CN114014922B - Protein for regulating and controlling plant salt tolerance, coding gene and application thereof - Google Patents

Abstract

The invention discloses a protein for regulating and controlling plant salt tolerance, and a coding gene and application thereof. The name of the protein is HbSETF, and the amino acid sequence of the protein is SEQ ID No. 1. The invention aims to regulate and control the stress resistance of plants, and particularly aims to improve the salt tolerance of the plants. The present invention obtains overexpression by introducing a gene encoding HbSETF into a recipient plantHbSETFTransgenic lines of transgenic Arabidopsis. Experiments prove that the overexpressionHbSETFThe salt tolerance of the transgenic arabidopsis strain system of the gene is obviously enhanced under the condition of salt stress, which shows thatHbSETFEctopic expression of the gene can enhance the tolerance of the plant to salt stress. According to the inventionHbSETFThe gene can be used for breeding the plant with stress resistance.

Description

Protein for regulating and controlling plant salt tolerance, coding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a protein for regulating and controlling plant salt tolerance, and a coding gene and application thereof.

Background

Soil salinization is a major abiotic stress in agricultural crop production. Salt stress has an important influence on the growth and development of plants. Under the salt treatment, the seed germination, root length, plant height and fruit development of the plant are all obviously inhibited. The harm of salt stress to plants is mainly in the aspects of osmotic stress, ion stress and the like, and the salt stress destroys a plant cell membrane structure, influences the activity of a plurality of enzymes and the function of a photosynthesis organ, causes the reduction of photosynthesis, prevents the growth of crops and causes the great reduction of the global crop yield. Where osmotic stress is the stress that the plant first experiences when exposed to saline soil, it affects the growth of the plant. Ionic toxicity occurs when the salt content reaches a threshold above which plants will be unable to maintain ionic homeostasis and growth. Ionic toxicity and osmotic stress act as primary stresses, which in turn can cause oxidative stress and a range of secondary stresses. Salt tolerant varieties of plants, such as cereal (cereal) plants, are highly desirable in order to reduce the impact of salt stress on crop yield.

Currently, two main technologies for salinized soil are: chemical or physical methods are used for modifying soil, and salt-tolerant crop varieties are cultivated through biotechnology. People try to reform the saline-alkali soil by reasonable irrigation, fresh water washing, chemical modifying agents and other methods, but the method is difficult to popularize due to high cost and slow effect, secondary salinization of the soil is increased, and a large amount of chemical residual substances are added into the soil. Attempts to improve salt tolerance in crops by conventional breeding programs have met with some success, but due to the complexity of salt tolerance in genetics and physiology, the salt tolerance of successfully produced plants remains relatively low. With the improvement of transgenic technology, the utilization of genetic engineering means to obtain drought-resistant and salt-tolerant transgenic plants has become one of the hot spots in the current field of plant biotechnology, and the breeding of plants with strong saline-alkali resistance and drought tolerance and the improvement of the drought and salt tolerance of the plants are an economic and effective way to solve the problems of drought and salt tolerance. Therefore, the salt tolerance of the plant is improved, important salt-tolerant genetic resources are excavated, the salt-tolerant plant breeding method plays a key role in breeding salt-tolerant crop varieties, and the salt-tolerant mechanism of the plant is the theoretical basis for breeding transgenic resistant varieties.

Disclosure of Invention

The technical problem to be solved by the invention is how to regulate the stress resistance of the plant and/or how to improve the salt tolerance of the plant. The technical problem to be solved is not limited to the technical subject as described, and other technical subject not mentioned herein may be clearly understood by those skilled in the art through the following description.

In order to solve the technical problems, the invention firstly provides a protein, which is named as HbSETF, and the protein can be any one of the following proteins:

A1) a protein having an amino acid sequence of SEQ ID No. 1;

A2) a protein which is obtained by substituting and/or deleting and/or adding amino acid residues to the amino acid sequence shown in SEQ ID No.1, has more than 80% of identity with the protein shown in A1), and has the same function;

A3) a fusion protein with the same function obtained by connecting labels at the N end and/or the C end of A1) or A2).

In order to facilitate the purification or detection of the protein in A1), a tag protein may be attached to the amino terminus or the carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No.1 of the sequence Listing.

Such tag proteins include, but are not limited to: GST (glutathione mercaptotransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

The nucleotide sequence of the present invention which codes for the protein HbSETF can easily be mutated by the person skilled in the art by known methods, for example directed evolution or point mutation. Those nucleotides which are artificially modified and have 75% or more than 75% identity to the nucleotide sequence of the isolated protein HbSETF of the present invention are derived from the nucleotide sequence of the present invention and are identical to the sequence of the present invention as long as they encode the protein HbSETF and have the function of the protein HbSETF.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

Herein, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of the amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web pages of the NCBI home website. For example, in the advanced BLAST2.1, by using blastp as a program, setting the value of Expect to 10, setting all filters to OFF, using BLOSUM62 as a Matrix, setting Gap existence cost, Per residual Gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a calculation by searching for the identity of a pair of amino acid sequences, a value (%) of identity can be obtained.

Herein, the 80% or greater identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.

Further, the protein may be derived from wild barley (A)Hordeum brevisubulatum）。

The present invention also provides a biomaterial, which may be any one of the following B1) to B7):

B1) a nucleic acid molecule encoding said protein HbSETF;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector;

B5) a transgenic plant cell line comprising B1) the nucleic acid molecule or a transgenic plant cell line comprising B2) the expression cassette;

B6) transgenic plant tissue comprising the nucleic acid molecule of B1) or transgenic plant tissue comprising the expression cassette of B2);

B7) a transgenic plant organ containing B1) the nucleic acid molecule or a transgenic plant organ containing B2) the expression cassette.

In the above biological material, B1) the nucleic acid molecule may be any one of:

C1) the coding sequence (CDS) is a cDNA molecule at position 101-1129 of SEQ ID No. 2;

C2) the nucleotide sequence is the DNA molecule of SEQ ID No. 2.

The nucleotide sequence shown in the 101-1129 th site of SEQ ID NO.2 is a protein HbSETF coding gene (HbSETFGene). The protein HbSETF gene (b) of the present inventionHbSETFGene) can be any nucleotide sequence capable of encoding the protein HbSETF. In view of the degeneracy of the codons and the preference of codons for different species, one skilled in the art can use codons suitable for the expression of a particular species as needed.

B1) The nucleic acid molecule also comprises a nucleic acid molecule obtained by codon preference modification on the basis of the nucleotide sequence shown in the 101-position 1129 of SEQ ID No. 2.

DNA molecule shown in position 101-1129 of SEQ ID NO.2 (HbSETFGene) encodes the protein HbSETF whose amino acid sequence is SEQ ID No. 1.

The nucleic acid molecules described herein may be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be an RNA, such as a gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

Herein, the substance that regulates the activity or content of the protein may be a substance that regulates the expression of a gene encoding the protein HbSETF.

As above, the substance that regulates gene expression may be a substance that performs at least one of the following 6 controls: 1) regulation at the level of transcription of said gene; 2) regulation after transcription of the gene (i.e., regulation of splicing or processing of a primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of nuclear to cytoplasmic transport of mRNA of the gene); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (i.e., regulation of the activity of a protein translated from the gene).

The substance for regulating gene expression may be specifically any one of the biomaterials B1) -B3).

Vectors described herein are well known to those skilled in the art and include, but are not limited to: plasmids, phages (e.g., lambda phage or M13 filamentous phage, etc.), cosmids (i.e., cosmids), Ti plasmids, viral vectors, and the like. In one embodiment of the invention, the vector may specifically be pCAMBIA 1300.

In order to facilitate the identification and screening of the transgenic plant cells or plants, the plant expression vectors used may be processed, for example, by adding genes encoding enzymes or luminescent compounds which produce a color change (GUS gene, luciferase gene, etc.), antibiotic markers having resistance (gentamicin marker, kanamycin marker, etc.), or chemical-resistant agent marker genes (e.g., herbicide-resistant gene), etc., which are expressed in plants. From the safety of transgenic plants, the transgenic plants can be directly screened and transformed in a stress environment without adding any selective marker gene.

The vector provided by the invention can be used for guiding the expression of the exogenous gene in the plantHbSETFThe gene or the gene segment is introduced into plant cells or receptor plants, and a transgenic cell line and a transgenic plant with improved resistance to adversity stress can be obtained. Carry aboutHbSETFExpression vectors for genes can be used to transform plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant viral vector, direct DNA transformation, microinjection, conductance, Agrobacterium mediation, etc., and to grow the transformed plant tissues into plants.

