KR20190052557A - Method of improving resistance of Bakanae disease - Google Patents

Abstract

The present invention relates to a recombinant vector containing OsNAC58 gene derived from rice. Plants transformed with the vector can enhance resistance to bakanae disease and bacterial leaf blight by overexpressing OsNAC58. Thus, it is possible to provide rice with enhanced resistance to the two plant diseases.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for enhancing resistance to a plant disease,

The present invention relates to a rice-derived OsNAC58 gene and its use for increasing the resistance of the plant to Kidney Disease, and more particularly, to a method for overexpressing OsNAC58 gene by transforming a plant cell with a recombinant vector comprising OsNAC58 gene derived from rice , A method for producing a transgenic plant having enhanced resistance to the bacterium, and a transgenic plant produced thereby.

Rice ( Oryza sativa ), together with barley and corn, is one of the most important crops in the world. The demand for rice is increasing due to population growth, lack of agricultural land due to industrialization, and climate change. However, new varieties are required to be developed to increase production.

On the other hand, blight of rice blight was caused by Xanthomonas oryzae pv. oryzae (Xoo). The onset of the disease occurs in early July, but usually occurs in early July to mid August. Bacterial wintering is possible in underground stalks, roots, or diseased rice straw and rice stubble, which are intermediate host plants. Bacteria spread along the water by monocotyledons and enter into the water holes, air holes and cut roots of rice leaves. Disease occurs mainly in the area of frequent occurrence of the disease every year, but it also occurs in areas not in the area of the pelvic area.

It usually appears before and after the heading, but it is invented at the beginning of the reply in the occurrence of the occurrence of the rush or the occurrence of the rush. The first occurrence of the disease in Korea was first reported in 1930 in Haenam County, Jeollanam-do, and until 1960, it was limited in some parts of the southern part of the country. The cultivation of Gyeongnam cultivar showed a nationwide occurrence. It is considered to be one of the three major diseases of rice, showing not only the onset of leaf in later stage during the cultivation period but also the symptom of gold molding in which the whole body occurs until the post-transplantation cleavage stage.

Rice blight disease is classified as Gram-negative bacteria and is a phytopathogenic bacterium that causes bacterial fake disease of rice. It is widely distributed worldwide and causes great damage to rice. However, since the pathogenic bacterium propagates in the conduit of rice, So far, there is no specific fungicide for this disease.

In addition, Bakanae disease is a disease caused by seed transmission, and therefore occurs in all countries where rice is grown. The degree of occurrence varies depending on the region, variety, cultivation mode, and seed sterilization. It is reported that the effect on the yield was 20% in 1931 and 40 ~ 50% in 1975 in Japan. In Korea, in some farms in the 1960s, there was a case where a new seed was destroyed due to the occurrence of a seed plate. However, thorough seed disinfection has rarely been reported by Kidari disease. The scientific name of the pathogen is Gibberella fujikuroi ( Fusarium moniliforme ). These pathogens can be divided into complete and incomplete generations, which are usually caused by bacteria of incomplete generations (Non-Patent Document 1).

Rice Kidari disease has not been a problem for the development of seed disinfectants which have excellent effects such as prochloraz. However, in recent years, the activation of the common roasted seedlings has resulted in high temperature conditions, And the onset thereof has been rapidly increasing due to the appearance of resistant bacteria to the microorganisms (Non-Patent Document 2).

As with other seed infectious diseases, the most effective control method is to cultivate and harvest using fully seed sterilized seeds. However, currently used seed surface disinfectants are not permeable enough to completely remove pathogens that are hidden deep in seeds. Do. Even if only one seed is infected, it can cause pollution throughout the seedling, and cases of damage and breeding of seedlings are frequent.

Under these circumstances, the inventors of the present invention discovered a gene that simultaneously promotes resistance to blight and bladder disease in plants in order to prevent blight of rice blight and rice pandemic disease, The inventors have completed the present invention by developing a method for improving resistance.

Ministry of Agriculture, Forestry and Fisheries, 1981, Sang et al., 2014. Journal of Agriculture & Life Science, 45 (2): 55-59

It is an object of the present invention to provide a method for enhancing the resistance of a plant transformed with a recombinant vector containing the OsNAC58 gene to a tympanic disease.

