, may be used, for example, E. coli JM109, E. coli BL21, Bacillus genus strains such as E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis , B. thuringiensis , And Salmonella typhimurium ( Salmonella typhimurium ), Serratia marcescens ( Serratia marcescens ) and various enterobacteriaceae and strains such as Pseudomonas species.

In addition, when the vector of the present invention is transformed into a eukaryotic cell, as a host cell, yeast (eg, Saccharomyce cerevisiae ), insect cell, human cell (eg, CHO cell line (Chinese hamster ovary), W138, BHK, COS-7) , 293, HepG2, 3T3, RIN and MDCK cell lines) and plant cells may be used, preferably plant cells.

Transformation of a plant refers to any method of transferring DNA into a plant. Such transformation methods need not necessarily have a period of regeneration and/or tissue culture. Transformation of plant species is now common for plant species including both monocots as well as dicots. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Methods include the calcium/polyethylene glycol method for protoplasts (Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), Electroporation (Shillito R.D. et al., 1985 Bio/Technol. 3, 1099-1102), microinjection with plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185) , Agrobacterium tumefaciens by particle bombardment of various plant elements (DNA or RNA-coated) (Klein T.M. et al., 1987, Nature 327, 70), infiltration of plants or transformation of mature pollen or vesicles. In mediated gene transfer, it can be appropriately selected from (incomplete) viral infection (EP 0 301 316) and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery.

The present invention also

(a) correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsWRKY5 protein-coding gene into plant cells; and

(b) re-differentiating the plant from the plant cells in which the genome has been corrected;

As used herein, the term "genome/gene editing" refers to a technology capable of introducing a target-directed mutation into the genome sequence of animal and plant cells, including human cells, and one or more nucleic acids by DNA cleavage. Knock-out or knock-in a specific gene by deletion, insertion, substitution, etc. of a molecule, or non-coding (non-coding) that does not produce a protein -coding) refers to a technology that can introduce mutations into DNA sequences. For the purpose of the present invention, the genome editing may be to introduce a mutation into a plant using an endonuclease, for example, a CRISPR associated protein 9 (Cas9) protein and a guide RNA. Also, 'gene editing' may be used interchangeably with 'gene editing'.

As used herein, the term "target gene" refers to some DNA in the genome of a plant to be corrected through the present invention, is not limited to the type of the gene, and may include both a coding region and a non-coding region. . A person skilled in the art can select the target gene according to the desired mutation for the genome-corrected plant to be prepared, depending on the purpose.

As used herein, the term “guide RNA” refers to an RNA specific for DNA encoding a nucleotide sequence of a target gene, and all or part of the target DNA nucleotide sequence is complementarily bound to the target DNA nucleotide sequence It means ribonucleic acid that plays a role in leading the endonuclease protein. The guide RNA may include two RNAs, that is, a dual RNA including crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA) as components; Or it refers to a single-chain guide RNA (sgRNA) form comprising a first site comprising a sequence that is fully or partially complementary to a nucleotide sequence in a target gene and a second site comprising a sequence that interacts with an RNA-guided nuclease. , the RNA-guided nuclease may be included in the scope of the present invention without limitation as long as it has a form capable of having activity in the target nucleotide sequence, taking into account the type of endonuclease used together or the microorganism derived from the endonuclease, etc. It can be appropriately selected according to a technique known in the art.

In addition, the guide RNA may be transcribed from a plasmid template, transcribed in vitro (eg, oligonucleotide double-stranded), or synthesized guide RNA, but is not limited thereto.

In addition, in the method for producing a genome editing plant according to the present invention, the endonuclease protein is Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease) Or it may be one or more selected from the group consisting of functional analogues thereof, and preferably, it may be a Cas9 protein, but is not limited thereto.

In addition, the Cas9 protein is Streptococcus pyogenes -derived Cas9 protein, Campylobacter jejuni -derived Cas9 protein, Streptococcus thermophilus or Streptococcus aureus ( S. aureus ) derived Cas9 protein, Neisseria meningitidis derived Cas9 protein, Pasteurella multocida derived Cas9 protein, Francisella novicida Cas9 protein derived from, etc. It may be one or more selected from the group consisting of, but is not limited thereto. Cas9 protein or genetic information thereof can be obtained from a known database such as GenBank of the National Center for Biotechnology Information (NCBI).