The microorganism described herein may be a yeast, bacterium, algae or fungus. Among them, the bacteria may be derived from Escherichia (Escherichia), Erwinia (Erwinia), Agrobacterium (Agrobacterium), Flavobacterium (Flavobacterium), Alcaligenes (Alcaligenes), Pseudomonas (Pseudomonas), Bacillus (Bacillus), etc. Specifically, Agrobacterium tumefaciens GV 3101.

The recombinant vector can be pCAMBIA1300-HbSETF, wherein the fragment (small fragment) between EcoRI recognition sites and SalI recognition sites of the pCAMBIA1300 vector is replaced by a DNA fragment with the nucleotide sequence of the 101-th-1129 th site of SEQ ID No.2 in the sequence table, and other sequences of the pCAMBIA1300 vector are kept unchanged to obtain the recombinant expression vector.

The recombinant microorganism can be specifically recombinant Agrobacterium tumefaciens GV3101/pCAMBIA1300-HbSETF, and the recombinant Agrobacterium tumefaciens GV3101/pCAMBIA1300-HbSETF contains a nucleotide sequence shown by the 101-1129 th site of SEQ ID No.2HbSETFA gene.

The invention also provides a method for cultivating stress-resistant plants, which comprises the step of improving the content and/or activity of the protein HbSETF in target plants to obtain the stress-resistant plants with stress resistance higher than that of the target plants.

In the above method, the increase in the content and/or activity of the protein HbSETF in the target plant is achieved by increasing the expression level of a gene encoding the protein HbSETF in the target plant.

In the above method, the improvement of the expression level of the gene encoding the protein HbSETF in the target plant is achieved by introducing the gene encoding the protein HbSETF into the target plant.

Specifically, the improvement of the expression level of the gene encoding the protein in the target plant can be achieved by introducing the DNA molecule shown in position 101-1129 of SEQ ID No.2 into the target plant.

In one embodiment of the invention, the method for cultivating stress-resistant plants comprises the following steps:

(1) constructing a recombinant vector containing the DNA molecule shown in the 101-1129 site of the SEQ ID No. 2;

(2) transferring the recombinant vector constructed in the step (1) into a target plant (such as a crop or arabidopsis thaliana);

(3) screening and identifying to obtain stress-resistant plants with stress resistance higher than that of the target plants.

The invention also provides any one of the following uses of the protein HbSETF, and/or the biological material:

D1) the protein HbSETF, and/or the use of the biological material for regulating the stress resistance of a plant;

D2) the protein HbSETF and/or the application of the biological material in preparing a product for regulating and controlling the stress resistance of plants;

D3) the protein HbSETF, and/or the application of the biological material in cultivating stress-resistant plants;

D4) the protein HbSETF and/or the application of the biological material in preparing products for cultivating stress-resistant plants;

D5) the protein HbSETF, and/or the use of the biological material in plant breeding.

In the above applications, the stress resistance includes salt resistance, drought resistance, heat resistance, cold resistance and/or strong light resistance.

The invention also provides a method for cultivating stress-resistant plants, and/or application of the structural domain of the protein HbSETF in creating stress-resistant plants and/or plant breeding, wherein the amino acid sequence of the structural domain of the protein HbSETF is the polypeptide at the 154-th and 214-th positions of SEQ ID No. 1.

The plant breeding can be crop stress-resistant transgenic breeding, and particularly can be crop salt tolerance transgenic breeding.

The regulation and control of the plant stress resistance can be the improvement of the plant stress resistance or the reduction of the plant stress resistance, and specifically can be the improvement of the plant salt tolerance or the reduction of the plant salt tolerance.

The stress resistance described herein includes, but is not limited to, salt tolerance, drought tolerance, heat tolerance, cold tolerance, and/or sunlight tolerance.

In particular, the stress resistance may be specifically salt resistance.

In the context of the present invention, the stress-tolerant plants are understood to comprise not only the plants mentionedHbSETFThe first generation transgenic plants obtained by genetically transforming a plant of interest also include progeny thereof. The gene may be propagated in the species, or transferred into other varieties of the same species, including particularly commercial varieties, using conventional breeding techniques. The stress-resistant plant comprises seeds, callus, complete plants and cells.

The stress tolerant plants include, but are not limited to, salt tolerant plants, drought tolerant plants, heat tolerant plants, cold tolerant plants, and/or light tolerant plants.

Herein, the plant may be a monocotyledon or a dicotyledon. For example, it may be a crucifer or a gramineae.

Herein, the plant may be a crop (e.g., a crop).

Herein, the terms "protein HbSETF", "transcription factor HbSETF" and "HbSETF" have the same meaning and are used interchangeably.

The identification and functional identification of the ethylene signal pathway are of great significance for understanding the adaptation of halophytes to natural saline and alkaline environments. The present invention utilizes wild barley (A), (B), (C)Hordeum brevisubulatum) CBL interacting protein kinasesHbCIPK2Gene promoter (proHbCIPK2) For bait screening of yeast single hybrid libraries, a salt-, drought-and ABA-induced ethylene-responsive Transcription Factor (Stress-responsive ERF-like Transcription Factor) was successfully identified and named HbSETF.

The transcription factor HbSETF full-length gene has an Open Reading Frame (ORF) of 1029 bp, encodes protein HbSETF with 342 amino acids, the amino acid sequence of the protein HbSETF is SEQ ID No.1, and the coding sequence (CDS) is the 101-th-1129 bit of SEQ ID No. 2. The molecular weight of the protein HbSETF is 36.5 kDa, and the isoelectric point is 4.7. The protein HbSETF contains a single AP2 domain consisting of 61 amino acids (amino acid sequence 154-214 of SEQ ID No. 1) which contains conserved alanine (A) and aspartic acid (D), indicating that it is a member of the ERF family. The AP2 domain contains conserved YRG and RAYD elements that may play key roles in DNA binding and protein interactions, respectively. In addition, the C-terminal region of the protein HbSETF contains a conserved LSPLSPHPP motif, which is a mitogen-activated protein kinase (MAPK) phosphorylation site. The PCR results showedHbSETFThe DNA of the gene has no intron. Phylogenetic tree analysis showed that HbSETF protein was highly similar to HvERF5 (genbank No. ANA 52685), AtERF5 (AT 5G 47230), ZmERF5 (genbank No. PWZ 220596.1) and OsERF5 (genbank No. XP 015624058), respectively. The result of searching the SWISS-MODEL database (https:// swissmodel. expasy.org /) showed that AP of HbSETF proteinThe 3D structure of the 2-domain has a long C-terminal alpha-helix (alpha) enclosed in three antiparallel beta-sheets (. beta.1-. beta.3), which sequence recognizes the core cis-acting element GCC-box of the target DNA.

Subcellular localization analysis showed that HbSETF was localized within the nucleus. Yeast single-hybridization analysis and gel migration experiments show that HbSETF can be directly connected withHbCIPK2The gene promoter (proCIPK 2). Dual luciferase assay demonstrated that HbSETF is capable of transactivationHbCIPK2A gene promoter. Experiments show that the transcription factor HbSETF can be identifiedHbCIPK2The GCC box of the gene promoter interacts with the gene promoter, indicating that the transcription factor HbSETF may be involved in the pairHbCIPK2Regulation of genes, onHbCIPK2The gene promoter has a transcriptional activation effect.

AndHbCIPK2the transcription factor HbSETF specifically combined with the gene promoter is an AP2/ERF transcription factor with stress response,HbSETFthe gene has response to salt, drought and ABA abiotic stress treatment in different degrees, and plays an important role in regulating and controlling wild barley to respond to different environmental stresses.

The invention is obtained by the future source of wild barley (A)Hordeum brevisubulatum) Is/are as followsHbSETFThe coding gene is introduced into wild arabidopsis (WT, Col) of a receptor plant to obtain a transgenic arabidopsis plant, and experiments prove that the coding gene is over-expressed compared with the wild arabidopsis (WT, Col) without transgenic receptor controlHbSETFCompared with wild arabidopsis thaliana (WT, Col) under the condition of salt stress, transgenic arabidopsis thaliana strains (L6, L7 and L13) of the genes have longer roots and larger leaves, the fresh weight and the root growth rate are obviously higher than that of the WT, and seedling growth experiments also show that the transgenic arabidopsis thaliana strains have longer roots and larger leaves, and the transgenic arabidopsis thaliana strains have higher fresh weight and root growth rate than that of the WT, so that the seedling growth experiments also show thatHbSIF1The gene strain seedling shows a better growth state than a wild plant under the condition of salt stress, and the chlorophyll content is obviously higher than that of the wild plant, which shows that the salt tolerance of the transgenic plant is obviously enhanced.