The present invention also provides a method for producing a transgenic plant containing a vector comprising OsNAC58 gene, and a transgenic plant.

The inventors of the present invention were studying to produce rice having resistance to blight of white blotchy and Kidari disease, and showed that OsNAC58 gene derived from rice showed resistance to the two plant diseases and resistance to blight of blight and Kidari disease The present invention has been accomplished by confirming that it is possible to produce enhanced rice.

The present invention provides a recombinant vector comprising the OsNAC58 gene consisting of the nucleotide sequence of SEQ ID NO: 1.

In the present invention, the OsNAC58 gene may be a gene derived from rice ( Oryza sativa ), but is not limited thereto. Variants of the above base sequences are also included within the scope of the present invention. Specifically, the OsNAC58 gene has a sequence homology of at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95% with the nucleotide sequence of SEQ ID NO: 1 Base sequence. &Quot;% of sequence homology to polynucleotides " is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

In the present invention, the recombinant vector can be used for the purpose of enhancing resistance to Kidari disease and blight of blight. The vector may include, but is not limited to, a herbicide resistant Bar gene.

In the present invention, the term " recombinant " refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in a natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

In the present invention, the term " vector " is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term " recombinant vector " means a recombinant DNA molecule comprising a desired coding sequence and a suitable nucleic acid sequence necessary for expressing a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

The vector of the present invention can typically be constructed as a vector for cloning or expression. In addition, the vector of the present invention can be constructed as a host cell or eukaryotic cell. For example, when the recombinant vector of the present invention is an expression vector and a prokaryotic cell is used as a host, a strong promoter (for example, pL? Promoter, trp promoter, lac promoter, T7 promoter, tac promoter, etc.) , Ribosome binding sites for initiation of detoxification, and transcription / translation termination sequences.

The vectors that can be used in the present invention include plasmids such as pSC101, ColE1, pBR322, pUC8 / 9, pH79, pGEX series, pET series and pUC19 which are frequently used in the art, ,? -charon,?? z1, and M13) or a virus (e.g., SV40 and the like).

In one embodiment, where the expression vector of the invention utilizes eukaryotic cells as hosts, promoters derived from the genome of mammalian cells (such as the metallothionein promoter) or from mammalian viruses (such as the adenovirus late promoter , The vaccinia virus 7.5K promoter, the SV40 promoter, the cytomegalovirus promoter and the tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

The vector of the present invention may be a selection marker and may include an antibiotic resistance gene commonly used in the art, for example, ampicillin, gentamycin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin, There are resistance genes for tetracycline and vasta herbicide.

In addition, the present invention provides a method for enhancing the resistance of a plant to metastasis by transforming the recombinant vector into a plant cell and overexpressing the OsNAC58 gene.

In the present invention, the method may be a method for increasing the intracellular level of the OsNAC58 protein having the amino acid sequence of SEQ ID NO: 2 to enhance the resistance of the plant to the Kidney Disease.

The intracellular level refers to the amount present in a cell, which can be controlled by various methods known to those skilled in the art. For example, intracellular levels may be regulated through, but not limited to, regulation at the transcription stage or post transcription stage. Modulation in the transcription step can be carried out by a method for promoting the expression of a gene known to a person skilled in the art, for example, by preparing a recombinant vector comprising the OsNAC58 gene of SEQ ID NO: 1 or a homologous gene thereof in the promoter, Or by inserting an expression control sequence for promoting the expression of the gene in the vicinity of the OsNAC58 gene of SEQ ID NO: 1 or a homologous gene thereof. Modulation in the post-transcriptional step may be accomplished by any method known in the art for promoting protein expression, for example, by promoting the stability of the mRNA transcribed from the OsNAC58 gene of SEQ ID NO: 1 or its functional equivalent, A method of enhancing the stability of the protein or a method of promoting the activity of the protein or protein.