Cas9 protein is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. In order for the Cas9 protein to accurately bind to the target sequence and cut the DNA strand, a short sequence of three bases known as PAM (Protospacer Adjacent Motif) must exist next to the target sequence, and the Cas9 protein has a PAM sequence (NGG). cleavage by inferring between the 3rd and 4th base pairs from

In the present invention, the guide RNA and the endonuclease protein form a ribonucleoprotein complex to operate as RNA-Guided Engineered Nuclease (RGEN).

The CRISPR/Cas9 system used in the present invention introduces a double helix break at a specific position of a specific gene to be corrected, and NHEJ induces an insertion-deletion (InDel) mutation caused by incomplete repair induced in the DNA repair process. It is a gene editing method based on (non-homologous end joining) mechanism.

In the method according to an embodiment of the present invention, the introduction of the guide RNA and the endonuclease protein in step (a) into the plant cell includes a guide RNA and an endonuclease specific for the target nucleotide sequence of the plant-derived OsWRKY5 gene. ribonucleoprotein; Alternatively, a recombinant vector comprising a DNA encoding a guide RNA specific for the target nucleotide sequence of the OsWRKY5 gene and a nucleic acid sequence encoding an endonuclease protein may be used, but is not limited thereto.

In one embodiment of the present invention, the target nucleotide sequence of the OsWRKY5 gene may preferably consist of the nucleotide sequence of SEQ ID NO: 3.

In addition, in the genome editing plant according to the present invention, the 4 bp base corresponding to the 139th to 142th among the nucleotide sequence of the OsWRKY5 gene consisting of the nucleotide sequence of SEQ ID NO: 1 is deleted through the CRISPR/Cas9 gene editing system, so that the expression of the OsWRKY5 gene is reduced. It may be a suppressed genome editing plant, but is not limited thereto.

In one embodiment of the present invention, the plants are monocotyledonous plants such as rice, barley, wheat, rye, corn, sugar cane, oats, and onion, or Arabidopsis thaliana, potato, eggplant, tobacco, pepper, tomato, burdock, wormwood, It may be a dicotyledonous plant such as lettuce, bellflower, spinach, chard, sweet potato, carrot, water parsley, Chinese cabbage, cabbage, radish, watermelon, melon, cucumber, pumpkin, gourd, strawberry, soybean, mung bean, kidney bean, pea, etc., preferably It may be a monocot plant, more preferably a rice plant, but is not limited thereto.

The present invention also provides a genome editing plant and seeds thereof with increased resistance to abiotic stress produced by the method.

The present invention also

transforming plant cells with a recombinant vector containing a rice-derived OsWRKY5 protein-coding gene; and

It provides a method for producing a transgenic plant with regulated resistance to abiotic stress, comprising the step of re-differentiating the transformed plant from the transformed plant cell.

In the production method of the present invention, the rice-derived OsWRKY5 protein may include a rice-derived OsWRKY5 protein comprising the amino acid sequence of SEQ ID NO: 2 and a functional equivalent of the protein, and the specific details are the same as described above.

In addition, in the production method of the present invention, the method for transforming the plant cell is as described above, and the method for redifferentiating the transgenic plant from the transformed plant cell may use any method known in the art. can Transformed plant cells must be redifferentiated into whole plants. Techniques for the redifferentiation of mature plants from callus or protoplast cultures are well known in the art for a number of different species (Handbook of Plant Cell Culture, Vol. 1-5, 1983-1989 Momillan, N.Y.).

In the manufacturing method according to an embodiment of the present invention, the abiotic stress may be drought or osmotic stress, but is not limited thereto.

In the production method according to an embodiment of the present invention, when the expression of the gene encoding the OsWRKY5 protein is inhibited in plant cells, resistance to abiotic stress of a non-transformed plant, that is, a plant compared to a wild-type plant can be increased. Or, overexpression of the gene encoding the OsWRKY5 protein in plant cells may increase the sensitivity of the plant to abiotic stress compared to the non-transformed plant, but is not limited thereto.