Further experiments show thatHbSETFTransgenic Arabidopsis with ectopic expression (overexpression) of gene enhances the tolerance of plants to salt stress, and downstream gene expression in transgenic plants is analyzedHbSETF now significantly enhances the level of transcription of stress-responsive genes, e.g.AtCIPK24、AtRD29BAndAtP5CSand the like. Indicating that HbSETF is enhancedHbCIPK2Expression of the gene plays a role in plant salt tolerance.

In summary, the inventionHbSETFThe gene can be used for breeding the plant with stress resistance.

Drawings

FIG. 1 is a schematic view ofHbCIPK2And (3) screening a cDNA library with a bait gene promoter. Wherein a in FIG. 1 isHbCIPK2Gene promoter (proHbCIPK2) A schematic structural diagram; FIG. 1, b is a yeast single hybrid screening library; FIG. 1 c is a schematic structural diagram of HbSETF protein; in FIG. 1 d isHbSEFTGenes andHbCIPK2the gene promoters were verified in yeast one-to-one.

FIG. 2 is a structural diagram of the ERF subfamily of the transcription factor HbSETF belonging to the AP2/ERF family. Wherein a in FIG. 2 is a three-dimensional structural diagram of the HbSETF AP2 domain; FIG. 2b shows HbSETF evolutionary tree analysis; in FIG. 2 c is the amino acid sequence alignment of HbSETF with other species ERF subfamily transcription factors.

FIG. 3 shows the expression pattern, subcellular and tissue localization of the transcription factor HbSETF. Wherein a in FIG. 3 isHbSETFThe expression mode of the gene under various adversity stress conditions; b in FIG. 3 is the subcellular localization of HbSETF protein; in FIG. 3, c-g are transitionsproHbSETF::GUSDifferent histochemical staining of Arabidopsis thaliana.

FIG. 4 shows transcriptional activation of transcription factor HbSETFHbCIPK2A gene promoter. Wherein a in FIG. 4 is the transcription factor HbSETF andHbCIPK2GCC Box interaction of gene promoters; FIG. 4 b and FIG. 4 c show that the EMSA experiment analyzes that the transcription factor HbSETF can bindHbCIPK2GCC Box for gene promoter; in FIG. 4 d is a LUC in vivo imaging analysis chart; in FIG. 4, e and f are graphs showing the results of the dual-luciferase experiment.

FIG. 5 shows wild type andHbSETFand (3) performing phenotype, physiology and biochemistry analysis on the gene overexpression Arabidopsis plants under normal and salt stress. Wherein A in FIG. 5 is wild type andHbSETFphenotype of arabidopsis plant seedlings under salt stress during gene overexpression; in FIG. 5, B and C are the measurement of root length and fresh weight, respectively; in FIG. 5D is wild type andHbSETFphenotype under salt stress when the gene over-expresses arabidopsis plants to grow seedlings; in FIG. 5, E represents the chlorophyll content measurement. In FIG. 5F is Na⁺Measuring the content; in FIG. 5, G is K⁺And (4) measuring the content. ". indicates p compared to wild type<0.01, ". indicates p compared to wild type<0.001. MS means treatment of culturing with an MS plate containing no NaCl, 100 mM means treatment of culturing with an MS plate containing 100 mM NaCl, 125 mM means treatment of culturing with an MS plate containing 125 mM NaCl, Control means treatment of irrigating roots with a NaCl solution, and NaCl means treatment of irrigating roots with a 300 mM NaCl solution.

FIG. 6 shows wild type and wild type under normal and salt stressHbSETFRelative expression of the stress response gene in the gene overexpression arabidopsis plants. MS means treatment of culturing with an MS plate containing no NaCl, and 100 mM means treatment of culturing with an MS plate containing 100 mM NaCl. A, B, C, D, E and F in FIG. 6 are wild type and under normal and salt stress, respectivelyHbSETFStress response gene ADH (in gene overexpression Arabidopsis thaliana plants) ((AtADH）、CIPK24（AtCIPK24）、KIN2（AtKIN2）、COR47（AtCOR47）、RD29B（AtRD29B) And P5CS (AtP5CS) Relative expression amount of (3).

Detailed Description

The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.

The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples were processed using Excel statistical software and the results were expressed as mean ± standard deviation, with Student's t-test, P < 0.05 (x) for significant differences, P < 0.01 (x) for very significant differences, and P < 0.001 (x) for very significant differences. The quantitative tests in the following examples, unless otherwise specified, were set up in triplicate and the results averaged.

The wild type Arabidopsis thaliana (WT, Col) in the examples described below was Columbia ecotype Arabidopsis thaliana (Col-0), Arabidopsis Biological Resource Center (ABRC).

Example 1 screening and identification of transcription factor HbSETF

1. Cultivation of wild barley Material

The wild barley seeds are subjected to water culture at 25 ℃ and room temperature for about 21 days to serve as experimental materials. During the wild barley culture process: the illumination time is 16 h/8 h, the illumination intensity is 6000 lx, and the relative humidity is 60%. After 21 days, treating by 350 mM NaCl, 350 mM Mannitol (Mannitol), 10% PEG6000 and 20 mu M ABA for 0 h, 0.5 h, 1h, 2 h, 3 h, 6 h and 12 h respectively to obtain wild barley seedlings with different treatment times, washing the wild barley seedlings with distilled water, then sucking water by clean filter paper, collecting overground and underground tissues respectively, quickly freezing for 1 min by liquid nitrogen, and storing at-80 ℃.

2. Screening of transcription factor specifically bound with HbCIPK2 promoter by using yeast single-hybrid technology

2.1 construction of Yeast Single hybrid libraries

And (2) storing the tissue sample subjected to salt treatment in the step (1) in liquid nitrogen, extracting the barley mally total RNA by adopting a Trizol Reagent method, carrying out gel electrophoresis analysis to prove that the RNA is not degraded and has good quality, and carrying out reverse transcription on the total RNA into cDNA by utilizing a Takara reverse transcription kit to construct a barley mally cDNA library. Using SMART from Clontech^TM The cDNA library construction kit constructs a cDNA library, and the cDNA is purified by a Chroma SPIN-400 purification column and then connected with a carrier to obtain cDNA library plasmid.

2.2 construction of bait vectors and bait strains

Wild barley protein kinase coding geneHbCIPK2The promoter of (a) is a stress-inducible promoter, i.e., a promoter ofGranted patents have been obtained in the laboratory (a plant inducible promoter and its applications, patent No. 201610009572.5, publication No. CN 105505932B). To be provided withHbCIPK2Full-length promoter of gene (nameproHbCIPK2Nucleotide sequence is SEQ ID No. 4) as bait, and upstream transcription factor is screened by using yeast single hybridization technology. Firstly, through an enzyme digestion connection method, theproHbCIPK2(SEQ ID No. 4) was ligated to decoy vector pAbAi (purchased from Clontech Catalog number 630491) to obtain a recombinant vectorproHbCIPK2pAbAi (plasmid obtained by cleaving pAbAi with KpnI and XhoI and ligating the cleaved plasmidHbCIPK2The promoter of (4) is obtained. ). Separately digesting the recombinant vectors using Bbs I enzymeproHbCIPK2pAbAi and a positive control plasmid p53-AbAi (purchased from Clontech Catalog number 630491), the linearized plasmid was transformed into the yeast strain Y1HGold (purchased from Clontech Catalog number 630491), spread on SD/-Ura solid medium, cultured at 28 ℃ for 3 days, and well-grown monoclones were selected, and PCR identification was performed by adding Matchmaker Insert PCR Mix 1, confirming that the linearized recombinant vector wasproHbCIPK2pAbAi has been integrated into the yeast Y1HGold genome, thereby obtaining a bait yeast. From the SD/-Ura medium, Y1HGold having good growth was selectedproHbCIPK2-pAbAi](transformed bait vectorproHbCIPK2Recombinant bacterium of pAbAi) and Y1HGold [ p53-AbAi](recombinant bacteria transformed with the control plasmid p 53-AbAi) colonies were shaken and diluted to an OD600 of 0.002, 100 ul each on SD/-Ura medium with concentrations of 0, 100, 200, 400 ng/ml of antibiotic Aureobasidin A (AbA for short) (purchased from Clontech Catalog number 630491), and the appropriate concentration of AbA inhibitory autoictivation (200 ng/ml) was screened for subsequent yeast one-hybrid library screening.