In one embodiment, increasing the intracellular level of a protein having the amino acid sequence of SEQ ID NO: 2 or an equivalent thereof in the present invention may be performed by overexpressing the gene encoding the protein. Such overexpression may be performed by methods known to those skilled in the art. For example, a promoter may include a protein having the amino acid sequence of SEQ ID NO: 2 or a gene encoding the same, such as the nucleotide sequence of SEQ ID NO: 1 A recombinant vector operably linked to the gene having the gene can be produced and its expression promoted.

Such protein equivalents may include homologous proteins having homology to a protein having the amino acid sequence of SEQ ID NO: 2.

In the present invention, the term " homologous protein " refers to a protein having 80% or more, preferably 90% or more, more preferably 95% or more, and most preferably 99% or more homology with the amino acid sequence of SEQ ID NO: Refers to a protein that exhibits substantially the same function as the OsNAC58 protein of the present invention.

In the present invention, the term " substantially homogenous function " is meant to relate to resistance to Kidney disease and blight of blight. Such functional equivalents include, for example, amino acid sequence variants in which some of the amino acids of the amino acid sequence of SEQ ID NO: 2 are substituted, deleted or added. Substitution of amino acids is preferably conservative substitution. Examples of conservative substitutions of amino acids present in nature are as follows: (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of the amino acid is preferably located at a site that is not directly involved in the activity of OsNAC58 of the present invention. The functional equivalents also include derivatives of proteins whose basic chemical structure of OsNAC58 and its chemical structure has been modified while maintaining its physiological activity. For example, it may include a fusion protein made by fusion with other proteins such as GFP, while retaining the structural modification and physiological activity to change the stability, storage stability, volatility or solubility of the protein of the present invention.

Also provided is a transgenic plant transformed with the recombinant vector of the present invention.

The plant may have increased resistance to Kidari disease and blight of blight by overexpression of OsNAC58 gene.

In the present invention, when the recombinant vector is transformed into eukaryotic cells, Saccharomyce cerevisiae, insect cells, human cells (e.g., Chinese hamster ovary, W138, BHK, COS-7, 293 , HepG2, 3T3, RIN and MDCK cell lines), plant cells and plants. In one embodiment, the host cell may be a plant.

In the present invention, the recombinant vector may include one or more selectable markers. The marker is typically a nucleic acid sequence having a property that can be selected by a chemical method, and includes all genes capable of distinguishing a transformed cell from a non-transformed cell. Examples include herbicide resistance genes such as glyphosate, glufosinate ammonium or phosphinothricin, kanamycin, G418, Bleomycin, hygromycin, ), Chloramphenicol (chloramphenicol), but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. &Quot; Promoter " refers to a region of DNA upstream from a structural gene, and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A " plant promoter " is a promoter capable of initiating transcription in plant cells. A " constitutive promoter " is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit selectivity.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens ) Octopine gene terminator, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

The expression vector containing the nucleic acid according to the present invention can be introduced into cells using methods known in the art. The cells may be eukaryotic cells such as yeast, plant cells, or prokaryotic cells such as E. coli. Preferably, it may be a bacterium. More preferably, the bacterium is Escherichia coli or an Agrobacterium sp. Microorganism. Known methods for introducing the expression vector according to the present invention into a host cell include, but are not limited to, Agrobacterium-mediated transformation, particle gun bombardment or microparticle bombardment ), Silicon carbide whiskers, sonication, electroporation, and polyethylenglycol-mediated uptake may be used. Agrobacterium-mediated transformation can be preferably used.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373) (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microinjection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202,179-185 (Klein et al., 1987, Nature 327, 70), the infiltration of plants or the transformation of mature pollen or vesicles into Agrobacterium tumefaciens Infection by viruses (non-integrative) in virus-mediated gene transfer (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

The plant according to the present invention is selected from the group consisting of food crops selected from the group consisting of rice, wheat, barley, corn, soybean, potato, wheat, red bean, oats and millet; Vegetable crops selected from the group consisting of Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Ginseng, tobacco, cotton, sesame, sugar cane, beet, perilla, peanut and rapeseed; Apple trees, pears, jujubes, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots and banana; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies and tulips; And feed crops selected from the group consisting of Ryegrass, Red Clover, Orchardgrass, Alpha Alpha, Tall Fescue, and Fereniallaigrus.