The OsWRKY5 protein coding Inhibition of gene expression is to inhibit the expression of OsWRKY5 protein-coding gene by transforming plant cells with a recombinant vector containing sense or antisense DNA or microRNA for the OsWRKY5 gene, or a gene such as CRISPR/Cas9 It may be to inhibit the expression of the OsWRKY5 protein-coding gene using a correction system, but is not limited thereto, and a gene expression inhibition technique known in the art may be used.

The present invention also provides a transgenic plant with regulated resistance to abiotic stress prepared by the method of the present invention and a transformed seed thereof.

The transgenic plant according to the present invention is characterized in that resistance to abiotic stress is increased when the expression of the OsWRKY5 protein-coding gene is inhibited, and when the expression of the OsWRKY5 protein-coding gene is increased, it is resistant to abiotic stress. characterized by increased sensitivity to

The plants are Arabidopsis thaliana, potato, eggplant, tobacco, red pepper, tomato, burdock root, green radish, lettuce, bellflower, spinach, chard, sweet potato, carrot, water parsley, Chinese cabbage, cabbage, gat radish, watermelon, melon, cucumber, pumpkin, gourd, It may be a dicotyledonous plant such as strawberry, soybean, mung bean, kidney bean, pea, or a monocotyledonous plant such as rice, barley, wheat, rye, corn, sugar cane, oat, and onion, preferably a monocot plant, and more preferably a monocot plant. may be a rice plant, but is not limited thereto.

The present invention also provides a composition for regulating resistance to abiotic stress of a plant comprising a rice-derived OsWRKY5 protein-coding gene as an active ingredient.

The composition comprises, as an active ingredient, a mutation of a gene encoding a rice-derived OsWRKY5 protein or a gene encoding an OsWRKY5 protein, and plant cells with a recombinant vector comprising a gene encoding the OsWRKY5 protein or a gene encoding the OsWRKY5 protein. By transforming, the resistance of the plant to abiotic stress can be controlled.

In the composition according to the present invention, the rice-derived OsWRKY5 protein may preferably consist of the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

Hereinafter, the present invention will be described in detail by way of Examples. However, the following examples are only illustrative of the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Plant material

Wild-type Dongjinbyeo, a japonica variety, was used as a control, and the seeds of the OsWRKY5 -overexpressing transformant ( oswrky5-D ; PFG_3A-15928) were provided by Professor Jinheung Ahn's laboratory at Kyunghee University. The OsWRKY5 overexpressing transformant is a plant in which the expression of the OsWRKY5 gene is increased by the T-DNA activation tagging method (Plant Physiol, 2002, 130(4), 1636-1644).

In addition, in order to construct an oswrky5-2 mutant with suppressed OsWRKY5 gene expression using the CRISPR/Cas9 system, sgRNA targeting the coding sequence region of the OsWRKY5 gene (5'-CGACGACGACGTCCTCCGTG-3'; SEQ ID NO: 3) was used. After design, it was introduced into the pOs-sgRNA vector, and then cloned into the final vector, pH-Ubi-Cas9-7. Finally, the cloned recombinant plasmid was transformed by freezing and thawing in Agrobacterium tumefaciens strain LBA4404. Callus transformation mediated by Agrobacterium tumefaciens was performed using Dongjinbyeo, and in order to check whether the CDS (coding sequence) of the OsWRKY5 gene was edited, the DNA of the redifferentiated plant was extracted, amplified by PCR, and then transferred to Macrogen. A sequencing service was requested. The oswrky5-2 mutant produced by the CRISPR/Cas9 system is a mutant in which the function of the OsWRKY5 gene is lost due to a deletion of a 4 bp base from the second exon of the OsWRKY5 gene ( FIG. 1 ).

2. Abiotic stress treatment

2-1. Drought stress treatment and resistance validation

In the same pot in a glass greenhouse, the wild-type, mutant and overexpression plants grown for 3 weeks under long-day conditions (16 hours light condition 30°C/8 h dark condition 25°C) were treated with drought stress by stopping watering for 5 days. Re-irrigation was performed for 8 days after drought stress treatment, and resistance to drought stress was evaluated by analyzing the survival rate, ion leakage rate, MDA amount, water loss rate and yield of rice.