2.3 Yeast Single hybrid library screening

The yeast strain Y1HGold [, [ solution of ] isproHbCIPK2-pAbAi]Made competent, the cDNA library plasmid prepared in step 2.1 was transferred into the bait yeast Y1HGold 2 using the PEG/LiAC transformation methodproHbCIPK2-pAbAi]A competent cell. Primary screening was performed on SD/-Leu medium containing 200 ng/ml AbA, adding the Matchmaker Insert Check PCR Mix 2 (purchased from Clontech Catalog number 63)0497) And performing PCR amplification, sending the product with the band more than 500 bp to sequence, performing Blast comparison analysis on the sequencing result at NCBI, and screening the transcription factor HbSETF specifically combined with the promoter HbCIPK 2.

Transcription factor HbSETF gene (HbSETFGene) is SEQ ID No.2, the 101-position 1129-position of the SEQ ID No.2 is a coding sequence (CDS), and the coding amino acid sequence is the protein HbSETF of SEQ ID No. 1.

3. HbSETF subcellular localization analysis

According toHbSETFDesigning primer without terminator for CDS sequence of gene, PCR amplificationHbSETFAfter the gene was inserted into pCAMBIA1307 vector (CAMBIA Co.) to construct pCAMBIA1307-HbSETF-GFP plasmid (subcellular localization vector), and pCAMBIA1307-AtCBF1-RFP plasmid (CAMBIA Co.) was used as a control. The pCAMBIA1307-HbSETF-GFP and pCAMBIA1307-AtCBF1-RFP were transformed into onion epidermal cells by Agrobacterium tumefaciens transformation, and cultured in dark at 28 ℃ for 72 h. Selecting the transformed onion epidermis to be made into a mounting piece, dyeing by DAPI, observing the expression part of the gene under an Olympus fluorescence microscope, photographing, recording and storing.

4. LUC in vivo imaging and dual luciferase transient assays

Will be provided withHbCIPK2The gene promoter (ATG upstream 1750 bp sequence, named:proHbCIPK2nucleotide sequence is SEQ ID No. 4) is introduced into LUC gene expression vector (name pCAMBIA1300, CAMBIA company) to obtain recombinant vector pCAMBIA1300-proHbCIPK2-LUC. Amplification ofHbSETFThe coding region of the gene (position 1129 along the 101-th-channel of SEQ ID No. 2) is inserted into the pCAMBIA1307 vector to obtain the recombinant vector pCAMBIA 1307-HbSETF. pCAMBIA1300-proHbCIPK2LUC and pCAMBIA1307-HbSETF Agrobacterium strain GV3101, injected into tobacco leaves. On the third day after infection, the back of the leaf was evenly smeared with 300. mu.l of D-fluorescein (Promega) at a final concentration of 1 mM and left in the dark for 2 minutes. The treated leaves were scanned and photographed using a biosome imager (Night shadow LV 985, Berthold, GER), and the promoter activity was compared according to the fluorescence intensity.

Will be provided withHbCIPK2The gene promoter (SEQ ID No. 4) is inserted into the upstream of pGreenII 0800-LUC vector (Beijing Huayue Biometrics) as a reporter gene expression vectorHbSETFThe coding region of the gene (position 1129 along the 101-th channel of SEQ ID No. 2) was recombined onto pGreenII 62-SK vector (Beijing Huayuyang bio-corporation) as an effector gene expression vector. The negative control was the empty vector pGreenII 62-SK (Beijing Huayu Biotech). The vector is used for transforming agrobacterium GV3101, the mixing ratio of agrobacterium culture solution for transforming effector gene and reporter gene is 8:1, the symmetrical positions of the left end and the right end of tobacco leaf are injected respectively, the range of the injected bacterial solution is marked by a marker pen, the injection position is cut off after three days, the leaf is broken by a proof press, cell lysate is added, the activity of luciferase is measured by using a kit, and the activity of a promoter is analyzed according to the ratio of LUC to RLU.

5. Results and analysis

5.1 screening and identification of the transcription factor HbSETF by Yeast Single hybridization

Early experiments showed that overexpressionHbCIPK2The gene can improve the salt tolerance of plants. WhileHbCIPK2Promoters of genes are induced by various stresses. Therefore, further studies were made on what genes are under regulationHbCIPK2Expression of the gene. Analysis and prediction Using PlantCARE (http:// bioinformatics. psb. content. be/western/plantare/html /)HbCIPK2Cis-acting elements of the promoter. It was found to have transcription factor binding elements such as MYB, W-Box and DRE (a in FIG. 1), presumablyHbCIPK2The expression of a gene may be regulated by stress-related transcription factors. Thus, there is a need to identify compounds that are capable of directly modulatingHbCIPK2Transcription factors of genes. Will be provided withHbCIPK2The gene promoter (SEQ ID No.4, 1750 bp) is used as a bait, a plant cDNA library (b in figure 1) which is treated by salt stress is screened, and a transcription factor HbSETF is screened. Will containHbSETFPrey plasmid containing gene and plasmid containing geneHbCIPK2The decoy plasmid of the promoter co-transformed yeast competent cells, transformed yeast can grow on SD/-Leu-Ura medium containing AbA (d in FIG. 1), HbSETF protein structure as shown in FIG. 1 c.

5.2、HbSETFOf genesSequence analysis

Amplifying from wild barley cDNA by RT-PCR technologyHbSETFThe full-length sequence of the gene.HbSETFThe gene has an Open Reading Frame (ORF) of 1029 bp, encodes a protein HbSETF of 342 amino acids, has a molecular weight of 36.5 kDa and an isoelectric point of 4.7. The HbSETF protein contains a single AP2 domain consisting of 61 amino acids (fig. 2) with conserved alanine (a) and aspartic acid (D), indicating that it is a member of the ERF family (fig. 2). The AP2 domain contains conserved YRG and RAYD elements that may play key roles in DNA binding and protein interactions, respectively (fig. 2). In addition, the C-terminal region of the HbSETF protein contains a conserved LSPLSPHPP motif, which is a mitogen-activated protein kinase (MAPK) phosphorylation site (C in FIG. 2). The PCR results showedHbSETFThe DNA of the gene has no intron. Phylogenetic tree analysis showed that HbSETF protein was highly similar to HvERF5 (genbank No. ANA 52685), AtERF5 (AT 5G 47230), ZmERF5 (genbank No. PWZ 220596.1) and OsERF5 (genbank No. XP 015624058), respectively (b in fig. 2). The results of searching the SWISS-MODEL database (https:// swissmodel. expasy. org /) show that the 3D structure of the AP2 domain of the HbSETF protein has a long C-terminal alpha-helix (alpha) wrapped in a three antiparallel beta-sheet (. beta.1-. beta.3) that identifies the core cis-acting element GCC-box of the target DNA (FIG. 2 a).

5.3 identification of HbSETF protein as stress-responsive AP2/ERF transcription factor

To determineHbSETFGenes involved in different stress responses, analysisHbSETFExpression of genes in the stem and root under salt (350 mM NaCl), drought (10% PEG6000 and 350 mM mannitol) and ABA stress (20. mu.M). 0.5 h after treatment under 350 mM NaCl stress, in the rootHbSETFThe expression level of the gene begins to be up-regulated, then the gene is remarkably accumulated for 2-12 h, and the expression condition in the stem is similar to the expression condition (a in figure 3). To simulate drought stress, seedlings were treated with 10% PEG 6000. In the root systemHbSETFThe gene was slightly responsive to PEG 6000. In the stemHbSETFThe gene begins to rise at 0.5 h and continues to be high for 3-12 hAnd (4) expressing. For Mannitol (Mannitol) treatment, in roots and stemsHbSETFThe gene was clearly induced to express at 2 h (a in FIG. 3). After 20 μm ABA treatment, in roots and stemsHbSETFThe expression level of (2) reached a maximum at 2 h of treatment, and then decreased slowly. In view of the above, it is desirable to provide,HbSETFthe genes respond to salt, drought and ABA abiotic stress treatment to different degrees. It is presumed that by this means,HbSETFthe gene may play an important role in regulating and controlling wild barley under different environmental stresses.