In addition, the present invention provides a method for producing a transgenic plant in which the resistance of the plant to Kideri disease and blight of blight is enhanced by introducing the recombinant vector into the plant.

In the present invention, the plant may be rice ( Oryza sativa ), but is not limited thereto.

According to the present invention, a plant transformed with a vector containing the OsNAC58 gene can over-express OsNAC58, thereby enhancing the resistance of the plant to Kidari disease and blight of blight.

Figure 1 shows the nucleotide sequence of the OsNAC58 gene, and the underlined portion indicates the well-conserved region of the analogous amino acid sequence and the NAC family.
Fig. 2 shows the genetic relationship of the OsNAC58 protein with other proteins.
FIG. 3 shows the result of examining the location of the OsNAC58 gene in the cell using the CaMV35S / OsNAC58 :: smGFP fusion protein.
4 is a schematic diagram of a vector for constructing OsNAC58-overexpressed cells.
FIG. 5 shows the expression analysis of a target gene of OsNAC58 overexpressed organism and the result of bioassay for resistance to blight of blight.
FIG. 6 shows the bioassay results of the resistance of the OsNAC58 overexpressant to the Kidney Disease.

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail with reference to the following examples. However, the following examples are intended to illustrate the contents of the present invention, but the scope of the present invention is not limited to the following examples. Embodiments of the present invention are provided to more fully describe the present invention to those skilled in the art.

≪ Example 1 > Characterization of OsNAC58 gene and investigation of genetic relatedness

The present inventors isolated the OsNAC58 gene, which is expressed by disease and stress, in order to select a gene resistant to blight of blight. The primers shown in Table 1 were prepared, and 3 μg of total RNA of O. sativa L. cv., 100 pmol of oligodT and 10 μl of ddH ₂ O were mixed and heated at 70 ° C. for 10 minutes, then cooled on ice, 4 μl of 5 × first strand buffer, 1 μl of 0.1 M DTT and 2 μl of dNTP (10 mM) were added, followed by reaction at 65 ° C for 5 minutes. 1 μl (5 units) of Superscript III was added to the reaction solution, followed by reaction at 50 ° C for 1 hour and inactivation of the enzyme at 70 ° C for 10 minutes. After inactivation, 1 ㎕ of RNaseH was added and reacted at 37 ℃ for 20 min. Then, the first strand of Dongjin - yin cDNA was synthesized by inactivation at 70 ℃ for 10 min. 20 pmol of OsNAC58-forward primer (SEQ ID NO: 3), 20 pmol of OsNAC58-reverse primer (SEQ ID NO: 4), 0.5 mu l of pfu polymerase (Finnzymes), dNTP (10 mM) 1 μl of 10 × PCR buffer 5 and 50 μl of ddH ₂ O were mixed and incubated at 95 ° C. for 2 minutes, at 94 ° C. for 30 seconds, at 50 ° C. for 30 seconds, at 72 ° C. for 1 minute for 35 cycles, PCR was carried out for 10 minutes. After PCR, the PCR product was confirmed by electrophoresis on 1% agarose gel. DNA was extracted using Qiagen Gel extraction kit and cloned into pGEM-Teasy vector (Promega). After cloning, the nucleotide sequence of the target gene, OsNAC58 , was analyzed using T7 primer, SP6 primer and BigDye Terminator 3.1 (ABI). As a result, the OsNAC58 gene (LOC_Os03g39100) was composed of 1,179 bp DNA encoding 392 amino acids. As a result of analysis of the nucleotide sequence using DNAMAN, the molecular weight of the protein was estimated to be 42.1 kDa. As a result of analyzing the protein BLAST of NCBI using the deduced amino acid, the NAM super family region common to the NAC transcription factor family At the N-terminus (Fig. 1).

The amino acid sequence of the deduced OsNAC58 was analyzed using the DNAMAN CLUSTAL -W program Sorghumbicolor NAC transcription factor ( SbNAC , XM_002465283), Brachypodium distachyon NAC transcription factor 29-like ( BdNAC29 , XM_003557950), Hordeum vulgare subsp. vulgare NAC transcription factor 023 ( HvNAC023, FR821745), Zea mays NAC transcription factor ( ZmNAC , NM_001158141) and Glycine max NAC domain-containing protein 29-like ( GmNAC , XM_003518141).