2-2. Osmotic stress treatment and resistance verification

Osmotic stress was treated with 200 mM mannitol for 10 days in wild-type, mutant, and overexpression plants grown for 3 weeks under long-day conditions (16 hours light condition 30°C/8 h dark condition 25°C) in the same pot in a glasshouse. After induction, tap water was irrigated for 10 days, and resistance to osmotic stress was evaluated by measuring the survival rate and length of the above-ground part of rice.

3. Measurement of water loss rate, ion leakage rate and MDA amount

To measure the water loss rate, leaves of wild-type, mutant and overexpression were placed on a 3M filter patter on a laboratory bench (temperature 23±1° C., humidity 30-40%), and weights were measured at 20-minute intervals for 100 minutes. . The water loss rate was calculated by converting the measured weight to the initial weight into a percentile. The ion leakage rate was measured by obtaining the amount of electrolyte leaked from a leaf piece of rice (1 cm ² ). The leaf pieces of each plant were immersed in 6 ml of 0.4 M mannitol at room temperature and reacted with gentle stirring, and the conductivity of each reacted solution was measured using a conductivity meter (CON6 METER, LaMOTTE, USA). The overall conductivity was measured after each sample was treated at 85° C. for 20 minutes.

In the case of plants under abiotic stress, the cell membrane is damaged and the ion leakage rate increases, and lipid peroxidation due to the over-accumulation of ROS can increase the amount of MDA (malondialdehyde). It is considered an important measure of resistance. The ion leakage rate was analyzed by comparing the total conductivity in each sample and the conductivity after treatment as a percentage. To measure the amount of MDA, 100 mg of leaf powder of each plant was reacted with 0.1% trichloroacetic acid (TCA), centrifuged at 15,000 g, 4°C for 10 minutes, and then 0.5% TBA (Thiobarbituric acid) was added to 20% of TCA. One solution was added to the supernatant in such a way that it was quadrupled and reacted at 95°C for 25 minutes. Thereafter, the reaction was terminated by keeping it on ice for 15 minutes, and the absorbance of the reaction solution was measured at 532 nm and 600 nm using a spectrophotometer. The amount of MDA was calculated using an extinction coefficient of 155 mM ^-1 cm ^-1 .

4. Observation of stomatal cells

To measure the state of the stoma, leaf pieces of wild-type, mutant, and overexpression grown for 3 weeks were fixed in a solution of 2.5% glutaraldehyde in 0.1 M phosphate buffer at pH 7.2, followed by distilled water. After washing 3 times, the dehydration process was performed with ethanol (30%, 50%, 70%, 80%, 95%), and then the dehydration process was performed 3 times with 100% ethanol. Afterwards, the sample was finally dried using a critical point dryer (EM CPD300, Leica, Germany). The pore area pictures were taken using a SUPRA 55VP scanning electron microscope by Carl Zeiss. For measurement of stomatal conductivity, using a portable measuring instrument (AP4, Delta-T Devices, UK), drought stress was applied for 24 hours and then measured in automatic mode for about 30 seconds. The density of pores (the number of pores per unit area) was measured at three random points on the leaf using an optical microscope (Olympus BX-50, Japan), and the stomata were made by coating the reverse side of the leaf with an instant adhesive.

5. Reverse Transcription and Quantitative Real-Time PCR

Total RNA was extracted from each plant tissue using the MG total RNA extraction kit (MGmed, Korea) according to the manufacturer's protocol. First-strand cDNA is finally prepared by mixing 2 μg of total RNA, M-MLV reverse transcriptase and oligo(dT)15 primer (promega, USA) to 25 μl of first-strand cDNA. and 75 μl of water was added to the cDNA and diluted for use.

The qPCR reaction was prepared by mixing 2 μl of first-strand cDNA mixture, 10 μl of 2X GoTaq PCR Mix (Roche), 7 μl of nuclease free water, and 1 μl of 10 pM qRT primer set to make a total of 20 μl. , qPCR was performed using a LightCycler 2.0 instrument (Roche Diagnostics). The qPCR procedure was predenatured at 95 °C for 2 min; The process of denaturation 95 ℃ 5 seconds, 59 ℃ 15 sec, extension 72 ℃ 10 sec was performed under the condition of repeating a total of 50 times. OsUBQ5 ( Os01g0328400 ) was used as an internal control, and primer information used for qPCR analysis is shown in Table 1 below.