To analyze the subcellular localization of HbSETF proteinHbSETFThe full-length cDNA sequence of the gene was fused to the 5' end of Green Fluorescent Protein (GFP), resulting in pro35S driven by the CaMV 35S promoter:HbSETF:GFPthe fusion gene is transiently expressed in onion cells. Confocal imaging showed that HbSETF-GFP fusion protein was predominantly expressed in the nucleus, as was imaging with RFP fluorescence (AtCBF 1-RFP) and DAPI (staining of nuclei) (b in fig. 3).

HbSETF About 2 kb promoter (SEQ ID No. 3) upstream of the coding region of the gene fused with the GUS reporter gene: (proHbSETF::GUS) Wild type Arabidopsis thaliana was transformed and homozygous T2 seed was harvested. Transformed plants 8 days after germination were selected for GUS staining, and it was revealed that strong GUS expression was detected in the shoot apical meristem, vascular tissue of the leaf (c in FIG. 3), and vascular tissue of the root had weak GUS activity (e in FIG. 3). The floral tissue was stained and the GUS gene was expressed in the stigma and pedicel, as well as in the pollen tube of pistils and filaments of stamens (d in FIG. 3). In MS medium, GUS activity was weak in leaf vascular tissue and shoot apical meristem of 15-day seedlings (f in FIG. 3). However, strong GUS activity was observed in vascular tissues of leaves and shoot tips by 100 mM NaCl treatment (g in FIG. 3). It is clear that,proHbSETF::GUSGUS activity of the transformed plants is induced to be enhanced under salt stress. In any case, it is preferable that,proHbSETF::GUSthe activity of the transformed plant is mainly expressed in the shoot apical meristem and vascular bundles of different tissues.

5.4 transcription factor HbSETF activationHbCIPK2Gene promoters

Confirmation of transcription factors by Yeast Monohybrid technologyHbSETF andHbCIPK2the gene promoter is combined. By analysis ofHbCIPK2A gene promoter sequence containing two GCC-box recognizable by AP2/ERF transcription factor at 1750 bp upstream of ATG initiation codon: (proHbCIPK2 GCC-box-1, -2); these GCC-boxes (sequence: AGCCGCC) are located-230 bp and-1086 bp upstream of ATG, respectively (a in FIG. 1). Will be provided withHbCIPK2Two GCC-box gene promoters are respectively constructed on a pLacZi vector and are transferred into a yeast EGY48 together with a pB42AD vector constructed by a transcription factor HbSETF CDS sequence. The results indicate that the transcription factor HbSETF is indeed capable of interacting withHbCIPK2The gene promoter GCC cassette binds (a in fig. 4). Two pairs of biotin-labeled DNA sequences were further designed, each pair being directed against one GCC cassette, based on the 16 bp sequence of the yeast single-hybridization assay. EMSA experiment shows that the in vitro purified protein His-HbSETF can be directly combined with two proteinsproHbCIPK2GCC cassette (b in fig. 4 and c in fig. 4). Therefore, yeast single-hybrid and in vitro EMSA experiments show that the transcription factor HbSETF can be identifiedHbCIPK2The GCC cassette of the gene promoter and interacts with it. The above results indicate that the transcription factor HbSETF may be involved in the treatment ofHbCIPK2Regulation of genes.

Further, the transcription factor HbSETF pair was demonstrated in vivo by LUC in vivo imaging analysisHbCIPK2The role of the gene. Will carry pcambia1300-proHbCIPK2Co-injecting LUC and pcambia1300-35S-HbSETF Agrobacterium into tobacco leaf blades, carrying pcambia1300-proHbCIPK2LUC and pcambia1300 Agrobacterium were also co-injected into tobacco leaves and used as a negative control, as a result of which pcambia1300-proHbCIPK2the-LUC and pcambia1300-HbSETF fluoresced more strongly than the negative control (d in FIG. 4), indicating that the transcription factor HbSETF acts onHbCIPK2Gene and increase the expression of LUC.

Using a homologous recombination methodHbCIPK2The gene promoter fused with LUC as a reporter geneHbSETFGene fusion 62-SK as an effector gene (e in FIG. 4). The results of the dual luciferase assay are shown in fig. 4 f, where the transcription factor HbSETF was significantly increased compared to the empty vectorHbCIPK2Transcriptional activity of the Gene promoter indicating the transcription factor HbSETF pairsHbCIPK2The gene promoter has transcriptional activationThe application is as follows.

Examples 2,HbSETFGene overexpression arabidopsis thaliana and salt tolerance functional verification thereof

1、HbSETFObtaining of Gene-overexpressed Arabidopsis plants

1.1 construction of a recombinant vector comprising the DNA molecule shown in position 101-1129 of SEQ ID No.2

Construction ofHbSETFThe gene overexpression vector pCAMBIA 1300-HbSETF: will be provided withHbSETFThe coding sequence of the gene (position 101-1129 of SEQ ID NO. 2) was constructed on the vector pCAMBIA1300 (CAMBIA corporation) to obtain the over-expressionHbSETFThe recombinant vector of the gene is named pCAMBIA 1300-HbSETF.

The recombinant vector pCAMBIA1300-HbSETF is a recombinant expression vector obtained by replacing a fragment (small fragment) between EcoRI recognition sites and SalI recognition sites of the pCAMBIA1300 vector with a DNA fragment of which the nucleotide sequence is 101-th and 1129-th sites of SEQ ID No.2 in a sequence table and keeping other sequences of the pCAMBIA1300 vector unchanged.

1.2 transferring the recombinant vector constructed in the step 1.1 into Arabidopsis thaliana

Transferring the plasmid (recombinant vector pCAMBIA 1300-HbSETF) constructed in the step 1.1 into Agrobacterium tumefaciens GV3101, culturing at 28 ℃ for 72 hours, picking out a single clone, and screening a positive clone (containing 101-th 1129 th site with the coding sequence of SEQ ID No. 2) by colony PCRHbSETFGene), named recombinant Agrobacterium tumefaciens GV3101/pCAMBIA1300-HbSETF, the positive clone (GV 3101/pCAMBIA 1300-HbSETF) was transfected with wild type Arabidopsis thaliana (WT, Col) by pollen tube infection, and the T0 generation grown by Kan antibiotic selection was transferredHbSETFThe gene arabidopsis thaliana strain is transplanted and planted to harvest homozygous T2 generation seeds (T3 generation transfer)HbSETFA gene arabidopsis line). The numbers of the homozygous lines which are screened to be capable of growing normally and stably transformed are respectively L6, L7 and L13, and the homozygous lines are used for subsequent experiments.

2. Rotating shaftHbSETFSalt tolerance functional verification of gene arabidopsis plant

Transfer T2 intoHbSETFGene and wild type Arabidopsis seeds were dibbled on MS plates and after one week of growth transferred to MS plates containing 100 mM and 125 mM NaCl, respectivelyAfter 7 days, the phenotype was observed and the root length and fresh weight were measured. Transgenic and wild arabidopsis thaliana which are screened to grow for 4 weeks are subjected to salt damage treatment, 300 mM NaCl solution is adopted for root irrigation treatment, the treatment is carried out for 3 times, and then normal watering is carried out. Observe phenotype and analyze chlorophyll content.

3. Rotating shaftHbSETFGene arabidopsis thaliana plant cDNA synthesis and real-time fluorescent quantitative PCR analysis

Extracting with TRIzol reagent (Dalian TaKaRa Co., Ltd.)HbSETFRNA of the root or leaf of a transgenic Arabidopsis plant. The RNA concentration and purity were determined by UV-visible spectrophotometer (NanoDrop 2000 c). cDNA was synthesized using a reverse transcription kit (Nanjing Novozam Biotechnology Co., Ltd.) and stored at-20 ℃. Q-PCR primers (primer sequences shown in Table 1) were designed based on the CDS sequence of the gene of interest (position 1129 along the 101-th channel of SEQ ID No. 2) using Premier 5.0 software. The arabidopsis constitutive expression gene actin is used as an internal reference, a cDNA template is diluted by 5 times by using water without DNase, and real-time fluorescence quantitative PCR is carried out by using a SYBR Green PCR Master Mix kit (Nanjing Novozan Biotechnology Co., Ltd.). All reactions were performed in triplicate, using 2^-△△CTThe algorithm performs expression analysis.