As a result, the genetic mutual relation with soybean NAC domain-containing protein 29-like (GmNAC, XM_003518141) was found to be closest (Fig. 2).

SEQ ID NO:
(SEQ ID NO) Primer name The primer sequence (5 '- > 3') 3 OsNAC58-F ATGGTTCTGTCGAACCCGGCG 4 OsNAC58-R TCAGTTCATCCCCATGTTAGAGTGGAG 5 OsNAC58-attB1 AAAAAGCAGGCTCGATGGTTCTGTCGAACCCGG 6 OsNAC58-attB2 AGAAAGCTGGGTAGTTCATCCCCATGTTAGAGTGGAG 7 attB1 adapter GGGGACAAGTTTGTACAAAAAAGCAGGCT 8 attB2 adapter GGGGACCACTTTGTACAAGAAAGCTGGGT

Example 2: Intracellular localization of OsNAC58

 OsNAC58 :: SmGFP fusion vector was constructed to investigate the intracellular location of OsNAC58 protein, and the p35S-SmGFP and NLS-RFP vector were used as a control. After infection, the cells were infected with the protoplast and analyzed by fluorescence microscope (Leica TCS SP8) (Kim et al., 2007; Zhang et al., 2011).

As a result, it was confirmed that OsNAC58 was located in the nucleus as shown in FIG.

Example 3 Construction of Vector for OsNAC58 Overexpressing Rice Transformants

The present inventors used a gateway system to construct a vector for transfection of a plant that overexpresses the OsNAC58 gene, which is resistant to blight of blight.

Specifically, 1 μl of the OsNAC58 gene isolated in Example 1, 20 pmol of the OsNAC58-attB1 primer (Table 1), 20 pmol of the OsNAC58-attB2 primer (Table 1), 0.5 μl of rTaq polymerase (Takara) mM), 2 μl of 10 × PCR buffer and 20 μl of ddH ₂ O, and the mixture was preheated at 95 ° C. for 2 minutes, at 94 ° C. for 30 seconds, at 50 ° C. for 30 seconds, at 72 ° C. for 1 minute for 30 cycles, Lt; 0 > C for 10 minutes. Then 20 μl of attB1 adapter primer (Table 1), 20 pmol of attB2 adapter primer (Table 1), 0.5 μl of rTaq polymerase, 1 μl of dNTP (10 mM), 5 μl of 10x PCR buffer and 1 μl of ddH ₂ O at 50 ° C, followed by 2 minutes of preheating at 95 ° C, 30 seconds at 94 ° C, 30 seconds at 45 ° C, 1 cycle at 72 ° C for 1 minute, additional 30 seconds at 94 ° C, and 30 seconds at 55 ° C , PCR was carried out at 72 ° C for 1 minute for 20 cycles and at 70 ° C for 10 minutes. The PCR product was cloned into pDONOR201 using BP cloning system using Invitrogen's Gateway cloning system. From the entry clone, a vector was constructed using the LR reaction on the pEarlyGate201 vector containing the 35S promoter and the bar marker.

As a result, the pEarlyGate201 / OsNAC58 vector was constructed (see Earley et al., 2006). A schematic diagram of the vector is shown in Fig.

≪ Example 4 > Molecular Biological Analysis of Rice Transformants and Resistant Biological Assay of Blight Bacterial Blight

The present inventors transfected rice with Agrobacterium-mediated transformation method (Hiei et al. 1994) to produce transformants overexpressing the OsNAC58 gene.