Primer information used in the present invention Primer name Base sequence (5'→3') (SEQ ID NO:) OsWRKY5
( Os05g04640 ) F: GGTCCAATGATCAGTGATGGA (4) R: AGCCATTGTGCATCGGTAGT (5) OsUBQ5
( Os01g0328400 ) F: ACCACTTCGACCGCCACTACT (6) R: ACGCCTAAGCCTGCTGGTT (7)

Example 1. In a rice plant OsWRKY5 Gene Expression Confirmation

In order to confirm the expression pattern of OsWRKY5 gene, transpiration in leaf blades, sheaths, branches, roots, leaf nodes, stems, nodes, internodes, tillers or ears of wild-type Dongjinbyeo grown for 10 days under natural long-day conditions and wild-type Dongjinbyeo grown for 120 days. was measured.

As a result, it was confirmed that the OsWRKY5 gene was expressed in leaf tissues such as leaf blades, sheaths and branches ( FIG. 2 ). Through this, the OsWRKY5 gene was expected to function mainly in the leaves of rice.

Example 2. For drought stress OsWRKY5 Resistance verification of gene loss-of-function mutants and overexpressions

2-1. Survival rate, ion leakage rate and MDA amount measurement results

Three-week-old wild-type Dongjinbyeo (control group), a mutant with a loss of OsWRKY5 gene function ( oswrky5-2 ), and a transformant with an OsWRKY5 gene overexpression ( oswrky5-D ) were grown in a pot under the same conditions, and then watering was stopped for 5 days to stress drought stress. was treated, and after re-irrigation for 8 days, the resistance to drought stress was evaluated by analyzing the survival rate, ion leakage rate, MDA amount, water loss rate, and productivity of each plant.

First, as a result of measuring the survival rate, it was confirmed that the survival rate of oswrky5-2 was increased compared to the wild type, and the viability of oswrky5-D was decreased compared to the wild type ( FIGS. 3A and 3B ).

In addition, the ion leakage rate and the amount of MDA increased in all plants after 5 days of treatment with drought stress, but it was confirmed that the ion leakage rate and the amount of MDA of oswrky5-2 were relatively low compared to wild-type and oswrky5-D (Fig. 3C and 3D). Through this, it was found that when the function of the OsWRKY5 gene is lost in plants, resistance to drought stress can be conferred.

2-2. Water loss rate measurement result

The growth status of each plant after removing the leaves of two-week-old wild-type Dongjinbyeo (control group), a mutant with a loss of OsWRKY5 gene function ( oswrky5-2 ), and a transformant with an overexpression of OsWRKY5 gene ( oswrky5-D ) The resistance to drought stress was evaluated by observing the and stomata and analyzing the water loss rate.

First, as a result of observing the growth state, oswrky5-D showed a severe leaf curling phenotype, while oswrky5-2 showed less leaf curling after dehydration compared to wild-type and oswrky5-D ( FIG. 4A ). In addition, the water loss rate was the same as the leaf curling phenotype, while the oswrky5-D leaves lost water faster than the wild type, whereas the oswrky5-2 leaves showed a significantly lower water loss rate compared to the wild type and oswrky5-D (Fig. 4B).

In addition, as a result of measuring the morphology of the stomata, the wild-type, oswrky5-2 and oswrky5-D Closed stomata were about 20% among leaf stomata, but after drought stress treatment, closed stomata of oswrky5-2 were about 87%, closed stomata of wild type about 45%, and closed stomata of oswrky5-D about 33.7%. It was confirmed that the ratio of closed pores was significantly higher in oswrky5-2 than in oswrky5-D (Fig. 4C).

In addition, as a result of measuring the stomatal conductivity and stomatal density of the leaves, the stomatal conductivity of oswrky5 -D was significantly lower than that of wild-type and oswrky5-D (Fig. 4D), and similar to that of wild-type, oswrky5-2 and oswrky5-D leaves. It was confirmed that there were pores at the level (Fig. 4E). Through this, it was expected that when the function of the OsWRKY5 gene was lost in plants, the stomata were closed quickly, so that moisture and gas exchange through the stomata could be tolerated, thereby minimizing water loss and improving resistance to drought stress.