TABLE 1 primers for real-time fluorescent quantitative PCR analysis

Primer name	Primer sequence (5 '-3')	Sequence numbering
			AtActin1-F	GGCGATGAAGCTCAATCCAAACG	SEQ ID No.5
AtActin1-R	GGTCACGACCAGCAAGATCAAGACG	SEQ ID No.6
			AtSOD-F	CGCATGATCCTTTGGCTTCG	SEQ ID No.7
AtSOD-R	TCCTGGTTGGCTGTGGTTTC	SEQ ID No.8
			AtPOD-F	CCAAACTCTTCGTGGACTATGC	SEQ ID No.9
AtPOD-R	AACTCTTGGTCGCTCTGGAT	SEQ ID No.10
			AtCAT1-F	TCCTGTTATCGTTCGTTTCTCA	SEQ ID No.11
AtCAT1-R	CAAAGTTCCCCTCTCTGGTGTA	SEQ ID No.12
			AtLEA-F	GATTGACCCGGCTGAGCTACGA	SEQ ID No.13
AtLEA-R	AGATGGGATTCACCACAAAAGA	SEQ ID No.14
			AtP5CS-F	GGGACAAGTTGTGGATGGAGAC	SEQ ID No.15
AtP5CS-R	TGGTACAAACCTCAAGGAACAC	SEQ ID No.16
			AtNHX1-F	AGCCTTCAGGGAACCACAAT	SEQ ID No.17
AtNHX1-R	CTCCAAAGACGGGTCGCATG	SEQ ID No.18
			AtACT2-F	TCGCTGACCGTATGAGCAAAG	SEQ ID No.19
AtACT2-R	TGTGAACGATTCCTGGACCTG	SEQ ID No.20
			AtRD29B-F	GTGAAGATGACTATCTCGGTGGTC	SEQ ID No.21
AtRD29B-R	TACCAAGAGACTCAGCAATCTCTG	SEQ ID No.22
			AtKIN2-F	GTCAGAGACCAACAAGAATGCC	SEQ ID No.23
AtKIN2-R	TGACTCGAATCGCTACTTGTTC	SEQ ID No.24
			AtCOR15a-F	ACTCAGTTCGTCGTCGTTTCTC	SEQ ID No.25
AtCOR15a-R	TCTCACCATCTGCTAATGCCTC	SEQ ID No.26
			AtADH-F	CTCTTGGTGCTGTTGGTTTAGG	SEQ ID No.27
AtADH-R	AATTGGCTTGTCATGGTCTTTC	SEQ ID No.28
			AtFRY1-F	CGCAGTAGCACTAGGATTG	SEQ ID No.29
AtFRY1-R	TTGACACCGAGTTTATTGG	SEQ ID No.30
			AtCIPK24-F	ATTGAGGCTGTAGCGAAC	SEQ ID No.31
AtCIPK24-R	GGTATTCCTTCTGTTGCC	SEQ ID No.32
			AtCBL4-F	GGAGGAATCTCTTCGCTG	SEQ ID No.33
AtCBL4-R	CACGAAAGCCTTATCCACC	SEQ ID No.34
			AtCIPK2-F	TAAGTGCGCTTGCTGATTGC	SEQ ID No.35
AtCIPK2-R	CCGCTTTCGTACCCTCGTAT	SEQ ID No.36
			Hb-qRT-ERF6-F	CGGAGAAGCCGACGACTT	SEQ ID No.37
Hb-qRT-ERF6-R	GAAGGTGGCATCACAGGG	SEQ ID No.38

4. Rotating shaftHbSETFIon content detection of gene Arabidopsis plants

For over-expressionHbSETFNa in transgenic Arabidopsis lines (L6, L7) and wild-type Arabidopsis (WT) of genes⁺、K⁺The content is measured by the following method:

10-day-old seedlings grown on vertical MS plates were transferred to MS plates without or with 100 mM NaCl and placed vertically. After 10 days of growth, plant material was collected, digested, and the potassium and sodium ion content was determined using Inductively Coupled Plasma Atomic Emission spectrometry (ICP-AES).

5. Results and analysis

5.1 overexpressionHbSETFGene-enhanced salt tolerance of Arabidopsis thaliana

For verificationHbSETFThe effect of the gene in plantsHbSETFThe gene was overexpressed in Arabidopsis. ComparisonHbSETFGene overexpression lines (L6, L7 and L13) and wild type Arabidopsis (WT) developed under salt stress. Transgenic arabidopsis plants showed longer roots and larger leaves than WT on medium containing 100 mM NaCl compared to MS medium. After 125 mM NaCl treatment, WT plants showed more severe wilting than the transgenic lines (a in fig. 5).HbSETFThe fresh weight and root growth rate of the gene overexpression lines were significantly higher than those of 100 mM or 125 mM NaCl-treated wild-type arabidopsis (B in fig. 5, C in fig. 5).

To determineHbSETFThe function of the gene in enhancing salt tolerance analyzes the phenotype of the transgenic and wild plants in the seedling period. Will be provided withHbSETFGene overexpressing lines and WT plants were grown in the greenhouse for 20 days and then treated with 300 mM NaCl for 10 days before normal watering and culture conditions were restored. After several days, the transgenic plants showed better growth status than the wild type plants (D in fig. 5).HbSETFThe chlorophyll content of the gene overexpression system is obviously higher than that of a wild plant. These results indicate that the salt tolerance of the transgenic plants is significantly enhanced (E in fig. 5).

5.2、HbSETFGene over-expression pair Na⁺And K⁺Effects of accumulation

For the study ofHbSETFGene over-expression pair Na⁺And K⁺The accumulated influence is detected by inductively coupled plasma emission spectrometer ICP-AES, and the ion content of transgenic seedlings and wild plants under normal conditions (0 mM NaCl) and salt stress (100 mM NaCl) is detected. Na from transgenic plants (L6 and L7) and wild type plants (WT) under normal conditions⁺Or K⁺There was no significant difference in the contents. However, after salt treatment, Na was present in transgenic Arabidopsis thaliana⁺The content increase was significantly lower than the wild type (F in fig. 5). K of non-transgenic plants under the same treatment⁺The content reduction is significantly higher than that of the transgenic plants (G in figure 5), and the results show that the overexpression is performedHbSETFThe gene can prevent K in transgenic arabidopsis thaliana under the condition of salt stress⁺Reduction of Na and⁺accumulation of K in plants under salt stress⁺/Na⁺Equilibrium ofHbSETFGene-mediated salt stress down-conversion of excessive Na in transgenic plants⁺And (4) discharging the salt-tolerant gene outside the transgenic plant, thereby improving the salt tolerance of the transgenic plant.

5.3、HbSETFExpression of Gene activation stress response Gene

As described above, the transcription factor HbSETF can improve salt tolerance in plants. To understand which stress-responsive genes in Arabidopsis thaliana are affectedHbSETFThe influence of the genes, the expression of these target genes was detected using semi-quantitative RT-PCR. Analyze atHbSETFGene overexpression expression of 14 stress-related genes in plants and wild-type plants. According to the RT-PCR results, growth on MS medium was observedHbSETFBetween the gene over-expression plant and the WT plant,AtADH、AtCIPK24、AtKIN2、AtCOR47、AtRD29BandAtP5CSthere was no significant difference in expression levels. Expression of these genes was up-regulated after 100 mM NaCl treatment, both in transgenic and wild-type plants; however, the mRNA abundance in the over-expressed lines was significantly higher than that of the wild-type plants (A-F in FIG. 6). Under salt stress, compared with wild plants, the expression levels of other 6 stress response genes are not greatly different.