Specifically, the seeds of the peeled rice (variety: Dongjin) were sterilized in 70% EtOH for 1 minute, in 50% Clorox solution in 15 minutes for 15 minutes, and for 3 minutes in sterilized water. The disinfected seeds were exposed to 2N6 medium (Hiei, Y. et al., 1994) (Fig. 4) and incubated for 4 weeks at 28 ° C in a dark state to form embryogenic callus. And cultured for another 4 days. Agrobacterium LBA4404 prepared by introducing the pEarlyGate201 / OsNAC58 vector prepared in Example 2 above into Agrobacterium tumefaciens LBA4404 by electroporation was suspended in AB agar medium (50 mg (50 mg / l of spectinomycin, 10 mg / l of tetracycline) to obtain an OD600 of 1.8 to 2.0 < RTI ID = 0.0 > . The suspension of the callus cultured in the new medium for 4 days and the Agrobacterium LBA4404 species were co-cultured for 10 minutes and then transferred to 2N6-AS medium (Hiei, Y. et al., 1994) Lt; / RTI &gt; for 3 days. After 3 days, the callus was washed several times with sterilized water containing 250 mg / L cell cefotaxime and transferred to 2N6-CP medium supplemented with 250 mg / L cell TAM and 6 mg / L L-phosphinothricin And cultured for 3 weeks in a dark state at 28 캜. After 3 weeks, the unfiltered callus was transferred to fresh 2N6-CP and cultured for another 2 weeks. After two weeks, the surviving calli were resuspended in MSR-CP (1 ml) containing 30 g / l sucrose, 2 mg / l kinetine, 0.5 mg / l NAA, 250 mg / pH 5.8) and cultured at 26 ° C for one month under constant light conditions (FIG. 7). One month later, the cells were transferred to a new MSR-CP and further cultured. The shoots thus formed were transferred to MS0 (pH 5.8) containing 30 g / l sucrose and cultured at 27 to 29 ° C / light to form roots. After 7 days of root formation, they were planted in a pot and cultured in a greenhouse. One week after transfer to the greenhouse, 0.3% of Basta was treated to select survivors. OsNAC58 overexpressed transformants were transferred to the greenhouse and cultured for another 2 weeks. Then, 0.1% of Basta was treated to select one more transformant and cultured for another 4 weeks.

As a result, 16 transformants were obtained and 13 individuals were used for analysis. The leaves and stems of Dongjinbyeon and transgenic rice were harvested, ground using liquid nitrogen, and then total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, Hilden). First strand cDNA was synthesized by RT-PCR using 5 ㎍ total RNA and SuperScript III (200 units / ㎕). Target gene fractions were preheated at 95 ° C for 2 min at 95 ° C for 30 sec at 94 ° C, for 30 sec at 55 ° C, for 1 min at 72 ° C and then for 35 cycles PCR was performed. After PCR, the DNA was extracted from the gel by electrophoresis on 1% agarose gel (Sambrook et al., 1989) and RT-PCR was performed.

As a result (Fig. 5A), OsNAC58 expression was increased in OsNAC58 overexpressing transformants compared to Dongjinbang, which is a control.

In order to confirm resistance of the transformant overexpressing the OsNAC58 gene to blight of blight of white blossom, the inventors of the present invention used Xanthomonas oryzae pv. oryzae ( Xoo ) (KACC10859).

Specifically, Xanthomonas oryzae pv. oryzae ( XOO ) (KACC10859) was cultured in Peptone Sucrose agar medium (PSA) at 28 DEG C for 2 days to an OD600 = 1.0. The Xanthomonas oryzae pv. oryzae ( XOO ) (KACC10859) was diluted with 10 mM MgCl ₂ , and the scissors were immersed in a diluted solution and scissors were inoculated with cuttings of control rice ( O. sativa L. cv. Dongjin) and 12 selected transformants (Karganilla et al ., 1973). The disease progression of the inoculated rice was observed for 14 days and samples were taken and the length of the lesion was measured with a ruler. As a result, it was confirmed that all 13 transgenic plants overexpressing the OsNAC58 gene were more resistant to blight of blight than those of the control group (Fig. 5B and C).

<Example 5> Resistance biosynthetic assay of rice plants transformants

Dongjinbyeong, and Nambyeongbyeon and transformant seeds were sterilized with 50% lactose solution for 30 minutes, rinsed with sterilized water 3 to 5 times, and germinated at 28 ° C for 3 to 5 days. Fusarium 10 μl of fusikuroi CF283 storage cells were inoculated into PDA (Difco), incubated at 28 ° C for 3 days, and then inoculated into germinated seeds at a density of 5.2 x 10 ⁵ spores / ml and O / N at 28 ° C. Then, 10 inoculated seeds were transferred to a magenta box containing MS agar medium and cultured for 3 weeks to observe and give disease index. The results are compared and shown in FIG. 6 according to the following evaluation table. At this time, the rice photograph of FIG. 6 shows the observation of the sample which is normal (0) or dried at the end of the leaf (1).