2-3. Crop Productivity Measurement Results

Wild-type Dongjinbyeo (control), mutant with loss of OsWRKY5 gene function ( oswrky5-2 ) and transformant with overexpression of OsWRKY5 gene ( oswrky5-D ) were treated in paddy fields for 100 days under natural long-day conditions (>14 hours light condition/day) As a result of observing the growth status of the rice plants after growing them in a plastic box and treating them with two drought stresses, oswrky5-2 had better growth status compared to the wild type (FIG. 5A), whereas oswrky5-D compared to the wild type. It was confirmed that the growth state was not good (FIG. 5B).

In addition, the factors closely related to crop productivity: yield, 500 GW (grain weight), TGW (total grain weight), FR (filling rate), NFG (Number of filled grains), NSP (Number of spikelets) per panicle), NTS (Number of total spikelets), PL (Panicle length), NP (Number of panicles) and CL (Culm length) were measured. In oswrky5-2 , the remaining 7 elements except CL, PL and NSP It was confirmed that all of them increased (Fig. 6A and Table 2), whereas in oswrky5-D , it was confirmed that a total of 10 elements decreased compared to the wild type (Fig. 6B and Table 3).

That is, compared with wild-type Dongjinbyeo, the oswrky5-2 mutant has excellent resistance to drought stress, thereby increasing the total productivity of the crop, whereas the oswrky5-D transformant has increased sensitivity to drought stress and thus the total productivity of the crop. Rather, it was found to decrease. Therefore, it was expected that loss of OsWRKY5 function could increase crop productivity by enhancing resistance to drought stress in the vegetative growth stage of plants.

Example 3. For osmotic stress OsWRKY5 Resistance verification of gene loss-of-function mutants and overexpressions

Three-week-old wild-type Dongjinbyeo (control group), a mutant with a loss of OsWRKY5 gene function ( oswrky5-2 ) and a transformant with an OsWRKY5 gene overexpression ( oswrky5-D ) were grown in a pot under the same conditions and then 200 mM mannitol (mannitol) for 10 days. ), and after 10 days of recovery, the survival rate ( FIG. 7A ) and the length of the above-ground part ( FIG. 7B ) of each rice were measured. As a result, oswrky5-2 was significantly increased compared to the wild type, and oswrky5-D was compared to the wild type. It was confirmed that there was a significant decrease. Through this, it was found that loss of OsWRKY5 gene function in plants by genome/gene editing of OsWRKY5 can increase resistance to osmotic stress.