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

Sequence listing

<110> agriculture and forestry academy of sciences of Beijing City

<120> protein for regulating and controlling plant salt tolerance, and coding gene and application thereof

<160> 38

<170> SIPOSequenceListing 1.0

<210> 1

<211> 342

<212> PRT

<213> Hordeum brachisuubulatum)

<400> 1

Met Glu Phe Ala Gly Glu Ala Asp Asp Phe Ala Leu Asp Leu Ile Arg

1 5 10 15

Glu His Leu Leu Gly Gly Asp Gly Gly Val Leu Ala Thr Ala Asn Asp

20 25 30

Asp Gln Gly Pro Phe Cys Asp Asp Val Thr Phe Pro Val Met Pro Pro

35 40 45

Ser Ala Ala Glu Pro Ala Ala Tyr Gln Gln Gln Pro Met Phe Phe Pro

50 55 60

Gln Gln Gln Gln Asp Glu Gln Met Gln Gly Tyr Met Asp Leu Thr His

65 70 75 80

Gln Tyr Leu Asn Ser Cys Pro Ser Thr Asp Val Pro Glu Ala Val Phe

85 90 95

Arg Ala Pro Glu Ala Val Met Ile Gln Phe Gly Gly Glu Pro Ser Pro

100 105 110

Val Thr Ala Pro Ser Ser Thr Leu Thr Ile Ser Val Pro Ala Lys Gly

115 120 125

Ser Phe Gly Trp Ala Gly Thr Ala Ala Ala Ala Ala Pro Pro Ala Pro

130 135 140

Ala Pro Val Glu Asp Phe Arg Lys Tyr Arg Gly Val Arg Gln Arg Pro

145 150 155 160

Trp Gly Lys Tyr Ala Ala Glu Ile Arg Asp Pro Lys Arg Arg Gly Ser

165 170 175

Arg Val Trp Leu Gly Thr Tyr Asp Thr Ser Val Glu Ala Ala Arg Ala

180 185 190

Tyr Asp Arg Ala Ala Phe Arg Met Arg Gly Ala Lys Ala Ile Leu Asn

195 200 205

Phe Pro Asn Glu Val Gly Thr Arg Gly Ala Glu Leu Trp Ala Leu Pro

210 215 220

Pro Pro Val Pro Ala Ser Gln Ala Ala Gly Ala Thr Asn Lys Arg Lys

225 230 235 240

Arg Ser His Glu Glu Asp Ser Asp Val Glu Val Thr Gly Val Val Ile

245 250 255

Ser Lys Ala Pro Lys Thr Glu Ala Pro Ser Pro Ser Ser Ala Gln Val

260 265 270

Ser Trp Asp Thr Pro Ser Ser Val Ser Arg Glu Thr Ala Ser Ser Thr

275 280 285

Leu Thr Ser Ala Ala Thr Thr Pro Glu Gly Gly Phe Pro Pro Thr Pro

290 295 300

Ser Ser Ser Gly Trp Glu Gln Tyr Trp Glu Ala Leu Leu Gly Gly Met

305 310 315 320

Pro Leu Leu Ser Pro Leu Ser Pro His Pro Ala Leu Gly Phe Pro Gln

325 330 335

Leu Thr Val Ser Asp Gln

340

<210> 2

<211> 1329

<212> DNA

<213> Hordeum brachisuubulatum)

<400> 2

ctcaggaaaa tcgaacagca gaactcacaa acaaacttgc aaacctctgc cactggcatc 60

gagtagttct ctaccgtgcc atcgatccct cttaggcggc atggagttcg ccggagaagc 120

cgacgacttt gctctcgacc tcatccgcga gcacctcctc ggcggcgacg gcggtgtcct 180

ggcgacggcc aacgatgatc agggcccttt ttgcgacgac gtcaccttcc ctgtgatgcc 240

accttccgcg gccgaaccag ccgcgtacca gcagcagccc atgttcttcc cgcagcagca 300

gcaggacgag cagatgcaag gttatatgga cctgacgcac cagtacctga actcctgccc 360

gtccaccgac gtccctgagg cggtgttccg ggcgccggag gcggtgatga tacagttcgg 420

cggcgagccg tctcctgtga ctgcgccgtc gtccacgctg accatctctg tgccggccaa 480

gggctcgttc gggtgggcgg ggactgctgc cgccgcggca ccgccagcgc cagcaccggt 540

ggaggacttc cgcaagtacc gcggcgtgcg gcagcggccg tggggcaagt atgcggcgga 600

gatccgcgac cccaagcgcc ggggctcccg cgtgtggctc ggcacctacg acacctccgt 660

ggaggccgcg cgtgcctacg accgcgctgc cttccggatg cgcggcgcca aggccattct 720

taacttccca aacgaggtcg gcacccgcgg cgccgagctg tgggcgcttc cgcctcctgt 780

acccgcgtcc caggccgccg gcgcgacgaa caaacgtaag agatcacatg aggaggactc 840

cgacgtcgag gtgaccggag tggtcataag caaggccccc aagaccgagg cgccgtcgcc 900

gtcgtccgcc caggtgtcgt gggacacgcc ctcgtccgtg tcgcgggaga cagcctcctc 960

gacgttgacg tcggcggcca cgacgccgga gggaggattt cctccgacgc cgtcgagctc 1020

gggctgggag cagtactggg aggcgctgct gggcggcatg ccgctgctct cgccgctgtc 1080

gccgcacccg gctctggggt tcccgcagct caccgtgagt gatcaataat taagaggcgg 1140

ttaattactg tgattgagct ggggttaacc aataagcagt ctttcgttgt ttagttggca 1200

gcggcatgca tgtctctgca tgctgggacg cgtacacttc tttgggacta atgataggtg 1260

taatgtgcgc gtttgctaag agacatgaag atcggatcga ccgatgcatg cttgtaaaga 1320

ataaacaac 1329

<210> 3

<211> 2149

<212> DNA

<213> Hordeum brachisuubulatum)

<400> 3

cccaaattgt cgtgaaacca aggttcacaa accaccggtt ctgcacgtat atgtctgttt 60

ttgtgcaacc gcgtcggtcc tttcatcaaa ctgtgaaacg gcgttatatc atgtagaacg 120

agtccatgta tatcctctaa cagtttagcc acttgtaagt cgcctgaaat tagttttagg 180

tcagataatt ttggaagtaa gctgccgtag ggaaggaaga agcagccgcc ggcttgccag 240

agaagccctc tgggttcgcc tggaaagaaa tgttcatggt tggggttaga gggatggccg 300

gtggcagcac gacggtggac ggcgcttgtg gggagggcat ggccgcgaga ctggcgccgc 360

gggcagcggc atcagtcggt taagccggtg gtagatcggc ggttcgaggt atgaacagtg 420

aaccttttcg gaggttgaag aaggcgatct ggccatccat cttgcatccg atggctcata 480

tggaatcctc gtgtggtctc tcctcttcgt agtctcgtca tgatgcatgc cactcagtgg 540

cttttttttt ctatttcgtt gatgctttct ttgggcatga ttgtattgtt ggcacatccg 600

tcttagttgc tttgccactt tggttatgtt atatgaatgt ttgctttatt tataaagcga 660

gataaaaacc tatttcgagg aagacatcta gccagtcgag taatgctaca cataaaaaaa 720

gctacatgca gttttacgta attagccacc tggcaatctg tgattgtaag tagggggaag 780

gaggggccca ttccactgaa attcagcggg ggagagaatg gttgaaggaa agttatgcac 840

gtaattgttc gtaggtgtag gattattgct agccagtccc atcctctaat ggcatggagg 900

actaccgttc atttaacgcc atatacgagc cggtagtagt gctgtacctg gtgcggttta 960

tatgcatggc aacgagctat tttttttttc aagaacatgc aggagcatta catgtctttt 1020

ctattaagga gaagagaaat atcccaatac aaagatgatt atagggtcat atccgccctc 1080

gagggccatt gcccagggcg cgctctagtg gatctgaaag gggtgacgag ctaatttgga 1140

ttgcaacctt gttctgtgag cctgtttttt tttttttttt ttttggaaaa ggaggaagac 1200

cccggcctct gcatctgggc gatgcatgca gccactttat taattattct caaaagacct 1260

tacaaggaca tacaacagta tgtctgaagc caccgtctag gcaacatctg tcgctactcc 1320

tatccaattg atgtagggat gctgatgtgc cctccaccga cgcacgggta cgtttcgcca 1380

gcatgggatc ggacgtggca attaactcgt aacctagtac atcatctgca tgtgcacctg 1440

tcttcccatc ccatcgtttc gatcgctaat tgtgaacaat ttccttgcaa tctctgagta 1500

gtgagtacgc ggggaaagct ggccagccga tactaggact gcgcaatata agaatgacac 1560

tattgtatat attccttttc tgtgaataaa aattaagaga gagatacacg cgtcgcttca 1620

ttgcgaggtc tgggtatggg cagcagctaa tggctctcca gcgcgcgtct cattaaattc 1680

cttgtaaagt gtgagcggaa tggtcgaagc tcctgtcaat ggacgtacgt atgctatgcg 1740

cgcccctgtt cttctttctt gaaatgaaat gtgttcttca ttgacacgaa acccgaaaaa 1800

tctcggcgca gcaaatttga acaggatcga gtagtactac tgtgcttgac agtacagcgg 1860

cgccacatga aatgaaagca ttccacggaa agtgacgaga tcgagtagga ccccgaagcc 1920

ccaaaagcgg gccccggccg cgtgcaatcg tgttggtcaa atcgaatcaa atgcccgaga 1980

acataggcct tcccgtctcc ttcctgcagc tgtcctataa gtacgcacac caccaccgct 2040

agttttgtcc tcaggaaaat cgaacagcag aactcacaaa caaacttgca aacctctgcc 2100

actggcaccg agtagttctc taccgtgcca tcgatccctc ttaggcggc 2149

<210> 4

<211> 1750

<212> DNA

<213> Hordeum brachisuubulatum)