<Rice Kidney Disease Resistance Evaluation Table>

0: Normal

1: Leaf ends

2: Pale green wrinkles appear throughout the stem

3: Death of plant completely dry

As a result, as shown in FIG. 6, it was confirmed that OsNAC58-overexpressed transformants had similar or increased resistance to the resistant varietal control, Nampeungbyeo and Kidari disease, as compared to the susceptible Dongjinbyeo.

<110> Republic of Korea <120> Method of improving resistance of Bakanae disease <130> P17R12C1233 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 1179 <212> DNA <213> Artificial Sequence <220> <223> OsNAC58 gene sequence <400> 1 atggttctgt cgaacccggc gatgctgccg ccggggttcc ggttccaccc gacggacgag 60 gagctgatcg tgcactacct ccgcaaccgg gccgcctcct cgccgtgccc cgtctccatc 120 atcgccgacg tcgacatcta caagttcgat ccgtgggacc tcccatccaa ggagaattac 180 ggggacaggg agtggtactt cttcagcccg agggaccgca agtacccgaa cgggatccgg 240 ccgaaccgcg ccgcgggctc cggctactgg aaggccaccg gcaccgacaa gcccatccac 300 agcagcggcg gcgcggcgac caacgagagc gtcggcgtca agaaggcgct cgtcttctac 360 aagggccgcc cgcccaaggg caccaagacc aactggatca tgcacgagta ccgcctcgcc 420 gccgcagacg cccacgccgc caacacctac cgccccatga agttccgcaa cacctccatg 480 aggctggatg actgggtgct gtgccggatc tacaagaaga gcagccacgc gtcgccgctg 540 gccgtgccgc cgctctccga ccacgagcag gacgagccgt gcgccctgga ggagaacgcg 600 ccgctgtacg cgccgtcgtc gtcgagcgcc gcatccatga tcttgcaggg cgctgccgcc 660 ggcgccttcc cgtcgctgca cgccgccgcc gccgctacgc agaggacggc gatgcagaag 720 atcccttcca tttccgacct gctcaacgag tactcgctgt cgcagctctt cgacgacggc 780 ggcgccgccg ccgccgcccc cctgcaggag atggcgaggc agcccgacca ccaccaccac 840 caacaacaac aacacgccct ctttggccac cccgtcatga accatttcat cgcgaacaac 900 agcatggttc agctcgcgca cctggacccg tcctcctctg cggccgcctc gacgtcggca 960 ggcgccgtcg tcgagccgcc ggccgtcacc gggaagcgca agagatcatc ggacggaggc 1020 gagccgacga tccaggcgct gcctcctgct gccgcggcgg ccaagaagcc gaacggttca 1080 tgcgttggtg caactttcca aataggcagc gccttgcagg gatcgtcact gggactgagc 1140 caccagatgc tgctccactc taacatgggg atgaactga 1179 <210> 2 <211> 392 <212> PRT <213> Artificial Sequence <220> <223> OsNAC58 protein sequence <400> 2 Met Val Leu Ser Asn Pro Ala Met Leu Pro Pro Gly Phe Arg Phe His   1 5 10 15 Pro Thr Asp Glu Glu Leu Ile Val His Tyr Leu Arg Asn Arg Ala Ala              20 25 30 Ser Ser Pro Cys Pro Val Ser Ile Ile Ala Asp Val Asp Ile Tyr Lys          35 40 45 Phe Asp Pro Trp Asp Leu Pro Ser Lys Glu Asn Tyr Gly Asp Arg Glu      50 55 60 Trp Tyr Phe Ser Pro Arg Asp Arg Lys Tyr Pro Asn Gly Ile Arg  65 70 75 80 Pro Asn Arg Ala Ala Gly Ser Gly Tyr Trp Lys Ala Thr Gly Thr Asp                  85 90 95 Lys Pro Ile His Ser Ser Gly Gly Ala Ala Thr Asn Glu Ser Val Gly             100 105 110 Val Lys Lys Ala Leu Val Phe Tyr Lys Gly Arg Pro Pro Lys Gly Thr         115 120 125 Lys Thr Asn Trp Ile Met His Glu Tyr Arg Leu Ala Ala Ala Asp Ala     130 135 140 His Ala Ala Asn Thr Tyr Arg Pro Met Lys Phe Arg Asn Thr Ser Met 145 150 155 160 Arg Leu Asp Asp Trp Val Leu Cys Arg Ile Tyr Lys Lys Ser Ser His                 165 