<110> Seoul National University R&DB Foundation <120> OsWRKY5 gene controlling resistance to abiotic stress in plant and uses it <130> PN21056 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 1509 <212> DNA <213> Oryza sativa <400> 1 atggagatga tggtgcagaa gcaacgacac gaggaggggg aagaggagcg aggaggcttg 60 tgcgcccgcg agatcaagga gctcgacttc ttctccgccg ccggtgccgg tgccggccgg 120 agagacgacg acgacgtcct ccgtgcggat gggatcagca gcagccacgc cggatttatg 180 gtcagcactg cgctggactt gctgacagcg gtcaacgacg gtgatcatca tgaggagaag 240 aaagggcagt caaatattca ccaaagcaag cagatggatg cggcggcgac gacggtggag 300 ggggagctcc ggcaagccgg cgaagagaac cggcggctgc ggcggaggct ggaggagctc 360 accagcagct atggcgccct ctaccaccag ctcgtccagg cgcagcagct gcacaccaag 420 catcagcagc aggctccgat cgccggcgtg cagttgctgg acgcgctcgc ggcggcgtct 480 ccggcgagcc accggcgacg agcggcggcg gcggtggacg gcgatagaac agctgactct 540 gatggtggcg agggcgacga gaacgtgtcg ccttctcttg gtagcaagag gccggcggcg 600 gcagcgacgt taacgcggct gacgccggag agcggcagcg gcggggagaa taatggcggc 660 ggcgagcagg cgccggcggc ggagatggcg ccgtgccgga aggccagggt gtcggtgcga 720 gcacgatccg aggctccaat gatcagtgat ggatgccaat ggaggaagta cgggcagaag 780 atggccaagg gtaacccttg ccctagagcc tactaccgat gcacaatggc ttcgcaatgc 840 cccgtcagaa aacaggtgca acgatgcgcg gaggacaaga gcatcctcat caccacctac 900 gagggcaccc acagccaccc gctgccgccg gccgccgccg ccatggccaa gaccacctcc 960 gccgccgccg ccatgctcct ctccggcccc gccgtcagcc gcgacgcgct gttcgccgcc 1020 caccaccacg tcgtcgcgcc gccgcccttc ttccaccacc cctacgccgg gtccaccatg 1080 gccacgctct ccgcctccgc cccgttcccg accatcacgc tcgacctcac ccagccgccg 1140 ccgacgacga cgaccaccgc cgccgccgcc atgctccagc tccaccgccc ttatgccttc 1200 tcctcattgc cgttctcgat gtacggcgcc ggcggcggct cgcaccggcc gcccgtcgtc 1260 ctgcccccgc cgtcgtcggt ggtggagacg atgaccgccg cgatcaccag ggaccccaac 1320 ttcaccacgg cggtggcggc cgcgctctcc tcgatcatgg cgggaggcgg cgcccaagct 1380 cgaacacctc cacgcggcgg gagtgacgcc gccggagaca tcaacggagg cggcggcgcc 1440 gaccacgcca ctgccggagc acgcgccgcg gcggcggcga cgcagccttg cggcacgtct 1500 cccacctga 1509 <210> 2 <211> 502 <212> PRT <213> Oryza sativa <400> 2 Met Glu Met Met Val Gln Lys Gln Arg His Glu Glu Gly Glu Glu Glu 1 5 10 15 Arg Gly Gly Leu Cys Ala Arg Glu Ile Lys Glu Leu Asp Phe Phe Ser 20 25 30 Ala Ala Gly Ala Gly Ala Gly Arg Arg Asp Asp Asp Asp Val Leu Arg 35 40 45 Ala Asp Gly Ile Ser Ser Ser His Ala Gly Phe Met Val Ser Thr Ala 50 55 60 Leu Asp Leu Leu Thr Ala Val Asn Asp Gly Asp His His Glu Glu Lys 65 70 75 80 Lys Gly Gln Ser Asn Ile His Gln Ser Lys Gln Met Asp Ala Ala Ala 85 90 95 Thr Thr Val Glu Gly Glu Leu Arg Gln Ala Gly Glu Glu Asn Arg Arg 100 105 110 Leu Arg Arg Arg Leu Glu Glu Leu Thr Ser Ser Tyr Gly Ala Leu Tyr 115 120 125 His Gln Leu Val Gln Ala Gln Gln Leu His Thr Lys His Gln Gln Gln 130 135 140 Ala Pro Ile Ala Gly Val Gln Leu Leu Asp Ala Leu Ala Ala Ala Ser 145 150 155 160 Pro Ala Ser His Arg Arg Arg Ala Ala Ala Ala Val Asp Gly Asp Arg 165 170 175 Thr Ala Asp Ser Asp Gly Gly Glu Gly Asp Glu Asn Val Ser Pro Ser 180 185 190 Leu Gly Ser Lys Arg Pro Ala Ala Ala Ala Thr Leu Thr Arg Leu Thr 195 200 205 Pro Glu Ser Gly Ser Gly Gly Glu Asn Asn Gly Gly Gly Glu Gln Ala 210 215 220 Pro Ala Ala Glu Met Ala Pro Cys Arg Lys Ala Arg Val Ser Val Arg 225 230 235 240 Ala Arg Ser Glu Ala Pro Met Ile Ser Asp Gly Cys Gln Trp Arg Lys 245 250 255 Tyr Gly Gln Lys Met Ala Lys Gly Asn Pro Cys Pro Arg Ala Tyr Tyr 260 265 270 Arg Cys Thr Met Ala Ser Gln Cys Pro Val Arg Lys Gln Val Gln Arg 275 280 285 Cys Ala Glu Asp Lys Ser Ile Leu Ile Thr Thr Tyr Glu Gly Thr His 290 295 300 Ser His Pro Leu Pro Pro Ala Ala Ala Ala Met Ala Lys Thr Thr Ser 305 310 315 320 Ala Ala Ala Ala Met Leu Leu Ser Gly Pro Ala Val Ser Arg Asp Ala 325 330 335 Leu Phe Ala Ala His His His Val Val Ala Pro Pro Pro Phe Phe His 340 345 350 His Pro Tyr Ala Gly Ser Thr Met Ala Thr Leu Ser Ala Ser Ala Pro 355 360 365 Phe Pro Thr Ile Thr Leu Asp Leu Thr Gln Pro Pro Thr Thr Thr 370 375 380 Thr Thr Ala Ala Ala Ala Met Leu Gln Leu His Arg Pro Tyr Ala Phe 385 390 395 400 Ser Ser Leu Pro Phe Ser Met Tyr Gly Ala Gly Gly Gly Ser His Arg 405 410 415 Pro Pro Val Val Leu Pro Pro Pro Ser Ser Val Val Glu Thr Met Thr 420 425 430 Ala Ala Ile Thr Arg Asp Pro Asn Phe Thr Thr Ala Val Ala Ala Ala 435 440 445 Leu Ser Ser Ile Met Ala Gly Gly Gly Ala Gln Ala Arg Thr Pro Pro 450 455 460 Arg Gly Gly Ser Asp Ala Ala Gly Asp Ile Asn Gly Gly Gly Gly Ala 465 470 475 480 Asp His Ala Thr Ala Gly Ala Arg Ala Ala Ala Ala Ala Thr Gln Pro 485 490 495 Cys Gly Thr Ser Pro Thr 500 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> OsWRKY5 target sequence <400> 3 cgacgacgac gtcctccgtg 20 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ggctccaatg atcagtgatg ga 22 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 agccattgtg catcggtagt 20 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 accacttcga ccgccactac t 21 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 acgcctaagc ctgctggtt 19