<400> 4

gccagtgcta ctactactgc ttcccgttgt ttcaaagctg gcagatcgcc atctactacg 60

atctgcgcca ttgatgctcc atatataatt tacagccgca ggtcaaaaag atcttcctcc 120

gtgacccgac aattatggag caccatcatg cacgtaaaac aaaggccgag cgccgcccgc 180

ccacgctcca gctagagctc tacaaagtct accaccgata ttttcgcacc gaaaacaatc 240

caccgaagtt cacagccgcg agtcaaaagt ttccttcgtg gcgaccctac aattatggag 300

tgccatttct caataaataa aaaataaaat tacggagtgc catcatgcac gcaggtaaaa 360

caagggctgg gcacgggaac catgcatgcc tatgaaacaa gggctggtcc gatggccggc 420

cgattcagaa cggacggcgg aggacggcca acgggccgat ccaatttcgt ccgtccgtcg 480

cagcggacag gccagcgcat tattggtggg ccccgccgcg gcgtaatttt accggcccac 540

agcggcgggc ggtgggtggg tgtggtttgg tctgcggcga gggagaggag gaatatctct 600

ctgcgggaat ggatccatcc ctagcgggcg gggggttgtg ccgcccccgc ggcgtataaa 660

acggagccgc ctctcaagct taacctctcg ctgcacaaag ctctctctca caccagcctc 720

tagaaaaaga aatctaccac cactctgccg tcgtctccca gccccgccgc ccacgcatca 780

gcctcctcac tccctcccct agcccgccgt cctcctcgcg actactcatc tcttcgcgga 840

ggaagggatc tgatctaccg ccggggttgc cgcgggttcc gttcgcgtcg ccggccgccg 900

ggatctggta cacggcctca ctcgcttctc cctggttctg cctctggttc cggttgcggt 960

tcgtagttat tgattcatgt gtatgtgcgc gaaatattga tgccatctag agaggtctcg 1020

gcgatttagg agcttccgtt gaatgatacg gaatataaga tgctagtttt ttagttcttc 1080

aaccaaaaaa aatggtagtt ttcctttttc agttcgtgtc gatgcgcgtt tacgggggct 1140

gccgcttcat ttttggcagc ggtagcttta ggcttggcgg tagtgcgtcc ccgcagagag 1200

agatcgatcg accaaccacg gccaggtgcc acgggaagtt agatttcgtt cgtttctgac 1260

tctctgccgt aagaggaacg cacgcatatg ctcttgtccg tgtacgcgga aaagatctac 1320

ttttcctctt ctgcgtagac agatgccttt taacctccaa cttggatttg ccttcagtac 1380

atatagccgt gtgtctaacg ttgtgctttg ttttgtgatt cgcagcatct tgatttccac 1440

aaggaggaac catcttaggg aatgcagaga gatgtgtttg catgctagag agctaccttg 1500

cgagggaatc ggcagggtag ccgccccagt ttctgctttg attgaccttg atgacaccgg 1560

cgcacagcag caccacacaa cgcacctctt cttccatgtg cttctgcaca atggggttcg 1620

acgtggcatc tcaaccatca tcttagatta ccacctcgga ggggacggtt gaggccatct 1680

agcgcccgca ggctcccttg caaggtccgg gatcgctgct gattttgtct gtgtacatct 1740

gcctgccacc 1750

<210> 5

<211> 23

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 5

ggcgatgaag ctcaatccaa acg 23

<210> 6

<211> 25

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 6

ggtcacgacc agcaagatca agacg 25

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 7

cgcatgatcc tttggcttcg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 8

tcctggttgg ctgtggtttc 20

<210> 9

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 9

ccaaactctt cgtggactat gc 22

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 10

aactcttggt cgctctggat 20

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 11

tcctgttatc gttcgtttct ca 22

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 12

caaagttccc ctctctggtg ta 22

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 13

gattgacccg gctgagctac ga 22

<210> 14

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 14

agatgggatt caccacaaaa ga 22

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 15

gggacaagtt gtggatggag ac 22

<210> 16

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 16

tggtacaaac ctcaaggaac ac 22

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 17

agccttcagg gaaccacaat 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 18

ctccaaagac gggtcgcatg 20

<210> 19

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 19

tcgctgaccg tatgagcaaa g 21

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 20

tgtgaacgat tcctggacct g 21

<210> 21

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 21

gtgaagatga ctatctcggt ggtc 24

<210> 22

<211> 24

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 22

taccaagaga ctcagcaatc tctg 24

<210> 23

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 23

gtcagagacc aacaagaatg cc 22

<210> 24

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 24

tgactcgaat cgctacttgt tc 22

<210> 25

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 25

actcagttcg tcgtcgtttc tc 22

<210> 26

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 26

tctcaccatc tgctaatgcc tc 22

<210> 27

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 27

ctcttggtgc tgttggttta gg 22

<210> 28

<211> 22

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 28

aattggcttg tcatggtctt tc 22

<210> 29

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 29

cgcagtagca ctaggattg 19

<210> 30

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 30

ttgacaccga gtttattgg 19

<210> 31

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 31

attgaggctg tagcgaac 18

<210> 32

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 32

ggtattcctt ctgttgcc 18

<210> 33

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 33

ggaggaatct cttcgctg 18

<210> 34

<211> 19

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 34

cacgaaagcc ttatccacc 19

<210> 35

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 35

taagtgcgct tgctgattgc 20

<210> 36

<211> 20

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 36

ccgctttcgt accctcgtat 20

<210> 37

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 37

cggagaagcc gacgactt 18

<210> 38

<211> 18

<212> DNA

<213> Artificial sequence (Artificial sequence)

<400> 38

gaaggtggca tcacaggg 18

Claims (7)

1. A protein, wherein the protein is any one of:

A1) a protein having an amino acid sequence of SEQ ID No. 1;

A2) and (3) a fusion protein with the same function obtained by connecting a label to the N terminal and/or the C terminal of A1).

2. A biomaterial, characterized in that it is any one of the following B1) to B4):

B1) a nucleic acid molecule encoding the protein of claim 1;

B2) an expression cassette comprising the nucleic acid molecule of B1);

B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2);

B4) a recombinant microorganism containing B1) the nucleic acid molecule, or a recombinant microorganism containing B2) the expression cassette, or a recombinant microorganism containing B3) the recombinant vector.

3. The biomaterial according to claim 2, wherein B1) said nucleic acid molecule is any one of the following:

C1) the coding sequence is cDNA molecule of the 101-1129 th site of SEQ ID No. 2;

C2) the nucleotide sequence is the DNA molecule of SEQ ID No. 2.

4. A method for cultivating stress-resistant plants, which comprises increasing the content and/or activity of the protein of claim 1 in a target plant to obtain a stress-resistant plant with higher stress resistance than the target plant; the stress resistance is salt resistance.

5. The method according to claim 4, wherein the increase in the content and/or activity of the protein of claim 1 in the plant of interest is achieved by increasing the expression level of a gene encoding the protein in the plant of interest.

6. The method according to claim 5, wherein the increase in the expression level of the gene encoding the protein in the plant of interest is achieved by introducing the gene encoding the protein according to claim 1 into the plant of interest.

7. Use of the protein of claim 1 or the biomaterial of claim 2 or 3 for any one of the following:

D1) use of the protein of claim 1 or the biomaterial of claim 2 or 3 for modulating plant stress resistance; the stress resistance is salt resistance;

D2) use of the protein of claim 1 or the biological material of claim 2 or 3 for the preparation of a product for modulating stress resistance in plants; the stress resistance is salt resistance;

D3) use of a protein according to claim 1 or a biological material according to claim 2 or 3 for growing stress-tolerant plants; the stress resistance is salt resistance;

D4) use of the protein of claim 1 or the biomaterial of claim 2 or 3 for the preparation of a product for growing stress-resistant plants; the stress resistance is salt resistance.

Images