170 175 Ala Ser Pro Leu Ala Val Pro Pro Leu Ser Asp His Glu Gln Asp Glu             180 185 190 Pro Cys Ala Leu Glu Glu Asn Ala Pro Leu Tyr Ala Pro Ser Ser Ser         195 200 205 Ser Ala Ala Gla Ala Gla Ala Gla Ala Gla Ala Phe Pro     210 215 220 Ser Leu His Ala Ala Ala Ala Thr Gln Arg Thr Ala Met Gln Lys 225 230 235 240 Ile Pro Ser Ile Ser Asp Leu Leu Asn Glu Tyr Ser Leu Ser Gln Leu                 245 250 255 Phe Asp Asp Gly Gly Ala Ala Ala Ala Pro Leu Gln Glu Met Ala             260 265 270 Arg Gln Pro Asp His His His Gln Gln Gln Gln His Ala Leu Phe         275 280 285 Gly His Pro Val Met Asn His Phe Ile Ala Asn Asn Ser Met Val Gln     290 295 300 Leu Ala His Leu Asp Pro Ser Ser Ala Ala Ala Ser Thr Ser Ala 305 310 315 320 Gly Ala Val Val Glu Pro Pro Ala Val Thr Gly Lys Arg Lys Arg Ser                 325 330 335 Ser Asp Gly Gly Glu Pro Thr Ile Gln Ala Leu Pro Pro Ala Ala Ala             340 345 350 Ala Ala Lys Lys Pro Asn Gly Ser Cys Val Gly Ala Thr Phe Gln Ile         355 360 365 Gly Ser Ala Leu Gln Gly Ser Ser Leu Gly Leu Ser His Gln Met Leu     370 375 380 Leu His Ser Asn Met Gly Met Asn 385 390 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> OsNAC58-F <400> 3 atggttctgt cgaacccggc g 21 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> OsNAC58-R <400> 4 tcagttcatc cccatgttag agtggag 27 <210> 5 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> OsNAC58-attB1 <400> 5 aaaaagcagg ctcgatggtt ctgtcgaacc cgg 33 <210> 6 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> OsNAC58-attB2 <400> 6 agaaagctgg gtagttcatc cccatgttag agtggag 37 <210> 7 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> attB1_adaptor <400> 7 ggggacaagt ttgtacaaaa aagcaggct 29 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> attB2_adaptor <400> 8 ggggaccact ttgtacaaga aagctgggt 29

Claims (8)

1. A recombinant vector for promoting resistance to metastasis of a plant comprising OsNAC58 gene comprising the nucleotide sequence of SEQ ID NO: 1. A transformant having enhanced resistance to keypad disease transformed with the recombinant vector of claim 1. 1. A method for promoting resistance to a metastatic disease of a plant comprising transforming a plant cell with a recombinant vector comprising OsNAC58 gene comprising the nucleotide sequence of SEQ ID NO: 1 and overexpressing the OsNAC58 gene. 1. A method for producing a transgenic plant having enhanced resistance to metastasis of a plant comprising the step of transfecting a plant cell with a recombinant vector comprising OsNAC58 gene comprising the nucleotide sequence of SEQ ID NO: 1 and overexpressing the OsNAC58 gene. 4. A transgenic plant having enhanced resistance to a key strain according to the method of claim 4. 6. The method of claim 5,
Wherein the plant is a rice plant. A transformed seed of a plant according to claim 5 or 6. A composition for promoting resistance to a metastatic disease comprising a recombinant vector comprising OsNAC58 gene comprising the nucleotide sequence of SEQ ID NO: 1.

Images