Claims (14)

A method for regulating resistance to abiotic stress in plants, comprising transforming plant cells with a recombinant vector containing a rice-derived OsWRKY5 protein-coding gene to regulate the expression of the OsWRKY5 protein-coding gene. According to claim 1, wherein plant cells are transformed with a recombinant vector containing the rice-derived OsWRKY5 protein-coding gene to inhibit the expression of the OsWRKY5 protein-coding gene in plant cells, thereby resisting abiotic stress compared to non-transgenic plants. A method characterized in that increasing the. The method of claim 1, wherein the rice-derived OsWRKY5 protein-coding gene is knocked out using a gene editing system to increase resistance to abiotic stress. The method of claim 1 , wherein the abiotic stress is drought or osmotic stress. (a) correcting the genome by introducing a guide RNA and an endonuclease protein specific to the target nucleotide sequence of the rice-derived OsWRKY5 protein-coding gene into plant cells; and
(b) re-differentiating the plant from the plant cells in which the genome has been corrected; The method according to claim 5, wherein the target nucleotide sequence of the OsWRKY5 protein-coding gene comprises the nucleotide sequence of SEQ ID NO: 3, wherein the resistance to abiotic stress is increased. According to claim 5, wherein the introduction of the guide RNA and endonuclease protein in step (a) into plant cells comprises a complex of guide RNA and endonuclease protein specific to the target nucleotide sequence of the plant-derived OsWRKY5 gene ( ribonucleoprotein); Or a recombinant vector comprising a nucleic acid sequence encoding an endonuclease protein and DNA encoding a guide RNA specific for the target nucleotide sequence of the OsWRKY5 gene; a genome with increased resistance to abiotic stress, characterized in that it uses A method for producing an orthodontic plant. A genome editing plant with increased resistance to abiotic stress produced by the method of claim 5 . transforming plant cells with a recombinant vector containing a rice-derived OsWRKY5 protein-coding gene; and
Re-differentiation of the transformed plant from the transformed plant cells; A method for producing a transgenic plant with regulated resistance to abiotic stress, comprising a. The method according to claim 9, wherein by inhibiting the expression of the rice-derived OsWRKY5 protein-coding gene, resistance to abiotic stress is increased compared to that of the non-transgenic plant. The method according to claim 9, wherein the abiotic stress is drought or osmotic stress. A transgenic plant with regulated resistance to abiotic stress prepared by the method of any one of claims 9 to 11. The transformed seed of the plant according to claim 12 . A composition for regulating resistance to abiotic stress of plants, comprising a rice-derived OsWRKY5 protein-coding gene as an active ingredient.

Images